>Feature sequence001 <1 670 gene locus_tag LOCUS_00010 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122139.1:N-acetylgalactosamine-6-sulfatase 678 1292 gene locus_tag LOCUS_00020 678 1292 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXY7 protein_id gnl|my_center|LOCUS_00020 1764 1363 gene locus_tag LOCUS_00030 1764 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2873 1908 gene locus_tag LOCUS_00040 gene pdxA 2873 1908 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ2 protein_id gnl|my_center|LOCUS_00040 3068 4057 gene locus_tag LOCUS_00050 3068 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4129 5613 gene locus_tag LOCUS_00060 gene rbsA 4129 5613 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122659.1 protein_id gnl|my_center|LOCUS_00060 5839 6774 gene locus_tag LOCUS_00070 gene rbsC 5839 6774 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_00070 9914 6786 gene locus_tag LOCUS_00080 9914 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12410 10059 gene locus_tag LOCUS_00090 12410 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123549.1 protein_id gnl|my_center|LOCUS_00090 12755 12937 gene locus_tag LOCUS_00100 12755 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14382 13969 gene locus_tag LOCUS_00110 14382 13969 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123550.1 protein_id gnl|my_center|LOCUS_00110 15362 14448 gene locus_tag LOCUS_00120 15362 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18832 15434 gene locus_tag LOCUS_00130 18832 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123552.1 protein_id gnl|my_center|LOCUS_00130 19557 20900 gene locus_tag LOCUS_00140 19557 20900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 20982 21425 gene locus_tag LOCUS_00150 20982 21425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 21735 23798 gene locus_tag LOCUS_00160 21735 23798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 25269 23854 gene locus_tag LOCUS_00170 25269 23854 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121014.1 protein_id gnl|my_center|LOCUS_00170 26960 25641 gene locus_tag LOCUS_00180 26960 25641 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_00180 28038 27190 gene locus_tag LOCUS_00190 28038 27190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 28181 28489 gene locus_tag LOCUS_00200 28181 28489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28517 28954 gene locus_tag LOCUS_00210 28517 28954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29652 30893 gene locus_tag LOCUS_00220 gene ugpC 29652 30893 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPU2 protein_id gnl|my_center|LOCUS_00220 30896 32233 gene locus_tag LOCUS_00230 gene nusA 30896 32233 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URQ7 protein_id gnl|my_center|LOCUS_00230 32419 35316 gene locus_tag LOCUS_00240 gene infB 32419 35316 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR0 protein_id gnl|my_center|LOCUS_00240 35391 35906 gene locus_tag LOCUS_00250 gene rbfA 35391 35906 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR1 protein_id gnl|my_center|LOCUS_00250 36042 37076 gene locus_tag LOCUS_00260 36042 37076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 37161 37916 gene locus_tag LOCUS_00270 37161 37916 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR4 protein_id gnl|my_center|LOCUS_00270 39568 37961 gene locus_tag LOCUS_00280 gene glyQS 39568 37961 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_00280 40522 39749 gene locus_tag LOCUS_00290 gene comB 40522 39749 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM81 protein_id gnl|my_center|LOCUS_00290 40714 41418 gene locus_tag LOCUS_00300 gene menG 40714 41418 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59912 protein_id gnl|my_center|LOCUS_00300 41429 42031 gene locus_tag LOCUS_00310 gene ubiX 41429 42031 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA7 protein_id gnl|my_center|LOCUS_00310 42090 43013 gene locus_tag LOCUS_00320 gene ubiA 42090 43013 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_00320 43228 44373 gene locus_tag LOCUS_00330 gene mqnE 43228 44373 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_00330 44484 44783 gene locus_tag LOCUS_00340 44484 44783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 46896 44791 gene locus_tag LOCUS_00350 gene recG 46896 44791 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118187.1 protein_id gnl|my_center|LOCUS_00350 47440 46970 gene locus_tag LOCUS_00360 gene rnhA 47440 46970 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF86 protein_id gnl|my_center|LOCUS_00360 49590 47542 gene locus_tag LOCUS_00370 49590 47542 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123340.1 protein_id gnl|my_center|LOCUS_00370 52063 49766 gene locus_tag LOCUS_00380 gene priA 52063 49766 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFQ0 protein_id gnl|my_center|LOCUS_00380 52266 52916 gene locus_tag LOCUS_00390 gene nadD 52266 52916 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V3 protein_id gnl|my_center|LOCUS_00390 52932 53198 gene locus_tag LOCUS_00400 52932 53198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 53489 53232 gene locus_tag LOCUS_00410 53489 53232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 53816 54664 gene locus_tag LOCUS_00420 gene hydH 53816 54664 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121413.1 protein_id gnl|my_center|LOCUS_00420 55534 54695 gene locus_tag LOCUS_00430 gene mutM 55534 54695 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_00430 55798 57036 gene locus_tag LOCUS_00440 gene trpB 55798 57036 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG9 protein_id gnl|my_center|LOCUS_00440 57102 57911 gene locus_tag LOCUS_00450 gene trpA 57102 57911 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URN0 protein_id gnl|my_center|LOCUS_00450 58172 58726 gene locus_tag LOCUS_00460 58172 58726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335171.1 protein_id gnl|my_center|LOCUS_00460 59667 58741 gene locus_tag LOCUS_00470 59667 58741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_00470 62538 59740 gene locus_tag LOCUS_00480 62538 59740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117825.1 protein_id gnl|my_center|LOCUS_00480 63586 62699 gene locus_tag LOCUS_00490 gene folD 63586 62699 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNN9 protein_id gnl|my_center|LOCUS_00490 64097 64693 gene locus_tag LOCUS_00500 64097 64693 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_00500 64863 66119 gene locus_tag LOCUS_00510 64863 66119 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120510.1 protein_id gnl|my_center|LOCUS_00510 66396 68288 gene locus_tag LOCUS_00520 66396 68288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 68820 68266 gene locus_tag LOCUS_00530 68820 68266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 69715 68906 gene locus_tag LOCUS_00540 69715 68906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_00540 71585 69849 gene locus_tag LOCUS_00550 71585 69849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 71976 72806 gene locus_tag LOCUS_00560 71976 72806 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_00560 72932 73879 gene locus_tag LOCUS_00570 72932 73879 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118357.1 protein_id gnl|my_center|LOCUS_00570 75563 73974 gene locus_tag LOCUS_00580 75563 73974 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122083.1 protein_id gnl|my_center|LOCUS_00580 75777 76730 gene locus_tag LOCUS_00590 75777 76730 CDS product 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I476 protein_id gnl|my_center|LOCUS_00590 76727 77986 gene locus_tag LOCUS_00600 gene dadA 76727 77986 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_00600 77983 79410 gene locus_tag LOCUS_00610 gene hemY 77983 79410 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_00610 80150 79473 gene locus_tag LOCUS_00620 80150 79473 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121331.1 protein_id gnl|my_center|LOCUS_00620 84146 80373 gene locus_tag LOCUS_00630 84146 80373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 85836 84382 gene locus_tag LOCUS_00640 85836 84382 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_00640 88688 85872 gene locus_tag LOCUS_00650 88688 85872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_00650 90105 88876 gene locus_tag LOCUS_00660 gene pepT 90105 88876 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNU2 protein_id gnl|my_center|LOCUS_00660 90316 91137 gene locus_tag LOCUS_00670 90316 91137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_00670 93098 91158 gene locus_tag LOCUS_00680 gene typA 93098 91158 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120935.1 protein_id gnl|my_center|LOCUS_00680 93354 94466 gene locus_tag LOCUS_00690 gene mnmA 93354 94466 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ4 protein_id gnl|my_center|LOCUS_00690 94690 95691 gene locus_tag LOCUS_00700 94690 95691 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQJ2 protein_id gnl|my_center|LOCUS_00700 95844 96332 gene locus_tag LOCUS_00710 95844 96332 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_00710 96606 96680 gene locus_tag LOCUS_t00010 96606 96680 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 97917 97447 gene locus_tag LOCUS_00720 97917 97447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 98630 98169 gene locus_tag LOCUS_00730 98630 98169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 99344 99090 gene locus_tag LOCUS_00740 99344 99090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 99860 99486 gene locus_tag LOCUS_00750 99860 99486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 100421 99906 gene locus_tag LOCUS_00760 100421 99906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 101235 100561 gene locus_tag LOCUS_00770 101235 100561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121005.1 protein_id gnl|my_center|LOCUS_00770 102000 101497 gene locus_tag LOCUS_00780 102000 101497 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250949.1 protein_id gnl|my_center|LOCUS_00780 103416 102196 gene locus_tag LOCUS_00790 103416 102196 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207152.1 protein_id gnl|my_center|LOCUS_00790 104727 103585 gene locus_tag LOCUS_00800 104727 103585 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_00800 105261 106967 gene locus_tag LOCUS_00810 105261 106967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 107137 108501 gene locus_tag LOCUS_00820 gene thrC 107137 108501 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122990.1 protein_id gnl|my_center|LOCUS_00820 108913 108527 gene locus_tag LOCUS_00830 108913 108527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531294.1 protein_id gnl|my_center|LOCUS_00830 109045 109290 gene locus_tag LOCUS_00840 109045 109290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 109348 109632 gene locus_tag LOCUS_00850 109348 109632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 110120 109752 gene locus_tag LOCUS_00860 110120 109752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 111128 110136 gene locus_tag LOCUS_00870 111128 110136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 111537 113558 gene locus_tag LOCUS_00880 gene thrS 111537 113558 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56881 protein_id gnl|my_center|LOCUS_00880 113904 114329 gene locus_tag LOCUS_00890 gene infC 113904 114329 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ17 protein_id gnl|my_center|LOCUS_00890 115882 114494 gene locus_tag LOCUS_00900 115882 114494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 116852 116313 gene locus_tag LOCUS_00910 gene pyrE 116852 116313 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYX5 protein_id gnl|my_center|LOCUS_00910 117025 118239 gene locus_tag LOCUS_00920 117025 118239 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118339.1 protein_id gnl|my_center|LOCUS_00920 118622 122656 gene locus_tag LOCUS_00930 118622 122656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 123755 122670 gene locus_tag LOCUS_00940 gene lpxK 123755 122670 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW7 protein_id gnl|my_center|LOCUS_00940 123999 124739 gene locus_tag LOCUS_00950 123999 124739 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ43 protein_id gnl|my_center|LOCUS_00950 125180 126589 gene locus_tag LOCUS_00960 125180 126589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 128310 126763 gene locus_tag LOCUS_00970 128310 126763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 129147 128929 gene locus_tag LOCUS_00980 gene infA 129147 128929 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY5 protein_id gnl|my_center|LOCUS_00980 129545 130873 gene locus_tag LOCUS_00990 129545 130873 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403781.1 protein_id gnl|my_center|LOCUS_00990 131453 132376 gene locus_tag LOCUS_01000 131453 132376 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020824.1 protein_id gnl|my_center|LOCUS_01000 133601 132453 gene locus_tag LOCUS_01010 133601 132453 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_01010 134851 133598 gene locus_tag LOCUS_01020 134851 133598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 135425 134898 gene locus_tag LOCUS_01030 gene hpt 135425 134898 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_01030 136986 135577 gene locus_tag LOCUS_01040 136986 135577 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_01040 138521 137022 gene locus_tag LOCUS_01050 gene trpE 138521 137022 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_01050 138903 139418 gene locus_tag LOCUS_01060 gene yacH 138903 139418 CDS product UvrB/UvrC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_01060 139411 140556 gene locus_tag LOCUS_01070 gene yacI 139411 140556 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV3 protein_id gnl|my_center|LOCUS_01070 140553 141629 gene locus_tag LOCUS_01080 gene yacI 140553 141629 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV3 protein_id gnl|my_center|LOCUS_01080 141979 143100 gene locus_tag LOCUS_01090 141979 143100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_01090 143234 144679 gene locus_tag LOCUS_01100 143234 144679 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_01100 144743 145894 gene locus_tag LOCUS_01110 144743 145894 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_01110 146128 147267 gene locus_tag LOCUS_01120 146128 147267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 147315 148625 gene locus_tag LOCUS_01130 gene hemN 147315 148625 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_01130 148622 149104 gene locus_tag LOCUS_01140 gene gcvH 148622 149104 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121110.1 protein_id gnl|my_center|LOCUS_01140 149229 149633 gene locus_tag LOCUS_01150 149229 149633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 149840 150913 gene locus_tag LOCUS_01160 149840 150913 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121488.1 protein_id gnl|my_center|LOCUS_01160 151587 150949 gene locus_tag LOCUS_01170 151587 150949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 152932 151655 gene locus_tag LOCUS_01180 152932 151655 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_01180 154201 153245 gene locus_tag LOCUS_01190 154201 153245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 155085 154354 gene locus_tag LOCUS_01200 155085 154354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 155595 156395 gene locus_tag LOCUS_01210 gene thyA2 155595 156395 CDS product thymidylate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11044 protein_id gnl|my_center|LOCUS_01210 156396 156923 gene locus_tag LOCUS_01220 gene folA 156396 156923 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NQ7 protein_id gnl|my_center|LOCUS_01220 157135 160314 gene locus_tag LOCUS_01230 157135 160314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_01230 160754 161098 gene locus_tag LOCUS_01240 160754 161098 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467451.1 protein_id gnl|my_center|LOCUS_01240 161160 161636 gene locus_tag LOCUS_01250 gene fruA 161160 161636 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_01250 161685 161990 gene locus_tag LOCUS_01260 gene ptsH 161685 161990 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332233.1 protein_id gnl|my_center|LOCUS_01260 162734 164341 gene locus_tag LOCUS_01270 gene rne 162734 164341 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_01270 167200 164450 gene locus_tag LOCUS_01280 167200 164450 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121470.1 protein_id gnl|my_center|LOCUS_01280 169844 167403 gene locus_tag LOCUS_01290 169844 167403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 170292 174329 gene locus_tag LOCUS_01300 170292 174329 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122155.1 protein_id gnl|my_center|LOCUS_01300 174483 174875 gene locus_tag LOCUS_01310 174483 174875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 176269 174929 gene locus_tag LOCUS_01320 176269 174929 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_01320 178239 176374 gene locus_tag LOCUS_01330 178239 176374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 178992 178339 gene locus_tag LOCUS_01340 gene nth 178992 178339 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_01340 180047 179088 gene locus_tag LOCUS_01350 180047 179088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 181595 180345 gene locus_tag LOCUS_01360 181595 180345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 182738 181629 gene locus_tag LOCUS_01370 182738 181629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 183025 183702 gene locus_tag LOCUS_01380 183025 183702 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334179.1 protein_id gnl|my_center|LOCUS_01380 183953 186226 gene locus_tag LOCUS_01390 183953 186226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 187242 186256 gene locus_tag LOCUS_01400 187242 186256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 187858 187433 gene locus_tag LOCUS_01410 187858 187433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 188465 187872 gene locus_tag LOCUS_01420 gene clpP2 188465 187872 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK66 protein_id gnl|my_center|LOCUS_01420 189222 188599 gene locus_tag LOCUS_01430 gene clpP1 189222 188599 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK67 protein_id gnl|my_center|LOCUS_01430 191194 189710 gene locus_tag LOCUS_01440 gene tig 191194 189710 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URG5 protein_id gnl|my_center|LOCUS_01440 191619 191546 gene locus_tag LOCUS_t00020 191619 191546 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 192120 192950 gene locus_tag LOCUS_01450 192120 192950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 193195 193836 gene locus_tag LOCUS_01460 193195 193836 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119950.1 protein_id gnl|my_center|LOCUS_01460 196448 194325 gene locus_tag LOCUS_01470 gene fadJ 196448 194325 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NP24 protein_id gnl|my_center|LOCUS_01470 196683 197123 gene locus_tag LOCUS_01480 196683 197123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 197287 197925 gene locus_tag LOCUS_01490 197287 197925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 199786 198236 gene locus_tag LOCUS_01500 199786 198236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 199791 200036 gene locus_tag LOCUS_01510 199791 200036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 200308 200865 gene locus_tag LOCUS_01520 200308 200865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 201224 202948 gene locus_tag LOCUS_01530 gene pilB 201224 202948 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123899.1 protein_id gnl|my_center|LOCUS_01530 203315 204448 gene locus_tag LOCUS_01540 gene pilT 203315 204448 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_01540 204584 206302 gene locus_tag LOCUS_01550 gene pilB 204584 206302 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123902.1 protein_id gnl|my_center|LOCUS_01550 206418 207824 gene locus_tag LOCUS_01560 gene pilC 206418 207824 CDS product type II secretion system F domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329380.1 protein_id gnl|my_center|LOCUS_01560 207948 208847 gene locus_tag LOCUS_01570 207948 208847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 208892 209848 gene locus_tag LOCUS_01580 208892 209848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence002 1546 236 gene locus_tag LOCUS_01590 1546 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119155.1 protein_id gnl|my_center|LOCUS_01590 3950 1557 gene locus_tag LOCUS_01600 3950 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119154.1 protein_id gnl|my_center|LOCUS_01600 5085 4441 gene locus_tag LOCUS_01610 5085 4441 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_01610 5534 6643 gene locus_tag LOCUS_01620 5534 6643 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119138.1 protein_id gnl|my_center|LOCUS_01620 6789 10382 gene locus_tag LOCUS_01630 6789 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 10622 11680 gene locus_tag LOCUS_01640 10622 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 11776 15087 gene locus_tag LOCUS_01650 gene kefA 11776 15087 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120603.1 protein_id gnl|my_center|LOCUS_01650 15705 15184 gene locus_tag LOCUS_01660 15705 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 16341 15721 gene locus_tag LOCUS_01670 16341 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 17237 16680 gene locus_tag LOCUS_01680 17237 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 17876 18859 gene locus_tag LOCUS_01690 17876 18859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 19559 18915 gene locus_tag LOCUS_01700 19559 18915 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461889.1 protein_id gnl|my_center|LOCUS_01700 19762 20574 gene locus_tag LOCUS_01710 19762 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_01710 21115 21342 gene locus_tag LOCUS_01720 21115 21342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 23053 21395 gene locus_tag LOCUS_01730 23053 21395 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_01730 23336 24274 gene locus_tag LOCUS_01740 23336 24274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 24425 24952 gene locus_tag LOCUS_01750 24425 24952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076326.1 protein_id gnl|my_center|LOCUS_01750 26306 24978 gene locus_tag LOCUS_01760 26306 24978 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118148.1 protein_id gnl|my_center|LOCUS_01760 26549 28108 gene locus_tag LOCUS_01770 gene merA 26549 28108 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_01770 28098 29762 gene locus_tag LOCUS_01780 gene arsA 28098 29762 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_01780 30518 29829 gene locus_tag LOCUS_01790 30518 29829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 31410 30643 gene locus_tag LOCUS_01800 31410 30643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 32138 31467 gene locus_tag LOCUS_01810 32138 31467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 33070 32135 gene locus_tag LOCUS_01820 gene modB 33070 32135 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948646.1 protein_id gnl|my_center|LOCUS_01820 34893 33271 gene locus_tag LOCUS_01830 34893 33271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 35597 34926 gene locus_tag LOCUS_01840 35597 34926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_01840 36772 35597 gene locus_tag LOCUS_01850 36772 35597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_01850 37042 36812 gene locus_tag LOCUS_01860 37042 36812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 37231 38511 gene locus_tag LOCUS_01870 37231 38511 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP3 protein_id gnl|my_center|LOCUS_01870 39807 38500 gene locus_tag LOCUS_01880 39807 38500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 43850 39804 gene locus_tag LOCUS_01890 43850 39804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 45183 43987 gene locus_tag LOCUS_01900 45183 43987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 47089 45575 gene locus_tag LOCUS_01910 gene arsA 47089 45575 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119603.1 protein_id gnl|my_center|LOCUS_01910 49583 47202 gene locus_tag LOCUS_01920 49583 47202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 50926 49712 gene locus_tag LOCUS_01930 gene galK 50926 49712 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQH8 protein_id gnl|my_center|LOCUS_01930 52916 51165 gene locus_tag LOCUS_01940 52916 51165 CDS product adenine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123876.1 protein_id gnl|my_center|LOCUS_01940 53340 54401 gene locus_tag LOCUS_01950 53340 54401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_01950 56076 54430 gene locus_tag LOCUS_01960 56076 54430 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120103.1 protein_id gnl|my_center|LOCUS_01960 58293 56200 gene locus_tag LOCUS_01970 58293 56200 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403348.1 protein_id gnl|my_center|LOCUS_01970 60100 58409 gene locus_tag LOCUS_01980 60100 58409 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096548.1 protein_id gnl|my_center|LOCUS_01980 60295 62130 gene locus_tag LOCUS_01990 60295 62130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 62415 63155 gene locus_tag LOCUS_02000 62415 63155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 63373 64242 gene locus_tag LOCUS_02010 63373 64242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 64902 64387 gene locus_tag LOCUS_02020 64902 64387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 65426 69079 gene locus_tag LOCUS_02030 65426 69079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 69172 69882 gene locus_tag LOCUS_02040 69172 69882 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072041.1 protein_id gnl|my_center|LOCUS_02040 70169 75481 gene locus_tag LOCUS_02050 70169 75481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 77419 75545 gene locus_tag LOCUS_02060 77419 75545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119909.1 protein_id gnl|my_center|LOCUS_02060 78551 77514 gene locus_tag LOCUS_02070 78551 77514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 79896 78649 gene locus_tag LOCUS_02080 79896 78649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 80267 81622 gene locus_tag LOCUS_02090 80267 81622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 82680 81676 gene locus_tag LOCUS_02100 82680 81676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 83034 82777 gene locus_tag LOCUS_02110 83034 82777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 85496 83313 gene locus_tag LOCUS_02120 85496 83313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 86083 88092 gene locus_tag LOCUS_02130 86083 88092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_02130 88483 89448 gene locus_tag LOCUS_02140 88483 89448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 89450 90493 gene locus_tag LOCUS_02150 89450 90493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 90544 91641 gene locus_tag LOCUS_02160 90544 91641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 91660 92205 gene locus_tag LOCUS_02170 91660 92205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 92205 92765 gene locus_tag LOCUS_02180 92205 92765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 92876 93169 gene locus_tag LOCUS_02190 92876 93169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 93237 94109 gene locus_tag LOCUS_02200 93237 94109 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121978.1 protein_id gnl|my_center|LOCUS_02200 95647 94154 gene locus_tag LOCUS_02210 95647 94154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 96800 96048 gene locus_tag LOCUS_02220 96800 96048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 97498 96806 gene locus_tag LOCUS_02230 97498 96806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 98366 97581 gene locus_tag LOCUS_02240 98366 97581 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_02240 98955 99305 gene locus_tag LOCUS_02250 98955 99305 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKF3 protein_id gnl|my_center|LOCUS_02250 99335 99766 gene locus_tag LOCUS_02260 99335 99766 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X185 protein_id gnl|my_center|LOCUS_02260 99763 100074 gene locus_tag LOCUS_02270 99763 100074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 100139 101647 gene locus_tag LOCUS_02280 100139 101647 CDS product flagellar M-ring protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272873.1 protein_id gnl|my_center|LOCUS_02280 101660 102673 gene locus_tag LOCUS_02290 gene fliG 101660 102673 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY63 protein_id gnl|my_center|LOCUS_02290 102676 103215 gene locus_tag LOCUS_02300 102676 103215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 103208 104548 gene locus_tag LOCUS_02310 gene fliI 103208 104548 CDS product flagellum-specific ATP synthase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678707.1 protein_id gnl|my_center|LOCUS_02310 104592 105038 gene locus_tag LOCUS_02320 104592 105038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 105035 105790 gene locus_tag LOCUS_02330 105035 105790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 105844 106110 gene locus_tag LOCUS_02340 105844 106110 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_02340 106107 106874 gene locus_tag LOCUS_02350 gene fliR 106107 106874 CDS product flagellar biosynthesis protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213766.1 protein_id gnl|my_center|LOCUS_02350 106902 107966 gene locus_tag LOCUS_02360 106902 107966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02360 109720 108080 gene locus_tag LOCUS_02370 109720 108080 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6B8 protein_id gnl|my_center|LOCUS_02370 110224 109865 gene locus_tag LOCUS_02380 gene flgD 110224 109865 CDS product flagellar basal body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089591.1 protein_id gnl|my_center|LOCUS_02380 111325 110300 gene locus_tag LOCUS_02390 111325 110300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 111770 112456 gene locus_tag LOCUS_02400 111770 112456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 113712 112645 gene locus_tag LOCUS_02410 113712 112645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 114229 113819 gene locus_tag LOCUS_02420 114229 113819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 115106 114210 gene locus_tag LOCUS_02430 115106 114210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 117346 115148 gene locus_tag LOCUS_02440 117346 115148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 117716 117973 gene locus_tag LOCUS_02450 117716 117973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 118080 119489 gene locus_tag LOCUS_02460 gene fliC 118080 119489 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_02460 119678 121654 gene locus_tag LOCUS_02470 119678 121654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 121722 122132 gene locus_tag LOCUS_02480 121722 122132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 122289 124199 gene locus_tag LOCUS_02490 122289 124199 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106635.1 protein_id gnl|my_center|LOCUS_02490 124498 125412 gene locus_tag LOCUS_02500 124498 125412 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_02500 126992 125535 gene locus_tag LOCUS_02510 126992 125535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 128955 126997 gene locus_tag LOCUS_02520 gene flgK 128955 126997 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268454.1 protein_id gnl|my_center|LOCUS_02520 129567 128965 gene locus_tag LOCUS_02530 129567 128965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 130076 129675 gene locus_tag LOCUS_02540 130076 129675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 131392 130151 gene locus_tag LOCUS_02550 gene flgI 131392 130151 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5T5 protein_id gnl|my_center|LOCUS_02550 132101 131439 gene locus_tag LOCUS_02560 gene flgH 132101 131439 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM39 protein_id gnl|my_center|LOCUS_02560 133241 132159 gene locus_tag LOCUS_02570 133241 132159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 134042 133254 gene locus_tag LOCUS_02580 gene flgG 134042 133254 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51715 protein_id gnl|my_center|LOCUS_02580 134829 134080 gene locus_tag LOCUS_02590 gene flgG 134829 134080 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNG7 protein_id gnl|my_center|LOCUS_02590 135288 135800 gene locus_tag LOCUS_02600 135288 135800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 135797 136657 gene locus_tag LOCUS_02610 135797 136657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 136662 137096 gene locus_tag LOCUS_02620 136662 137096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 137122 138015 gene locus_tag LOCUS_02630 137122 138015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 138060 138764 gene locus_tag LOCUS_02640 138060 138764 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_02640 138844 140988 gene locus_tag LOCUS_02650 gene flhA 138844 140988 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_02650 140985 141209 gene locus_tag LOCUS_02660 140985 141209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 141274 141984 gene locus_tag LOCUS_02670 gene fliA 141274 141984 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_02670 142045 142263 gene locus_tag LOCUS_02680 142045 142263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 142943 143332 gene locus_tag LOCUS_02690 142943 143332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 143638 144192 gene locus_tag LOCUS_02700 143638 144192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 145125 144256 gene locus_tag LOCUS_02710 145125 144256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 146782 145310 gene locus_tag LOCUS_02720 146782 145310 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_02720 150308 146793 gene locus_tag LOCUS_02730 150308 146793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 150968 150792 gene locus_tag LOCUS_02740 150968 150792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 151109 152371 gene locus_tag LOCUS_02750 151109 152371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810182.1 protein_id gnl|my_center|LOCUS_02750 152329 152520 gene locus_tag LOCUS_02760 152329 152520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 152648 153415 gene locus_tag LOCUS_02770 152648 153415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 154356 153466 gene locus_tag LOCUS_02780 154356 153466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 155759 154419 gene locus_tag LOCUS_02790 155759 154419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_02790 156173 157846 gene locus_tag LOCUS_02800 156173 157846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_02800 159663 157990 gene locus_tag LOCUS_02810 159663 157990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 160907 159825 gene locus_tag LOCUS_02820 160907 159825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 161172 162299 gene locus_tag LOCUS_02830 161172 162299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 162504 163013 gene locus_tag LOCUS_02840 162504 163013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 163077 165461 gene locus_tag LOCUS_02850 163077 165461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_02850 165480 166727 gene locus_tag LOCUS_02860 165480 166727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_02860 167755 166832 gene locus_tag LOCUS_02870 167755 166832 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120424.1 protein_id gnl|my_center|LOCUS_02870 169353 168583 gene locus_tag LOCUS_02880 169353 168583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122498.1 protein_id gnl|my_center|LOCUS_02880 170553 169540 gene locus_tag LOCUS_02890 170553 169540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 173353 170951 gene locus_tag LOCUS_02900 gene katG 173353 170951 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUW9 protein_id gnl|my_center|LOCUS_02900 173810 174940 gene locus_tag LOCUS_02910 173810 174940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089044.1 protein_id gnl|my_center|LOCUS_02910 174937 175731 gene locus_tag LOCUS_02920 174937 175731 CDS product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_02920 177116 175869 gene locus_tag LOCUS_02930 177116 175869 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_02930 177976 177137 gene locus_tag LOCUS_02940 177976 177137 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336262.1 protein_id gnl|my_center|LOCUS_02940 178359 179528 gene locus_tag LOCUS_02950 178359 179528 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123815.1 protein_id gnl|my_center|LOCUS_02950 179646 180080 gene locus_tag LOCUS_02960 179646 180080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 180785 180219 gene locus_tag LOCUS_02970 180785 180219 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_02970 >Feature sequence003 131 1426 gene locus_tag LOCUS_02980 131 1426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112770.1 protein_id gnl|my_center|LOCUS_02980 1470 2936 gene locus_tag LOCUS_02990 1470 2936 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_02990 4326 2962 gene locus_tag LOCUS_03000 4326 2962 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_03000 5424 4516 gene locus_tag LOCUS_03010 5424 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 6437 5523 gene locus_tag LOCUS_03020 6437 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119598.1 protein_id gnl|my_center|LOCUS_03020 7069 6554 gene locus_tag LOCUS_03030 7069 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 8235 7231 gene locus_tag LOCUS_03040 8235 7231 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_03040 8653 10302 gene locus_tag LOCUS_03050 8653 10302 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123572.1 protein_id gnl|my_center|LOCUS_03050 10500 11903 gene locus_tag LOCUS_03060 10500 11903 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122409.1 protein_id gnl|my_center|LOCUS_03060 13370 11973 gene locus_tag LOCUS_03070 gene arsA 13370 11973 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_03070 15299 13440 gene locus_tag LOCUS_03080 15299 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 15814 16560 gene locus_tag LOCUS_03090 15814 16560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122635.1 protein_id gnl|my_center|LOCUS_03090 17082 19316 gene locus_tag LOCUS_03100 17082 19316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 20246 19389 gene locus_tag LOCUS_03110 20246 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119348.1 protein_id gnl|my_center|LOCUS_03110 20532 21251 gene locus_tag LOCUS_03120 20532 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118676.1 protein_id gnl|my_center|LOCUS_03120 22042 21266 gene locus_tag LOCUS_03130 22042 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 22023 22262 gene locus_tag LOCUS_03140 22023 22262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 22492 23181 gene locus_tag LOCUS_03150 22492 23181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 23324 24580 gene locus_tag LOCUS_03160 23324 24580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886897.1 protein_id gnl|my_center|LOCUS_03160 24682 25947 gene locus_tag LOCUS_03170 24682 25947 CDS product cytochrome P450 hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971502.1 protein_id gnl|my_center|LOCUS_03170 26110 27894 gene locus_tag LOCUS_03180 26110 27894 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_03180 28604 27969 gene locus_tag LOCUS_03190 28604 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 31049 28764 gene locus_tag LOCUS_03200 31049 28764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 31262 32758 gene locus_tag LOCUS_03210 31262 32758 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943658.1 protein_id gnl|my_center|LOCUS_03210 32999 33658 gene locus_tag LOCUS_03220 32999 33658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 34955 33750 gene locus_tag LOCUS_03230 34955 33750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 35324 36364 gene locus_tag LOCUS_03240 35324 36364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 39592 36407 gene locus_tag LOCUS_03250 39592 36407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 41505 39676 gene locus_tag LOCUS_03260 41505 39676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 43018 41744 gene locus_tag LOCUS_03270 43018 41744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 43828 45564 gene locus_tag LOCUS_03280 43828 45564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 46789 45638 gene locus_tag LOCUS_03290 gene nagX 46789 45638 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_03290 48194 46851 gene locus_tag LOCUS_03300 48194 46851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120991.1 protein_id gnl|my_center|LOCUS_03300 50326 48266 gene locus_tag LOCUS_03310 50326 48266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120992.1 protein_id gnl|my_center|LOCUS_03310 51059 50856 gene locus_tag LOCUS_03320 51059 50856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 51706 52911 gene locus_tag LOCUS_03330 51706 52911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 52938 53918 gene locus_tag LOCUS_03340 52938 53918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 54688 53966 gene locus_tag LOCUS_03350 54688 53966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 55490 57025 gene locus_tag LOCUS_03360 55490 57025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 59200 57077 gene locus_tag LOCUS_03370 59200 57077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 59410 61821 gene locus_tag LOCUS_03380 59410 61821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_03380 61866 63302 gene locus_tag LOCUS_03390 61866 63302 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_03390 63354 64229 gene locus_tag LOCUS_03400 63354 64229 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_03400 64421 65977 gene locus_tag LOCUS_03410 gene xynB 64421 65977 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94489 protein_id gnl|my_center|LOCUS_03410 66374 72661 gene locus_tag LOCUS_03420 66374 72661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 72699 74108 gene locus_tag LOCUS_03430 gene atsG 72699 74108 CDS product sulfatase atsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122623.1 protein_id gnl|my_center|LOCUS_03430 74164 75021 gene locus_tag LOCUS_03440 74164 75021 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947363.1 protein_id gnl|my_center|LOCUS_03440 75910 75131 gene locus_tag LOCUS_03450 gene cynT2 75910 75131 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGY2 protein_id gnl|my_center|LOCUS_03450 77907 76054 gene locus_tag LOCUS_03460 gene pepN 77907 76054 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_03460 78387 78157 gene locus_tag LOCUS_03470 78387 78157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 78588 81353 gene locus_tag LOCUS_03480 78588 81353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 81407 82891 gene locus_tag LOCUS_03490 81407 82891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_03490 82998 84461 gene locus_tag LOCUS_03500 82998 84461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 85230 84475 gene locus_tag LOCUS_03510 85230 84475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 86582 85227 gene locus_tag LOCUS_03520 gene aslA 86582 85227 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_03520 87571 86720 gene locus_tag LOCUS_03530 87571 86720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 88549 87818 gene locus_tag LOCUS_03540 88549 87818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 89881 88619 gene locus_tag LOCUS_03550 89881 88619 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120027.1 protein_id gnl|my_center|LOCUS_03550 90356 91525 gene locus_tag LOCUS_03560 90356 91525 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_03560 94973 91611 gene locus_tag LOCUS_03570 94973 91611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 95376 95038 gene locus_tag LOCUS_03580 95376 95038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03580 95616 95380 gene locus_tag LOCUS_03590 95616 95380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 97139 95811 gene locus_tag LOCUS_03600 97139 95811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_03600 98455 97199 gene locus_tag LOCUS_03610 98455 97199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_03610 100882 98498 gene locus_tag LOCUS_03620 100882 98498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_03620 102450 100942 gene locus_tag LOCUS_03630 102450 100942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 103979 102615 gene locus_tag LOCUS_03640 103979 102615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 104518 103976 gene locus_tag LOCUS_03650 104518 103976 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123878.1 protein_id gnl|my_center|LOCUS_03650 105938 104613 gene locus_tag LOCUS_03660 105938 104613 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_03660 107438 105999 gene locus_tag LOCUS_03670 107438 105999 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_03670 108987 107428 gene locus_tag LOCUS_03680 108987 107428 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_03680 109350 110597 gene locus_tag LOCUS_03690 109350 110597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 110756 112906 gene locus_tag LOCUS_03700 110756 112906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 113007 113498 gene locus_tag LOCUS_03710 113007 113498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 115186 113612 gene locus_tag LOCUS_03720 115186 113612 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_03720 116964 115282 gene locus_tag LOCUS_03730 116964 115282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 117537 116965 gene locus_tag LOCUS_03740 117537 116965 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120437.1 protein_id gnl|my_center|LOCUS_03740 118028 119986 gene locus_tag LOCUS_03750 118028 119986 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_03750 120216 121541 gene locus_tag LOCUS_03760 120216 121541 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_03760 121538 123157 gene locus_tag LOCUS_03770 121538 123157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 123167 127024 gene locus_tag LOCUS_03780 123167 127024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 127064 129847 gene locus_tag LOCUS_03790 127064 129847 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120440.1 protein_id gnl|my_center|LOCUS_03790 129919 131424 gene locus_tag LOCUS_03800 129919 131424 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333818.1 protein_id gnl|my_center|LOCUS_03800 132434 131511 gene locus_tag LOCUS_03810 132434 131511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 133435 132659 gene locus_tag LOCUS_03820 133435 132659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 133710 133540 gene locus_tag LOCUS_03830 133710 133540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 134753 135532 gene locus_tag LOCUS_03840 134753 135532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03840 135583 136494 gene locus_tag LOCUS_03850 135583 136494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 136645 138195 gene locus_tag LOCUS_03860 136645 138195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 139967 138306 gene locus_tag LOCUS_03870 139967 138306 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120974.1 protein_id gnl|my_center|LOCUS_03870 141032 140121 gene locus_tag LOCUS_03880 141032 140121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 142326 141202 gene locus_tag LOCUS_03890 142326 141202 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_03890 142575 144218 gene locus_tag LOCUS_03900 gene phoD 142575 144218 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_03900 145768 144221 gene locus_tag LOCUS_03910 145768 144221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 147416 145830 gene locus_tag LOCUS_03920 147416 145830 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123733.1 protein_id gnl|my_center|LOCUS_03920 148932 147481 gene locus_tag LOCUS_03930 gene sigA 148932 147481 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q038U5 protein_id gnl|my_center|LOCUS_03930 149299 150774 gene locus_tag LOCUS_03940 149299 150774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 152221 150782 gene locus_tag LOCUS_03950 152221 150782 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545725.1 protein_id gnl|my_center|LOCUS_03950 152563 153648 gene locus_tag LOCUS_03960 152563 153648 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_03960 155115 153700 gene locus_tag LOCUS_03970 gene arsA 155115 153700 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_03970 156927 155140 gene locus_tag LOCUS_03980 156927 155140 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_03980 157225 157854 gene locus_tag LOCUS_03990 157225 157854 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_03990 157985 159358 gene locus_tag LOCUS_04000 gene sdaA 157985 159358 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86564 protein_id gnl|my_center|LOCUS_04000 161016 159379 gene locus_tag LOCUS_04010 161016 159379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 161290 162825 gene locus_tag LOCUS_04020 161290 162825 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_04020 163017 165731 gene locus_tag LOCUS_04030 163017 165731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 >Feature sequence004 1139 75 gene locus_tag LOCUS_04040 1139 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 2443 1229 gene locus_tag LOCUS_04050 gene papS 2443 1229 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_04050 3989 2562 gene locus_tag LOCUS_04060 3989 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_04060 6395 4098 gene locus_tag LOCUS_04070 6395 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 6658 7011 gene locus_tag LOCUS_04080 gene moeB 6658 7011 CDS product rhodanese domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329766.1 protein_id gnl|my_center|LOCUS_04080 7116 7868 gene locus_tag LOCUS_04090 7116 7868 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_04090 9061 7889 gene locus_tag LOCUS_04100 9061 7889 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123528.1 protein_id gnl|my_center|LOCUS_04100 12390 9133 gene locus_tag LOCUS_04110 12390 9133 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7W6 protein_id gnl|my_center|LOCUS_04110 12643 12727 gene locus_tag LOCUS_t00030 12643 12727 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13106 12759 gene locus_tag LOCUS_04120 13106 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 14065 13160 gene locus_tag LOCUS_04130 14065 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 14351 15244 gene locus_tag LOCUS_04140 14351 15244 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122640.1 protein_id gnl|my_center|LOCUS_04140 16714 15257 gene locus_tag LOCUS_04150 16714 15257 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_04150 16613 16843 gene locus_tag LOCUS_04160 16613 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 20142 16960 gene locus_tag LOCUS_04170 20142 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 21359 20139 gene locus_tag LOCUS_04180 21359 20139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04180 22533 21418 gene locus_tag LOCUS_04190 22533 21418 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_04190 23113 23574 gene locus_tag LOCUS_04200 23113 23574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 23782 24261 gene locus_tag LOCUS_04210 23782 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 24478 25539 gene locus_tag LOCUS_04220 24478 25539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 25933 26295 gene locus_tag LOCUS_04230 25933 26295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 27984 26416 gene locus_tag LOCUS_04240 27984 26416 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_04240 28183 28701 gene locus_tag LOCUS_04250 28183 28701 CDS product putative TspO/MBR-related protein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702958.1 protein_id gnl|my_center|LOCUS_04250 29745 28735 gene locus_tag LOCUS_04260 29745 28735 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040720.1 protein_id gnl|my_center|LOCUS_04260 30113 31453 gene locus_tag LOCUS_04270 30113 31453 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 protein_id gnl|my_center|LOCUS_04270 31774 31442 gene locus_tag LOCUS_04280 31774 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 32623 31856 gene locus_tag LOCUS_04290 32623 31856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 33335 32613 gene locus_tag LOCUS_04300 33335 32613 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120874.1 protein_id gnl|my_center|LOCUS_04300 33808 33350 gene locus_tag LOCUS_04310 33808 33350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_04310 34711 33914 gene locus_tag LOCUS_04320 gene mutM 34711 33914 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123886.1 protein_id gnl|my_center|LOCUS_04320 37181 34812 gene locus_tag LOCUS_04330 gene phr 37181 34812 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122223.1 protein_id gnl|my_center|LOCUS_04330 37529 38245 gene locus_tag LOCUS_04340 37529 38245 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_04340 38744 38289 gene locus_tag LOCUS_04350 38744 38289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 40328 38859 gene locus_tag LOCUS_04360 40328 38859 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_04360 41119 40817 gene locus_tag LOCUS_04370 41119 40817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 41313 42092 gene locus_tag LOCUS_04380 41313 42092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 42165 42806 gene locus_tag LOCUS_04390 gene cnrH 42165 42806 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122499.1 protein_id gnl|my_center|LOCUS_04390 42904 44166 gene locus_tag LOCUS_04400 42904 44166 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_04400 44429 44172 gene locus_tag LOCUS_04410 44429 44172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 44762 44598 gene locus_tag LOCUS_04420 44762 44598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 45428 44823 gene locus_tag LOCUS_04430 45428 44823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123243.1 protein_id gnl|my_center|LOCUS_04430 46535 45855 gene locus_tag LOCUS_04440 46535 45855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 47232 47834 gene locus_tag LOCUS_04450 47232 47834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 47917 49554 gene locus_tag LOCUS_04460 47917 49554 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943995.1 protein_id gnl|my_center|LOCUS_04460 49714 51090 gene locus_tag LOCUS_04470 gene cls 49714 51090 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_04470 51294 51812 gene locus_tag LOCUS_04480 51294 51812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 52365 51871 gene locus_tag LOCUS_04490 gene fabZ 52365 51871 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR2 protein_id gnl|my_center|LOCUS_04490 53742 52486 gene locus_tag LOCUS_04500 53742 52486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_04500 54082 53789 gene locus_tag LOCUS_04510 54082 53789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 54692 54216 gene locus_tag LOCUS_04520 54692 54216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 56523 55243 gene locus_tag LOCUS_04530 56523 55243 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_04530 58904 56817 gene locus_tag LOCUS_04540 58904 56817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 59478 58894 gene locus_tag LOCUS_04550 59478 58894 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_04550 61313 59727 gene locus_tag LOCUS_04560 61313 59727 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_04560 61986 61711 gene locus_tag LOCUS_04570 61986 61711 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_04570 62650 65022 gene locus_tag LOCUS_04580 62650 65022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 66041 65094 gene locus_tag LOCUS_04590 66041 65094 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_04590 66535 66188 gene locus_tag LOCUS_04600 gene rplX 66535 66188 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN09 protein_id gnl|my_center|LOCUS_04600 67313 66603 gene locus_tag LOCUS_04610 gene cutC 67313 66603 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH5 protein_id gnl|my_center|LOCUS_04610 68685 67306 gene locus_tag LOCUS_04620 68685 67306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 69263 68904 gene locus_tag LOCUS_04630 gene groS 69263 68904 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1B0 protein_id gnl|my_center|LOCUS_04630 69525 70220 gene locus_tag LOCUS_04640 69525 70220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 71109 70303 gene locus_tag LOCUS_04650 71109 70303 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389055.1 protein_id gnl|my_center|LOCUS_04650 71270 72151 gene locus_tag LOCUS_04660 gene parA 71270 72151 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_04660 72478 72918 gene locus_tag LOCUS_04670 72478 72918 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532659.1 protein_id gnl|my_center|LOCUS_04670 73941 72964 gene locus_tag LOCUS_04680 73941 72964 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQJ2 protein_id gnl|my_center|LOCUS_04680 74756 74682 gene locus_tag LOCUS_t00040 74756 74682 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 75966 75406 gene locus_tag LOCUS_04690 75966 75406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 76712 75987 gene locus_tag LOCUS_04700 76712 75987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 79558 76910 gene locus_tag LOCUS_04710 gene glnD 79558 76910 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ2 protein_id gnl|my_center|LOCUS_04710 80074 79736 gene locus_tag LOCUS_04720 gene glnB 80074 79736 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119123.1 protein_id gnl|my_center|LOCUS_04720 80933 80370 gene locus_tag LOCUS_04730 80933 80370 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_04730 80997 81443 gene locus_tag LOCUS_04740 80997 81443 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338041.1 protein_id gnl|my_center|LOCUS_04740 81562 83193 gene locus_tag LOCUS_04750 gene ade 81562 83193 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S006 protein_id gnl|my_center|LOCUS_04750 84012 83257 gene locus_tag LOCUS_04760 84012 83257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 85564 84113 gene locus_tag LOCUS_04770 85564 84113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 86841 85567 gene locus_tag LOCUS_04780 86841 85567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 87594 86914 gene locus_tag LOCUS_04790 87594 86914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 87930 87643 gene locus_tag LOCUS_04800 87930 87643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 88662 88102 gene locus_tag LOCUS_04810 88662 88102 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267035.1 protein_id gnl|my_center|LOCUS_04810 89068 89814 gene locus_tag LOCUS_04820 89068 89814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_04820 91020 89926 gene locus_tag LOCUS_04830 91020 89926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 92463 91201 gene locus_tag LOCUS_04840 92463 91201 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_04840 93919 92606 gene locus_tag LOCUS_04850 93919 92606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 94362 95918 gene locus_tag LOCUS_04860 94362 95918 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_04860 96038 97924 gene locus_tag LOCUS_04870 gene mutL 96038 97924 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ3 protein_id gnl|my_center|LOCUS_04870 98075 99526 gene locus_tag LOCUS_04880 98075 99526 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ72 protein_id gnl|my_center|LOCUS_04880 99604 100155 gene locus_tag LOCUS_04890 gene aroK 99604 100155 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU71 protein_id gnl|my_center|LOCUS_04890 100295 101602 gene locus_tag LOCUS_04900 100295 101602 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119702.1 protein_id gnl|my_center|LOCUS_04900 102118 102903 gene locus_tag LOCUS_04910 102118 102903 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119020.1 protein_id gnl|my_center|LOCUS_04910 103222 104277 gene locus_tag LOCUS_04920 103222 104277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 104465 106120 gene locus_tag LOCUS_04930 104465 106120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 106177 109431 gene locus_tag LOCUS_04940 gene dnaE2 106177 109431 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXK9 protein_id gnl|my_center|LOCUS_04940 109704 109459 gene locus_tag LOCUS_04950 109704 109459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056973.1 protein_id gnl|my_center|LOCUS_04950 110724 109834 gene locus_tag LOCUS_04960 110724 109834 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118413.1 protein_id gnl|my_center|LOCUS_04960 110890 111471 gene locus_tag LOCUS_04970 110890 111471 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_04970 111533 112204 gene locus_tag LOCUS_04980 gene mtnB 111533 112204 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 protein_id gnl|my_center|LOCUS_04980 112326 112916 gene locus_tag LOCUS_04990 gene mtnD 112326 112916 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819E5 protein_id gnl|my_center|LOCUS_04990 112998 113735 gene locus_tag LOCUS_05000 gene mtnC 112998 113735 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I340 protein_id gnl|my_center|LOCUS_05000 114007 115017 gene locus_tag LOCUS_05010 114007 115017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 115479 115102 gene locus_tag LOCUS_05020 115479 115102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117893.1 protein_id gnl|my_center|LOCUS_05020 117612 115912 gene locus_tag LOCUS_05030 117612 115912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 120378 117844 gene locus_tag LOCUS_05040 gene rnr 120378 117844 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR0 protein_id gnl|my_center|LOCUS_05040 121643 120672 gene locus_tag LOCUS_05050 121643 120672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_05050 121880 123385 gene locus_tag LOCUS_05060 gene proS 121880 123385 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_05060 123480 124025 gene locus_tag LOCUS_05070 123480 124025 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121758.1 protein_id gnl|my_center|LOCUS_05070 124259 126061 gene locus_tag LOCUS_05080 124259 126061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 126192 127178 gene locus_tag LOCUS_05090 126192 127178 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_05090 127410 129146 gene locus_tag LOCUS_05100 127410 129146 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120586.1 protein_id gnl|my_center|LOCUS_05100 131541 129268 gene locus_tag LOCUS_05110 131541 129268 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_05110 133635 131551 gene locus_tag LOCUS_05120 133635 131551 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122783.1 protein_id gnl|my_center|LOCUS_05120 135738 133834 gene locus_tag LOCUS_05130 gene secA2 135738 133834 CDS product protein translocase subunit SecA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWI5 protein_id gnl|my_center|LOCUS_05130 136066 136644 gene locus_tag LOCUS_05140 136066 136644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326145.1 protein_id gnl|my_center|LOCUS_05140 136641 137687 gene locus_tag LOCUS_05150 136641 137687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 137927 138208 gene locus_tag LOCUS_05160 137927 138208 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_05160 140187 138328 gene locus_tag LOCUS_05170 140187 138328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121831.1 protein_id gnl|my_center|LOCUS_05170 141732 140365 gene locus_tag LOCUS_05180 141732 140365 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330158.1 protein_id gnl|my_center|LOCUS_05180 142218 142667 gene locus_tag LOCUS_05190 142218 142667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 142674 143858 gene locus_tag LOCUS_05200 142674 143858 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122080.1 protein_id gnl|my_center|LOCUS_05200 144565 143834 gene locus_tag LOCUS_05210 144565 143834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 147020 145476 gene locus_tag LOCUS_05220 147020 145476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 147302 149293 gene locus_tag LOCUS_05230 147302 149293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05230 149311 150957 gene locus_tag LOCUS_05240 149311 150957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05240 151017 151307 gene locus_tag LOCUS_05250 151017 151307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 151887 151381 gene locus_tag LOCUS_05260 151887 151381 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG74 protein_id gnl|my_center|LOCUS_05260 152937 151909 gene locus_tag LOCUS_05270 152937 151909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121358.1 protein_id gnl|my_center|LOCUS_05270 154051 152972 gene locus_tag LOCUS_05280 gene manC 154051 152972 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_05280 155537 154128 gene locus_tag LOCUS_05290 155537 154128 CDS product UDP-N-acetylhexosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_05290 156087 155692 gene locus_tag LOCUS_05300 156087 155692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 157421 156261 gene locus_tag LOCUS_05310 gene metK 157421 156261 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URU7 protein_id gnl|my_center|LOCUS_05310 158871 157669 gene locus_tag LOCUS_05320 gene kdtA 158871 157669 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_05320 162842 159144 gene locus_tag LOCUS_05330 gene secA1 162842 159144 CDS product protein translocase subunit SecA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDY6 protein_id gnl|my_center|LOCUS_05330 >Feature sequence005 1318 530 gene locus_tag LOCUS_05340 1318 530 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_05340 2139 3212 gene locus_tag LOCUS_05350 2139 3212 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122074.1 protein_id gnl|my_center|LOCUS_05350 3221 4327 gene locus_tag LOCUS_05360 3221 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4389 4892 gene locus_tag LOCUS_05370 4389 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4952 6250 gene locus_tag LOCUS_05380 4952 6250 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_05380 6549 7964 gene locus_tag LOCUS_05390 6549 7964 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_05390 9104 7989 gene locus_tag LOCUS_05400 9104 7989 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EL0 protein_id gnl|my_center|LOCUS_05400 10654 9215 gene locus_tag LOCUS_05410 10654 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119759.1 protein_id gnl|my_center|LOCUS_05410 10972 13050 gene locus_tag LOCUS_05420 10972 13050 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119758.1 protein_id gnl|my_center|LOCUS_05420 13972 13103 gene locus_tag LOCUS_05430 13972 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 14532 15239 gene locus_tag LOCUS_05440 14532 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 15564 16577 gene locus_tag LOCUS_05450 15564 16577 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333080.1 protein_id gnl|my_center|LOCUS_05450 18170 16620 gene locus_tag LOCUS_05460 18170 16620 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338852.1 protein_id gnl|my_center|LOCUS_05460 19045 18341 gene locus_tag LOCUS_05470 19045 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 19230 20186 gene locus_tag LOCUS_05480 19230 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_05480 20545 21318 gene locus_tag LOCUS_05490 20545 21318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 21851 22552 gene locus_tag LOCUS_05500 21851 22552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 23176 23751 gene locus_tag LOCUS_05510 23176 23751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008653063.1 protein_id gnl|my_center|LOCUS_05510 24017 26509 gene locus_tag LOCUS_05520 24017 26509 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119225.1 protein_id gnl|my_center|LOCUS_05520 26854 28140 gene locus_tag LOCUS_05530 26854 28140 CDS product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_05530 28146 29288 gene locus_tag LOCUS_05540 28146 29288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 protein_id gnl|my_center|LOCUS_05540 29494 30375 gene locus_tag LOCUS_05550 gene rsmH 29494 30375 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT99 protein_id gnl|my_center|LOCUS_05550 30536 31801 gene locus_tag LOCUS_05560 30536 31801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 31878 32372 gene locus_tag LOCUS_05570 31878 32372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 32743 34041 gene locus_tag LOCUS_05580 gene tadA 32743 34041 CDS product secretion system protein TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120689.1 protein_id gnl|my_center|LOCUS_05580 34130 35095 gene locus_tag LOCUS_05590 gene tadB 34130 35095 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120690.1 protein_id gnl|my_center|LOCUS_05590 35100 36083 gene locus_tag LOCUS_05600 gene tadC 35100 36083 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_05600 36473 37219 gene locus_tag LOCUS_05610 36473 37219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 37370 37537 gene locus_tag LOCUS_05620 37370 37537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 37616 38506 gene locus_tag LOCUS_05630 gene truB 37616 38506 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I48 protein_id gnl|my_center|LOCUS_05630 38748 41450 gene locus_tag LOCUS_05640 gene citB 38748 41450 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_05640 45289 42158 gene locus_tag LOCUS_05650 gene valS 45289 42158 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXH9 protein_id gnl|my_center|LOCUS_05650 45655 46416 gene locus_tag LOCUS_05660 45655 46416 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099320.1 protein_id gnl|my_center|LOCUS_05660 46598 47476 gene locus_tag LOCUS_05670 gene murB 46598 47476 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVF9 protein_id gnl|my_center|LOCUS_05670 47602 48558 gene locus_tag LOCUS_05680 47602 48558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 48880 48662 gene locus_tag LOCUS_05690 gene csrA 48880 48662 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44879 protein_id gnl|my_center|LOCUS_05690 53119 49319 gene locus_tag LOCUS_05700 53119 49319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 54115 53522 gene locus_tag LOCUS_05710 54115 53522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 54918 54349 gene locus_tag LOCUS_05720 54918 54349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 56306 55041 gene locus_tag LOCUS_05730 56306 55041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119986.1 protein_id gnl|my_center|LOCUS_05730 57258 56341 gene locus_tag LOCUS_05740 57258 56341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 57648 59000 gene locus_tag LOCUS_05750 57648 59000 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_05750 59630 59061 gene locus_tag LOCUS_05760 59630 59061 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119001.1 protein_id gnl|my_center|LOCUS_05760 60306 59752 gene locus_tag LOCUS_05770 60306 59752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 60740 61318 gene locus_tag LOCUS_05780 60740 61318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 61445 62116 gene locus_tag LOCUS_05790 61445 62116 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_05790 64175 62154 gene locus_tag LOCUS_05800 64175 62154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 64692 64267 gene locus_tag LOCUS_05810 gene exbD 64692 64267 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 protein_id gnl|my_center|LOCUS_05810 65528 64710 gene locus_tag LOCUS_05820 65528 64710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 68693 65682 gene locus_tag LOCUS_05830 68693 65682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 69546 69070 gene locus_tag LOCUS_05840 gene greA 69546 69070 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA0 protein_id gnl|my_center|LOCUS_05840 72049 69800 gene locus_tag LOCUS_05850 72049 69800 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_05850 72757 72083 gene locus_tag LOCUS_05860 72757 72083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 72972 73970 gene locus_tag LOCUS_05870 gene dmt 72972 73970 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_05870 74012 74584 gene locus_tag LOCUS_05880 74012 74584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 74616 74828 gene locus_tag LOCUS_05890 74616 74828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 75321 76394 gene locus_tag LOCUS_05900 gene queA 75321 76394 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGI9 protein_id gnl|my_center|LOCUS_05900 77655 76402 gene locus_tag LOCUS_05910 gene fabB 77655 76402 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119514.1 protein_id gnl|my_center|LOCUS_05910 78935 77805 gene locus_tag LOCUS_05920 78935 77805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121691.1 protein_id gnl|my_center|LOCUS_05920 79107 80081 gene locus_tag LOCUS_05930 gene hpnA 79107 80081 CDS product HpnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121915.1 protein_id gnl|my_center|LOCUS_05930 81355 80141 gene locus_tag LOCUS_05940 81355 80141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_05940 82085 81558 gene locus_tag LOCUS_05950 82085 81558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_05950 82317 83288 gene locus_tag LOCUS_05960 82317 83288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 83451 84122 gene locus_tag LOCUS_05970 83451 84122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 84393 85397 gene locus_tag LOCUS_05980 gene fabH 84393 85397 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120566.1 protein_id gnl|my_center|LOCUS_05980 85900 85421 gene locus_tag LOCUS_05990 gene fabZ 85900 85421 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_05990 86909 86388 gene locus_tag LOCUS_06000 gene ppiB 86909 86388 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_06000 87727 87260 gene locus_tag LOCUS_06010 87727 87260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 87900 89033 gene locus_tag LOCUS_06020 87900 89033 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_06020 90535 89237 gene locus_tag LOCUS_06030 90535 89237 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_06030 93297 90886 gene locus_tag LOCUS_06040 93297 90886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 99908 93552 gene locus_tag LOCUS_06050 99908 93552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 100543 100292 gene locus_tag LOCUS_06060 100543 100292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 101120 102769 gene locus_tag LOCUS_06070 101120 102769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 103165 103926 gene locus_tag LOCUS_06080 103165 103926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 103979 105907 gene locus_tag LOCUS_06090 103979 105907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 105910 108162 gene locus_tag LOCUS_06100 105910 108162 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 protein_id gnl|my_center|LOCUS_06100 109218 108253 gene locus_tag LOCUS_06110 gene miaA 109218 108253 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU09 protein_id gnl|my_center|LOCUS_06110 110130 109318 gene locus_tag LOCUS_06120 110130 109318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 110875 110168 gene locus_tag LOCUS_06130 gene ptsN 110875 110168 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_06130 111326 112873 gene locus_tag LOCUS_06140 gene murE 111326 112873 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819Q0 protein_id gnl|my_center|LOCUS_06140 113442 113702 gene locus_tag LOCUS_06150 113442 113702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 113885 115450 gene locus_tag LOCUS_06160 113885 115450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 116160 115459 gene locus_tag LOCUS_06170 116160 115459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 118168 116237 gene locus_tag LOCUS_06180 gene selB 118168 116237 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_06180 118428 119228 gene locus_tag LOCUS_06190 gene proC 118428 119228 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPI9 protein_id gnl|my_center|LOCUS_06190 119384 119860 gene locus_tag LOCUS_06200 119384 119860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 119929 120492 gene locus_tag LOCUS_06210 119929 120492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 121275 120532 gene locus_tag LOCUS_06220 121275 120532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 122146 121430 gene locus_tag LOCUS_06230 122146 121430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 124133 122313 gene locus_tag LOCUS_06240 gene sigA 124133 122313 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQG1 protein_id gnl|my_center|LOCUS_06240 126371 124488 gene locus_tag LOCUS_06250 gene dnaG 126371 124488 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQG2 protein_id gnl|my_center|LOCUS_06250 130528 126812 gene locus_tag LOCUS_06260 130528 126812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 130740 130546 gene locus_tag LOCUS_06270 130740 130546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 130729 131157 gene locus_tag LOCUS_06280 130729 131157 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_06280 131295 132470 gene locus_tag LOCUS_06290 131295 132470 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328980.1 protein_id gnl|my_center|LOCUS_06290 133479 132523 gene locus_tag LOCUS_06300 gene hprA 133479 132523 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_06300 134244 133795 gene locus_tag LOCUS_06310 134244 133795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_06310 135431 134376 gene locus_tag LOCUS_06320 135431 134376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 137812 135614 gene locus_tag LOCUS_06330 137812 135614 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328585.1 protein_id gnl|my_center|LOCUS_06330 138025 139743 gene locus_tag LOCUS_06340 138025 139743 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121082.1 protein_id gnl|my_center|LOCUS_06340 140648 139782 gene locus_tag LOCUS_06350 140648 139782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 141599 140652 gene locus_tag LOCUS_06360 gene mch 141599 140652 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPS1 protein_id gnl|my_center|LOCUS_06360 142669 141716 gene locus_tag LOCUS_06370 142669 141716 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKE8 protein_id gnl|my_center|LOCUS_06370 142863 143249 gene locus_tag LOCUS_06380 142863 143249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 144088 143321 gene locus_tag LOCUS_06390 144088 143321 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_06390 146997 144289 gene locus_tag LOCUS_06400 gene deaD 146997 144289 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG20 protein_id gnl|my_center|LOCUS_06400 149024 147507 gene locus_tag LOCUS_06410 149024 147507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 150342 149035 gene locus_tag LOCUS_06420 150342 149035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 152474 150363 gene locus_tag LOCUS_06430 152474 150363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 153104 152664 gene locus_tag LOCUS_06440 gene rpiB 153104 152664 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_06440 154304 153171 gene locus_tag LOCUS_06450 154304 153171 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_06450 154534 155517 gene locus_tag LOCUS_06460 154534 155517 CDS product ring finger protein HAC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122950.1 protein_id gnl|my_center|LOCUS_06460 155592 156596 gene locus_tag LOCUS_06470 155592 156596 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_06470 156609 158204 gene locus_tag LOCUS_06480 156609 158204 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123565.1 protein_id gnl|my_center|LOCUS_06480 158201 160363 gene locus_tag LOCUS_06490 gene ppk 158201 160363 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULJ4 protein_id gnl|my_center|LOCUS_06490 >Feature sequence006 6519 5926 gene locus_tag LOCUS_06500 6519 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6815 8173 gene locus_tag LOCUS_06510 6815 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 10620 8236 gene locus_tag LOCUS_06520 10620 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_06520 11125 12507 gene locus_tag LOCUS_06530 11125 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_06530 12827 12997 gene locus_tag LOCUS_06540 12827 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 13973 13035 gene locus_tag LOCUS_06550 13973 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 14548 14351 gene locus_tag LOCUS_06560 14548 14351 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_06560 15372 17597 gene locus_tag LOCUS_06570 15372 17597 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_06570 17626 18222 gene locus_tag LOCUS_06580 17626 18222 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_06580 20130 18298 gene locus_tag LOCUS_06590 20130 18298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 20644 20186 gene locus_tag LOCUS_06600 20644 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 21081 20698 gene locus_tag LOCUS_06610 21081 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 22631 21150 gene locus_tag LOCUS_06620 22631 21150 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 protein_id gnl|my_center|LOCUS_06620 24116 22758 gene locus_tag LOCUS_06630 gene xylA 24116 22758 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG2 protein_id gnl|my_center|LOCUS_06630 24259 25425 gene locus_tag LOCUS_06640 gene xylR 24259 25425 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_06640 27075 25483 gene locus_tag LOCUS_06650 27075 25483 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_06650 27205 29508 gene locus_tag LOCUS_06660 27205 29508 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119225.1 protein_id gnl|my_center|LOCUS_06660 29693 31162 gene locus_tag LOCUS_06670 gene ids 29693 31162 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123097.1 protein_id gnl|my_center|LOCUS_06670 32849 31182 gene locus_tag LOCUS_06680 gene aslA 32849 31182 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118456.1 protein_id gnl|my_center|LOCUS_06680 32932 34170 gene locus_tag LOCUS_06690 32932 34170 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_06690 36512 34236 gene locus_tag LOCUS_06700 36512 34236 CDS product NADH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121573.1 protein_id gnl|my_center|LOCUS_06700 38578 36551 gene locus_tag LOCUS_06710 gene speA 38578 36551 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F01 protein_id gnl|my_center|LOCUS_06710 40182 38716 gene locus_tag LOCUS_06720 40182 38716 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_06720 43202 40239 gene locus_tag LOCUS_06730 43202 40239 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_06730 44804 43305 gene locus_tag LOCUS_06740 44804 43305 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_06740 47730 44812 gene locus_tag LOCUS_06750 47730 44812 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122121.1 protein_id gnl|my_center|LOCUS_06750 47800 48540 gene locus_tag LOCUS_06760 47800 48540 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122515.1 protein_id gnl|my_center|LOCUS_06760 49389 48586 gene locus_tag LOCUS_06770 49389 48586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 49737 51269 gene locus_tag LOCUS_06780 49737 51269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 51826 51284 gene locus_tag LOCUS_06790 51826 51284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122724.1 protein_id gnl|my_center|LOCUS_06790 52851 54380 gene locus_tag LOCUS_06800 gene rpdD 52851 54380 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF51 protein_id gnl|my_center|LOCUS_06800 54703 55146 gene locus_tag LOCUS_06810 54703 55146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 55219 55755 gene locus_tag LOCUS_06820 55219 55755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 56243 56923 gene locus_tag LOCUS_06830 56243 56923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 57750 56971 gene locus_tag LOCUS_06840 57750 56971 CDS product N,N-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_06840 60844 57848 gene locus_tag LOCUS_06850 60844 57848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 61475 60834 gene locus_tag LOCUS_06860 61475 60834 CDS product RNA polymerase sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120732.1 protein_id gnl|my_center|LOCUS_06860 61922 62254 gene locus_tag LOCUS_06870 61922 62254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 62518 65199 gene locus_tag LOCUS_06880 62518 65199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 protein_id gnl|my_center|LOCUS_06880 65251 66666 gene locus_tag LOCUS_06890 65251 66666 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_06890 67311 69770 gene locus_tag LOCUS_06900 67311 69770 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121337.1 protein_id gnl|my_center|LOCUS_06900 69767 70693 gene locus_tag LOCUS_06910 69767 70693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 72222 70732 gene locus_tag LOCUS_06920 72222 70732 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_06920 73071 72325 gene locus_tag LOCUS_06930 73071 72325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 74452 73265 gene locus_tag LOCUS_06940 74452 73265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 75721 74735 gene locus_tag LOCUS_06950 75721 74735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 77965 76043 gene locus_tag LOCUS_06960 gene gyrB 77965 76043 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU72 protein_id gnl|my_center|LOCUS_06960 80416 78026 gene locus_tag LOCUS_06970 gene gyrA 80416 78026 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU73 protein_id gnl|my_center|LOCUS_06970 80929 81501 gene locus_tag LOCUS_06980 80929 81501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 81577 82140 gene locus_tag LOCUS_06990 81577 82140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 85084 82514 gene locus_tag LOCUS_07000 85084 82514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 85545 85081 gene locus_tag LOCUS_07010 85545 85081 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119076.1 protein_id gnl|my_center|LOCUS_07010 85967 85542 gene locus_tag LOCUS_07020 85967 85542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 86775 86020 gene locus_tag LOCUS_07030 gene tolQ 86775 86020 CDS product TolQ-type transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 protein_id gnl|my_center|LOCUS_07030 87823 86855 gene locus_tag LOCUS_07040 87823 86855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 88768 87911 gene locus_tag LOCUS_07050 88768 87911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 89288 89500 gene locus_tag LOCUS_07060 89288 89500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 90335 89532 gene locus_tag LOCUS_07070 90335 89532 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_07070 90861 90352 gene locus_tag LOCUS_07080 90861 90352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 91062 95093 gene locus_tag LOCUS_07090 91062 95093 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120738.1 protein_id gnl|my_center|LOCUS_07090 95083 96546 gene locus_tag LOCUS_07100 95083 96546 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_07100 98540 96624 gene locus_tag LOCUS_07110 98540 96624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 99086 98613 gene locus_tag LOCUS_07120 99086 98613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 99836 99177 gene locus_tag LOCUS_07130 99836 99177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 100322 99873 gene locus_tag LOCUS_07140 100322 99873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 100521 100742 gene locus_tag LOCUS_07150 100521 100742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 101526 101173 gene locus_tag LOCUS_07160 101526 101173 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405496.1 protein_id gnl|my_center|LOCUS_07160 101837 101559 gene locus_tag LOCUS_07170 101837 101559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123708.1 protein_id gnl|my_center|LOCUS_07170 102756 102040 gene locus_tag LOCUS_07180 gene bioD 102756 102040 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URG0 protein_id gnl|my_center|LOCUS_07180 102891 103784 gene locus_tag LOCUS_07190 102891 103784 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329752.1 protein_id gnl|my_center|LOCUS_07190 103828 104859 gene locus_tag LOCUS_07200 103828 104859 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_07200 105022 105762 gene locus_tag LOCUS_07210 105022 105762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 106698 105907 gene locus_tag LOCUS_07220 106698 105907 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_07220 106767 107228 gene locus_tag LOCUS_07230 106767 107228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 107265 108314 gene locus_tag LOCUS_07240 gene hemH 107265 108314 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFZ7 protein_id gnl|my_center|LOCUS_07240 108315 108671 gene locus_tag LOCUS_07250 108315 108671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 108675 108851 gene locus_tag LOCUS_07260 108675 108851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 109620 109859 gene locus_tag LOCUS_07270 109620 109859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 110591 109902 gene locus_tag LOCUS_07280 gene ung 110591 109902 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3TZW1 protein_id gnl|my_center|LOCUS_07280 112348 110588 gene locus_tag LOCUS_07290 gene recJ 112348 110588 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_07290 112738 112571 gene locus_tag LOCUS_07300 gene rpmG 112738 112571 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMN0 protein_id gnl|my_center|LOCUS_07300 113943 112966 gene locus_tag LOCUS_07310 113943 112966 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_07310 114630 115958 gene locus_tag LOCUS_07320 114630 115958 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122733.1 protein_id gnl|my_center|LOCUS_07320 116281 119583 gene locus_tag LOCUS_07330 116281 119583 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337208.1 protein_id gnl|my_center|LOCUS_07330 120481 119624 gene locus_tag LOCUS_07340 120481 119624 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_07340 120874 121752 gene locus_tag LOCUS_07350 120874 121752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 122773 121775 gene locus_tag LOCUS_07360 122773 121775 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122861.1 protein_id gnl|my_center|LOCUS_07360 122913 125393 gene locus_tag LOCUS_07370 122913 125393 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117697.1 protein_id gnl|my_center|LOCUS_07370 126107 125421 gene locus_tag LOCUS_07380 126107 125421 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117903.1 protein_id gnl|my_center|LOCUS_07380 127267 126098 gene locus_tag LOCUS_07390 127267 126098 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_07390 127499 128224 gene locus_tag LOCUS_07400 127499 128224 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730498.1 protein_id gnl|my_center|LOCUS_07400 128258 129067 gene locus_tag LOCUS_07410 128258 129067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 129697 129212 gene locus_tag LOCUS_07420 gene coaD 129697 129212 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG6 protein_id gnl|my_center|LOCUS_07420 130233 130436 gene locus_tag LOCUS_07430 130233 130436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 130738 132045 gene locus_tag LOCUS_07440 130738 132045 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_07440 133079 132096 gene locus_tag LOCUS_07450 133079 132096 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209638.1 protein_id gnl|my_center|LOCUS_07450 133324 136299 gene locus_tag LOCUS_07460 133324 136299 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120962.1 protein_id gnl|my_center|LOCUS_07460 136382 137851 gene locus_tag LOCUS_07470 136382 137851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_07470 137817 138674 gene locus_tag LOCUS_07480 137817 138674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 138782 140233 gene locus_tag LOCUS_07490 138782 140233 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121190.1 protein_id gnl|my_center|LOCUS_07490 140326 141348 gene locus_tag LOCUS_07500 gene xynE 140326 141348 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122022.1 protein_id gnl|my_center|LOCUS_07500 142696 141365 gene locus_tag LOCUS_07510 142696 141365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 143012 143959 gene locus_tag LOCUS_07520 gene paaG 143012 143959 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_07520 144758 143967 gene locus_tag LOCUS_07530 144758 143967 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 protein_id gnl|my_center|LOCUS_07530 144853 145824 gene locus_tag LOCUS_07540 144853 145824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 149227 145874 gene locus_tag LOCUS_07550 149227 145874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 149826 149302 gene locus_tag LOCUS_07560 149826 149302 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122486.1 protein_id gnl|my_center|LOCUS_07560 150764 149991 gene locus_tag LOCUS_07570 gene bioC 150764 149991 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC8 protein_id gnl|my_center|LOCUS_07570 151522 150761 gene locus_tag LOCUS_07580 gene bioH 151522 150761 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSF8 protein_id gnl|my_center|LOCUS_07580 152703 151519 gene locus_tag LOCUS_07590 gene bioF 152703 151519 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A97 protein_id gnl|my_center|LOCUS_07590 153812 152766 gene locus_tag LOCUS_07600 gene bioB 153812 152766 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMG4 protein_id gnl|my_center|LOCUS_07600 155334 153958 gene locus_tag LOCUS_07610 gene bioA 155334 153958 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V66 protein_id gnl|my_center|LOCUS_07610 158840 155595 gene locus_tag LOCUS_07620 gene carB 158840 155595 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ58 protein_id gnl|my_center|LOCUS_07620 >Feature sequence007 524 2410 gene locus_tag LOCUS_07630 524 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120253.1 protein_id gnl|my_center|LOCUS_07630 2460 3770 gene locus_tag LOCUS_07640 2460 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119021.1 protein_id gnl|my_center|LOCUS_07640 3906 4850 gene locus_tag LOCUS_07650 3906 4850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_07650 4948 5997 gene locus_tag LOCUS_07660 4948 5997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_07660 6738 6013 gene locus_tag LOCUS_07670 6738 6013 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_07670 7183 8469 gene locus_tag LOCUS_07680 7183 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 8470 9930 gene locus_tag LOCUS_07690 8470 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_07690 11762 10026 gene locus_tag LOCUS_07700 11762 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 12082 12411 gene locus_tag LOCUS_07710 12082 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 13542 12448 gene locus_tag LOCUS_07720 13542 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 14083 13775 gene locus_tag LOCUS_07730 gene glnB 14083 13775 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327966.1 protein_id gnl|my_center|LOCUS_07730 14868 14152 gene locus_tag LOCUS_07740 14868 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143958.1 protein_id gnl|my_center|LOCUS_07740 16514 14877 gene locus_tag LOCUS_07750 16514 14877 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123862.1 protein_id gnl|my_center|LOCUS_07750 16804 17451 gene locus_tag LOCUS_07760 16804 17451 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123703.1 protein_id gnl|my_center|LOCUS_07760 17493 18578 gene locus_tag LOCUS_07770 17493 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333498.1 protein_id gnl|my_center|LOCUS_07770 21197 18618 gene locus_tag LOCUS_07780 21197 18618 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103180.1 protein_id gnl|my_center|LOCUS_07780 21465 24032 gene locus_tag LOCUS_07790 21465 24032 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257164.1 protein_id gnl|my_center|LOCUS_07790 24755 24081 gene locus_tag LOCUS_07800 24755 24081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 25695 24820 gene locus_tag LOCUS_07810 25695 24820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 26042 27850 gene locus_tag LOCUS_07820 26042 27850 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_07820 27910 29757 gene locus_tag LOCUS_07830 27910 29757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 29829 30608 gene locus_tag LOCUS_07840 29829 30608 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_07840 30711 30785 gene locus_tag LOCUS_t00050 30711 30785 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 30966 31793 gene locus_tag LOCUS_07850 30966 31793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07850 32055 32444 gene locus_tag LOCUS_07860 32055 32444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07860 32747 36001 gene locus_tag LOCUS_07870 32747 36001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_07870 36436 38208 gene locus_tag LOCUS_07880 gene acs 36436 38208 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806493.1 protein_id gnl|my_center|LOCUS_07880 39216 38230 gene locus_tag LOCUS_07890 39216 38230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 40527 39226 gene locus_tag LOCUS_07900 gene fabF 40527 39226 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ1 protein_id gnl|my_center|LOCUS_07900 41226 40687 gene locus_tag LOCUS_07910 gene fabZ 41226 40687 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121272.1 protein_id gnl|my_center|LOCUS_07910 41703 41320 gene locus_tag LOCUS_07920 gene acpP 41703 41320 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP48 protein_id gnl|my_center|LOCUS_07920 42348 41785 gene locus_tag LOCUS_07930 42348 41785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 42605 44362 gene locus_tag LOCUS_07940 gene ptsI-2 42605 44362 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMP1 protein_id gnl|my_center|LOCUS_07940 45043 44402 gene locus_tag LOCUS_07950 45043 44402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 46033 45896 gene locus_tag LOCUS_07960 46033 45896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 48528 46447 gene locus_tag LOCUS_07970 gene fusA 48528 46447 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_07970 49140 48670 gene locus_tag LOCUS_07980 gene rpsG 49140 48670 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN31 protein_id gnl|my_center|LOCUS_07980 49571 49206 gene locus_tag LOCUS_07990 gene rpsL 49571 49206 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN32 protein_id gnl|my_center|LOCUS_07990 55336 49865 gene locus_tag LOCUS_08000 gene rpoC 55336 49865 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URW4 protein_id gnl|my_center|LOCUS_08000 59216 55482 gene locus_tag LOCUS_08010 gene rpoB 59216 55482 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URW6 protein_id gnl|my_center|LOCUS_08010 60138 59728 gene locus_tag LOCUS_08020 gene rplL 60138 59728 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI01 protein_id gnl|my_center|LOCUS_08020 60843 60319 gene locus_tag LOCUS_08030 gene rplJ 60843 60319 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_08030 61588 60914 gene locus_tag LOCUS_08040 gene rplA 61588 60914 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI03 protein_id gnl|my_center|LOCUS_08040 62100 61675 gene locus_tag LOCUS_08050 gene rplK 62100 61675 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY7 protein_id gnl|my_center|LOCUS_08050 62987 62148 gene locus_tag LOCUS_08060 62987 62148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 63497 63045 gene locus_tag LOCUS_08070 gene secE 63497 63045 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY9 protein_id gnl|my_center|LOCUS_08070 63671 63596 gene locus_tag LOCUS_t00060 63671 63596 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 65005 63809 gene locus_tag LOCUS_08080 gene tuf 65005 63809 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_08080 65177 65105 gene locus_tag LOCUS_t00070 65177 65105 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 65292 65221 gene locus_tag LOCUS_t00080 65292 65221 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 65613 65531 gene locus_tag LOCUS_t00090 65613 65531 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 65815 65743 gene locus_tag LOCUS_t00100 65815 65743 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 66250 66453 gene locus_tag LOCUS_08090 66250 66453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 68518 66818 gene locus_tag LOCUS_08100 68518 66818 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_08100 69070 70455 gene locus_tag LOCUS_08110 69070 70455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 70600 71427 gene locus_tag LOCUS_08120 gene punA 70600 71427 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ11 protein_id gnl|my_center|LOCUS_08120 71506 72324 gene locus_tag LOCUS_08130 gene punA 71506 72324 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ11 protein_id gnl|my_center|LOCUS_08130 72472 73500 gene locus_tag LOCUS_08140 72472 73500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122550.1 protein_id gnl|my_center|LOCUS_08140 74572 73538 gene locus_tag LOCUS_08150 74572 73538 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550456.1 protein_id gnl|my_center|LOCUS_08150 74966 76996 gene locus_tag LOCUS_08160 74966 76996 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122783.1 protein_id gnl|my_center|LOCUS_08160 77030 77563 gene locus_tag LOCUS_08170 77030 77563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 77882 78868 gene locus_tag LOCUS_08180 77882 78868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 80009 78912 gene locus_tag LOCUS_08190 80009 78912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 81083 80163 gene locus_tag LOCUS_08200 81083 80163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 82443 81391 gene locus_tag LOCUS_08210 gene nrdB 82443 81391 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6S4 protein_id gnl|my_center|LOCUS_08210 85520 82710 gene locus_tag LOCUS_08220 gene nrdA 85520 82710 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MCP2 protein_id gnl|my_center|LOCUS_08220 86460 87245 gene locus_tag LOCUS_08230 86460 87245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 88558 87383 gene locus_tag LOCUS_08240 88558 87383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 89641 88772 gene locus_tag LOCUS_08250 gene thiG 89641 88772 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US84 protein_id gnl|my_center|LOCUS_08250 89900 89643 gene locus_tag LOCUS_08260 89900 89643 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120020.1 protein_id gnl|my_center|LOCUS_08260 90972 90019 gene locus_tag LOCUS_08270 gene lipA 90972 90019 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH37 protein_id gnl|my_center|LOCUS_08270 91417 91926 gene locus_tag LOCUS_08280 gene smpB 91417 91926 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH38 protein_id gnl|my_center|LOCUS_08280 92136 92852 gene locus_tag LOCUS_08290 92136 92852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_08290 92984 94693 gene locus_tag LOCUS_08300 92984 94693 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_08300 94932 96626 gene locus_tag LOCUS_08310 94932 96626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 96855 97535 gene locus_tag LOCUS_08320 96855 97535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121361.1 protein_id gnl|my_center|LOCUS_08320 97607 98134 gene locus_tag LOCUS_08330 97607 98134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 98285 99475 gene locus_tag LOCUS_08340 98285 99475 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_08340 99551 100294 gene locus_tag LOCUS_08350 gene ubiE 99551 100294 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_08350 101797 100553 gene locus_tag LOCUS_08360 101797 100553 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU00 protein_id gnl|my_center|LOCUS_08360 102900 101980 gene locus_tag LOCUS_08370 102900 101980 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_08370 103699 103076 gene locus_tag LOCUS_08380 103699 103076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 104776 103724 gene locus_tag LOCUS_08390 104776 103724 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQD2 protein_id gnl|my_center|LOCUS_08390 106154 104994 gene locus_tag LOCUS_08400 106154 104994 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_08400 107312 106233 gene locus_tag LOCUS_08410 107312 106233 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096413.1 protein_id gnl|my_center|LOCUS_08410 108472 107636 gene locus_tag LOCUS_08420 108472 107636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 109878 108850 gene locus_tag LOCUS_08430 109878 108850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 110520 109939 gene locus_tag LOCUS_08440 gene sigW 110520 109939 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_08440 111941 110640 gene locus_tag LOCUS_08450 gene lgt 111941 110640 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMF7 protein_id gnl|my_center|LOCUS_08450 112945 112091 gene locus_tag LOCUS_08460 gene panC 112945 112091 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM60 protein_id gnl|my_center|LOCUS_08460 113253 114803 gene locus_tag LOCUS_08470 113253 114803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118208.1 protein_id gnl|my_center|LOCUS_08470 116044 114926 gene locus_tag LOCUS_08480 gene fabH 116044 114926 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59814 protein_id gnl|my_center|LOCUS_08480 116465 117238 gene locus_tag LOCUS_08490 116465 117238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123408.1 protein_id gnl|my_center|LOCUS_08490 118340 117390 gene locus_tag LOCUS_08500 118340 117390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 118459 119424 gene locus_tag LOCUS_08510 gene cysK 118459 119424 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32978 protein_id gnl|my_center|LOCUS_08510 122722 119480 gene locus_tag LOCUS_08520 gene glnE 122722 119480 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPN2 protein_id gnl|my_center|LOCUS_08520 124038 122806 gene locus_tag LOCUS_08530 gene deaD 124038 122806 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121346.1 protein_id gnl|my_center|LOCUS_08530 124337 125932 gene locus_tag LOCUS_08540 124337 125932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121549.1 protein_id gnl|my_center|LOCUS_08540 126092 126538 gene locus_tag LOCUS_08550 126092 126538 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_08550 126910 127173 gene locus_tag LOCUS_08560 126910 127173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 127205 129457 gene locus_tag LOCUS_08570 gene feoB 127205 129457 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_08570 129467 129673 gene locus_tag LOCUS_08580 129467 129673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 130578 129751 gene locus_tag LOCUS_08590 130578 129751 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_08590 130772 131635 gene locus_tag LOCUS_08600 130772 131635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 133617 132550 gene locus_tag LOCUS_08610 133617 132550 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330020.1 protein_id gnl|my_center|LOCUS_08610 135018 133882 gene locus_tag LOCUS_08620 gene dgt 135018 133882 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU12 protein_id gnl|my_center|LOCUS_08620 136151 135135 gene locus_tag LOCUS_08630 gene fba 136151 135135 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_867402.2 protein_id gnl|my_center|LOCUS_08630 137562 136639 gene locus_tag LOCUS_08640 137562 136639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 138294 137812 gene locus_tag LOCUS_08650 138294 137812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 140007 138556 gene locus_tag LOCUS_08660 140007 138556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_08660 142598 140079 gene locus_tag LOCUS_08670 142598 140079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_08670 143955 143065 gene locus_tag LOCUS_08680 143955 143065 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120889.1 protein_id gnl|my_center|LOCUS_08680 145788 144223 gene locus_tag LOCUS_08690 145788 144223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 146190 149525 gene locus_tag LOCUS_08700 146190 149525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 149954 151810 gene locus_tag LOCUS_08710 149954 151810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 151807 152583 gene locus_tag LOCUS_08720 151807 152583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_08720 152638 153978 gene locus_tag LOCUS_08730 152638 153978 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_08730 154450 155703 gene locus_tag LOCUS_08740 gene argH 154450 155703 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK64 protein_id gnl|my_center|LOCUS_08740 156059 158260 gene locus_tag LOCUS_08750 156059 158260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence008 1945 644 gene locus_tag LOCUS_08760 gene purD 1945 644 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPZ8 protein_id gnl|my_center|LOCUS_08760 2156 2959 gene locus_tag LOCUS_08770 2156 2959 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_08770 3155 3322 gene locus_tag LOCUS_08780 3155 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3521 4804 gene locus_tag LOCUS_08790 gene pbrT 3521 4804 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122077.1 protein_id gnl|my_center|LOCUS_08790 4804 5697 gene locus_tag LOCUS_08800 4804 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5727 7466 gene locus_tag LOCUS_08810 gene ctaD 5727 7466 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM0 protein_id gnl|my_center|LOCUS_08810 7522 8442 gene locus_tag LOCUS_08820 gene ctaB 7522 8442 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJF4 protein_id gnl|my_center|LOCUS_08820 8509 9786 gene locus_tag LOCUS_08830 8509 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 9791 10195 gene locus_tag LOCUS_08840 9791 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 10222 11484 gene locus_tag LOCUS_08850 10222 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 11481 12047 gene locus_tag LOCUS_08860 11481 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 12076 12384 gene locus_tag LOCUS_08870 12076 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 13327 12461 gene locus_tag LOCUS_08880 13327 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 13998 13537 gene locus_tag LOCUS_08890 13998 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 14403 14936 gene locus_tag LOCUS_08900 14403 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123400.1 protein_id gnl|my_center|LOCUS_08900 14971 16857 gene locus_tag LOCUS_08910 14971 16857 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_08910 17102 18106 gene locus_tag LOCUS_08920 17102 18106 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121269.1 protein_id gnl|my_center|LOCUS_08920 18911 18159 gene locus_tag LOCUS_08930 18911 18159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 19680 18904 gene locus_tag LOCUS_08940 gene fliR 19680 18904 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35537 protein_id gnl|my_center|LOCUS_08940 20213 19683 gene locus_tag LOCUS_08950 20213 19683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 21273 20302 gene locus_tag LOCUS_08960 gene fliP 21273 20302 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXG5 protein_id gnl|my_center|LOCUS_08960 22108 21380 gene locus_tag LOCUS_08970 22108 21380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 24029 22515 gene locus_tag LOCUS_08980 24029 22515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 24604 24080 gene locus_tag LOCUS_08990 24604 24080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 25592 24855 gene locus_tag LOCUS_09000 25592 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 26840 25863 gene locus_tag LOCUS_09010 gene mdh 26840 25863 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_09010 28563 27136 gene locus_tag LOCUS_09020 28563 27136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 30058 28556 gene locus_tag LOCUS_09030 30058 28556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 30563 33661 gene locus_tag LOCUS_09040 30563 33661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 33734 34798 gene locus_tag LOCUS_09050 33734 34798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 34904 35755 gene locus_tag LOCUS_09060 gene tolQ 34904 35755 CDS product tolQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119635.1 protein_id gnl|my_center|LOCUS_09060 35788 36234 gene locus_tag LOCUS_09070 35788 36234 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_09070 36244 36738 gene locus_tag LOCUS_09080 36244 36738 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119636.1 protein_id gnl|my_center|LOCUS_09080 36905 37855 gene locus_tag LOCUS_09090 gene xerC 36905 37855 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQK2 protein_id gnl|my_center|LOCUS_09090 38820 37930 gene locus_tag LOCUS_09100 gene prmC 38820 37930 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_09100 39947 38874 gene locus_tag LOCUS_09110 gene prfA 39947 38874 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT3 protein_id gnl|my_center|LOCUS_09110 41109 40204 gene locus_tag LOCUS_09120 41109 40204 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122268.1 protein_id gnl|my_center|LOCUS_09120 41312 42451 gene locus_tag LOCUS_09130 gene aroC 41312 42451 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL4 protein_id gnl|my_center|LOCUS_09130 42429 42740 gene locus_tag LOCUS_09140 42429 42740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 42724 43680 gene locus_tag LOCUS_09150 42724 43680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 46704 43714 gene locus_tag LOCUS_09160 46704 43714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09160 47607 46705 gene locus_tag LOCUS_09170 47607 46705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09170 48551 47658 gene locus_tag LOCUS_09180 48551 47658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 50568 49222 gene locus_tag LOCUS_09190 gene fahA 50568 49222 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808480.1 protein_id gnl|my_center|LOCUS_09190 51585 50611 gene locus_tag LOCUS_09200 51585 50611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405079.1 protein_id gnl|my_center|LOCUS_09200 51791 51582 gene locus_tag LOCUS_09210 51791 51582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 52946 51810 gene locus_tag LOCUS_09220 52946 51810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 54166 53420 gene locus_tag LOCUS_09230 54166 53420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 55238 54378 gene locus_tag LOCUS_09240 55238 54378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120864.1 protein_id gnl|my_center|LOCUS_09240 56393 55374 gene locus_tag LOCUS_09250 56393 55374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120248.1 protein_id gnl|my_center|LOCUS_09250 56680 57171 gene locus_tag LOCUS_09260 gene ispF 56680 57171 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU80 protein_id gnl|my_center|LOCUS_09260 57175 57684 gene locus_tag LOCUS_09270 gene ruvC 57175 57684 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US71 protein_id gnl|my_center|LOCUS_09270 57709 58350 gene locus_tag LOCUS_09280 gene ruvA 57709 58350 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USB0 protein_id gnl|my_center|LOCUS_09280 58827 58504 gene locus_tag LOCUS_09290 58827 58504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 61507 59183 gene locus_tag LOCUS_09300 61507 59183 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119225.1 protein_id gnl|my_center|LOCUS_09300 63380 61578 gene locus_tag LOCUS_09310 63380 61578 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_09310 64578 63778 gene locus_tag LOCUS_09320 64578 63778 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_09320 65466 64681 gene locus_tag LOCUS_09330 65466 64681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 65829 66887 gene locus_tag LOCUS_09340 65829 66887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 66973 68547 gene locus_tag LOCUS_09350 66973 68547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 68654 69202 gene locus_tag LOCUS_09360 68654 69202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 70746 69262 gene locus_tag LOCUS_09370 70746 69262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 72956 70890 gene locus_tag LOCUS_09380 72956 70890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 73544 73020 gene locus_tag LOCUS_09390 73544 73020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 74816 73611 gene locus_tag LOCUS_09400 74816 73611 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456304.1 protein_id gnl|my_center|LOCUS_09400 76326 74821 gene locus_tag LOCUS_09410 76326 74821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460289.1 protein_id gnl|my_center|LOCUS_09410 77470 76337 gene locus_tag LOCUS_09420 77470 76337 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_09420 78139 77525 gene locus_tag LOCUS_09430 78139 77525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 79542 78256 gene locus_tag LOCUS_09440 79542 78256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 80521 79706 gene locus_tag LOCUS_09450 80521 79706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 81387 80677 gene locus_tag LOCUS_09460 81387 80677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 82136 81420 gene locus_tag LOCUS_09470 82136 81420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 84398 82536 gene locus_tag LOCUS_09480 84398 82536 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59825 protein_id gnl|my_center|LOCUS_09480 85796 84660 gene locus_tag LOCUS_09490 gene fixW 85796 84660 CDS product redoxin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327198.1 protein_id gnl|my_center|LOCUS_09490 86243 87526 gene locus_tag LOCUS_09500 86243 87526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_09500 87858 88214 gene locus_tag LOCUS_09510 87858 88214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706767.1 protein_id gnl|my_center|LOCUS_09510 88664 88263 gene locus_tag LOCUS_09520 88664 88263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 protein_id gnl|my_center|LOCUS_09520 89493 88687 gene locus_tag LOCUS_09530 gene dapB 89493 88687 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJD7 protein_id gnl|my_center|LOCUS_09530 89896 90276 gene locus_tag LOCUS_09540 89896 90276 CDS product conjugal transfer protein TraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679887.1 protein_id gnl|my_center|LOCUS_09540 90395 90910 gene locus_tag LOCUS_09550 90395 90910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 90962 91777 gene locus_tag LOCUS_09560 90962 91777 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118358.1 protein_id gnl|my_center|LOCUS_09560 93066 91813 gene locus_tag LOCUS_09570 93066 91813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 93595 95049 gene locus_tag LOCUS_09580 93595 95049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 96414 95131 gene locus_tag LOCUS_09590 96414 95131 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122884.1 protein_id gnl|my_center|LOCUS_09590 97339 96482 gene locus_tag LOCUS_09600 97339 96482 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_09600 98453 97419 gene locus_tag LOCUS_09610 98453 97419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123872.1 protein_id gnl|my_center|LOCUS_09610 99095 100615 gene locus_tag LOCUS_09620 gene tolQ 99095 100615 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_09620 100612 102237 gene locus_tag LOCUS_09630 100612 102237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 102234 103280 gene locus_tag LOCUS_09640 102234 103280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324693.1 protein_id gnl|my_center|LOCUS_09640 103471 103929 gene locus_tag LOCUS_09650 103471 103929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 104263 103976 gene locus_tag LOCUS_09660 104263 103976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 105713 104400 gene locus_tag LOCUS_09670 gene gatB 105713 104400 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK56 protein_id gnl|my_center|LOCUS_09670 107380 105908 gene locus_tag LOCUS_09680 gene gatA 107380 105908 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY4 protein_id gnl|my_center|LOCUS_09680 107726 107433 gene locus_tag LOCUS_09690 gene gatC 107726 107433 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DX0 protein_id gnl|my_center|LOCUS_09690 108175 107915 gene locus_tag LOCUS_09700 gene rpmB 108175 107915 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY96 protein_id gnl|my_center|LOCUS_09700 109557 108355 gene locus_tag LOCUS_09710 109557 108355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 109795 109520 gene locus_tag LOCUS_09720 109795 109520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 112189 113016 gene locus_tag LOCUS_09730 112189 113016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 113860 113042 gene locus_tag LOCUS_09740 113860 113042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 114804 113857 gene locus_tag LOCUS_09750 114804 113857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_09750 115878 114856 gene locus_tag LOCUS_09760 115878 114856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 116816 115878 gene locus_tag LOCUS_09770 116816 115878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_09770 117303 116980 gene locus_tag LOCUS_09780 117303 116980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_09780 118363 117533 gene locus_tag LOCUS_09790 118363 117533 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_09790 119295 118438 gene locus_tag LOCUS_09800 119295 118438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 120385 119780 gene locus_tag LOCUS_09810 gene sodA 120385 119780 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_09810 122213 120747 gene locus_tag LOCUS_09820 122213 120747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 122442 123314 gene locus_tag LOCUS_09830 122442 123314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 123460 124719 gene locus_tag LOCUS_09840 123460 124719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 124832 126466 gene locus_tag LOCUS_09850 gene gltX 124832 126466 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNF9 protein_id gnl|my_center|LOCUS_09850 127211 126513 gene locus_tag LOCUS_09860 gene pepE 127211 126513 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RZ5 protein_id gnl|my_center|LOCUS_09860 127471 129165 gene locus_tag LOCUS_09870 gene glnS 127471 129165 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_09870 129253 130203 gene locus_tag LOCUS_09880 129253 130203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 130233 130973 gene locus_tag LOCUS_09890 130233 130973 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence009 1002 778 gene locus_tag LOCUS_09900 1002 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1418 1879 gene locus_tag LOCUS_09910 1418 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2256 5021 gene locus_tag LOCUS_09920 2256 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5164 7089 gene locus_tag LOCUS_09930 5164 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 8638 7232 gene locus_tag LOCUS_09940 8638 7232 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_09940 8904 11297 gene locus_tag LOCUS_09950 8904 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 11638 12657 gene locus_tag LOCUS_09960 11638 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 13447 12680 gene locus_tag LOCUS_09970 gene queC 13447 12680 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UN9 protein_id gnl|my_center|LOCUS_09970 13809 14825 gene locus_tag LOCUS_09980 13809 14825 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331323.1 protein_id gnl|my_center|LOCUS_09980 14818 16428 gene locus_tag LOCUS_09990 gene comM 14818 16428 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_09990 16677 18146 gene locus_tag LOCUS_10000 16677 18146 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122540.1 protein_id gnl|my_center|LOCUS_10000 19330 18149 gene locus_tag LOCUS_10010 19330 18149 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879120.1 protein_id gnl|my_center|LOCUS_10010 20370 19327 gene locus_tag LOCUS_10020 20370 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090930.1 protein_id gnl|my_center|LOCUS_10020 20453 20605 gene locus_tag LOCUS_10030 20453 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 21108 22385 gene locus_tag LOCUS_10040 21108 22385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 23335 24054 gene locus_tag LOCUS_10050 23335 24054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 24562 24047 gene locus_tag LOCUS_10060 24562 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 25289 24609 gene locus_tag LOCUS_10070 25289 24609 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_10070 25976 25536 gene locus_tag LOCUS_10080 25976 25536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 26501 27544 gene locus_tag LOCUS_10090 26501 27544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 32028 28252 gene locus_tag LOCUS_10100 32028 28252 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119226.1 protein_id gnl|my_center|LOCUS_10100 33779 32286 gene locus_tag LOCUS_10110 33779 32286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 35465 33936 gene locus_tag LOCUS_10120 35465 33936 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124008.1 protein_id gnl|my_center|LOCUS_10120 36131 35469 gene locus_tag LOCUS_10130 36131 35469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 37163 36171 gene locus_tag LOCUS_10140 37163 36171 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124010.1 protein_id gnl|my_center|LOCUS_10140 39546 37108 gene locus_tag LOCUS_10150 39546 37108 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124011.1 protein_id gnl|my_center|LOCUS_10150 40672 39536 gene locus_tag LOCUS_10160 40672 39536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 41395 41607 gene locus_tag LOCUS_10170 41395 41607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 42683 41859 gene locus_tag LOCUS_10180 42683 41859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 43501 43833 gene locus_tag LOCUS_10190 gene groS2 43501 43833 CDS product 10 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ0 protein_id gnl|my_center|LOCUS_10190 43909 45528 gene locus_tag LOCUS_10200 gene groL3 43909 45528 CDS product 60 kDa chaperonin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY9 protein_id gnl|my_center|LOCUS_10200 45743 46627 gene locus_tag LOCUS_10210 45743 46627 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122002.1 protein_id gnl|my_center|LOCUS_10210 47122 47517 gene locus_tag LOCUS_10220 47122 47517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 51126 48064 gene locus_tag LOCUS_10230 51126 48064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 53517 51172 gene locus_tag LOCUS_10240 gene natB 53517 51172 CDS product sodium extrusion protein NatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120937.1 protein_id gnl|my_center|LOCUS_10240 54280 53525 gene locus_tag LOCUS_10250 54280 53525 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327800.1 protein_id gnl|my_center|LOCUS_10250 54494 57190 gene locus_tag LOCUS_10260 gene recQ 54494 57190 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122787.1 protein_id gnl|my_center|LOCUS_10260 57628 59811 gene locus_tag LOCUS_10270 gene ftsH1 57628 59811 CDS product ATP-dependent zinc metalloprotease FtsH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ7 protein_id gnl|my_center|LOCUS_10270 59994 60482 gene locus_tag LOCUS_10280 59994 60482 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL36 protein_id gnl|my_center|LOCUS_10280 61238 60540 gene locus_tag LOCUS_10290 61238 60540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 63456 61630 gene locus_tag LOCUS_10300 63456 61630 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_10300 64529 63453 gene locus_tag LOCUS_10310 64529 63453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 66671 64857 gene locus_tag LOCUS_10320 66671 64857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 68348 66759 gene locus_tag LOCUS_10330 68348 66759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 68994 71648 gene locus_tag LOCUS_10340 68994 71648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 71804 72217 gene locus_tag LOCUS_10350 71804 72217 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_10350 73532 72414 gene locus_tag LOCUS_10360 gene moeB 73532 72414 CDS product thiamine/molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840950.1 protein_id gnl|my_center|LOCUS_10360 76082 73611 gene locus_tag LOCUS_10370 gene uvrA1 76082 73611 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKV1 protein_id gnl|my_center|LOCUS_10370 77275 76259 gene locus_tag LOCUS_10380 77275 76259 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_10380 77569 79197 gene locus_tag LOCUS_10390 77569 79197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 79329 79661 gene locus_tag LOCUS_10400 79329 79661 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_10400 79933 82287 gene locus_tag LOCUS_10410 79933 82287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 82987 84081 gene locus_tag LOCUS_10420 gene galM 82987 84081 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN4 protein_id gnl|my_center|LOCUS_10420 84337 85440 gene locus_tag LOCUS_10430 84337 85440 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 protein_id gnl|my_center|LOCUS_10430 85628 86092 gene locus_tag LOCUS_10440 gene accB 85628 86092 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121914.1 protein_id gnl|my_center|LOCUS_10440 86267 87604 gene locus_tag LOCUS_10450 gene accC 86267 87604 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_10450 88083 89387 gene locus_tag LOCUS_10460 gene pfkA 88083 89387 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121457.1 protein_id gnl|my_center|LOCUS_10460 90181 89537 gene locus_tag LOCUS_10470 90181 89537 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_10470 90315 91373 gene locus_tag LOCUS_10480 gene tdh 90315 91373 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07913 protein_id gnl|my_center|LOCUS_10480 91437 92612 gene locus_tag LOCUS_10490 gene kbl 91437 92612 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L232 protein_id gnl|my_center|LOCUS_10490 92649 93686 gene locus_tag LOCUS_10500 92649 93686 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_10500 93912 96008 gene locus_tag LOCUS_10510 gene flhA 93912 96008 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_10510 96497 97285 gene locus_tag LOCUS_10520 gene whiG 96497 97285 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFV6 protein_id gnl|my_center|LOCUS_10520 97621 97424 gene locus_tag LOCUS_10530 97621 97424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 98387 98656 gene locus_tag LOCUS_10540 98387 98656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 99253 100986 gene locus_tag LOCUS_10550 99253 100986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_10550 101458 102951 gene locus_tag LOCUS_10560 101458 102951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 104723 102975 gene locus_tag LOCUS_10570 104723 102975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120984.1 protein_id gnl|my_center|LOCUS_10570 105717 104890 gene locus_tag LOCUS_10580 gene kdsA 105717 104890 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ25 protein_id gnl|my_center|LOCUS_10580 106842 105925 gene locus_tag LOCUS_10590 106842 105925 CDS product protein BmrU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120987.1 protein_id gnl|my_center|LOCUS_10590 109185 107275 gene locus_tag LOCUS_10600 gene phoA 109185 107275 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120609.1 protein_id gnl|my_center|LOCUS_10600 109975 109106 gene locus_tag LOCUS_10610 109975 109106 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120581.1 protein_id gnl|my_center|LOCUS_10610 112508 109959 gene locus_tag LOCUS_10620 112508 109959 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120826.1 protein_id gnl|my_center|LOCUS_10620 114349 115914 gene locus_tag LOCUS_10630 114349 115914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 116017 117663 gene locus_tag LOCUS_10640 116017 117663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 117761 119176 gene locus_tag LOCUS_10650 117761 119176 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339602.1 protein_id gnl|my_center|LOCUS_10650 119279 120055 gene locus_tag LOCUS_10660 gene cobB2 119279 120055 CDS product NAD-dependent protein deacylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E1 protein_id gnl|my_center|LOCUS_10660 121223 120174 gene locus_tag LOCUS_10670 121223 120174 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709533.1 protein_id gnl|my_center|LOCUS_10670 <124598 121373 gene locus_tag LOCUS_10680 <124598 121373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706947.1:hemolysin >Feature sequence010 230 78 gene locus_tag LOCUS_10690 230 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 902 249 gene locus_tag LOCUS_10700 902 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3829 1466 gene locus_tag LOCUS_10710 3829 1466 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 protein_id gnl|my_center|LOCUS_10710 5089 3998 gene locus_tag LOCUS_10720 5089 3998 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143828.1 protein_id gnl|my_center|LOCUS_10720 8888 5286 gene locus_tag LOCUS_10730 8888 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10525 9242 gene locus_tag LOCUS_10740 gene tyrS 10525 9242 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM14 protein_id gnl|my_center|LOCUS_10740 11005 11766 gene locus_tag LOCUS_10750 11005 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 11763 13166 gene locus_tag LOCUS_10760 11763 13166 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226191.1 protein_id gnl|my_center|LOCUS_10760 13163 13984 gene locus_tag LOCUS_10770 13163 13984 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_10770 14233 16017 gene locus_tag LOCUS_10780 gene ask 14233 16017 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_10780 17157 16126 gene locus_tag LOCUS_10790 17157 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 17517 18563 gene locus_tag LOCUS_10800 17517 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 20045 18729 gene locus_tag LOCUS_10810 gene aceF 20045 18729 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU97 protein_id gnl|my_center|LOCUS_10810 22853 20112 gene locus_tag LOCUS_10820 22853 20112 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU96 protein_id gnl|my_center|LOCUS_10820 23636 25201 gene locus_tag LOCUS_10830 23636 25201 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405548.1 protein_id gnl|my_center|LOCUS_10830 26223 25366 gene locus_tag LOCUS_10840 26223 25366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 27082 27702 gene locus_tag LOCUS_10850 gene tmk 27082 27702 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIM1 protein_id gnl|my_center|LOCUS_10850 27752 28846 gene locus_tag LOCUS_10860 gene holB 27752 28846 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 protein_id gnl|my_center|LOCUS_10860 30020 28884 gene locus_tag LOCUS_10870 30020 28884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 31915 30353 gene locus_tag LOCUS_10880 31915 30353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 33055 32231 gene locus_tag LOCUS_10890 gene map 33055 32231 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU68 protein_id gnl|my_center|LOCUS_10890 33366 36203 gene locus_tag LOCUS_10900 gene leuS 33366 36203 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMC0 protein_id gnl|my_center|LOCUS_10900 36261 37373 gene locus_tag LOCUS_10910 gene mutY 36261 37373 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_10910 38214 37438 gene locus_tag LOCUS_10920 38214 37438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 39296 38493 gene locus_tag LOCUS_10930 gene trpC 39296 38493 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ7 protein_id gnl|my_center|LOCUS_10930 39713 40336 gene locus_tag LOCUS_10940 39713 40336 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGM3 protein_id gnl|my_center|LOCUS_10940 40713 40393 gene locus_tag LOCUS_10950 40713 40393 CDS product nuclear scaffold-like protein p76 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333113.1 protein_id gnl|my_center|LOCUS_10950 43740 40999 gene locus_tag LOCUS_10960 43740 40999 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_10960 44856 45041 gene locus_tag LOCUS_10970 44856 45041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 46408 45038 gene locus_tag LOCUS_10980 46408 45038 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122935.1 protein_id gnl|my_center|LOCUS_10980 46566 47507 gene locus_tag LOCUS_10990 46566 47507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 47504 48721 gene locus_tag LOCUS_11000 47504 48721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_11000 49016 50413 gene locus_tag LOCUS_11010 gene argD 49016 50413 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121945.1 protein_id gnl|my_center|LOCUS_11010 50509 51534 gene locus_tag LOCUS_11020 gene astA 50509 51534 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZR0 protein_id gnl|my_center|LOCUS_11020 51594 53063 gene locus_tag LOCUS_11030 gene astD 51594 53063 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50174 protein_id gnl|my_center|LOCUS_11030 53083 54345 gene locus_tag LOCUS_11040 53083 54345 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879422.1 protein_id gnl|my_center|LOCUS_11040 55617 54352 gene locus_tag LOCUS_11050 55617 54352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_11050 56712 55693 gene locus_tag LOCUS_11060 56712 55693 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_11060 57850 56822 gene locus_tag LOCUS_11070 57850 56822 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814134.1 protein_id gnl|my_center|LOCUS_11070 59117 57984 gene locus_tag LOCUS_11080 gene yjjN 59117 57984 CDS product L-galactonate-5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106030.1 protein_id gnl|my_center|LOCUS_11080 59414 60391 gene locus_tag LOCUS_11090 59414 60391 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117796.1 protein_id gnl|my_center|LOCUS_11090 60460 61302 gene locus_tag LOCUS_11100 60460 61302 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083944.1 protein_id gnl|my_center|LOCUS_11100 61549 62106 gene locus_tag LOCUS_11110 61549 62106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 62096 63805 gene locus_tag LOCUS_11120 62096 63805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120249.1 protein_id gnl|my_center|LOCUS_11120 65292 63844 gene locus_tag LOCUS_11130 65292 63844 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_11130 68995 65300 gene locus_tag LOCUS_11140 68995 65300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_11140 69639 69181 gene locus_tag LOCUS_11150 69639 69181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 70606 69947 gene locus_tag LOCUS_11160 70606 69947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328057.1 protein_id gnl|my_center|LOCUS_11160 71854 70703 gene locus_tag LOCUS_11170 71854 70703 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_11170 73018 71996 gene locus_tag LOCUS_11180 73018 71996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_11180 74352 73108 gene locus_tag LOCUS_11190 74352 73108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_11190 74571 75614 gene locus_tag LOCUS_11200 74571 75614 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118418.1 protein_id gnl|my_center|LOCUS_11200 76989 75676 gene locus_tag LOCUS_11210 gene pyrC 76989 75676 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFD0 protein_id gnl|my_center|LOCUS_11210 77185 79650 gene locus_tag LOCUS_11220 77185 79650 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_11220 81042 79672 gene locus_tag LOCUS_11230 81042 79672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121069.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11230 81266 83257 gene locus_tag LOCUS_11240 gene nolO 81266 83257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887298.1 protein_id gnl|my_center|LOCUS_11240 83525 84166 gene locus_tag LOCUS_11250 83525 84166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 84457 84891 gene locus_tag LOCUS_11260 84457 84891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 85883 85005 gene locus_tag LOCUS_11270 gene sucD 85883 85005 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_11270 87172 85988 gene locus_tag LOCUS_11280 gene sucC 87172 85988 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI3 protein_id gnl|my_center|LOCUS_11280 87406 88458 gene locus_tag LOCUS_11290 87406 88458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 89018 88590 gene locus_tag LOCUS_11300 89018 88590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 90143 89157 gene locus_tag LOCUS_11310 90143 89157 CDS product adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733831.1 protein_id gnl|my_center|LOCUS_11310 92634 90175 gene locus_tag LOCUS_11320 92634 90175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 94104 92914 gene locus_tag LOCUS_11330 94104 92914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 94814 94101 gene locus_tag LOCUS_11340 gene salX 94814 94101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942282.1 protein_id gnl|my_center|LOCUS_11340 95230 94814 gene locus_tag LOCUS_11350 95230 94814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 96025 96348 gene locus_tag LOCUS_11360 gene rpsJ 96025 96348 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN22 protein_id gnl|my_center|LOCUS_11360 96476 97192 gene locus_tag LOCUS_11370 gene rplC 96476 97192 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN20 protein_id gnl|my_center|LOCUS_11370 97206 97856 gene locus_tag LOCUS_11380 gene rplD 97206 97856 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN19 protein_id gnl|my_center|LOCUS_11380 97863 98198 gene locus_tag LOCUS_11390 gene rplW 97863 98198 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN18 protein_id gnl|my_center|LOCUS_11390 98294 99151 gene locus_tag LOCUS_11400 gene rplB 98294 99151 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN17 protein_id gnl|my_center|LOCUS_11400 99224 99493 gene locus_tag LOCUS_11410 gene rpsS 99224 99493 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN16 protein_id gnl|my_center|LOCUS_11410 99566 99913 gene locus_tag LOCUS_11420 gene rplV 99566 99913 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN15 protein_id gnl|my_center|LOCUS_11420 99952 100659 gene locus_tag LOCUS_11430 gene rpsC 99952 100659 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN14 protein_id gnl|my_center|LOCUS_11430 100598 101014 gene locus_tag LOCUS_11440 gene rplP 100598 101014 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN13 protein_id gnl|my_center|LOCUS_11440 101113 101337 gene locus_tag LOCUS_11450 gene rpmC 101113 101337 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN12 protein_id gnl|my_center|LOCUS_11450 101400 101762 gene locus_tag LOCUS_11460 gene rpsQ 101400 101762 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN11 protein_id gnl|my_center|LOCUS_11460 101821 102189 gene locus_tag LOCUS_11470 gene rplN 101821 102189 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN10 protein_id gnl|my_center|LOCUS_11470 102269 102823 gene locus_tag LOCUS_11480 gene rplE 102269 102823 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN08 protein_id gnl|my_center|LOCUS_11480 103139 103534 gene locus_tag LOCUS_11490 gene rpsH 103139 103534 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN06 protein_id gnl|my_center|LOCUS_11490 103658 104194 gene locus_tag LOCUS_11500 gene rplF 103658 104194 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN05 protein_id gnl|my_center|LOCUS_11500 104245 104643 gene locus_tag LOCUS_11510 gene rplR 104245 104643 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN04 protein_id gnl|my_center|LOCUS_11510 104798 105310 gene locus_tag LOCUS_11520 gene rpsE 104798 105310 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN03 protein_id gnl|my_center|LOCUS_11520 105307 105801 gene locus_tag LOCUS_11530 gene rplO 105307 105801 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN02 protein_id gnl|my_center|LOCUS_11530 105883 107259 gene locus_tag LOCUS_11540 gene secY 105883 107259 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN01 protein_id gnl|my_center|LOCUS_11540 108742 107963 gene locus_tag LOCUS_11550 108742 107963 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118949.1 protein_id gnl|my_center|LOCUS_11550 109256 108792 gene locus_tag LOCUS_11560 109256 108792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 109804 110013 gene locus_tag LOCUS_11570 gene csrA 109804 110013 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_11570 110289 110362 gene locus_tag LOCUS_t00110 110289 110362 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 110448 111416 gene locus_tag LOCUS_11580 110448 111416 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119033.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence011 1644 160 gene locus_tag LOCUS_11590 1644 160 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_11590 3182 1641 gene locus_tag LOCUS_11600 3182 1641 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123732.1 protein_id gnl|my_center|LOCUS_11600 3585 4580 gene locus_tag LOCUS_11610 3585 4580 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_11610 4580 6361 gene locus_tag LOCUS_11620 4580 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6732 8129 gene locus_tag LOCUS_11630 6732 8129 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_11630 9594 8272 gene locus_tag LOCUS_11640 9594 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 11424 9892 gene locus_tag LOCUS_11650 11424 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 11664 12170 gene locus_tag LOCUS_11660 11664 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 14785 12947 gene locus_tag LOCUS_11670 14785 12947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_11670 14971 15180 gene locus_tag LOCUS_11680 14971 15180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 15492 15704 gene locus_tag LOCUS_11690 15492 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 15761 16141 gene locus_tag LOCUS_11700 15761 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 16237 16608 gene locus_tag LOCUS_11710 16237 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_11710 16690 16923 gene locus_tag LOCUS_11720 16690 16923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 16981 17466 gene locus_tag LOCUS_11730 16981 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 17710 17516 gene locus_tag LOCUS_11740 17710 17516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 19036 18077 gene locus_tag LOCUS_11750 19036 18077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 20918 19845 gene locus_tag LOCUS_11760 gene rsmH 20918 19845 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK87 protein_id gnl|my_center|LOCUS_11760 21326 22150 gene locus_tag LOCUS_11770 gene rrmA 21326 22150 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123419.1 protein_id gnl|my_center|LOCUS_11770 22345 22160 gene locus_tag LOCUS_11780 22345 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 23094 22486 gene locus_tag LOCUS_11790 23094 22486 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121675.1 protein_id gnl|my_center|LOCUS_11790 23241 24941 gene locus_tag LOCUS_11800 23241 24941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 26880 28136 gene locus_tag LOCUS_11810 26880 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 28450 29301 gene locus_tag LOCUS_11820 28450 29301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 29334 29260 gene locus_tag LOCUS_t00120 29334 29260 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30203 29403 gene locus_tag LOCUS_11830 30203 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 30684 30430 gene locus_tag LOCUS_11840 30684 30430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 32502 30928 gene locus_tag LOCUS_11850 gene murG 32502 30928 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120938.1 protein_id gnl|my_center|LOCUS_11850 35334 32605 gene locus_tag LOCUS_11860 35334 32605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 36263 35760 gene locus_tag LOCUS_11870 36263 35760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 36697 37110 gene locus_tag LOCUS_11880 36697 37110 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120691.1 protein_id gnl|my_center|LOCUS_11880 37436 37221 gene locus_tag LOCUS_11890 gene csrA 37436 37221 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_11890 38241 37801 gene locus_tag LOCUS_11900 gene fliW 38241 37801 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URF1 protein_id gnl|my_center|LOCUS_11900 38497 40377 gene locus_tag LOCUS_11910 38497 40377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 40853 40937 gene locus_tag LOCUS_t00130 40853 40937 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41840 41052 gene locus_tag LOCUS_11920 41840 41052 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_11920 43174 41957 gene locus_tag LOCUS_11930 43174 41957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 44853 43471 gene locus_tag LOCUS_11940 44853 43471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 46411 45287 gene locus_tag LOCUS_11950 46411 45287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 49224 46603 gene locus_tag LOCUS_11960 49224 46603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 50936 49422 gene locus_tag LOCUS_11970 50936 49422 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_11970 53342 51132 gene locus_tag LOCUS_11980 53342 51132 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_11980 53528 54244 gene locus_tag LOCUS_11990 gene lutA 53528 54244 CDS product lactate utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07020 protein_id gnl|my_center|LOCUS_11990 54241 55647 gene locus_tag LOCUS_12000 gene lutB 54241 55647 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07021 protein_id gnl|my_center|LOCUS_12000 55644 56354 gene locus_tag LOCUS_12010 55644 56354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256718.1 protein_id gnl|my_center|LOCUS_12010 56442 57707 gene locus_tag LOCUS_12020 56442 57707 CDS product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 protein_id gnl|my_center|LOCUS_12020 59177 57753 gene locus_tag LOCUS_12030 gene acrA1 59177 57753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122386.1 protein_id gnl|my_center|LOCUS_12030 59530 60777 gene locus_tag LOCUS_12040 59530 60777 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121268.1 protein_id gnl|my_center|LOCUS_12040 61765 60830 gene locus_tag LOCUS_12050 gene ispH 61765 60830 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_12050 62288 63049 gene locus_tag LOCUS_12060 62288 63049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 64978 63092 gene locus_tag LOCUS_12070 64978 63092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143991.1 protein_id gnl|my_center|LOCUS_12070 66510 65251 gene locus_tag LOCUS_12080 gene gdhA 66510 65251 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPH7 protein_id gnl|my_center|LOCUS_12080 66776 69790 gene locus_tag LOCUS_12090 66776 69790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 70129 72435 gene locus_tag LOCUS_12100 70129 72435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 74150 72468 gene locus_tag LOCUS_12110 74150 72468 CDS product protein fwdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_12110 74591 74295 gene locus_tag LOCUS_12120 74591 74295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 74879 76231 gene locus_tag LOCUS_12130 74879 76231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 76442 78241 gene locus_tag LOCUS_12140 76442 78241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 79251 78364 gene locus_tag LOCUS_12150 79251 78364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_12150 79625 80878 gene locus_tag LOCUS_12160 gene gcvT 79625 80878 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNG8 protein_id gnl|my_center|LOCUS_12160 80961 81353 gene locus_tag LOCUS_12170 gene gcvH 80961 81353 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNG9 protein_id gnl|my_center|LOCUS_12170 81616 84516 gene locus_tag LOCUS_12180 gene gcvP 81616 84516 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZM3 protein_id gnl|my_center|LOCUS_12180 84572 85369 gene locus_tag LOCUS_12190 gene lplA 84572 85369 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 protein_id gnl|my_center|LOCUS_12190 85612 86271 gene locus_tag LOCUS_12200 85612 86271 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325534.1 protein_id gnl|my_center|LOCUS_12200 86513 87061 gene locus_tag LOCUS_12210 gene sigW 86513 87061 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118528.1 protein_id gnl|my_center|LOCUS_12210 87048 87770 gene locus_tag LOCUS_12220 87048 87770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 87971 88747 gene locus_tag LOCUS_12230 87971 88747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 89311 90414 gene locus_tag LOCUS_12240 gene serC 89311 90414 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQL3 protein_id gnl|my_center|LOCUS_12240 90432 92108 gene locus_tag LOCUS_12250 gene serA 90432 92108 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQL2 protein_id gnl|my_center|LOCUS_12250 92226 93665 gene locus_tag LOCUS_12260 92226 93665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 94858 93824 gene locus_tag LOCUS_12270 94858 93824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 97830 94957 gene locus_tag LOCUS_12280 gene alaS 97830 94957 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFH9 protein_id gnl|my_center|LOCUS_12280 99113 97965 gene locus_tag LOCUS_12290 99113 97965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 100751 99453 gene locus_tag LOCUS_12300 gene recA 100751 99453 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJJ0 protein_id gnl|my_center|LOCUS_12300 102834 101044 gene locus_tag LOCUS_12310 gene ptfA 102834 101044 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336551.1 protein_id gnl|my_center|LOCUS_12310 103597 103025 gene locus_tag LOCUS_12320 103597 103025 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Z9 protein_id gnl|my_center|LOCUS_12320 >Feature sequence012 116 625 gene locus_tag LOCUS_12330 116 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 721 1389 gene locus_tag LOCUS_12340 721 1389 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082950.1 protein_id gnl|my_center|LOCUS_12340 1753 2559 gene locus_tag LOCUS_12350 1753 2559 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_12350 2624 5569 gene locus_tag LOCUS_12360 2624 5569 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118284.1 protein_id gnl|my_center|LOCUS_12360 5635 7047 gene locus_tag LOCUS_12370 5635 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 7659 7090 gene locus_tag LOCUS_12380 7659 7090 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_12380 8112 8519 gene locus_tag LOCUS_12390 8112 8519 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095862.1 protein_id gnl|my_center|LOCUS_12390 10039 8582 gene locus_tag LOCUS_12400 10039 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 12059 10110 gene locus_tag LOCUS_12410 12059 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 12398 13147 gene locus_tag LOCUS_12420 12398 13147 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224946.1 protein_id gnl|my_center|LOCUS_12420 13140 14486 gene locus_tag LOCUS_12430 gene astB 13140 14486 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LN4 protein_id gnl|my_center|LOCUS_12430 14591 14890 gene locus_tag LOCUS_12440 14591 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_12440 14887 16668 gene locus_tag LOCUS_12450 14887 16668 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_12450 18279 16738 gene locus_tag LOCUS_12460 18279 16738 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_12460 18966 20039 gene locus_tag LOCUS_12470 18966 20039 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_12470 20365 21405 gene locus_tag LOCUS_12480 20365 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 21613 22404 gene locus_tag LOCUS_12490 21613 22404 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121590.1 protein_id gnl|my_center|LOCUS_12490 22564 22731 gene locus_tag LOCUS_12500 22564 22731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 23239 22889 gene locus_tag LOCUS_12510 23239 22889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_12510 24548 23283 gene locus_tag LOCUS_12520 24548 23283 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_12520 25669 24545 gene locus_tag LOCUS_12530 gene ftsA 25669 24545 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_12530 25708 26007 gene locus_tag LOCUS_12540 25708 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 26018 26653 gene locus_tag LOCUS_12550 26018 26653 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_12550 27491 27874 gene locus_tag LOCUS_12560 gene rpsM 27491 27874 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC7 protein_id gnl|my_center|LOCUS_12560 28011 28391 gene locus_tag LOCUS_12570 gene rpsK 28011 28391 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC6 protein_id gnl|my_center|LOCUS_12570 28575 29564 gene locus_tag LOCUS_12580 gene rpoA 28575 29564 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC5 protein_id gnl|my_center|LOCUS_12580 29741 30385 gene locus_tag LOCUS_12590 gene rplQ 29741 30385 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC4 protein_id gnl|my_center|LOCUS_12590 30974 30480 gene locus_tag LOCUS_12600 30974 30480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 31234 37791 gene locus_tag LOCUS_12610 31234 37791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 39313 37946 gene locus_tag LOCUS_12620 gene GALNS 39313 37946 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121931.1 protein_id gnl|my_center|LOCUS_12620 40819 39401 gene locus_tag LOCUS_12630 40819 39401 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_12630 41669 41103 gene locus_tag LOCUS_12640 gene efp 41669 41103 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN7 protein_id gnl|my_center|LOCUS_12640 41768 42784 gene locus_tag LOCUS_12650 gene kamA 41768 42784 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118269.1 protein_id gnl|my_center|LOCUS_12650 43646 42858 gene locus_tag LOCUS_12660 43646 42858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 43778 44569 gene locus_tag LOCUS_12670 43778 44569 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDY5 protein_id gnl|my_center|LOCUS_12670 44778 45548 gene locus_tag LOCUS_12680 44778 45548 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_12680 45541 47202 gene locus_tag LOCUS_12690 45541 47202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_12690 48182 47229 gene locus_tag LOCUS_12700 48182 47229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118058.1 protein_id gnl|my_center|LOCUS_12700 49054 48248 gene locus_tag LOCUS_12710 49054 48248 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122962.1 protein_id gnl|my_center|LOCUS_12710 51202 49127 gene locus_tag LOCUS_12720 gene metG 51202 49127 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URP3 protein_id gnl|my_center|LOCUS_12720 51355 52488 gene locus_tag LOCUS_12730 51355 52488 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_12730 53905 52526 gene locus_tag LOCUS_12740 53905 52526 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119007.1 protein_id gnl|my_center|LOCUS_12740 55554 53923 gene locus_tag LOCUS_12750 55554 53923 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119006.1 protein_id gnl|my_center|LOCUS_12750 57228 55924 gene locus_tag LOCUS_12760 gene Pph1 57228 55924 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121826.1 protein_id gnl|my_center|LOCUS_12760 57572 58030 gene locus_tag LOCUS_12770 57572 58030 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122603.1 protein_id gnl|my_center|LOCUS_12770 58764 58090 gene locus_tag LOCUS_12780 gene yflK 58764 58090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34542 protein_id gnl|my_center|LOCUS_12780 60017 58761 gene locus_tag LOCUS_12790 60017 58761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 60920 60087 gene locus_tag LOCUS_12800 60920 60087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_12800 61788 60922 gene locus_tag LOCUS_12810 61788 60922 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121261.1 protein_id gnl|my_center|LOCUS_12810 62471 62271 gene locus_tag LOCUS_12820 62471 62271 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_12820 63030 64676 gene locus_tag LOCUS_12830 63030 64676 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_12830 67377 64777 gene locus_tag LOCUS_12840 gene clpC 67377 64777 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_12840 68116 67499 gene locus_tag LOCUS_12850 68116 67499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 68516 69613 gene locus_tag LOCUS_12860 gene thiE 68516 69613 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQH1 protein_id gnl|my_center|LOCUS_12860 69883 70515 gene locus_tag LOCUS_12870 69883 70515 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259683.1 protein_id gnl|my_center|LOCUS_12870 72080 70554 gene locus_tag LOCUS_12880 gene xylB 72080 70554 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964653.1 protein_id gnl|my_center|LOCUS_12880 72740 72192 gene locus_tag LOCUS_12890 gene fae 72740 72192 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 protein_id gnl|my_center|LOCUS_12890 72987 73586 gene locus_tag LOCUS_12900 72987 73586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 73600 74982 gene locus_tag LOCUS_12910 73600 74982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 75151 76002 gene locus_tag LOCUS_12920 75151 76002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 76106 76258 gene locus_tag LOCUS_12930 76106 76258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 76373 77629 gene locus_tag LOCUS_12940 gene lpxB 76373 77629 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119004.1 protein_id gnl|my_center|LOCUS_12940 77777 78559 gene locus_tag LOCUS_12950 77777 78559 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_12950 79621 79860 gene locus_tag LOCUS_12960 79621 79860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 81053 79974 gene locus_tag LOCUS_12970 81053 79974 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMF2 protein_id gnl|my_center|LOCUS_12970 81544 81116 gene locus_tag LOCUS_12980 81544 81116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 83001 81541 gene locus_tag LOCUS_12990 83001 81541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 83282 84292 gene locus_tag LOCUS_13000 gene ruvB 83282 84292 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPG4 protein_id gnl|my_center|LOCUS_13000 84486 85478 gene locus_tag LOCUS_13010 gene fabD 84486 85478 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY3 protein_id gnl|my_center|LOCUS_13010 85538 86299 gene locus_tag LOCUS_13020 gene fabG 85538 86299 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_13020 86510 86752 gene locus_tag LOCUS_13030 gene acpP 86510 86752 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY2 protein_id gnl|my_center|LOCUS_13030 87043 88287 gene locus_tag LOCUS_13040 gene fabF 87043 88287 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY0 protein_id gnl|my_center|LOCUS_13040 88677 88396 gene locus_tag LOCUS_13050 88677 88396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 90684 88894 gene locus_tag LOCUS_13060 90684 88894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 91658 90855 gene locus_tag LOCUS_13070 91658 90855 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119727.1 protein_id gnl|my_center|LOCUS_13070 93220 92087 gene locus_tag LOCUS_13080 93220 92087 CDS product Rho termination factor domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327172.1 protein_id gnl|my_center|LOCUS_13080 93786 94130 gene locus_tag LOCUS_13090 93786 94130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 94139 94543 gene locus_tag LOCUS_13100 94139 94543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 94605 95759 gene locus_tag LOCUS_13110 94605 95759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 95811 96125 gene locus_tag LOCUS_13120 95811 96125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 96333 96758 gene locus_tag LOCUS_13130 96333 96758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 96803 97423 gene locus_tag LOCUS_13140 gene atpH 96803 97423 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB8 protein_id gnl|my_center|LOCUS_13140 97523 99049 gene locus_tag LOCUS_13150 gene atpA2 97523 99049 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB7 protein_id gnl|my_center|LOCUS_13150 99271 100095 gene locus_tag LOCUS_13160 gene atpG 99271 100095 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_13160 100186 101613 gene locus_tag LOCUS_13170 gene atpD 100186 101613 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB5 protein_id gnl|my_center|LOCUS_13170 101723 102118 gene locus_tag LOCUS_13180 gene atpC 101723 102118 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB4 protein_id gnl|my_center|LOCUS_13180 >Feature sequence013 2867 3097 gene locus_tag LOCUS_13190 2867 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3419 3637 gene locus_tag LOCUS_13200 3419 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4260 3838 gene locus_tag LOCUS_13210 4260 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 5639 4701 gene locus_tag LOCUS_13220 5639 4701 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_13220 6111 6365 gene locus_tag LOCUS_13230 6111 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6796 7755 gene locus_tag LOCUS_13240 gene trpS 6796 7755 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA4 protein_id gnl|my_center|LOCUS_13240 7855 8256 gene locus_tag LOCUS_13250 gene acpS 7855 8256 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA5 protein_id gnl|my_center|LOCUS_13250 8462 9268 gene locus_tag LOCUS_13260 8462 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 9447 10466 gene locus_tag LOCUS_13270 gene glcK 9447 10466 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118462.1 protein_id gnl|my_center|LOCUS_13270 10541 12355 gene locus_tag LOCUS_13280 gene lepA1 10541 12355 CDS product elongation factor 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX15 protein_id gnl|my_center|LOCUS_13280 12599 13744 gene locus_tag LOCUS_13290 12599 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 13819 14286 gene locus_tag LOCUS_13300 13819 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13300 14625 15008 gene locus_tag LOCUS_13310 14625 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 16669 15005 gene locus_tag LOCUS_13320 16669 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 17399 16845 gene locus_tag LOCUS_13330 17399 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 17739 20285 gene locus_tag LOCUS_13340 17739 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 20495 21847 gene locus_tag LOCUS_13350 gene uvrC 20495 21847 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD6 protein_id gnl|my_center|LOCUS_13350 23708 22485 gene locus_tag LOCUS_13360 23708 22485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 24734 23799 gene locus_tag LOCUS_13370 24734 23799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 25269 25502 gene locus_tag LOCUS_13380 25269 25502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 25761 27173 gene locus_tag LOCUS_13390 25761 27173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 27457 28857 gene locus_tag LOCUS_13400 27457 28857 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_13400 29240 30121 gene locus_tag LOCUS_13410 gene mrsA 29240 30121 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 protein_id gnl|my_center|LOCUS_13410 30318 31499 gene locus_tag LOCUS_13420 30318 31499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 32598 31546 gene locus_tag LOCUS_13430 32598 31546 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122231.1 protein_id gnl|my_center|LOCUS_13430 32869 33069 gene locus_tag LOCUS_13440 32869 33069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 34972 33146 gene locus_tag LOCUS_13450 gene pmm 34972 33146 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_13450 35289 36641 gene locus_tag LOCUS_13460 35289 36641 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122491.1 protein_id gnl|my_center|LOCUS_13460 37867 36656 gene locus_tag LOCUS_13470 37867 36656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 38191 38637 gene locus_tag LOCUS_13480 38191 38637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 38953 40149 gene locus_tag LOCUS_13490 38953 40149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 40146 41726 gene locus_tag LOCUS_13500 gene cysA 40146 41726 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119278.1 protein_id gnl|my_center|LOCUS_13500 41775 41912 gene locus_tag LOCUS_13510 41775 41912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 42219 42446 gene locus_tag LOCUS_13520 42219 42446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 42462 42752 gene locus_tag LOCUS_13530 42462 42752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 44128 42884 gene locus_tag LOCUS_13540 44128 42884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_13540 45086 44292 gene locus_tag LOCUS_13550 45086 44292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 45397 46314 gene locus_tag LOCUS_13560 gene rarD 45397 46314 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120954.1 protein_id gnl|my_center|LOCUS_13560 48721 46343 gene locus_tag LOCUS_13570 48721 46343 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121151.1 protein_id gnl|my_center|LOCUS_13570 48968 50548 gene locus_tag LOCUS_13580 48968 50548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 50601 51662 gene locus_tag LOCUS_13590 50601 51662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 52823 51681 gene locus_tag LOCUS_13600 52823 51681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 54796 53189 gene locus_tag LOCUS_13610 54796 53189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 55350 54796 gene locus_tag LOCUS_13620 55350 54796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 57513 55726 gene locus_tag LOCUS_13630 57513 55726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 58040 60214 gene locus_tag LOCUS_13640 58040 60214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 60393 62039 gene locus_tag LOCUS_13650 60393 62039 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_13650 62345 65218 gene locus_tag LOCUS_13660 62345 65218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 65291 66700 gene locus_tag LOCUS_13670 65291 66700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 67006 67809 gene locus_tag LOCUS_13680 67006 67809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 69513 68038 gene locus_tag LOCUS_13690 69513 68038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_13690 74676 69547 gene locus_tag LOCUS_13700 74676 69547 CDS product vegetatible incompatibility protein HET-E-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118726.1 protein_id gnl|my_center|LOCUS_13700 75015 76235 gene locus_tag LOCUS_13710 75015 76235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 78501 76339 gene locus_tag LOCUS_13720 gene dcp 78501 76339 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121643.1 protein_id gnl|my_center|LOCUS_13720 81296 78927 gene locus_tag LOCUS_13730 81296 78927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence014 1443 832 gene locus_tag LOCUS_13740 1443 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1959 1615 gene locus_tag LOCUS_13750 1959 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3427 3594 gene locus_tag LOCUS_13760 3427 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4667 3720 gene locus_tag LOCUS_13770 4667 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121246.1 protein_id gnl|my_center|LOCUS_13770 5686 4667 gene locus_tag LOCUS_13780 5686 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332028.1 protein_id gnl|my_center|LOCUS_13780 7305 6616 gene locus_tag LOCUS_13790 7305 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 8986 8033 gene locus_tag LOCUS_13800 8986 8033 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N23 protein_id gnl|my_center|LOCUS_13800 9978 8983 gene locus_tag LOCUS_13810 9978 8983 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_13810 10530 11237 gene locus_tag LOCUS_13820 10530 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 11820 11545 gene locus_tag LOCUS_13830 11820 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 12142 13521 gene locus_tag LOCUS_13840 12142 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 13725 13967 gene locus_tag LOCUS_13850 13725 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 14127 14288 gene locus_tag LOCUS_13860 14127 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 14295 14642 gene locus_tag LOCUS_13870 14295 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 15194 16747 gene locus_tag LOCUS_13880 15194 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 17544 18374 gene locus_tag LOCUS_13890 17544 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 18477 18349 gene locus_tag LOCUS_13900 18477 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 18476 19672 gene locus_tag LOCUS_13910 18476 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_13910 20924 21178 gene locus_tag LOCUS_13920 20924 21178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 21147 22313 gene locus_tag LOCUS_13930 21147 22313 CDS product agarase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731459.1 protein_id gnl|my_center|LOCUS_13930 22390 22713 gene locus_tag LOCUS_13940 22390 22713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 23278 23439 gene locus_tag LOCUS_13950 23278 23439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 23839 23711 gene locus_tag LOCUS_13960 23839 23711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 25013 23970 gene locus_tag LOCUS_13970 25013 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 25150 25323 gene locus_tag LOCUS_13980 25150 25323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 25839 25342 gene locus_tag LOCUS_13990 25839 25342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 26250 25978 gene locus_tag LOCUS_14000 26250 25978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 26284 26619 gene locus_tag LOCUS_14010 26284 26619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 28122 27667 gene locus_tag LOCUS_14020 28122 27667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 28677 28249 gene locus_tag LOCUS_14030 28677 28249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 28816 31113 gene locus_tag LOCUS_14040 28816 31113 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_14040 31255 31527 gene locus_tag LOCUS_14050 31255 31527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 32515 32727 gene locus_tag LOCUS_14060 32515 32727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 32906 33352 gene locus_tag LOCUS_14070 32906 33352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 34798 33557 gene locus_tag LOCUS_14080 gene pksS 34798 33557 CDS product polyketide biosynthesis cytochrome P450 PksS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31785 protein_id gnl|my_center|LOCUS_14080 35382 34936 gene locus_tag LOCUS_14090 35382 34936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 35623 35399 gene locus_tag LOCUS_14100 35623 35399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 36519 35629 gene locus_tag LOCUS_14110 36519 35629 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_14110 38041 36890 gene locus_tag LOCUS_14120 38041 36890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 38872 42981 gene locus_tag LOCUS_14130 38872 42981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 42978 46076 gene locus_tag LOCUS_14140 42978 46076 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_14140 46079 47512 gene locus_tag LOCUS_14150 46079 47512 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121859.1 protein_id gnl|my_center|LOCUS_14150 47600 51022 gene locus_tag LOCUS_14160 47600 51022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 51150 52355 gene locus_tag LOCUS_14170 51150 52355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 52411 52668 gene locus_tag LOCUS_14180 52411 52668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 52620 52835 gene locus_tag LOCUS_14190 52620 52835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 52865 55426 gene locus_tag LOCUS_14200 52865 55426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 55423 59073 gene locus_tag LOCUS_14210 55423 59073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 59074 60414 gene locus_tag LOCUS_14220 59074 60414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_14220 60447 61862 gene locus_tag LOCUS_14230 60447 61862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_14230 61950 64925 gene locus_tag LOCUS_14240 61950 64925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 65934 66239 gene locus_tag LOCUS_14250 65934 66239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 66270 66470 gene locus_tag LOCUS_14260 66270 66470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 67241 68284 gene locus_tag LOCUS_14270 67241 68284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918091.1 protein_id gnl|my_center|LOCUS_14270 70534 68609 gene locus_tag LOCUS_14280 gene msaB 70534 68609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_14280 71696 71112 gene locus_tag LOCUS_14290 71696 71112 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_14290 71960 71748 gene locus_tag LOCUS_14300 71960 71748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 72979 72308 gene locus_tag LOCUS_14310 72979 72308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 75100 73898 gene locus_tag LOCUS_14320 75100 73898 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940254.1 protein_id gnl|my_center|LOCUS_14320 76188 75100 gene locus_tag LOCUS_14330 76188 75100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 76594 77646 gene locus_tag LOCUS_14340 gene purC 76594 77646 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J472 protein_id gnl|my_center|LOCUS_14340 77668 78003 gene locus_tag LOCUS_14350 77668 78003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence015 <1 1053 gene locus_tag LOCUS_14360 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120005.1:protein-export membrane protein SecD 1482 2573 gene locus_tag LOCUS_14370 1482 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3756 2776 gene locus_tag LOCUS_14380 3756 2776 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329841.1 protein_id gnl|my_center|LOCUS_14380 4178 6271 gene locus_tag LOCUS_14390 4178 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_14390 7012 6338 gene locus_tag LOCUS_14400 7012 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335207.1 protein_id gnl|my_center|LOCUS_14400 8037 7222 gene locus_tag LOCUS_14410 8037 7222 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118627.1 protein_id gnl|my_center|LOCUS_14410 9747 8191 gene locus_tag LOCUS_14420 gene rny 9747 8191 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE3 protein_id gnl|my_center|LOCUS_14420 10415 11419 gene locus_tag LOCUS_14430 gene tilS 10415 11419 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE1 protein_id gnl|my_center|LOCUS_14430 11674 13227 gene locus_tag LOCUS_14440 11674 13227 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119516.1 protein_id gnl|my_center|LOCUS_14440 13537 16653 gene locus_tag LOCUS_14450 13537 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 16693 17001 gene locus_tag LOCUS_14460 16693 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 18092 17037 gene locus_tag LOCUS_14470 18092 17037 CDS product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 protein_id gnl|my_center|LOCUS_14470 19571 18309 gene locus_tag LOCUS_14480 19571 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 21427 19883 gene locus_tag LOCUS_14490 21427 19883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 21654 21962 gene locus_tag LOCUS_14500 21654 21962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105926.1 protein_id gnl|my_center|LOCUS_14500 25160 22053 gene locus_tag LOCUS_14510 25160 22053 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118043.1 protein_id gnl|my_center|LOCUS_14510 25276 26916 gene locus_tag LOCUS_14520 25276 26916 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_14520 26909 28279 gene locus_tag LOCUS_14530 26909 28279 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_14530 30092 28323 gene locus_tag LOCUS_14540 30092 28323 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_14540 31051 30299 gene locus_tag LOCUS_14550 31051 30299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 32287 31136 gene locus_tag LOCUS_14560 gene mqnC 32287 31136 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT24 protein_id gnl|my_center|LOCUS_14560 33068 32268 gene locus_tag LOCUS_14570 gene mqnA 33068 32268 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_14570 33603 34274 gene locus_tag LOCUS_14580 33603 34274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 35649 34423 gene locus_tag LOCUS_14590 gene metB 35649 34423 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120920.1 protein_id gnl|my_center|LOCUS_14590 36201 36404 gene locus_tag LOCUS_14600 36201 36404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 36460 37365 gene locus_tag LOCUS_14610 36460 37365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 37444 38616 gene locus_tag LOCUS_14620 37444 38616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121267.1 protein_id gnl|my_center|LOCUS_14620 39447 38632 gene locus_tag LOCUS_14630 39447 38632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 40448 39597 gene locus_tag LOCUS_14640 gene dapF 40448 39597 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FS5 protein_id gnl|my_center|LOCUS_14640 41205 40594 gene locus_tag LOCUS_14650 41205 40594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 43218 41284 gene locus_tag LOCUS_14660 43218 41284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 44137 43511 gene locus_tag LOCUS_14670 44137 43511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 46162 44195 gene locus_tag LOCUS_14680 46162 44195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 46928 46470 gene locus_tag LOCUS_14690 gene ndk 46928 46470 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK7 protein_id gnl|my_center|LOCUS_14690 47305 49179 gene locus_tag LOCUS_14700 gene korA 47305 49179 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_14700 49242 50252 gene locus_tag LOCUS_14710 gene korB 49242 50252 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_14710 50361 51509 gene locus_tag LOCUS_14720 50361 51509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 51761 54424 gene locus_tag LOCUS_14730 51761 54424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 54526 55677 gene locus_tag LOCUS_14740 gene argC 54526 55677 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVL4 protein_id gnl|my_center|LOCUS_14740 55794 56978 gene locus_tag LOCUS_14750 gene argJ 55794 56978 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUJ7 protein_id gnl|my_center|LOCUS_14750 57694 58026 gene locus_tag LOCUS_14760 57694 58026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 58211 58023 gene locus_tag LOCUS_14770 58211 58023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 58387 61839 gene locus_tag LOCUS_14780 gene ileS 58387 61839 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ2 protein_id gnl|my_center|LOCUS_14780 61832 62458 gene locus_tag LOCUS_14790 gene pur3 61832 62458 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_14790 62547 63434 gene locus_tag LOCUS_14800 62547 63434 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_14800 63706 65268 gene locus_tag LOCUS_14810 gene oprO 63706 65268 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117790.1 protein_id gnl|my_center|LOCUS_14810 67357 65966 gene locus_tag LOCUS_14820 gene sthA 67357 65966 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325276.1 protein_id gnl|my_center|LOCUS_14820 68684 67515 gene locus_tag LOCUS_14830 gene solA 68684 67515 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_14830 70080 68725 gene locus_tag LOCUS_14840 70080 68725 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_14840 71115 70147 gene locus_tag LOCUS_14850 71115 70147 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119523.1 protein_id gnl|my_center|LOCUS_14850 71378 71845 gene locus_tag LOCUS_14860 71378 71845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 71848 73053 gene locus_tag LOCUS_14870 gene rimK 71848 73053 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_14870 73080 73955 gene locus_tag LOCUS_14880 73080 73955 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_14880 74046 74426 gene locus_tag LOCUS_14890 74046 74426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence016 2139 586 gene locus_tag LOCUS_14900 gene pntA 2139 586 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CII9 protein_id gnl|my_center|LOCUS_14900 2840 2316 gene locus_tag LOCUS_14910 2840 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4453 4629 gene locus_tag LOCUS_14920 4453 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 5021 7108 gene locus_tag LOCUS_14930 5021 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8582 7101 gene locus_tag LOCUS_14940 gene arsA 8582 7101 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_14940 10144 8780 gene locus_tag LOCUS_14950 10144 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 11287 10445 gene locus_tag LOCUS_14960 gene uppP 11287 10445 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_14960 11611 13044 gene locus_tag LOCUS_14970 gene leuC 11611 13044 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA7 protein_id gnl|my_center|LOCUS_14970 13117 13707 gene locus_tag LOCUS_14980 gene leuD 13117 13707 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA6 protein_id gnl|my_center|LOCUS_14980 13909 14949 gene locus_tag LOCUS_14990 13909 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 15030 15566 gene locus_tag LOCUS_15000 15030 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 15677 16135 gene locus_tag LOCUS_15010 15677 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 17239 16166 gene locus_tag LOCUS_15020 17239 16166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 17433 18239 gene locus_tag LOCUS_15030 gene map 17433 18239 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J21 protein_id gnl|my_center|LOCUS_15030 19454 18273 gene locus_tag LOCUS_15040 19454 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 20962 19535 gene locus_tag LOCUS_15050 gene fumC 20962 19535 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE6 protein_id gnl|my_center|LOCUS_15050 21256 21897 gene locus_tag LOCUS_15060 gene pdxH 21256 21897 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKQ9 protein_id gnl|my_center|LOCUS_15060 23810 21948 gene locus_tag LOCUS_15070 23810 21948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 25265 23982 gene locus_tag LOCUS_15080 gene aroA 25265 23982 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW43 protein_id gnl|my_center|LOCUS_15080 25691 26644 gene locus_tag LOCUS_15090 25691 26644 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_15090 26862 27611 gene locus_tag LOCUS_15100 26862 27611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 27874 29172 gene locus_tag LOCUS_15110 27874 29172 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_15110 30587 29235 gene locus_tag LOCUS_15120 gene clpY 30587 29235 CDS product ATP-dependent protease ATPase subunit ClpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39778 protein_id gnl|my_center|LOCUS_15120 31283 30729 gene locus_tag LOCUS_15130 31283 30729 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460420.1 protein_id gnl|my_center|LOCUS_15130 31571 32119 gene locus_tag LOCUS_15140 gene pncA 31571 32119 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124945.1 protein_id gnl|my_center|LOCUS_15140 32844 32218 gene locus_tag LOCUS_15150 32844 32218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 33147 33905 gene locus_tag LOCUS_15160 33147 33905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_15160 35221 34019 gene locus_tag LOCUS_15170 gene rnd 35221 34019 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120569.1 protein_id gnl|my_center|LOCUS_15170 35474 36229 gene locus_tag LOCUS_15180 35474 36229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 36531 36740 gene locus_tag LOCUS_15190 36531 36740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 36987 37298 gene locus_tag LOCUS_15200 36987 37298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 39421 37889 gene locus_tag LOCUS_15210 gene hutH 39421 37889 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSQ4 protein_id gnl|my_center|LOCUS_15210 41172 39511 gene locus_tag LOCUS_15220 gene hutU 41172 39511 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q76 protein_id gnl|my_center|LOCUS_15220 41432 42715 gene locus_tag LOCUS_15230 gene hutI 41432 42715 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI05 protein_id gnl|my_center|LOCUS_15230 42712 44118 gene locus_tag LOCUS_15240 42712 44118 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266356.1 protein_id gnl|my_center|LOCUS_15240 44343 45170 gene locus_tag LOCUS_15250 44343 45170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15250 45434 46525 gene locus_tag LOCUS_15260 gene ychF 45434 46525 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ1 protein_id gnl|my_center|LOCUS_15260 46601 47362 gene locus_tag LOCUS_15270 46601 47362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 47544 47470 gene locus_tag LOCUS_t00140 47544 47470 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 49543 47678 gene locus_tag LOCUS_15280 gene glmS 49543 47678 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA9 protein_id gnl|my_center|LOCUS_15280 49872 51518 gene locus_tag LOCUS_15290 gene fucI 49872 51518 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122003.1 protein_id gnl|my_center|LOCUS_15290 51629 52831 gene locus_tag LOCUS_15300 51629 52831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 53623 52868 gene locus_tag LOCUS_15310 53623 52868 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P771 protein_id gnl|my_center|LOCUS_15310 53769 54461 gene locus_tag LOCUS_15320 53769 54461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 54518 54742 gene locus_tag LOCUS_15330 54518 54742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 54865 56679 gene locus_tag LOCUS_15340 54865 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119040.1 protein_id gnl|my_center|LOCUS_15340 57472 56732 gene locus_tag LOCUS_15350 gene ispD 57472 56732 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM15 protein_id gnl|my_center|LOCUS_15350 58102 59043 gene locus_tag LOCUS_15360 58102 59043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 59978 64123 gene locus_tag LOCUS_15370 59978 64123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120768.1 protein_id gnl|my_center|LOCUS_15370 65575 64253 gene locus_tag LOCUS_15380 65575 64253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_15380 67337 65676 gene locus_tag LOCUS_15390 67337 65676 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121184.1 protein_id gnl|my_center|LOCUS_15390 67865 67680 gene locus_tag LOCUS_15400 67865 67680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 68246 68061 gene locus_tag LOCUS_15410 68246 68061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence017 428 3193 gene locus_tag LOCUS_15420 gene batD 428 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121994.1 protein_id gnl|my_center|LOCUS_15420 3288 3635 gene locus_tag LOCUS_15430 gene sui1 3288 3635 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326321.1 protein_id gnl|my_center|LOCUS_15430 3737 4939 gene locus_tag LOCUS_15440 gene adk 3737 4939 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXV7 protein_id gnl|my_center|LOCUS_15440 6095 5004 gene locus_tag LOCUS_15450 6095 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 6761 8245 gene locus_tag LOCUS_15460 6761 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 10925 8271 gene locus_tag LOCUS_15470 10925 8271 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_15470 12132 11071 gene locus_tag LOCUS_15480 12132 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 12839 13624 gene locus_tag LOCUS_15490 12839 13624 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15490 14963 13752 gene locus_tag LOCUS_15500 14963 13752 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_15500 16069 15461 gene locus_tag LOCUS_15510 16069 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 17248 16373 gene locus_tag LOCUS_15520 17248 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 17841 17314 gene locus_tag LOCUS_15530 17841 17314 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_15530 18714 17905 gene locus_tag LOCUS_15540 18714 17905 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_15540 19275 20288 gene locus_tag LOCUS_15550 19275 20288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 20849 21574 gene locus_tag LOCUS_15560 20849 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 21567 23588 gene locus_tag LOCUS_15570 21567 23588 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_15570 23759 29161 gene locus_tag LOCUS_15580 23759 29161 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_15580 29818 29282 gene locus_tag LOCUS_15590 29818 29282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 30814 29897 gene locus_tag LOCUS_15600 30814 29897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 31403 30807 gene locus_tag LOCUS_15610 31403 30807 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207186.1 protein_id gnl|my_center|LOCUS_15610 31997 31518 gene locus_tag LOCUS_15620 31997 31518 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326945.1 protein_id gnl|my_center|LOCUS_15620 33013 32453 gene locus_tag LOCUS_15630 33013 32453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 35278 33560 gene locus_tag LOCUS_15640 35278 33560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 37671 35275 gene locus_tag LOCUS_15650 37671 35275 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122892.1 protein_id gnl|my_center|LOCUS_15650 41289 37792 gene locus_tag LOCUS_15660 41289 37792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 42076 41378 gene locus_tag LOCUS_15670 42076 41378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 42619 42131 gene locus_tag LOCUS_15680 42619 42131 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324222.1 protein_id gnl|my_center|LOCUS_15680 43330 42686 gene locus_tag LOCUS_15690 gene tolQ 43330 42686 CDS product MotA/TolQ/ExbB proton channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324221.1 protein_id gnl|my_center|LOCUS_15690 44395 43523 gene locus_tag LOCUS_15700 44395 43523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122886.1 protein_id gnl|my_center|LOCUS_15700 46370 44493 gene locus_tag LOCUS_15710 46370 44493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122878.1 protein_id gnl|my_center|LOCUS_15710 47091 47164 gene locus_tag LOCUS_t00150 47091 47164 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 47518 48495 gene locus_tag LOCUS_15720 47518 48495 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528381.1 protein_id gnl|my_center|LOCUS_15720 48566 50128 gene locus_tag LOCUS_15730 gene rbsA 48566 50128 CDS product ribose import ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CG00 protein_id gnl|my_center|LOCUS_15730 50128 51678 gene locus_tag LOCUS_15740 50128 51678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 52043 52942 gene locus_tag LOCUS_15750 52043 52942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 53398 52985 gene locus_tag LOCUS_15760 53398 52985 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 protein_id gnl|my_center|LOCUS_15760 53561 54496 gene locus_tag LOCUS_15770 53561 54496 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098440.1 protein_id gnl|my_center|LOCUS_15770 54510 54992 gene locus_tag LOCUS_15780 54510 54992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 55049 55828 gene locus_tag LOCUS_15790 gene mntB 55049 55828 CDS product manganese transport system ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34338 protein_id gnl|my_center|LOCUS_15790 55905 57431 gene locus_tag LOCUS_15800 gene mntB 55905 57431 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_15800 58273 57473 gene locus_tag LOCUS_15810 58273 57473 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 protein_id gnl|my_center|LOCUS_15810 58557 59156 gene locus_tag LOCUS_15820 gene tdk 58557 59156 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C8 protein_id gnl|my_center|LOCUS_15820 61159 59165 gene locus_tag LOCUS_15830 61159 59165 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121893.1 protein_id gnl|my_center|LOCUS_15830 62082 61387 gene locus_tag LOCUS_15840 62082 61387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 62573 63880 gene locus_tag LOCUS_15850 62573 63880 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_15850 63969 66368 gene locus_tag LOCUS_15860 63969 66368 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120680.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence018 283 50 gene locus_tag LOCUS_15870 283 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 978 553 gene locus_tag LOCUS_15880 978 553 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333086.1 protein_id gnl|my_center|LOCUS_15880 1587 2960 gene locus_tag LOCUS_15890 gene czcC 1587 2960 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_15890 3228 4541 gene locus_tag LOCUS_15900 3228 4541 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119957.1 protein_id gnl|my_center|LOCUS_15900 4682 7876 gene locus_tag LOCUS_15910 4682 7876 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_15910 8518 9330 gene locus_tag LOCUS_15920 8518 9330 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120930.1 protein_id gnl|my_center|LOCUS_15920 9428 10333 gene locus_tag LOCUS_15930 9428 10333 CDS product PEP-CTERM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119976.1 protein_id gnl|my_center|LOCUS_15930 11261 12097 gene locus_tag LOCUS_15940 11261 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 15731 12168 gene locus_tag LOCUS_15950 gene dnaE 15731 12168 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUS6 protein_id gnl|my_center|LOCUS_15950 16161 17072 gene locus_tag LOCUS_15960 16161 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 18251 17850 gene locus_tag LOCUS_15970 18251 17850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 18671 18381 gene locus_tag LOCUS_15980 18671 18381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 18799 20220 gene locus_tag LOCUS_15990 18799 20220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 20487 21251 gene locus_tag LOCUS_16000 gene tpiA 20487 21251 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_16000 21326 21901 gene locus_tag LOCUS_16010 21326 21901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 21997 22866 gene locus_tag LOCUS_16020 21997 22866 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121239.1 protein_id gnl|my_center|LOCUS_16020 22871 23482 gene locus_tag LOCUS_16030 gene gmk 22871 23482 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP92 protein_id gnl|my_center|LOCUS_16030 23483 23743 gene locus_tag LOCUS_16040 gene rpoZ 23483 23743 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP93 protein_id gnl|my_center|LOCUS_16040 23869 24402 gene locus_tag LOCUS_16050 23869 24402 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121238.1 protein_id gnl|my_center|LOCUS_16050 24481 25119 gene locus_tag LOCUS_16060 gene dfp 24481 25119 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_16060 25513 25238 gene locus_tag LOCUS_16070 25513 25238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 25735 25526 gene locus_tag LOCUS_16080 25735 25526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 26537 25716 gene locus_tag LOCUS_16090 26537 25716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118614.1 protein_id gnl|my_center|LOCUS_16090 28234 27038 gene locus_tag LOCUS_16100 gene pyrB 28234 27038 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7U5 protein_id gnl|my_center|LOCUS_16100 30182 28443 gene locus_tag LOCUS_16110 gene ctpA 30182 28443 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119232.1 protein_id gnl|my_center|LOCUS_16110 31099 30740 gene locus_tag LOCUS_16120 31099 30740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120854.1 protein_id gnl|my_center|LOCUS_16120 35364 31543 gene locus_tag LOCUS_16130 35364 31543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 36068 35481 gene locus_tag LOCUS_16140 36068 35481 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_16140 37133 36285 gene locus_tag LOCUS_16150 37133 36285 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965735.1 protein_id gnl|my_center|LOCUS_16150 37725 37381 gene locus_tag LOCUS_16160 37725 37381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 37945 39180 gene locus_tag LOCUS_16170 gene hisS 37945 39180 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UZ20 protein_id gnl|my_center|LOCUS_16170 39370 39612 gene locus_tag LOCUS_16180 39370 39612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 41654 40005 gene locus_tag LOCUS_16190 41654 40005 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121701.1 protein_id gnl|my_center|LOCUS_16190 45086 41910 gene locus_tag LOCUS_16200 45086 41910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120285.1 protein_id gnl|my_center|LOCUS_16200 45534 45764 gene locus_tag LOCUS_16210 45534 45764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 46438 46013 gene locus_tag LOCUS_16220 gene dgkA 46438 46013 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8M1 protein_id gnl|my_center|LOCUS_16220 49605 46441 gene locus_tag LOCUS_16230 49605 46441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121175.1 protein_id gnl|my_center|LOCUS_16230 51971 50643 gene locus_tag LOCUS_16240 gene ugd 51971 50643 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_16240 54884 52140 gene locus_tag LOCUS_16250 gene gyrA 54884 52140 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMG7 protein_id gnl|my_center|LOCUS_16250 55632 57368 gene locus_tag LOCUS_16260 55632 57368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 57396 58292 gene locus_tag LOCUS_16270 gene folP 57396 58292 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ75 protein_id gnl|my_center|LOCUS_16270 62946 58300 gene locus_tag LOCUS_16280 62946 58300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 63713 65269 gene locus_tag LOCUS_16290 63713 65269 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123822.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence019 2515 68 gene locus_tag LOCUS_16300 gene gyrB 2515 68 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM28 protein_id gnl|my_center|LOCUS_16300 2941 2576 gene locus_tag LOCUS_16310 2941 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 4113 2998 gene locus_tag LOCUS_16320 gene dnaN 4113 2998 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKK1 protein_id gnl|my_center|LOCUS_16320 5613 4414 gene locus_tag LOCUS_16330 gene dnaA 5613 4414 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE51 protein_id gnl|my_center|LOCUS_16330 6152 6877 gene locus_tag LOCUS_16340 6152 6877 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_16340 6874 7989 gene locus_tag LOCUS_16350 6874 7989 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_16350 9079 9267 gene locus_tag LOCUS_16360 9079 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 9299 9949 gene locus_tag LOCUS_16370 9299 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 11152 9971 gene locus_tag LOCUS_16380 gene iscS 11152 9971 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHY5 protein_id gnl|my_center|LOCUS_16380 11865 11149 gene locus_tag LOCUS_16390 11865 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 12164 12889 gene locus_tag LOCUS_16400 12164 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 12889 13374 gene locus_tag LOCUS_16410 12889 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 14687 13416 gene locus_tag LOCUS_16420 gene hemA 14687 13416 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKZ2 protein_id gnl|my_center|LOCUS_16420 16891 15890 gene locus_tag LOCUS_16430 gene atoC 16891 15890 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123506.1 protein_id gnl|my_center|LOCUS_16430 17593 17222 gene locus_tag LOCUS_16440 gene rplU 17593 17222 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFG2 protein_id gnl|my_center|LOCUS_16440 19629 17698 gene locus_tag LOCUS_16450 19629 17698 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122938.1 protein_id gnl|my_center|LOCUS_16450 19765 20592 gene locus_tag LOCUS_16460 gene fabI 19765 20592 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK85 protein_id gnl|my_center|LOCUS_16460 21279 20629 gene locus_tag LOCUS_16470 21279 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 22615 21317 gene locus_tag LOCUS_16480 gene hofB 22615 21317 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326269.1 protein_id gnl|my_center|LOCUS_16480 24494 22725 gene locus_tag LOCUS_16490 24494 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 25723 24494 gene locus_tag LOCUS_16500 gene pilT 25723 24494 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_16500 26175 25912 gene locus_tag LOCUS_16510 26175 25912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 26367 27353 gene locus_tag LOCUS_16520 gene prfB 26367 27353 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ31 protein_id gnl|my_center|LOCUS_16520 27598 27960 gene locus_tag LOCUS_16530 27598 27960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 28540 27965 gene locus_tag LOCUS_16540 28540 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 28897 29307 gene locus_tag LOCUS_16550 28897 29307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 30585 29329 gene locus_tag LOCUS_16560 gene glyA 30585 29329 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN2 protein_id gnl|my_center|LOCUS_16560 32101 30650 gene locus_tag LOCUS_16570 32101 30650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117961.1 protein_id gnl|my_center|LOCUS_16570 32178 33260 gene locus_tag LOCUS_16580 32178 33260 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_16580 33613 33371 gene locus_tag LOCUS_16590 33613 33371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 36654 33916 gene locus_tag LOCUS_16600 36654 33916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 36980 38200 gene locus_tag LOCUS_16610 36980 38200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 39743 38271 gene locus_tag LOCUS_16620 gene miaB 39743 38271 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULM9 protein_id gnl|my_center|LOCUS_16620 40998 40033 gene locus_tag LOCUS_16630 gene fmt 40998 40033 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ6 protein_id gnl|my_center|LOCUS_16630 41683 41096 gene locus_tag LOCUS_16640 gene def 41683 41096 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ5 protein_id gnl|my_center|LOCUS_16640 42617 43378 gene locus_tag LOCUS_16650 42617 43378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 43544 45025 gene locus_tag LOCUS_16660 gene glgA 43544 45025 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPY2 protein_id gnl|my_center|LOCUS_16660 45140 46162 gene locus_tag LOCUS_16670 45140 46162 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_16670 46480 48651 gene locus_tag LOCUS_16680 46480 48651 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_16680 50587 48683 gene locus_tag LOCUS_16690 gene gaa 50587 48683 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_16690 52040 50874 gene locus_tag LOCUS_16700 52040 50874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 53829 52468 gene locus_tag LOCUS_16710 53829 52468 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_16710 54613 53978 gene locus_tag LOCUS_16720 gene cox3 54613 53978 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120015.1 protein_id gnl|my_center|LOCUS_16720 55041 54667 gene locus_tag LOCUS_16730 55041 54667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 56204 55047 gene locus_tag LOCUS_16740 gene ctaE 56204 55047 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123857.1 protein_id gnl|my_center|LOCUS_16740 58008 56305 gene locus_tag LOCUS_16750 gene ctaD 58008 56305 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_16750 59187 58093 gene locus_tag LOCUS_16760 gene cyoA 59187 58093 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9F3 protein_id gnl|my_center|LOCUS_16760 60190 59255 gene locus_tag LOCUS_16770 60190 59255 CDS product photosynthetic protein synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885550.1 protein_id gnl|my_center|LOCUS_16770 60511 60227 gene locus_tag LOCUS_16780 60511 60227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 61867 60572 gene locus_tag LOCUS_16790 61867 60572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123852.1 protein_id gnl|my_center|LOCUS_16790 63426 61954 gene locus_tag LOCUS_16800 63426 61954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123851.1 protein_id gnl|my_center|LOCUS_16800 <64843 63520 gene locus_tag LOCUS_16810 <64843 63520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328378.1:molybdopterin oxidoreductase membrane subunit >Feature sequence020 581 1018 gene locus_tag LOCUS_16820 581 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1666 4173 gene locus_tag LOCUS_16830 1666 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_16830 5430 6329 gene locus_tag LOCUS_16840 5430 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6615 7232 gene locus_tag LOCUS_16850 6615 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7359 8102 gene locus_tag LOCUS_16860 7359 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 8209 8610 gene locus_tag LOCUS_16870 8209 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 8881 9372 gene locus_tag LOCUS_16880 8881 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 9745 10257 gene locus_tag LOCUS_16890 9745 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 10727 10826 gene locus_tag LOCUS_t00160 10727 10826 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 11123 12109 gene locus_tag LOCUS_16900 11123 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 12109 13878 gene locus_tag LOCUS_16910 12109 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 14231 14452 gene locus_tag LOCUS_16920 14231 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 14520 14837 gene locus_tag LOCUS_16930 14520 14837 CDS product protein translocase TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328854.1 protein_id gnl|my_center|LOCUS_16930 15098 15949 gene locus_tag LOCUS_16940 15098 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 16421 17350 gene locus_tag LOCUS_16950 16421 17350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_16950 17551 18942 gene locus_tag LOCUS_16960 gene ctpA 17551 18942 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121377.1 protein_id gnl|my_center|LOCUS_16960 19247 18966 gene locus_tag LOCUS_16970 19247 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 20110 19259 gene locus_tag LOCUS_16980 20110 19259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 20446 21915 gene locus_tag LOCUS_16990 20446 21915 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119180.1 protein_id gnl|my_center|LOCUS_16990 26480 22125 gene locus_tag LOCUS_17000 26480 22125 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117959.1 protein_id gnl|my_center|LOCUS_17000 27264 26740 gene locus_tag LOCUS_17010 gene fabA 27264 26740 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 protein_id gnl|my_center|LOCUS_17010 27989 27369 gene locus_tag LOCUS_17020 27989 27369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 28579 28037 gene locus_tag LOCUS_17030 28579 28037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 29580 28468 gene locus_tag LOCUS_17040 29580 28468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 30128 31528 gene locus_tag LOCUS_17050 30128 31528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_17050 31959 32969 gene locus_tag LOCUS_17060 31959 32969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 33124 33939 gene locus_tag LOCUS_17070 33124 33939 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118316.1 protein_id gnl|my_center|LOCUS_17070 34922 35653 gene locus_tag LOCUS_17080 34922 35653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 38078 35751 gene locus_tag LOCUS_17090 38078 35751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 38723 38211 gene locus_tag LOCUS_17100 38723 38211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 39627 38713 gene locus_tag LOCUS_17110 gene thiL 39627 38713 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPP0 protein_id gnl|my_center|LOCUS_17110 41036 39918 gene locus_tag LOCUS_17120 41036 39918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 42104 41688 gene locus_tag LOCUS_17130 gene tesB 42104 41688 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331599.1 protein_id gnl|my_center|LOCUS_17130 42346 42843 gene locus_tag LOCUS_17140 gene ilvH 42346 42843 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_17140 42995 43807 gene locus_tag LOCUS_17150 42995 43807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 43868 45214 gene locus_tag LOCUS_17160 43868 45214 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118912.1 protein_id gnl|my_center|LOCUS_17160 45632 45216 gene locus_tag LOCUS_17170 45632 45216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 46881 45850 gene locus_tag LOCUS_17180 46881 45850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496933.1 protein_id gnl|my_center|LOCUS_17180 47810 46893 gene locus_tag LOCUS_17190 gene sulA 47810 46893 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038965.1 protein_id gnl|my_center|LOCUS_17190 48086 52891 gene locus_tag LOCUS_17200 48086 52891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 53216 55633 gene locus_tag LOCUS_17210 53216 55633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121398.1 protein_id gnl|my_center|LOCUS_17210 55911 55985 gene locus_tag LOCUS_t00170 55911 55985 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56715 58001 gene locus_tag LOCUS_17220 56715 58001 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120143.1 protein_id gnl|my_center|LOCUS_17220 58252 61800 gene locus_tag LOCUS_17230 58252 61800 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_17230 62169 62438 gene locus_tag LOCUS_17240 62169 62438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 64301 63309 gene locus_tag LOCUS_17250 64301 63309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence021 1456 2259 gene locus_tag LOCUS_17260 1456 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2840 3952 gene locus_tag LOCUS_17270 2840 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4041 5876 gene locus_tag LOCUS_17280 4041 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5931 6947 gene locus_tag LOCUS_17290 gene degP 5931 6947 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121356.1 protein_id gnl|my_center|LOCUS_17290 7036 8169 gene locus_tag LOCUS_17300 7036 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9269 8199 gene locus_tag LOCUS_17310 9269 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 9456 10667 gene locus_tag LOCUS_17320 9456 10667 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_17320 12085 10706 gene locus_tag LOCUS_17330 12085 10706 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119058.1 protein_id gnl|my_center|LOCUS_17330 12885 12169 gene locus_tag LOCUS_17340 gene rluD 12885 12169 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120941.1 protein_id gnl|my_center|LOCUS_17340 12957 13550 gene locus_tag LOCUS_17350 12957 13550 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWY8 protein_id gnl|my_center|LOCUS_17350 14844 13615 gene locus_tag LOCUS_17360 14844 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 15145 17367 gene locus_tag LOCUS_17370 15145 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 21277 17420 gene locus_tag LOCUS_17380 gene hrpA 21277 17420 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104871.1 protein_id gnl|my_center|LOCUS_17380 23144 21591 gene locus_tag LOCUS_17390 23144 21591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 24068 23199 gene locus_tag LOCUS_17400 24068 23199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 24533 24823 gene locus_tag LOCUS_17410 24533 24823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 24913 25887 gene locus_tag LOCUS_17420 24913 25887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 25962 26429 gene locus_tag LOCUS_17430 25962 26429 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_17430 27053 28081 gene locus_tag LOCUS_17440 gene kdsD 27053 28081 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_17440 28088 29059 gene locus_tag LOCUS_17450 28088 29059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 29070 30326 gene locus_tag LOCUS_17460 gene tagH 29070 30326 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_17460 30319 31281 gene locus_tag LOCUS_17470 30319 31281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 31390 32766 gene locus_tag LOCUS_17480 31390 32766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 32873 33640 gene locus_tag LOCUS_17490 32873 33640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 33790 34881 gene locus_tag LOCUS_17500 33790 34881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 34964 35899 gene locus_tag LOCUS_17510 34964 35899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 38013 35935 gene locus_tag LOCUS_17520 gene ftsH2 38013 35935 CDS product ATP-dependent zinc metalloprotease FtsH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URM7 protein_id gnl|my_center|LOCUS_17520 38585 39739 gene locus_tag LOCUS_17530 gene dxr 38585 39739 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185R8 protein_id gnl|my_center|LOCUS_17530 39724 41850 gene locus_tag LOCUS_17540 39724 41850 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120518.1 protein_id gnl|my_center|LOCUS_17540 42056 42445 gene locus_tag LOCUS_17550 42056 42445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330460.1 protein_id gnl|my_center|LOCUS_17550 42675 44732 gene locus_tag LOCUS_17560 42675 44732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 44741 45250 gene locus_tag LOCUS_17570 44741 45250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 45584 47233 gene locus_tag LOCUS_17580 45584 47233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 48474 47239 gene locus_tag LOCUS_17590 gene hemN 48474 47239 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_17590 49304 48465 gene locus_tag LOCUS_17600 49304 48465 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122511.1 protein_id gnl|my_center|LOCUS_17600 50750 49563 gene locus_tag LOCUS_17610 gene pgk 50750 49563 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEX1 protein_id gnl|my_center|LOCUS_17610 51276 50965 gene locus_tag LOCUS_17620 51276 50965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328015.1 protein_id gnl|my_center|LOCUS_17620 51391 52521 gene locus_tag LOCUS_17630 51391 52521 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948559.1 protein_id gnl|my_center|LOCUS_17630 52738 53970 gene locus_tag LOCUS_17640 52738 53970 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123528.1 protein_id gnl|my_center|LOCUS_17640 54938 54006 gene locus_tag LOCUS_17650 gene cdS 54938 54006 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119982.1 protein_id gnl|my_center|LOCUS_17650 55693 54947 gene locus_tag LOCUS_17660 gene uppS 55693 54947 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF53 protein_id gnl|my_center|LOCUS_17660 57098 55770 gene locus_tag LOCUS_17670 gene purA 57098 55770 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW3 protein_id gnl|my_center|LOCUS_17670 57507 58487 gene locus_tag LOCUS_17680 57507 58487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 59430 58522 gene locus_tag LOCUS_17690 gene xerC 59430 58522 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_17690 59903 59511 gene locus_tag LOCUS_17700 59903 59511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 60353 61114 gene locus_tag LOCUS_17710 60353 61114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 61519 61148 gene locus_tag LOCUS_17720 61519 61148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 62755 61595 gene locus_tag LOCUS_17730 62755 61595 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327931.1 protein_id gnl|my_center|LOCUS_17730 62750 62959 gene locus_tag LOCUS_17740 62750 62959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 63105 64301 gene locus_tag LOCUS_17750 63105 64301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120290.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence022 1334 159 gene locus_tag LOCUS_17760 1334 159 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_17760 2757 1381 gene locus_tag LOCUS_17770 2757 1381 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_17770 6766 2942 gene locus_tag LOCUS_17780 6766 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 7052 10030 gene locus_tag LOCUS_17790 7052 10030 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_17790 10115 11374 gene locus_tag LOCUS_17800 10115 11374 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_17800 11349 12587 gene locus_tag LOCUS_17810 11349 12587 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_17810 14070 12625 gene locus_tag LOCUS_17820 14070 12625 CDS product putative decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702424.1 protein_id gnl|my_center|LOCUS_17820 14364 15197 gene locus_tag LOCUS_17830 gene accD 14364 15197 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX0 protein_id gnl|my_center|LOCUS_17830 15268 16152 gene locus_tag LOCUS_17840 15268 16152 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_17840 17451 16237 gene locus_tag LOCUS_17850 gene lsyA-1 17451 16237 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B24 protein_id gnl|my_center|LOCUS_17850 19053 17626 gene locus_tag LOCUS_17860 gene prpD 19053 17626 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_17860 20314 19142 gene locus_tag LOCUS_17870 gene atoB 20314 19142 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44873 protein_id gnl|my_center|LOCUS_17870 20829 22658 gene locus_tag LOCUS_17880 20829 22658 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404477.1 protein_id gnl|my_center|LOCUS_17880 22727 24328 gene locus_tag LOCUS_17890 22727 24328 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888181.1 protein_id gnl|my_center|LOCUS_17890 25426 24467 gene locus_tag LOCUS_17900 gene eutD 25426 24467 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582987.1 protein_id gnl|my_center|LOCUS_17900 27519 25519 gene locus_tag LOCUS_17910 gene nadE 27519 25519 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_17910 27994 29733 gene locus_tag LOCUS_17920 27994 29733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 29794 30069 gene locus_tag LOCUS_17930 29794 30069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 32961 30121 gene locus_tag LOCUS_17940 32961 30121 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_17940 33853 32948 gene locus_tag LOCUS_17950 gene nanA 33853 32948 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NCP5 protein_id gnl|my_center|LOCUS_17950 39217 34037 gene locus_tag LOCUS_17960 39217 34037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 39470 40234 gene locus_tag LOCUS_17970 39470 40234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 40333 41640 gene locus_tag LOCUS_17980 40333 41640 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_17980 41851 43008 gene locus_tag LOCUS_17990 41851 43008 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_17990 43075 44121 gene locus_tag LOCUS_18000 43075 44121 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_18000 44281 44919 gene locus_tag LOCUS_18010 gene cypH 44281 44919 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMR2 protein_id gnl|my_center|LOCUS_18010 45804 45034 gene locus_tag LOCUS_18020 45804 45034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 46201 46127 gene locus_tag LOCUS_t00180 46201 46127 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 46421 47398 gene locus_tag LOCUS_18030 46421 47398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 47605 48105 gene locus_tag LOCUS_18040 gene tpx 47605 48105 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57668 protein_id gnl|my_center|LOCUS_18040 48355 51078 gene locus_tag LOCUS_18050 48355 51078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 52220 51198 gene locus_tag LOCUS_18060 52220 51198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122465.1 protein_id gnl|my_center|LOCUS_18060 53096 52314 gene locus_tag LOCUS_18070 53096 52314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 54061 53282 gene locus_tag LOCUS_18080 54061 53282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 protein_id gnl|my_center|LOCUS_18080 54617 54144 gene locus_tag LOCUS_18090 54617 54144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117698.1 protein_id gnl|my_center|LOCUS_18090 54882 54724 gene locus_tag LOCUS_18100 54882 54724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 55301 54906 gene locus_tag LOCUS_18110 55301 54906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 56811 56215 gene locus_tag LOCUS_18120 gene pgaM 56811 56215 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332332.1 protein_id gnl|my_center|LOCUS_18120 57512 56808 gene locus_tag LOCUS_18130 gene rpe 57512 56808 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX51 protein_id gnl|my_center|LOCUS_18130 57539 57736 gene locus_tag LOCUS_18140 57539 57736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 58614 57766 gene locus_tag LOCUS_18150 58614 57766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121285.1 protein_id gnl|my_center|LOCUS_18150 59759 58689 gene locus_tag LOCUS_18160 59759 58689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 60085 61305 gene locus_tag LOCUS_18170 gene ribA 60085 61305 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIK1 protein_id gnl|my_center|LOCUS_18170 61909 61472 gene locus_tag LOCUS_18180 61909 61472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 62317 62060 gene locus_tag LOCUS_18190 62317 62060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 62927 62415 gene locus_tag LOCUS_18200 62927 62415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 63855 63112 gene locus_tag LOCUS_18210 63855 63112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence023 198 479 gene locus_tag LOCUS_18220 198 479 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_18220 1180 620 gene locus_tag LOCUS_18230 1180 620 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_18230 1777 1469 gene locus_tag LOCUS_18240 1777 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2987 2067 gene locus_tag LOCUS_18250 gene apbE 2987 2067 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTS4 protein_id gnl|my_center|LOCUS_18250 3450 4451 gene locus_tag LOCUS_18260 3450 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4463 4888 gene locus_tag LOCUS_18270 4463 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4892 5332 gene locus_tag LOCUS_18280 4892 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 6268 5420 gene locus_tag LOCUS_18290 6268 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 8288 6357 gene locus_tag LOCUS_18300 8288 6357 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121956.1 protein_id gnl|my_center|LOCUS_18300 8908 8982 gene locus_tag LOCUS_t00190 8908 8982 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 9041 9114 gene locus_tag LOCUS_t00200 9041 9114 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9372 10511 gene locus_tag LOCUS_18310 9372 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 10812 11024 gene locus_tag LOCUS_18320 10812 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 11047 11592 gene locus_tag LOCUS_18330 11047 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 11936 12724 gene locus_tag LOCUS_18340 11936 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 12721 14085 gene locus_tag LOCUS_18350 12721 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 14180 15040 gene locus_tag LOCUS_18360 14180 15040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 15047 16099 gene locus_tag LOCUS_18370 15047 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 16092 16868 gene locus_tag LOCUS_18380 16092 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 16907 18910 gene locus_tag LOCUS_18390 16907 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 19004 19816 gene locus_tag LOCUS_18400 gene tadB 19004 19816 CDS product tight adherance operon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817201.1 protein_id gnl|my_center|LOCUS_18400 19878 20831 gene locus_tag LOCUS_18410 19878 20831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 20890 21810 gene locus_tag LOCUS_18420 20890 21810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 21864 25235 gene locus_tag LOCUS_18430 21864 25235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 25673 26911 gene locus_tag LOCUS_18440 gene fabB 25673 26911 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705793.1 protein_id gnl|my_center|LOCUS_18440 27251 31261 gene locus_tag LOCUS_18450 27251 31261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 33147 31345 gene locus_tag LOCUS_18460 33147 31345 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_18460 34080 33193 gene locus_tag LOCUS_18470 34080 33193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 35082 34810 gene locus_tag LOCUS_18480 35082 34810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 35497 36972 gene locus_tag LOCUS_18490 gene atsG 35497 36972 CDS product sulfatase atsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122623.1 protein_id gnl|my_center|LOCUS_18490 37221 38240 gene locus_tag LOCUS_18500 37221 38240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121407.1 protein_id gnl|my_center|LOCUS_18500 38399 40330 gene locus_tag LOCUS_18510 38399 40330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 40606 42717 gene locus_tag LOCUS_18520 40606 42717 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_18520 42803 43129 gene locus_tag LOCUS_18530 42803 43129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 43274 44386 gene locus_tag LOCUS_18540 43274 44386 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121284.1 protein_id gnl|my_center|LOCUS_18540 44644 45561 gene locus_tag LOCUS_18550 44644 45561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 45683 46048 gene locus_tag LOCUS_18560 45683 46048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 46359 48398 gene locus_tag LOCUS_18570 gene pepO 46359 48398 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070787.1 protein_id gnl|my_center|LOCUS_18570 48753 50534 gene locus_tag LOCUS_18580 gene nosR 48753 50534 CDS product NosR regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121575.1 protein_id gnl|my_center|LOCUS_18580 52116 50650 gene locus_tag LOCUS_18590 gene gltD 52116 50650 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_18590 56813 52167 gene locus_tag LOCUS_18600 gene gltB 56813 52167 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_18600 57160 57396 gene locus_tag LOCUS_18610 57160 57396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 57412 58221 gene locus_tag LOCUS_18620 57412 58221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 59052 58330 gene locus_tag LOCUS_18630 59052 58330 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122745.1 protein_id gnl|my_center|LOCUS_18630 59805 59104 gene locus_tag LOCUS_18640 gene udk 59805 59104 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT67 protein_id gnl|my_center|LOCUS_18640 59908 60678 gene locus_tag LOCUS_18650 59908 60678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 62018 60717 gene locus_tag LOCUS_18660 62018 60717 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_18660 63520 62231 gene locus_tag LOCUS_18670 63520 62231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence024 1460 618 gene locus_tag LOCUS_18680 gene sgaU 1460 618 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_18680 5358 1684 gene locus_tag LOCUS_18690 gene comQ 5358 1684 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118432.1 protein_id gnl|my_center|LOCUS_18690 8378 5766 gene locus_tag LOCUS_18700 8378 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 10270 8558 gene locus_tag LOCUS_18710 10270 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119062.1 protein_id gnl|my_center|LOCUS_18710 12771 10411 gene locus_tag LOCUS_18720 12771 10411 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_18720 13351 16302 gene locus_tag LOCUS_18730 13351 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119059.1 protein_id gnl|my_center|LOCUS_18730 16299 16982 gene locus_tag LOCUS_18740 gene cmk 16299 16982 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEW6 protein_id gnl|my_center|LOCUS_18740 17983 17012 gene locus_tag LOCUS_18750 17983 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 18978 17977 gene locus_tag LOCUS_18760 18978 17977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038327.1 protein_id gnl|my_center|LOCUS_18760 19866 19018 gene locus_tag LOCUS_18770 19866 19018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 20723 19863 gene locus_tag LOCUS_18780 20723 19863 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_18780 21760 20723 gene locus_tag LOCUS_18790 21760 20723 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761573.1 protein_id gnl|my_center|LOCUS_18790 22343 23794 gene locus_tag LOCUS_18800 22343 23794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 25200 23896 gene locus_tag LOCUS_18810 25200 23896 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684307.1 protein_id gnl|my_center|LOCUS_18810 26459 25545 gene locus_tag LOCUS_18820 gene rpoS 26459 25545 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTR4 protein_id gnl|my_center|LOCUS_18820 26913 27941 gene locus_tag LOCUS_18830 gene pilE1 26913 27941 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_18830 28159 28371 gene locus_tag LOCUS_18840 28159 28371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 29567 28533 gene locus_tag LOCUS_18850 29567 28533 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTA8 protein_id gnl|my_center|LOCUS_18850 30044 32341 gene locus_tag LOCUS_18860 30044 32341 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123369.1 protein_id gnl|my_center|LOCUS_18860 32490 34208 gene locus_tag LOCUS_18870 32490 34208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 35324 34326 gene locus_tag LOCUS_18880 35324 34326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 37622 35508 gene locus_tag LOCUS_18890 37622 35508 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_18890 37856 40063 gene locus_tag LOCUS_18900 37856 40063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 40511 40068 gene locus_tag LOCUS_18910 40511 40068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 42683 40614 gene locus_tag LOCUS_18920 42683 40614 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122294.1 protein_id gnl|my_center|LOCUS_18920 43594 42680 gene locus_tag LOCUS_18930 43594 42680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122296.1 protein_id gnl|my_center|LOCUS_18930 44644 43640 gene locus_tag LOCUS_18940 44644 43640 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_18940 48067 44729 gene locus_tag LOCUS_18950 48067 44729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123724.1 protein_id gnl|my_center|LOCUS_18950 48904 51744 gene locus_tag LOCUS_18960 48904 51744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120809.1 protein_id gnl|my_center|LOCUS_18960 52927 52043 gene locus_tag LOCUS_18970 52927 52043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 52959 53219 gene locus_tag LOCUS_18980 52959 53219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 53603 53190 gene locus_tag LOCUS_18990 53603 53190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 54010 55188 gene locus_tag LOCUS_19000 54010 55188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 57083 55281 gene locus_tag LOCUS_19010 gene aspS 57083 55281 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFY6 protein_id gnl|my_center|LOCUS_19010 57549 58232 gene locus_tag LOCUS_19020 57549 58232 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_19020 58351 59085 gene locus_tag LOCUS_19030 58351 59085 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_19030 59085 60263 gene locus_tag LOCUS_19040 59085 60263 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_19040 61257 60238 gene locus_tag LOCUS_19050 61257 60238 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841995.1 protein_id gnl|my_center|LOCUS_19050 61692 62537 gene locus_tag LOCUS_19060 61692 62537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 62653 63018 gene locus_tag LOCUS_19070 62653 63018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence025 215 427 gene locus_tag LOCUS_19080 215 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 664 3738 gene locus_tag LOCUS_19090 664 3738 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118999.1 protein_id gnl|my_center|LOCUS_19090 5299 3761 gene locus_tag LOCUS_19100 gene zwf 5299 3761 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P08 protein_id gnl|my_center|LOCUS_19100 6934 5483 gene locus_tag LOCUS_19110 6934 5483 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KL50 protein_id gnl|my_center|LOCUS_19110 7850 8896 gene locus_tag LOCUS_19120 7850 8896 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_19120 10371 8989 gene locus_tag LOCUS_19130 10371 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 10410 10631 gene locus_tag LOCUS_19140 10410 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 10802 11650 gene locus_tag LOCUS_19150 10802 11650 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 protein_id gnl|my_center|LOCUS_19150 12739 11672 gene locus_tag LOCUS_19160 gene mtnA 12739 11672 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKL8 protein_id gnl|my_center|LOCUS_19160 13315 12827 gene locus_tag LOCUS_19170 gene purE 13315 12827 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZY2 protein_id gnl|my_center|LOCUS_19170 14835 13474 gene locus_tag LOCUS_19180 gene der 14835 13474 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URJ8 protein_id gnl|my_center|LOCUS_19180 15042 16076 gene locus_tag LOCUS_19190 15042 16076 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120542.1 protein_id gnl|my_center|LOCUS_19190 16378 17823 gene locus_tag LOCUS_19200 16378 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119040.1 protein_id gnl|my_center|LOCUS_19200 18131 19177 gene locus_tag LOCUS_19210 18131 19177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 19395 20009 gene locus_tag LOCUS_19220 gene rpsD 19395 20009 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM6 protein_id gnl|my_center|LOCUS_19220 20164 21603 gene locus_tag LOCUS_19230 gene lpd 20164 21603 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM8 protein_id gnl|my_center|LOCUS_19230 21877 22257 gene locus_tag LOCUS_19240 gene crcB 21877 22257 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZS8 protein_id gnl|my_center|LOCUS_19240 22444 23094 gene locus_tag LOCUS_19250 22444 23094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 24250 23096 gene locus_tag LOCUS_19260 24250 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120378.1 protein_id gnl|my_center|LOCUS_19260 24618 27545 gene locus_tag LOCUS_19270 gene spoIIIE 24618 27545 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123442.1 protein_id gnl|my_center|LOCUS_19270 28138 27542 gene locus_tag LOCUS_19280 28138 27542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 29270 28164 gene locus_tag LOCUS_19290 29270 28164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 29569 30234 gene locus_tag LOCUS_19300 29569 30234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122508.1 protein_id gnl|my_center|LOCUS_19300 32303 31248 gene locus_tag LOCUS_19310 gene waaQ 32303 31248 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122214.1 protein_id gnl|my_center|LOCUS_19310 34346 32430 gene locus_tag LOCUS_19320 34346 32430 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_19320 35378 34506 gene locus_tag LOCUS_19330 gene yhdJ 35378 34506 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D161 protein_id gnl|my_center|LOCUS_19330 37528 35573 gene locus_tag LOCUS_19340 gene argS 37528 35573 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URC7 protein_id gnl|my_center|LOCUS_19340 37793 39670 gene locus_tag LOCUS_19350 37793 39670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 41128 39746 gene locus_tag LOCUS_19360 41128 39746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 41273 42064 gene locus_tag LOCUS_19370 41273 42064 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063886.1 protein_id gnl|my_center|LOCUS_19370 42190 42942 gene locus_tag LOCUS_19380 gene fabG 42190 42942 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51831 protein_id gnl|my_center|LOCUS_19380 43105 45351 gene locus_tag LOCUS_19390 gene dpp4 43105 45351 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_19390 46657 45458 gene locus_tag LOCUS_19400 gene degT 46657 45458 CDS product pleiotropic regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118241.1 protein_id gnl|my_center|LOCUS_19400 46847 47437 gene locus_tag LOCUS_19410 gene trpG 46847 47437 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120844.1 protein_id gnl|my_center|LOCUS_19410 47434 48657 gene locus_tag LOCUS_19420 gene moeA1 47434 48657 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_19420 48744 50438 gene locus_tag LOCUS_19430 gene lnt 48744 50438 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ8 protein_id gnl|my_center|LOCUS_19430 50621 51943 gene locus_tag LOCUS_19440 50621 51943 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_19440 52300 53046 gene locus_tag LOCUS_19450 52300 53046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 56586 53113 gene locus_tag LOCUS_19460 56586 53113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118178.1 protein_id gnl|my_center|LOCUS_19460 57892 56663 gene locus_tag LOCUS_19470 57892 56663 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118180.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence026 <1 1243 gene locus_tag LOCUS_19480 <1 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950933.1:radical SAM protein 1351 2067 gene locus_tag LOCUS_19490 1351 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963188.1 protein_id gnl|my_center|LOCUS_19490 4624 2045 gene locus_tag LOCUS_19500 4624 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5412 4816 gene locus_tag LOCUS_19510 5412 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 6290 5610 gene locus_tag LOCUS_19520 6290 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 6649 7074 gene locus_tag LOCUS_19530 6649 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 7638 8267 gene locus_tag LOCUS_19540 7638 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 9575 8550 gene locus_tag LOCUS_19550 9575 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 11428 9896 gene locus_tag LOCUS_19560 11428 9896 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_19560 13089 11632 gene locus_tag LOCUS_19570 13089 11632 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 protein_id gnl|my_center|LOCUS_19570 13670 13299 gene locus_tag LOCUS_19580 13670 13299 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896076.1 protein_id gnl|my_center|LOCUS_19580 13957 13709 gene locus_tag LOCUS_19590 13957 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 16386 15421 gene locus_tag LOCUS_19600 16386 15421 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_19600 18505 16388 gene locus_tag LOCUS_19610 18505 16388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 18849 18502 gene locus_tag LOCUS_19620 18849 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 19886 20698 gene locus_tag LOCUS_19630 19886 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 21015 22937 gene locus_tag LOCUS_19640 21015 22937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 23803 23994 gene locus_tag LOCUS_19650 23803 23994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 25616 24015 gene locus_tag LOCUS_19660 25616 24015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 27320 25995 gene locus_tag LOCUS_19670 27320 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 28893 27553 gene locus_tag LOCUS_19680 28893 27553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 29916 30554 gene locus_tag LOCUS_19690 29916 30554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 31389 30952 gene locus_tag LOCUS_19700 gene yiaA 31389 30952 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038893.1 protein_id gnl|my_center|LOCUS_19700 33581 32274 gene locus_tag LOCUS_19710 33581 32274 CDS product licheninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223397.1 protein_id gnl|my_center|LOCUS_19710 35472 33976 gene locus_tag LOCUS_19720 35472 33976 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_19720 36043 37362 gene locus_tag LOCUS_19730 36043 37362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 37610 38035 gene locus_tag LOCUS_19740 37610 38035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 38169 38747 gene locus_tag LOCUS_19750 38169 38747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 39197 39772 gene locus_tag LOCUS_19760 39197 39772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 39824 40462 gene locus_tag LOCUS_19770 39824 40462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 41574 40714 gene locus_tag LOCUS_19780 41574 40714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 43139 41931 gene locus_tag LOCUS_19790 43139 41931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 45149 43551 gene locus_tag LOCUS_19800 45149 43551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 47390 45333 gene locus_tag LOCUS_19810 47390 45333 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119585.1 protein_id gnl|my_center|LOCUS_19810 47947 47702 gene locus_tag LOCUS_19820 47947 47702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 51717 48118 gene locus_tag LOCUS_19830 51717 48118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 52496 51714 gene locus_tag LOCUS_19840 52496 51714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 54162 52732 gene locus_tag LOCUS_19850 54162 52732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 55676 54783 gene locus_tag LOCUS_19860 55676 54783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence027 <1 635 gene locus_tag LOCUS_19870 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118678.1:heparan N-sulfatase 1903 665 gene locus_tag LOCUS_19880 1903 665 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_19880 3372 2089 gene locus_tag LOCUS_19890 3372 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4014 11039 gene locus_tag LOCUS_19900 gene uvrA 4014 11039 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV4 protein_id gnl|my_center|LOCUS_19900 11093 11752 gene locus_tag LOCUS_19910 11093 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118740.1 protein_id gnl|my_center|LOCUS_19910 13166 11790 gene locus_tag LOCUS_19920 13166 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_19920 13448 14272 gene locus_tag LOCUS_19930 13448 14272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 14410 17274 gene locus_tag LOCUS_19940 14410 17274 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_19940 17490 19160 gene locus_tag LOCUS_19950 gene fhs 17490 19160 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM91 protein_id gnl|my_center|LOCUS_19950 19240 19608 gene locus_tag LOCUS_19960 19240 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_19960 19759 23298 gene locus_tag LOCUS_19970 gene putA 19759 23298 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_19970 24159 23371 gene locus_tag LOCUS_19980 24159 23371 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_19980 24585 26468 gene locus_tag LOCUS_19990 24585 26468 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_19990 26556 27197 gene locus_tag LOCUS_20000 26556 27197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 28703 27201 gene locus_tag LOCUS_20010 28703 27201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 28941 29264 gene locus_tag LOCUS_20020 28941 29264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 29503 30786 gene locus_tag LOCUS_20030 29503 30786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 30957 32486 gene locus_tag LOCUS_20040 30957 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 32891 32502 gene locus_tag LOCUS_20050 gene cdd 32891 32502 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19079 protein_id gnl|my_center|LOCUS_20050 34211 32934 gene locus_tag LOCUS_20060 gene pyn 34211 32934 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122679.1 protein_id gnl|my_center|LOCUS_20060 34514 35494 gene locus_tag LOCUS_20070 34514 35494 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584122.1 protein_id gnl|my_center|LOCUS_20070 35609 36703 gene locus_tag LOCUS_20080 gene yjmC 35609 36703 CDS product putative oxidoreductase YjmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34736 protein_id gnl|my_center|LOCUS_20080 36793 37575 gene locus_tag LOCUS_20090 36793 37575 CDS product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_20090 39163 37613 gene locus_tag LOCUS_20100 39163 37613 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_20100 39722 39279 gene locus_tag LOCUS_20110 39722 39279 CDS product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 protein_id gnl|my_center|LOCUS_20110 40289 39759 gene locus_tag LOCUS_20120 40289 39759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117810.1 protein_id gnl|my_center|LOCUS_20120 42160 40283 gene locus_tag LOCUS_20130 gene cstA 42160 40283 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_20130 42500 43588 gene locus_tag LOCUS_20140 gene trx 42500 43588 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_20140 43713 45437 gene locus_tag LOCUS_20150 43713 45437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_20150 45600 47000 gene locus_tag LOCUS_20160 gene asnS 45600 47000 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHE1 protein_id gnl|my_center|LOCUS_20160 47260 48366 gene locus_tag LOCUS_20170 47260 48366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 48366 48587 gene locus_tag LOCUS_20180 48366 48587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 48865 51912 gene locus_tag LOCUS_20190 48865 51912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 51970 53445 gene locus_tag LOCUS_20200 51970 53445 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121659.1 protein_id gnl|my_center|LOCUS_20200 55745 53469 gene locus_tag LOCUS_20210 55745 53469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120678.1 protein_id gnl|my_center|LOCUS_20210 <56564 55766 gene locus_tag LOCUS_20220 <56564 55766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:surface protein >Feature sequence028 778 287 gene locus_tag LOCUS_20230 778 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334492.1 protein_id gnl|my_center|LOCUS_20230 1099 2610 gene locus_tag LOCUS_20240 1099 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2864 3895 gene locus_tag LOCUS_20250 2864 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4202 5050 gene locus_tag LOCUS_20260 4202 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 5918 5136 gene locus_tag LOCUS_20270 5918 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 8193 6034 gene locus_tag LOCUS_20280 8193 6034 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_20280 8507 9043 gene locus_tag LOCUS_20290 8507 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 9272 11062 gene locus_tag LOCUS_20300 9272 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 11242 11655 gene locus_tag LOCUS_20310 gene atkY 11242 11655 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_20310 12953 11652 gene locus_tag LOCUS_20320 12953 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 13215 14591 gene locus_tag LOCUS_20330 gene recQ 13215 14591 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120942.1 protein_id gnl|my_center|LOCUS_20330 14659 15432 gene locus_tag LOCUS_20340 14659 15432 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_20340 15524 16711 gene locus_tag LOCUS_20350 15524 16711 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368551.1 protein_id gnl|my_center|LOCUS_20350 17509 16811 gene locus_tag LOCUS_20360 17509 16811 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337436.1 protein_id gnl|my_center|LOCUS_20360 17854 18654 gene locus_tag LOCUS_20370 17854 18654 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_20370 20885 18657 gene locus_tag LOCUS_20380 20885 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 22528 21086 gene locus_tag LOCUS_20390 gene amtB 22528 21086 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYZ3 protein_id gnl|my_center|LOCUS_20390 23296 22772 gene locus_tag LOCUS_20400 23296 22772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 25388 23334 gene locus_tag LOCUS_20410 25388 23334 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966811.1 protein_id gnl|my_center|LOCUS_20410 26724 25492 gene locus_tag LOCUS_20420 26724 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 26875 28059 gene locus_tag LOCUS_20430 26875 28059 CDS product muconate-lactonizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_20430 28819 28088 gene locus_tag LOCUS_20440 28819 28088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_20440 29140 29817 gene locus_tag LOCUS_20450 gene pcxB 29140 29817 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121516.1 protein_id gnl|my_center|LOCUS_20450 29939 30607 gene locus_tag LOCUS_20460 29939 30607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 30801 32582 gene locus_tag LOCUS_20470 30801 32582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 32829 33959 gene locus_tag LOCUS_20480 32829 33959 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327030.1 protein_id gnl|my_center|LOCUS_20480 34286 35062 gene locus_tag LOCUS_20490 34286 35062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 35222 35923 gene locus_tag LOCUS_20500 35222 35923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 36236 35964 gene locus_tag LOCUS_20510 36236 35964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 39033 36247 gene locus_tag LOCUS_20520 39033 36247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 40065 41894 gene locus_tag LOCUS_20530 40065 41894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 41939 43381 gene locus_tag LOCUS_20540 41939 43381 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119008.1 protein_id gnl|my_center|LOCUS_20540 43446 44963 gene locus_tag LOCUS_20550 43446 44963 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_20550 45021 46913 gene locus_tag LOCUS_20560 45021 46913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 47305 46940 gene locus_tag LOCUS_20570 47305 46940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20570 48466 47357 gene locus_tag LOCUS_20580 48466 47357 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_20580 48611 51457 gene locus_tag LOCUS_20590 48611 51457 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117969.1 protein_id gnl|my_center|LOCUS_20590 51461 52951 gene locus_tag LOCUS_20600 51461 52951 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_20600 54458 52998 gene locus_tag LOCUS_20610 gene pepD 54458 52998 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence029 813 409 gene locus_tag LOCUS_20620 813 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 983 2275 gene locus_tag LOCUS_20630 983 2275 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_20630 3516 2305 gene locus_tag LOCUS_20640 gene trzA 3516 2305 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_20640 5897 3648 gene locus_tag LOCUS_20650 gene natB 5897 3648 CDS product sodium extrusion protein NatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121496.1 protein_id gnl|my_center|LOCUS_20650 6724 5921 gene locus_tag LOCUS_20660 gene natA 6724 5921 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_20660 7022 8392 gene locus_tag LOCUS_20670 7022 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 9053 8463 gene locus_tag LOCUS_20680 gene folE 9053 8463 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJJ7 protein_id gnl|my_center|LOCUS_20680 10854 9253 gene locus_tag LOCUS_20690 10854 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 protein_id gnl|my_center|LOCUS_20690 11106 11579 gene locus_tag LOCUS_20700 11106 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 12625 11585 gene locus_tag LOCUS_20710 gene aspG 12625 11585 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_20710 13727 12828 gene locus_tag LOCUS_20720 gene dapA 13727 12828 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVB1 protein_id gnl|my_center|LOCUS_20720 14574 13849 gene locus_tag LOCUS_20730 gene pdxJ 14574 13849 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V7M2 protein_id gnl|my_center|LOCUS_20730 15612 14704 gene locus_tag LOCUS_20740 15612 14704 CDS product beta-ribofuranosylaminobenzene 5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119640.1 protein_id gnl|my_center|LOCUS_20740 16279 15701 gene locus_tag LOCUS_20750 16279 15701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_20750 16989 16276 gene locus_tag LOCUS_20760 16989 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 18507 17047 gene locus_tag LOCUS_20770 gene pabB 18507 17047 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121081.1 protein_id gnl|my_center|LOCUS_20770 19120 18587 gene locus_tag LOCUS_20780 gene ftsH 19120 18587 CDS product cell division protein FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119291.1 protein_id gnl|my_center|LOCUS_20780 20670 19189 gene locus_tag LOCUS_20790 20670 19189 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_20790 20916 22049 gene locus_tag LOCUS_20800 gene argE 20916 22049 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122153.1 protein_id gnl|my_center|LOCUS_20800 22070 22480 gene locus_tag LOCUS_20810 gene argA 22070 22480 CDS product N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121908.1 protein_id gnl|my_center|LOCUS_20810 23374 22583 gene locus_tag LOCUS_20820 23374 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 24520 23384 gene locus_tag LOCUS_20830 24520 23384 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120004.1 protein_id gnl|my_center|LOCUS_20830 24679 25773 gene locus_tag LOCUS_20840 24679 25773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_20840 26738 25809 gene locus_tag LOCUS_20850 26738 25809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_20850 26942 29128 gene locus_tag LOCUS_20860 26942 29128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118523.1 protein_id gnl|my_center|LOCUS_20860 29779 29342 gene locus_tag LOCUS_20870 gene csrA 29779 29342 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNH6 protein_id gnl|my_center|LOCUS_20870 30856 30068 gene locus_tag LOCUS_20880 30856 30068 CDS product UvrB/UvrC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_20880 31739 33157 gene locus_tag LOCUS_20890 31739 33157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_20890 34191 33280 gene locus_tag LOCUS_20900 34191 33280 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028560.1 protein_id gnl|my_center|LOCUS_20900 36557 34767 gene locus_tag LOCUS_20910 36557 34767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 36998 36564 gene locus_tag LOCUS_20920 36998 36564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 36958 37353 gene locus_tag LOCUS_20930 36958 37353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 37640 37942 gene locus_tag LOCUS_20940 37640 37942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 38070 41612 gene locus_tag LOCUS_20950 38070 41612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 41829 44360 gene locus_tag LOCUS_20960 41829 44360 CDS product ABC export transporter fused inner membrane and ATPases inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_20960 44363 45835 gene locus_tag LOCUS_20970 44363 45835 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_20970 47158 45911 gene locus_tag LOCUS_20980 47158 45911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121620.1 protein_id gnl|my_center|LOCUS_20980 47820 50042 gene locus_tag LOCUS_20990 47820 50042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 50546 50139 gene locus_tag LOCUS_21000 gene rpsI 50546 50139 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY4 protein_id gnl|my_center|LOCUS_21000 51058 50609 gene locus_tag LOCUS_21010 gene rplM 51058 50609 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY3 protein_id gnl|my_center|LOCUS_21010 51626 52729 gene locus_tag LOCUS_21020 51626 52729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 52849 52934 gene locus_tag LOCUS_t00210 52849 52934 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence030 464 1168 gene locus_tag LOCUS_21030 464 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1274 6274 gene locus_tag LOCUS_21040 1274 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 6736 9876 gene locus_tag LOCUS_21050 6736 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 10016 11164 gene locus_tag LOCUS_21060 10016 11164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_21060 11260 12732 gene locus_tag LOCUS_21070 11260 12732 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117863.1 protein_id gnl|my_center|LOCUS_21070 12831 14210 gene locus_tag LOCUS_21080 gene atsG 12831 14210 CDS product sulfatase atsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122623.1 protein_id gnl|my_center|LOCUS_21080 14542 14330 gene locus_tag LOCUS_21090 14542 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 15088 15014 gene locus_tag LOCUS_t00220 15088 15014 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15537 16190 gene locus_tag LOCUS_21100 15537 16190 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333247.1 protein_id gnl|my_center|LOCUS_21100 17529 16333 gene locus_tag LOCUS_21110 17529 16333 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_21110 17839 19029 gene locus_tag LOCUS_21120 gene aspC 17839 19029 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335565.1 protein_id gnl|my_center|LOCUS_21120 19753 19145 gene locus_tag LOCUS_21130 19753 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 21756 19897 gene locus_tag LOCUS_21140 21756 19897 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGI3 protein_id gnl|my_center|LOCUS_21140 23721 23068 gene locus_tag LOCUS_21150 23721 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 25630 23954 gene locus_tag LOCUS_21160 gene dagA 25630 23954 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_21160 25887 26510 gene locus_tag LOCUS_21170 25887 26510 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_21170 26627 27451 gene locus_tag LOCUS_21180 26627 27451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122565.1 protein_id gnl|my_center|LOCUS_21180 27599 29011 gene locus_tag LOCUS_21190 27599 29011 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_21190 29067 30386 gene locus_tag LOCUS_21200 29067 30386 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122564.1 protein_id gnl|my_center|LOCUS_21200 30551 33013 gene locus_tag LOCUS_21210 30551 33013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 33148 33465 gene locus_tag LOCUS_21220 gene nirD 33148 33465 CDS product benzene 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_21220 33506 33829 gene locus_tag LOCUS_21230 33506 33829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326213.1 protein_id gnl|my_center|LOCUS_21230 33826 34164 gene locus_tag LOCUS_21240 33826 34164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 34271 35833 gene locus_tag LOCUS_21250 34271 35833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 36080 37252 gene locus_tag LOCUS_21260 gene hppD 36080 37252 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810913.1 protein_id gnl|my_center|LOCUS_21260 38446 39015 gene locus_tag LOCUS_21270 38446 39015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 40002 39028 gene locus_tag LOCUS_21280 40002 39028 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ58 protein_id gnl|my_center|LOCUS_21280 41431 40049 gene locus_tag LOCUS_21290 41431 40049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 41589 42704 gene locus_tag LOCUS_21300 41589 42704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 43300 42752 gene locus_tag LOCUS_21310 43300 42752 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_21310 43720 45123 gene locus_tag LOCUS_21320 gene atoC 43720 45123 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_21320 46423 45149 gene locus_tag LOCUS_21330 46423 45149 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123590.1 protein_id gnl|my_center|LOCUS_21330 46975 46622 gene locus_tag LOCUS_21340 46975 46622 CDS product ATP-dependent Clp protease ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_21340 47350 48741 gene locus_tag LOCUS_21350 gene dapE 47350 48741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_21350 48869 50161 gene locus_tag LOCUS_21360 gene serS 48869 50161 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXX6 protein_id gnl|my_center|LOCUS_21360 50806 50180 gene locus_tag LOCUS_21370 gene adk 50806 50180 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSH8 protein_id gnl|my_center|LOCUS_21370 >Feature sequence031 226 1986 gene locus_tag LOCUS_21380 226 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2306 2031 gene locus_tag LOCUS_21390 2306 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2311 3678 gene locus_tag LOCUS_21400 2311 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3701 4840 gene locus_tag LOCUS_21410 3701 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329769.1 protein_id gnl|my_center|LOCUS_21410 4994 6310 gene locus_tag LOCUS_21420 4994 6310 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_21420 6657 7748 gene locus_tag LOCUS_21430 6657 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 8411 7788 gene locus_tag LOCUS_21440 8411 7788 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_21440 9014 9712 gene locus_tag LOCUS_21450 gene nnrE 9014 9712 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX4 protein_id gnl|my_center|LOCUS_21450 10651 9722 gene locus_tag LOCUS_21460 10651 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660854.1 protein_id gnl|my_center|LOCUS_21460 11694 10885 gene locus_tag LOCUS_21470 11694 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 14292 11917 gene locus_tag LOCUS_21480 14292 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 14795 17431 gene locus_tag LOCUS_21490 gene mutS 14795 17431 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP05 protein_id gnl|my_center|LOCUS_21490 18160 17537 gene locus_tag LOCUS_21500 18160 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 19141 18767 gene locus_tag LOCUS_21510 19141 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 19546 20352 gene locus_tag LOCUS_21520 19546 20352 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118732.1 protein_id gnl|my_center|LOCUS_21520 20588 20794 gene locus_tag LOCUS_21530 20588 20794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 22383 22120 gene locus_tag LOCUS_21540 22383 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 23156 22644 gene locus_tag LOCUS_21550 23156 22644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 24234 23242 gene locus_tag LOCUS_21560 24234 23242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 25854 24808 gene locus_tag LOCUS_21570 25854 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122487.1 protein_id gnl|my_center|LOCUS_21570 27869 25854 gene locus_tag LOCUS_21580 27869 25854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_21580 29157 28099 gene locus_tag LOCUS_21590 gene spsE 29157 28099 CDS product sialic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_21590 30790 29225 gene locus_tag LOCUS_21600 30790 29225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 31529 30804 gene locus_tag LOCUS_21610 gene spsF 31529 30804 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 protein_id gnl|my_center|LOCUS_21610 32703 31534 gene locus_tag LOCUS_21620 32703 31534 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_21620 33770 32715 gene locus_tag LOCUS_21630 33770 32715 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_21630 35179 33932 gene locus_tag LOCUS_21640 35179 33932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 35261 35428 gene locus_tag LOCUS_21650 35261 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 36340 35411 gene locus_tag LOCUS_21660 36340 35411 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_21660 36641 37426 gene locus_tag LOCUS_21670 gene tylF 36641 37426 CDS product macrocin O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726905.1 protein_id gnl|my_center|LOCUS_21670 37426 38313 gene locus_tag LOCUS_21680 37426 38313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 38561 39451 gene locus_tag LOCUS_21690 gene dhlA 38561 39451 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122685.1 protein_id gnl|my_center|LOCUS_21690 39448 40344 gene locus_tag LOCUS_21700 39448 40344 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122686.1 protein_id gnl|my_center|LOCUS_21700 40349 40858 gene locus_tag LOCUS_21710 40349 40858 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_21710 42543 40945 gene locus_tag LOCUS_21720 42543 40945 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089326.1 protein_id gnl|my_center|LOCUS_21720 43775 42540 gene locus_tag LOCUS_21730 43775 42540 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_21730 45432 44197 gene locus_tag LOCUS_21740 45432 44197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 47665 45689 gene locus_tag LOCUS_21750 47665 45689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_21750 49423 47939 gene locus_tag LOCUS_21760 49423 47939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence032 500 706 gene locus_tag LOCUS_21770 gene rpmI 500 706 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP72 protein_id gnl|my_center|LOCUS_21770 809 1204 gene locus_tag LOCUS_21780 gene rplT 809 1204 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP74 protein_id gnl|my_center|LOCUS_21780 1478 2518 gene locus_tag LOCUS_21790 gene pheS 1478 2518 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP75 protein_id gnl|my_center|LOCUS_21790 2595 4643 gene locus_tag LOCUS_21800 gene pheT 2595 4643 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP77 protein_id gnl|my_center|LOCUS_21800 4663 5979 gene locus_tag LOCUS_21810 4663 5979 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_21810 6640 6053 gene locus_tag LOCUS_21820 6640 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 6791 8035 gene locus_tag LOCUS_21830 6791 8035 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_21830 8143 8544 gene locus_tag LOCUS_21840 8143 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123965.1 protein_id gnl|my_center|LOCUS_21840 8789 11449 gene locus_tag LOCUS_21850 8789 11449 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_21850 12670 11477 gene locus_tag LOCUS_21860 gene cpaE 12670 11477 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_21860 14315 12765 gene locus_tag LOCUS_21870 gene cpaC 14315 12765 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120311.1 protein_id gnl|my_center|LOCUS_21870 15508 14486 gene locus_tag LOCUS_21880 15508 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 16360 15785 gene locus_tag LOCUS_21890 gene cpaA 16360 15785 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_21890 16936 16748 gene locus_tag LOCUS_21900 16936 16748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 19126 17465 gene locus_tag LOCUS_21910 gene pknB 19126 17465 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_21910 19792 19148 gene locus_tag LOCUS_21920 gene cnrH 19792 19148 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122499.1 protein_id gnl|my_center|LOCUS_21920 21196 20003 gene locus_tag LOCUS_21930 21196 20003 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_21930 22473 21454 gene locus_tag LOCUS_21940 gene glnII 22473 21454 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_21940 23059 24414 gene locus_tag LOCUS_21950 gene glnA 23059 24414 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C40 protein_id gnl|my_center|LOCUS_21950 24503 24928 gene locus_tag LOCUS_21960 gene arsC 24503 24928 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641672.1 protein_id gnl|my_center|LOCUS_21960 25128 26012 gene locus_tag LOCUS_21970 gene nadC 25128 26012 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121013.1 protein_id gnl|my_center|LOCUS_21970 27235 26375 gene locus_tag LOCUS_21980 27235 26375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122963.1 protein_id gnl|my_center|LOCUS_21980 27764 27228 gene locus_tag LOCUS_21990 27764 27228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 28159 28995 gene locus_tag LOCUS_22000 28159 28995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 29126 30571 gene locus_tag LOCUS_22010 29126 30571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 30810 32831 gene locus_tag LOCUS_22020 30810 32831 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122741.1 protein_id gnl|my_center|LOCUS_22020 32812 33339 gene locus_tag LOCUS_22030 32812 33339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 33409 35253 gene locus_tag LOCUS_22040 gene cya 33409 35253 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_22040 35372 36259 gene locus_tag LOCUS_22050 35372 36259 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120714.1 protein_id gnl|my_center|LOCUS_22050 36399 37394 gene locus_tag LOCUS_22060 36399 37394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 37301 37507 gene locus_tag LOCUS_22070 37301 37507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 37508 38152 gene locus_tag LOCUS_22080 37508 38152 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118202.1 protein_id gnl|my_center|LOCUS_22080 38245 39144 gene locus_tag LOCUS_22090 gene mqnD 38245 39144 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJD8 protein_id gnl|my_center|LOCUS_22090 40515 39526 gene locus_tag LOCUS_22100 gene pknB 40515 39526 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 protein_id gnl|my_center|LOCUS_22100 43715 40584 gene locus_tag LOCUS_22110 43715 40584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 44186 45436 gene locus_tag LOCUS_22120 44186 45436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 45503 45919 gene locus_tag LOCUS_22130 45503 45919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 46071 48134 gene locus_tag LOCUS_22140 gene uvrB 46071 48134 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR2 protein_id gnl|my_center|LOCUS_22140 >Feature sequence033 1497 805 gene locus_tag LOCUS_22150 1497 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22150 2211 1648 gene locus_tag LOCUS_22160 2211 1648 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_22160 4117 2873 gene locus_tag LOCUS_22170 4117 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 4468 5925 gene locus_tag LOCUS_22180 4468 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 6082 8427 gene locus_tag LOCUS_22190 6082 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 8506 9885 gene locus_tag LOCUS_22200 8506 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119155.1 protein_id gnl|my_center|LOCUS_22200 10075 12642 gene locus_tag LOCUS_22210 10075 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 12642 14045 gene locus_tag LOCUS_22220 12642 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_22220 14195 16396 gene locus_tag LOCUS_22230 14195 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 16731 16441 gene locus_tag LOCUS_22240 16731 16441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 18352 16928 gene locus_tag LOCUS_22250 18352 16928 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_22250 21444 18349 gene locus_tag LOCUS_22260 21444 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 22295 21441 gene locus_tag LOCUS_22270 22295 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 23359 22838 gene locus_tag LOCUS_22280 23359 22838 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_22280 23857 23372 gene locus_tag LOCUS_22290 23857 23372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_22290 25364 23892 gene locus_tag LOCUS_22300 25364 23892 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123146.1 protein_id gnl|my_center|LOCUS_22300 25751 25443 gene locus_tag LOCUS_22310 25751 25443 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122082.1 protein_id gnl|my_center|LOCUS_22310 26372 26932 gene locus_tag LOCUS_22320 26372 26932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121177.1 protein_id gnl|my_center|LOCUS_22320 28689 27067 gene locus_tag LOCUS_22330 28689 27067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122094.1 protein_id gnl|my_center|LOCUS_22330 29211 28900 gene locus_tag LOCUS_22340 29211 28900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 29285 29629 gene locus_tag LOCUS_22350 29285 29629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 31708 30392 gene locus_tag LOCUS_22360 31708 30392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 32622 31705 gene locus_tag LOCUS_22370 32622 31705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_22370 33042 33398 gene locus_tag LOCUS_22380 gene ywzG 33042 33398 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_22380 33411 35300 gene locus_tag LOCUS_22390 33411 35300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 35537 36622 gene locus_tag LOCUS_22400 35537 36622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 39079 36683 gene locus_tag LOCUS_22410 39079 36683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 40824 39418 gene locus_tag LOCUS_22420 40824 39418 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888081.1 protein_id gnl|my_center|LOCUS_22420 41695 40880 gene locus_tag LOCUS_22430 gene plcA 41695 40880 CDS product 1-phosphatidylinositol phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34024 protein_id gnl|my_center|LOCUS_22430 42102 44303 gene locus_tag LOCUS_22440 42102 44303 CDS product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_22440 44557 44937 gene locus_tag LOCUS_22450 44557 44937 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947347.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence034 360 839 gene locus_tag LOCUS_22460 360 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1484 852 gene locus_tag LOCUS_22470 gene rsmG 1484 852 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMW0 protein_id gnl|my_center|LOCUS_22470 1837 1613 gene locus_tag LOCUS_22480 1837 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3069 1942 gene locus_tag LOCUS_22490 gene cdsA 3069 1942 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328412.1 protein_id gnl|my_center|LOCUS_22490 3803 3195 gene locus_tag LOCUS_22500 3803 3195 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332043.1 protein_id gnl|my_center|LOCUS_22500 4816 3977 gene locus_tag LOCUS_22510 4816 3977 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336262.1 protein_id gnl|my_center|LOCUS_22510 6204 5320 gene locus_tag LOCUS_22520 6204 5320 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_22520 6595 6239 gene locus_tag LOCUS_22530 6595 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 7545 6658 gene locus_tag LOCUS_22540 7545 6658 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_22540 7879 9189 gene locus_tag LOCUS_22550 7879 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 9332 10243 gene locus_tag LOCUS_22560 9332 10243 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_22560 10293 11699 gene locus_tag LOCUS_22570 10293 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 11721 12854 gene locus_tag LOCUS_22580 gene gspA 11721 12854 CDS product general stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25148 protein_id gnl|my_center|LOCUS_22580 12876 13811 gene locus_tag LOCUS_22590 12876 13811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 13815 15077 gene locus_tag LOCUS_22600 13815 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 16233 15130 gene locus_tag LOCUS_22610 gene aroB 16233 15130 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWN8 protein_id gnl|my_center|LOCUS_22610 17169 16297 gene locus_tag LOCUS_22620 17169 16297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 18840 17452 gene locus_tag LOCUS_22630 18840 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22630 19469 18858 gene locus_tag LOCUS_22640 19469 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22640 20654 22360 gene locus_tag LOCUS_22650 20654 22360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_22650 22464 23732 gene locus_tag LOCUS_22660 22464 23732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_22660 24013 25059 gene locus_tag LOCUS_22670 gene lpxD 24013 25059 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEV1 protein_id gnl|my_center|LOCUS_22670 25087 25989 gene locus_tag LOCUS_22680 25087 25989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122809.1 protein_id gnl|my_center|LOCUS_22680 26371 26018 gene locus_tag LOCUS_22690 26371 26018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 26746 27417 gene locus_tag LOCUS_22700 26746 27417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 27713 30019 gene locus_tag LOCUS_22710 27713 30019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22710 30107 30301 gene locus_tag LOCUS_22720 30107 30301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 31465 30392 gene locus_tag LOCUS_22730 gene purM 31465 30392 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI59 protein_id gnl|my_center|LOCUS_22730 31772 33862 gene locus_tag LOCUS_22740 gene glgX 31772 33862 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT9 protein_id gnl|my_center|LOCUS_22740 33814 34005 gene locus_tag LOCUS_22750 33814 34005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 34068 35159 gene locus_tag LOCUS_22760 gene dprA 34068 35159 CDS product DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122801.1 protein_id gnl|my_center|LOCUS_22760 35188 35955 gene locus_tag LOCUS_22770 35188 35955 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_22770 36106 37572 gene locus_tag LOCUS_22780 36106 37572 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_22780 38072 37641 gene locus_tag LOCUS_22790 38072 37641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 38507 38139 gene locus_tag LOCUS_22800 38507 38139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 39637 43500 gene locus_tag LOCUS_22810 39637 43500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 44399 43542 gene locus_tag LOCUS_22820 44399 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 44644 44994 gene locus_tag LOCUS_22830 44644 44994 CDS product anti-anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123775.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence035 78 4 gene locus_tag LOCUS_t00230 78 4 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 791 315 gene locus_tag LOCUS_22840 gene spoU 791 315 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU01 protein_id gnl|my_center|LOCUS_22840 983 2128 gene locus_tag LOCUS_22850 gene ispG 983 2128 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWC8 protein_id gnl|my_center|LOCUS_22850 2478 3842 gene locus_tag LOCUS_22860 gene mgtE 2478 3842 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN8 protein_id gnl|my_center|LOCUS_22860 4335 3997 gene locus_tag LOCUS_22870 4335 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5298 6239 gene locus_tag LOCUS_22880 5298 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 8433 6364 gene locus_tag LOCUS_22890 8433 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 11365 8516 gene locus_tag LOCUS_22900 11365 8516 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118284.1 protein_id gnl|my_center|LOCUS_22900 12243 11461 gene locus_tag LOCUS_22910 12243 11461 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_22910 13510 12542 gene locus_tag LOCUS_22920 13510 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 14587 13658 gene locus_tag LOCUS_22930 gene htrB 14587 13658 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_22930 15252 14824 gene locus_tag LOCUS_22940 15252 14824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 16476 15382 gene locus_tag LOCUS_22950 16476 15382 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_22950 17516 16542 gene locus_tag LOCUS_22960 17516 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 18223 17615 gene locus_tag LOCUS_22970 18223 17615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 18378 18899 gene locus_tag LOCUS_22980 18378 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_22980 20428 19037 gene locus_tag LOCUS_22990 gene rimO 20428 19037 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK39 protein_id gnl|my_center|LOCUS_22990 21792 20644 gene locus_tag LOCUS_23000 gene rsgA 21792 20644 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ6 protein_id gnl|my_center|LOCUS_23000 22285 23988 gene locus_tag LOCUS_23010 22285 23988 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_23010 24145 25323 gene locus_tag LOCUS_23020 gene ykuE 24145 25323 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121947.1 protein_id gnl|my_center|LOCUS_23020 25655 25461 gene locus_tag LOCUS_23030 25655 25461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 26035 28107 gene locus_tag LOCUS_23040 26035 28107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 28506 28312 gene locus_tag LOCUS_23050 28506 28312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 28562 31450 gene locus_tag LOCUS_23060 28562 31450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 31440 32828 gene locus_tag LOCUS_23070 31440 32828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 35574 32950 gene locus_tag LOCUS_23080 35574 32950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 36167 37348 gene locus_tag LOCUS_23090 36167 37348 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_23090 39256 37427 gene locus_tag LOCUS_23100 39256 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 40801 39539 gene locus_tag LOCUS_23110 40801 39539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 41942 40947 gene locus_tag LOCUS_23120 gene pyrH 41942 40947 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFI0 protein_id gnl|my_center|LOCUS_23120 42670 42314 gene locus_tag LOCUS_23130 42670 42314 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_23130 44371 43190 gene locus_tag LOCUS_23140 44371 43190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 44403 44609 gene locus_tag LOCUS_23150 44403 44609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence036 1743 1048 gene locus_tag LOCUS_23160 gene rpsH 1743 1048 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_23160 1989 2330 gene locus_tag LOCUS_23170 1989 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2420 2854 gene locus_tag LOCUS_23180 2420 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 3072 3263 gene locus_tag LOCUS_23190 3072 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4235 4417 gene locus_tag LOCUS_23200 4235 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4433 4642 gene locus_tag LOCUS_23210 4433 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 6622 5423 gene locus_tag LOCUS_23220 6622 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118845.1 protein_id gnl|my_center|LOCUS_23220 6867 8783 gene locus_tag LOCUS_23230 gene uroD 6867 8783 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN37 protein_id gnl|my_center|LOCUS_23230 9323 11056 gene locus_tag LOCUS_23240 gene shc 9323 11056 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120685.1 protein_id gnl|my_center|LOCUS_23240 11158 13050 gene locus_tag LOCUS_23250 11158 13050 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_23250 13154 13720 gene locus_tag LOCUS_23260 13154 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120683.1 protein_id gnl|my_center|LOCUS_23260 13759 14448 gene locus_tag LOCUS_23270 gene surE 13759 14448 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYP8 protein_id gnl|my_center|LOCUS_23270 14638 14868 gene locus_tag LOCUS_23280 14638 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 14865 16412 gene locus_tag LOCUS_23290 14865 16412 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_23290 16538 18376 gene locus_tag LOCUS_23300 16538 18376 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118571.1 protein_id gnl|my_center|LOCUS_23300 20350 18410 gene locus_tag LOCUS_23310 20350 18410 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869733.1 protein_id gnl|my_center|LOCUS_23310 21464 20439 gene locus_tag LOCUS_23320 21464 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815960.1 protein_id gnl|my_center|LOCUS_23320 22552 21653 gene locus_tag LOCUS_23330 22552 21653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 22737 23042 gene locus_tag LOCUS_23340 gene rpsR 22737 23042 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFN3 protein_id gnl|my_center|LOCUS_23340 23184 23609 gene locus_tag LOCUS_23350 23184 23609 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_23350 23646 24584 gene locus_tag LOCUS_23360 23646 24584 CDS product beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_23360 24734 25408 gene locus_tag LOCUS_23370 gene lolD1 24734 25408 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_23370 25405 28953 gene locus_tag LOCUS_23380 25405 28953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_23380 29061 29145 gene locus_tag LOCUS_t00240 29061 29145 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31881 29713 gene locus_tag LOCUS_23390 31881 29713 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020540.1 protein_id gnl|my_center|LOCUS_23390 32145 33665 gene locus_tag LOCUS_23400 32145 33665 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107896.1 protein_id gnl|my_center|LOCUS_23400 34617 36164 gene locus_tag LOCUS_23410 34617 36164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 36161 38026 gene locus_tag LOCUS_23420 36161 38026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 39904 38078 gene locus_tag LOCUS_23430 39904 38078 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121988.1 protein_id gnl|my_center|LOCUS_23430 40464 42608 gene locus_tag LOCUS_23440 gene prc 40464 42608 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_23440 43538 42732 gene locus_tag LOCUS_23450 gene phnP 43538 42732 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence037 1892 723 gene locus_tag LOCUS_23460 1892 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816786.1 protein_id gnl|my_center|LOCUS_23460 2118 3119 gene locus_tag LOCUS_23470 2118 3119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119554.1 protein_id gnl|my_center|LOCUS_23470 3176 5647 gene locus_tag LOCUS_23480 3176 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 5941 7134 gene locus_tag LOCUS_23490 5941 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 7152 7817 gene locus_tag LOCUS_23500 7152 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 7866 9419 gene locus_tag LOCUS_23510 7866 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 9860 10228 gene locus_tag LOCUS_23520 9860 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 10832 10293 gene locus_tag LOCUS_23530 10832 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 11249 11815 gene locus_tag LOCUS_23540 11249 11815 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_23540 13386 11869 gene locus_tag LOCUS_23550 13386 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 14332 13457 gene locus_tag LOCUS_23560 gene metF 14332 13457 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNJ7 protein_id gnl|my_center|LOCUS_23560 15774 14512 gene locus_tag LOCUS_23570 15774 14512 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119694.1 protein_id gnl|my_center|LOCUS_23570 16668 16069 gene locus_tag LOCUS_23580 16668 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 17917 17120 gene locus_tag LOCUS_23590 17917 17120 CDS product nickel transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532037.1 protein_id gnl|my_center|LOCUS_23590 19719 17992 gene locus_tag LOCUS_23600 19719 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118208.1 protein_id gnl|my_center|LOCUS_23600 23194 19862 gene locus_tag LOCUS_23610 23194 19862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 23610 23813 gene locus_tag LOCUS_23620 23610 23813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 24308 23844 gene locus_tag LOCUS_23630 24308 23844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 24611 24354 gene locus_tag LOCUS_23640 24611 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_23640 26782 24776 gene locus_tag LOCUS_23650 gene yoaA 26782 24776 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_23650 27813 26887 gene locus_tag LOCUS_23660 gene rluD 27813 26887 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119269.1 protein_id gnl|my_center|LOCUS_23660 29614 27902 gene locus_tag LOCUS_23670 29614 27902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_23670 31061 29745 gene locus_tag LOCUS_23680 31061 29745 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_23680 32037 31138 gene locus_tag LOCUS_23690 gene lppC 32037 31138 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404190.1 protein_id gnl|my_center|LOCUS_23690 33489 32191 gene locus_tag LOCUS_23700 33489 32191 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118005.1 protein_id gnl|my_center|LOCUS_23700 34643 33849 gene locus_tag LOCUS_23710 gene cysG 34643 33849 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521268.1 protein_id gnl|my_center|LOCUS_23710 35479 34640 gene locus_tag LOCUS_23720 35479 34640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 37235 35481 gene locus_tag LOCUS_23730 gene cysI 37235 35481 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CMX5 protein_id gnl|my_center|LOCUS_23730 38140 37295 gene locus_tag LOCUS_23740 gene yitB 38140 37295 CDS product putative phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06737 protein_id gnl|my_center|LOCUS_23740 39018 40388 gene locus_tag LOCUS_23750 39018 40388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 40450 41250 gene locus_tag LOCUS_23760 40450 41250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 41253 42368 gene locus_tag LOCUS_23770 41253 42368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence038 525 1901 gene locus_tag LOCUS_23780 525 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_23780 1985 4252 gene locus_tag LOCUS_23790 1985 4252 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_23790 4254 7091 gene locus_tag LOCUS_23800 4254 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120348.1 protein_id gnl|my_center|LOCUS_23800 7223 7987 gene locus_tag LOCUS_23810 gene glmU 7223 7987 CDS product UDP-N-acetylglucosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121125.1 protein_id gnl|my_center|LOCUS_23810 8088 9050 gene locus_tag LOCUS_23820 gene prs 8088 9050 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPM4 protein_id gnl|my_center|LOCUS_23820 9518 9174 gene locus_tag LOCUS_23830 gene groS 9518 9174 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU13 protein_id gnl|my_center|LOCUS_23830 10275 10853 gene locus_tag LOCUS_23840 gene rplY 10275 10853 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU9 protein_id gnl|my_center|LOCUS_23840 10872 11507 gene locus_tag LOCUS_23850 gene pth 10872 11507 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV0 protein_id gnl|my_center|LOCUS_23850 11560 11958 gene locus_tag LOCUS_23860 gene rpsF 11560 11958 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV1 protein_id gnl|my_center|LOCUS_23860 12126 12584 gene locus_tag LOCUS_23870 12126 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 12695 13231 gene locus_tag LOCUS_23880 gene rplI 12695 13231 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV4 protein_id gnl|my_center|LOCUS_23880 13489 14925 gene locus_tag LOCUS_23890 gene dnaB 13489 14925 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWY4 protein_id gnl|my_center|LOCUS_23890 16312 14972 gene locus_tag LOCUS_23900 16312 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 16667 17377 gene locus_tag LOCUS_23910 gene ate1 16667 17377 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UET6 protein_id gnl|my_center|LOCUS_23910 17462 18817 gene locus_tag LOCUS_23920 17462 18817 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_23920 18849 19466 gene locus_tag LOCUS_23930 18849 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 20268 19609 gene locus_tag LOCUS_23940 20268 19609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 22242 20290 gene locus_tag LOCUS_23950 22242 20290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 22941 22288 gene locus_tag LOCUS_23960 22941 22288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 24879 22963 gene locus_tag LOCUS_23970 24879 22963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 25174 26172 gene locus_tag LOCUS_23980 25174 26172 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118170.1 protein_id gnl|my_center|LOCUS_23980 26451 27710 gene locus_tag LOCUS_23990 gene fabF 26451 27710 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118441.1 protein_id gnl|my_center|LOCUS_23990 27819 28079 gene locus_tag LOCUS_24000 27819 28079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 28171 29559 gene locus_tag LOCUS_24010 gene crtI 28171 29559 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_24010 29728 31710 gene locus_tag LOCUS_24020 29728 31710 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_24020 32180 31848 gene locus_tag LOCUS_24030 32180 31848 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_24030 33079 32468 gene locus_tag LOCUS_24040 33079 32468 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121754.1 protein_id gnl|my_center|LOCUS_24040 34148 33291 gene locus_tag LOCUS_24050 34148 33291 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_24050 34722 34228 gene locus_tag LOCUS_24060 34722 34228 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120292.1 protein_id gnl|my_center|LOCUS_24060 35159 34782 gene locus_tag LOCUS_24070 35159 34782 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_24070 35396 37285 gene locus_tag LOCUS_24080 gene atsG 35396 37285 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_24080 38296 39813 gene locus_tag LOCUS_24090 38296 39813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 40628 39840 gene locus_tag LOCUS_24100 40628 39840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 42480 40864 gene locus_tag LOCUS_24110 gene aslA 42480 40864 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123091.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence039 1734 862 gene locus_tag LOCUS_24120 1734 862 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121801.1 protein_id gnl|my_center|LOCUS_24120 3171 1918 gene locus_tag LOCUS_24130 gene ncx 3171 1918 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121670.1 protein_id gnl|my_center|LOCUS_24130 3974 3228 gene locus_tag LOCUS_24140 gene truA 3974 3228 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU07 protein_id gnl|my_center|LOCUS_24140 4984 3989 gene locus_tag LOCUS_24150 gene asd 4984 3989 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UL17 protein_id gnl|my_center|LOCUS_24150 6129 5155 gene locus_tag LOCUS_24160 6129 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 6962 6129 gene locus_tag LOCUS_24170 6962 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 8257 7166 gene locus_tag LOCUS_24180 8257 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 9760 8600 gene locus_tag LOCUS_24190 9760 8600 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123564.1 protein_id gnl|my_center|LOCUS_24190 10053 10796 gene locus_tag LOCUS_24200 10053 10796 CDS product CAAX prenyl protease-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942635.1 protein_id gnl|my_center|LOCUS_24200 12278 10824 gene locus_tag LOCUS_24210 12278 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118341.1 protein_id gnl|my_center|LOCUS_24210 14253 12298 gene locus_tag LOCUS_24220 14253 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 16507 14471 gene locus_tag LOCUS_24230 16507 14471 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_24230 17211 16609 gene locus_tag LOCUS_24240 17211 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_24240 18447 17350 gene locus_tag LOCUS_24250 18447 17350 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326016.1 protein_id gnl|my_center|LOCUS_24250 20386 18467 gene locus_tag LOCUS_24260 20386 18467 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_24260 21726 20584 gene locus_tag LOCUS_24270 21726 20584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 22583 21948 gene locus_tag LOCUS_24280 22583 21948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 24776 24937 gene locus_tag LOCUS_24290 24776 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 25019 25381 gene locus_tag LOCUS_24300 25019 25381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 25628 26911 gene locus_tag LOCUS_24310 gene clpX 25628 26911 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU7 protein_id gnl|my_center|LOCUS_24310 28267 27386 gene locus_tag LOCUS_24320 28267 27386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 28444 28791 gene locus_tag LOCUS_24330 28444 28791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 29811 28879 gene locus_tag LOCUS_24340 29811 28879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_24340 32112 29830 gene locus_tag LOCUS_24350 32112 29830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121270.1 protein_id gnl|my_center|LOCUS_24350 32654 32280 gene locus_tag LOCUS_24360 32654 32280 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_24360 33021 32641 gene locus_tag LOCUS_24370 gene nasE 33021 32641 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_24370 34110 33136 gene locus_tag LOCUS_24380 34110 33136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 34821 34132 gene locus_tag LOCUS_24390 34821 34132 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIT1 protein_id gnl|my_center|LOCUS_24390 36406 34979 gene locus_tag LOCUS_24400 gene pgi 36406 34979 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYT0 protein_id gnl|my_center|LOCUS_24400 36748 38394 gene locus_tag LOCUS_24410 gene gpmI 36748 38394 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59173 protein_id gnl|my_center|LOCUS_24410 38487 39599 gene locus_tag LOCUS_24420 38487 39599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602095.1 protein_id gnl|my_center|LOCUS_24420 39898 40386 gene locus_tag LOCUS_24430 39898 40386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 40930 40433 gene locus_tag LOCUS_24440 40930 40433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120345.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence040 2211 1060 gene locus_tag LOCUS_24450 2211 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4212 2974 gene locus_tag LOCUS_24460 gene ogt 4212 2974 CDS product O-linked GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118172.1 protein_id gnl|my_center|LOCUS_24460 4985 4677 gene locus_tag LOCUS_24470 4985 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 5525 5719 gene locus_tag LOCUS_24480 5525 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 6110 5739 gene locus_tag LOCUS_24490 6110 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 6296 7318 gene locus_tag LOCUS_24500 6296 7318 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH8 protein_id gnl|my_center|LOCUS_24500 7437 8054 gene locus_tag LOCUS_24510 7437 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 8393 8584 gene locus_tag LOCUS_24520 8393 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 8581 11898 gene locus_tag LOCUS_24530 8581 11898 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117884.1 protein_id gnl|my_center|LOCUS_24530 12122 13003 gene locus_tag LOCUS_24540 gene argB 12122 13003 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ8 protein_id gnl|my_center|LOCUS_24540 13045 13974 gene locus_tag LOCUS_24550 gene argF 13045 13974 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ6 protein_id gnl|my_center|LOCUS_24550 14038 14757 gene locus_tag LOCUS_24560 gene rph 14038 14757 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URE2 protein_id gnl|my_center|LOCUS_24560 15088 14822 gene locus_tag LOCUS_24570 15088 14822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 16157 15117 gene locus_tag LOCUS_24580 16157 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_24580 16781 16188 gene locus_tag LOCUS_24590 16781 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 17380 16964 gene locus_tag LOCUS_24600 17380 16964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 17681 18493 gene locus_tag LOCUS_24610 17681 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 18529 19260 gene locus_tag LOCUS_24620 18529 19260 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464630.1 protein_id gnl|my_center|LOCUS_24620 20447 19305 gene locus_tag LOCUS_24630 gene prpC 20447 19305 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883R2 protein_id gnl|my_center|LOCUS_24630 21328 20444 gene locus_tag LOCUS_24640 gene prpB 21328 20444 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZF8 protein_id gnl|my_center|LOCUS_24640 21690 23285 gene locus_tag LOCUS_24650 gene pckA2 21690 23285 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S008 protein_id gnl|my_center|LOCUS_24650 26957 23334 gene locus_tag LOCUS_24660 26957 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 27887 27360 gene locus_tag LOCUS_24670 27887 27360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 28040 29380 gene locus_tag LOCUS_24680 28040 29380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119642.1 protein_id gnl|my_center|LOCUS_24680 29439 30011 gene locus_tag LOCUS_24690 29439 30011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 30996 30076 gene locus_tag LOCUS_24700 30996 30076 CDS product iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_24700 32384 31317 gene locus_tag LOCUS_24710 32384 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 32762 32487 gene locus_tag LOCUS_24720 32762 32487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 33053 32865 gene locus_tag LOCUS_24730 33053 32865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 33404 34492 gene locus_tag LOCUS_24740 33404 34492 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118508.1 protein_id gnl|my_center|LOCUS_24740 34500 35495 gene locus_tag LOCUS_24750 34500 35495 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118508.1 protein_id gnl|my_center|LOCUS_24750 36904 35546 gene locus_tag LOCUS_24760 36904 35546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 38698 37190 gene locus_tag LOCUS_24770 38698 37190 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355117.1 protein_id gnl|my_center|LOCUS_24770 39239 40201 gene locus_tag LOCUS_24780 39239 40201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_24780 40328 41989 gene locus_tag LOCUS_24790 40328 41989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325469.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence041 313 1494 gene locus_tag LOCUS_24800 313 1494 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_24800 1696 3036 gene locus_tag LOCUS_24810 1696 3036 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_24810 3144 5057 gene locus_tag LOCUS_24820 3144 5057 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118855.1 protein_id gnl|my_center|LOCUS_24820 8977 5054 gene locus_tag LOCUS_24830 gene oplaH 8977 5054 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_24830 10256 8985 gene locus_tag LOCUS_24840 10256 8985 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122959.1 protein_id gnl|my_center|LOCUS_24840 11385 10354 gene locus_tag LOCUS_24850 11385 10354 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122136.1 protein_id gnl|my_center|LOCUS_24850 13438 11513 gene locus_tag LOCUS_24860 gene cysNC 13438 11513 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMW2 protein_id gnl|my_center|LOCUS_24860 14428 13520 gene locus_tag LOCUS_24870 gene cysD 14428 13520 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_24870 15871 14816 gene locus_tag LOCUS_24880 gene tal 15871 14816 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUN2 protein_id gnl|my_center|LOCUS_24880 17048 16155 gene locus_tag LOCUS_24890 17048 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 17288 17497 gene locus_tag LOCUS_24900 17288 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 17491 18336 gene locus_tag LOCUS_24910 17491 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 19597 18458 gene locus_tag LOCUS_24920 19597 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 19974 19741 gene locus_tag LOCUS_24930 19974 19741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 21460 19919 gene locus_tag LOCUS_24940 21460 19919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122556.1 protein_id gnl|my_center|LOCUS_24940 23511 21787 gene locus_tag LOCUS_24950 23511 21787 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_24950 23890 23501 gene locus_tag LOCUS_24960 23890 23501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 25439 23931 gene locus_tag LOCUS_24970 25439 23931 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_24970 26926 25436 gene locus_tag LOCUS_24980 26926 25436 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_24980 27408 26923 gene locus_tag LOCUS_24990 27408 26923 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335819.1 protein_id gnl|my_center|LOCUS_24990 27890 27405 gene locus_tag LOCUS_25000 27890 27405 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_25000 28495 27887 gene locus_tag LOCUS_25010 28495 27887 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328224.1 protein_id gnl|my_center|LOCUS_25010 28852 28523 gene locus_tag LOCUS_25020 28852 28523 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_25020 29187 28849 gene locus_tag LOCUS_25030 29187 28849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 29664 29191 gene locus_tag LOCUS_25040 29664 29191 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_25040 30423 30244 gene locus_tag LOCUS_25050 30423 30244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 31396 30506 gene locus_tag LOCUS_25060 31396 30506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 protein_id gnl|my_center|LOCUS_25060 32250 31570 gene locus_tag LOCUS_25070 32250 31570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 32551 33666 gene locus_tag LOCUS_25080 32551 33666 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_25080 33885 34409 gene locus_tag LOCUS_25090 33885 34409 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329169.1 protein_id gnl|my_center|LOCUS_25090 34420 35940 gene locus_tag LOCUS_25100 34420 35940 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_25100 36402 36034 gene locus_tag LOCUS_25110 36402 36034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962578.1 protein_id gnl|my_center|LOCUS_25110 36583 36762 gene locus_tag LOCUS_25120 36583 36762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 37093 37776 gene locus_tag LOCUS_25130 37093 37776 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_25130 37984 41349 gene locus_tag LOCUS_25140 37984 41349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence042 1531 2391 gene locus_tag LOCUS_25150 1531 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3056 2436 gene locus_tag LOCUS_25160 3056 2436 CDS product hydrolase phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123566.1 protein_id gnl|my_center|LOCUS_25160 3434 4897 gene locus_tag LOCUS_25170 gene chlI 3434 4897 CDS product magnesium protoporphyrin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117844.1 protein_id gnl|my_center|LOCUS_25170 4933 6636 gene locus_tag LOCUS_25180 4933 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_25180 7392 6739 gene locus_tag LOCUS_25190 7392 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 7731 10289 gene locus_tag LOCUS_25200 7731 10289 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_25200 12676 10313 gene locus_tag LOCUS_25210 12676 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 13201 14619 gene locus_tag LOCUS_25220 gene purB 13201 14619 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJA2 protein_id gnl|my_center|LOCUS_25220 16128 14692 gene locus_tag LOCUS_25230 16128 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 17655 16252 gene locus_tag LOCUS_25240 gene mnmE 17655 16252 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJI3 protein_id gnl|my_center|LOCUS_25240 20100 17659 gene locus_tag LOCUS_25250 gene yidC 20100 17659 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFZ2 protein_id gnl|my_center|LOCUS_25250 21200 20454 gene locus_tag LOCUS_25260 21200 20454 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327495.1 protein_id gnl|my_center|LOCUS_25260 22111 21353 gene locus_tag LOCUS_25270 22111 21353 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_25270 22424 23350 gene locus_tag LOCUS_25280 22424 23350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 23711 24316 gene locus_tag LOCUS_25290 23711 24316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 24577 25122 gene locus_tag LOCUS_25300 24577 25122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 25847 25275 gene locus_tag LOCUS_25310 gene fur 25847 25275 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121869.1 protein_id gnl|my_center|LOCUS_25310 26771 25956 gene locus_tag LOCUS_25320 26771 25956 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_25320 27166 26906 gene locus_tag LOCUS_25330 27166 26906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326599.1 protein_id gnl|my_center|LOCUS_25330 27265 27951 gene locus_tag LOCUS_25340 27265 27951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 28398 28003 gene locus_tag LOCUS_25350 28398 28003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 28336 28812 gene locus_tag LOCUS_25360 28336 28812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 28890 32135 gene locus_tag LOCUS_25370 gene mfd 28890 32135 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN7 protein_id gnl|my_center|LOCUS_25370 32246 33820 gene locus_tag LOCUS_25380 32246 33820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 34149 35435 gene locus_tag LOCUS_25390 gene gltA 34149 35435 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_25390 40269 35611 gene locus_tag LOCUS_25400 40269 35611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence043 1044 1574 gene locus_tag LOCUS_25410 1044 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324288.1 protein_id gnl|my_center|LOCUS_25410 1641 2612 gene locus_tag LOCUS_25420 1641 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 4274 2631 gene locus_tag LOCUS_25430 4274 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 6249 4438 gene locus_tag LOCUS_25440 gene uup 6249 4438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120247.1 protein_id gnl|my_center|LOCUS_25440 10189 6446 gene locus_tag LOCUS_25450 10189 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 11776 10286 gene locus_tag LOCUS_25460 11776 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 16167 11971 gene locus_tag LOCUS_25470 16167 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 17734 16442 gene locus_tag LOCUS_25480 17734 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_25480 19915 17813 gene locus_tag LOCUS_25490 19915 17813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_25490 20533 22368 gene locus_tag LOCUS_25500 20533 22368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 23167 22565 gene locus_tag LOCUS_25510 23167 22565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 23370 24428 gene locus_tag LOCUS_25520 gene ffsA 23370 24428 CDS product formylmethanofuran--tetrahydromethanopterin formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKZ8 protein_id gnl|my_center|LOCUS_25520 24551 26134 gene locus_tag LOCUS_25530 24551 26134 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058287.1 protein_id gnl|my_center|LOCUS_25530 26362 27873 gene locus_tag LOCUS_25540 26362 27873 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122409.1 protein_id gnl|my_center|LOCUS_25540 28016 29599 gene locus_tag LOCUS_25550 gene rpsA 28016 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 protein_id gnl|my_center|LOCUS_25550 29754 30881 gene locus_tag LOCUS_25560 gene pyrD 29754 30881 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NC99 protein_id gnl|my_center|LOCUS_25560 30871 31587 gene locus_tag LOCUS_25570 30871 31587 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120363.1 protein_id gnl|my_center|LOCUS_25570 32185 33003 gene locus_tag LOCUS_25580 gene panB 32185 33003 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM39 protein_id gnl|my_center|LOCUS_25580 33225 34934 gene locus_tag LOCUS_25590 33225 34934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 35317 34976 gene locus_tag LOCUS_25600 35317 34976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 35716 35366 gene locus_tag LOCUS_25610 35716 35366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_25610 35890 37197 gene locus_tag LOCUS_25620 35890 37197 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_25620 37598 38557 gene locus_tag LOCUS_25630 37598 38557 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121978.1 protein_id gnl|my_center|LOCUS_25630 38664 39017 gene locus_tag LOCUS_25640 38664 39017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence044 1717 4500 gene locus_tag LOCUS_25650 gene sucA 1717 4500 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326049.1 protein_id gnl|my_center|LOCUS_25650 4591 5853 gene locus_tag LOCUS_25660 gene sucB 4591 5853 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX6 protein_id gnl|my_center|LOCUS_25660 5964 7346 gene locus_tag LOCUS_25670 gene dldH 5964 7346 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVC8 protein_id gnl|my_center|LOCUS_25670 7519 8391 gene locus_tag LOCUS_25680 7519 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 8802 8635 gene locus_tag LOCUS_25690 8802 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 8859 9500 gene locus_tag LOCUS_25700 8859 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 10020 10877 gene locus_tag LOCUS_25710 10020 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 11017 11235 gene locus_tag LOCUS_25720 11017 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 11172 11615 gene locus_tag LOCUS_25730 11172 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 11793 13367 gene locus_tag LOCUS_25740 11793 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 13457 14698 gene locus_tag LOCUS_25750 gene dapL 13457 14698 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 protein_id gnl|my_center|LOCUS_25750 15547 14768 gene locus_tag LOCUS_25760 15547 14768 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970992.1 protein_id gnl|my_center|LOCUS_25760 15716 15892 gene locus_tag LOCUS_25770 15716 15892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 16958 15927 gene locus_tag LOCUS_25780 gene adh 16958 15927 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_25780 18576 17083 gene locus_tag LOCUS_25790 18576 17083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 19285 18614 gene locus_tag LOCUS_25800 19285 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 21244 19307 gene locus_tag LOCUS_25810 21244 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 21899 21237 gene locus_tag LOCUS_25820 21899 21237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 23846 21921 gene locus_tag LOCUS_25830 23846 21921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 24504 23848 gene locus_tag LOCUS_25840 24504 23848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 26367 24526 gene locus_tag LOCUS_25850 26367 24526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 26692 27903 gene locus_tag LOCUS_25860 gene ybhE 26692 27903 CDS product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_25860 28190 29926 gene locus_tag LOCUS_25870 gene ybiT 28190 29926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122134.1 protein_id gnl|my_center|LOCUS_25870 30061 30609 gene locus_tag LOCUS_25880 30061 30609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 31074 32033 gene locus_tag LOCUS_25890 31074 32033 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_25890 32158 34461 gene locus_tag LOCUS_25900 32158 34461 CDS product 7TM receptor with intracellular metal dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330940.1 protein_id gnl|my_center|LOCUS_25900 34486 34965 gene locus_tag LOCUS_25910 34486 34965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 34965 36245 gene locus_tag LOCUS_25920 34965 36245 CDS product hemolysin activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119979.1 protein_id gnl|my_center|LOCUS_25920 39343 36299 gene locus_tag LOCUS_25930 39343 36299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence045 378 1100 gene locus_tag LOCUS_25940 gene rex 378 1100 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WX14 protein_id gnl|my_center|LOCUS_25940 1169 1239 gene locus_tag LOCUS_t00250 1169 1239 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1550 2746 gene locus_tag LOCUS_25950 1550 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3033 4415 gene locus_tag LOCUS_25960 3033 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 4425 5294 gene locus_tag LOCUS_25970 4425 5294 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883169.1 protein_id gnl|my_center|LOCUS_25970 5301 6122 gene locus_tag LOCUS_25980 gene spoU 5301 6122 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121690.1 protein_id gnl|my_center|LOCUS_25980 6901 6173 gene locus_tag LOCUS_25990 6901 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 7821 7333 gene locus_tag LOCUS_26000 7821 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 8283 8789 gene locus_tag LOCUS_26010 8283 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 9117 8920 gene locus_tag LOCUS_26020 gene rpsU 9117 8920 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UZ14 protein_id gnl|my_center|LOCUS_26020 9563 9871 gene locus_tag LOCUS_26030 9563 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 11706 9958 gene locus_tag LOCUS_26040 11706 9958 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122025.1 protein_id gnl|my_center|LOCUS_26040 11974 13284 gene locus_tag LOCUS_26050 11974 13284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_26050 13374 14465 gene locus_tag LOCUS_26060 13374 14465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 15326 14484 gene locus_tag LOCUS_26070 15326 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 16233 15478 gene locus_tag LOCUS_26080 16233 15478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 17314 16253 gene locus_tag LOCUS_26090 17314 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 18584 17412 gene locus_tag LOCUS_26100 18584 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKS7 protein_id gnl|my_center|LOCUS_26100 19615 18710 gene locus_tag LOCUS_26110 19615 18710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 19816 20223 gene locus_tag LOCUS_26120 19816 20223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 21358 20294 gene locus_tag LOCUS_26130 21358 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 22641 21580 gene locus_tag LOCUS_26140 22641 21580 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765594.1 protein_id gnl|my_center|LOCUS_26140 22864 23613 gene locus_tag LOCUS_26150 gene trpF 22864 23613 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKL4 protein_id gnl|my_center|LOCUS_26150 23849 25354 gene locus_tag LOCUS_26160 gene ahcY 23849 25354 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_26160 25540 26274 gene locus_tag LOCUS_26170 25540 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 26499 27842 gene locus_tag LOCUS_26180 26499 27842 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118925.1 protein_id gnl|my_center|LOCUS_26180 28428 29174 gene locus_tag LOCUS_26190 gene parA 28428 29174 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118760.1 protein_id gnl|my_center|LOCUS_26190 29167 30144 gene locus_tag LOCUS_26200 gene parB 29167 30144 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 protein_id gnl|my_center|LOCUS_26200 30307 30382 gene locus_tag LOCUS_t00260 30307 30382 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30485 31012 gene locus_tag LOCUS_26210 30485 31012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 31523 32758 gene locus_tag LOCUS_26220 31523 32758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 32805 35087 gene locus_tag LOCUS_26230 32805 35087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 35124 36245 gene locus_tag LOCUS_26240 35124 36245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 36293 37318 gene locus_tag LOCUS_26250 gene galE 36293 37318 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55180 protein_id gnl|my_center|LOCUS_26250 37272 38264 gene locus_tag LOCUS_26260 37272 38264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 38318 38752 gene locus_tag LOCUS_26270 38318 38752 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence046 1452 577 gene locus_tag LOCUS_26280 1452 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2163 1702 gene locus_tag LOCUS_26290 2163 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2837 3985 gene locus_tag LOCUS_26300 2837 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118718.1 protein_id gnl|my_center|LOCUS_26300 4099 4401 gene locus_tag LOCUS_26310 4099 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 4447 4740 gene locus_tag LOCUS_26320 4447 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 5635 4838 gene locus_tag LOCUS_26330 gene suhB 5635 4838 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117902.1 protein_id gnl|my_center|LOCUS_26330 5855 6127 gene locus_tag LOCUS_26340 5855 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 6305 8065 gene locus_tag LOCUS_26350 6305 8065 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327079.1 protein_id gnl|my_center|LOCUS_26350 9408 8299 gene locus_tag LOCUS_26360 9408 8299 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_26360 10265 9405 gene locus_tag LOCUS_26370 gene lpxA 10265 9405 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ1 protein_id gnl|my_center|LOCUS_26370 11065 10277 gene locus_tag LOCUS_26380 gene lpxC 11065 10277 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ2 protein_id gnl|my_center|LOCUS_26380 11814 11206 gene locus_tag LOCUS_26390 11814 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 13011 11995 gene locus_tag LOCUS_26400 13011 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 13146 14201 gene locus_tag LOCUS_26410 13146 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 14230 15201 gene locus_tag LOCUS_26420 14230 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 15543 16955 gene locus_tag LOCUS_26430 15543 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120846.1 protein_id gnl|my_center|LOCUS_26430 17162 18730 gene locus_tag LOCUS_26440 gene cysS 17162 18730 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3T5 protein_id gnl|my_center|LOCUS_26440 18911 19420 gene locus_tag LOCUS_26450 18911 19420 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723593.1 protein_id gnl|my_center|LOCUS_26450 20713 19445 gene locus_tag LOCUS_26460 20713 19445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 22093 20720 gene locus_tag LOCUS_26470 22093 20720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 22491 22177 gene locus_tag LOCUS_26480 22491 22177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 22631 23464 gene locus_tag LOCUS_26490 22631 23464 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_26490 23506 24789 gene locus_tag LOCUS_26500 gene kynU 23506 24789 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD2 protein_id gnl|my_center|LOCUS_26500 24849 26243 gene locus_tag LOCUS_26510 gene kmo 24849 26243 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD3 protein_id gnl|my_center|LOCUS_26510 27485 26286 gene locus_tag LOCUS_26520 27485 26286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 29079 27922 gene locus_tag LOCUS_26530 29079 27922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 31366 29891 gene locus_tag LOCUS_26540 gene guaB 31366 29891 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJL3 protein_id gnl|my_center|LOCUS_26540 31415 31624 gene locus_tag LOCUS_26550 31415 31624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 31838 31671 gene locus_tag LOCUS_26560 31838 31671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 31813 32961 gene locus_tag LOCUS_26570 gene xseA 31813 32961 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTZ9 protein_id gnl|my_center|LOCUS_26570 33093 33473 gene locus_tag LOCUS_26580 33093 33473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 33568 34470 gene locus_tag LOCUS_26590 gene ggpP 33568 34470 CDS product geranylgeranyl pyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_26590 34473 36377 gene locus_tag LOCUS_26600 gene dxs 34473 36377 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB7 protein_id gnl|my_center|LOCUS_26600 36456 37325 gene locus_tag LOCUS_26610 gene nadK 36456 37325 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB8 protein_id gnl|my_center|LOCUS_26610 37431 38477 gene locus_tag LOCUS_26620 37431 38477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence047 2174 672 gene locus_tag LOCUS_26630 2174 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2366 3262 gene locus_tag LOCUS_26640 2366 3262 CDS product regucalcin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181677.1 protein_id gnl|my_center|LOCUS_26640 5037 3292 gene locus_tag LOCUS_26650 5037 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 5702 5124 gene locus_tag LOCUS_26660 5702 5124 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_26660 7253 5793 gene locus_tag LOCUS_26670 7253 5793 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_26670 10718 7257 gene locus_tag LOCUS_26680 10718 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 11142 14357 gene locus_tag LOCUS_26690 11142 14357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_26690 14370 15827 gene locus_tag LOCUS_26700 14370 15827 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117906.1 protein_id gnl|my_center|LOCUS_26700 15951 16808 gene locus_tag LOCUS_26710 15951 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803961.1 protein_id gnl|my_center|LOCUS_26710 17758 16817 gene locus_tag LOCUS_26720 17758 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 18232 17768 gene locus_tag LOCUS_26730 18232 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 19670 18471 gene locus_tag LOCUS_26740 19670 18471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 20054 21451 gene locus_tag LOCUS_26750 gene gadA 20054 21451 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5Y7 protein_id gnl|my_center|LOCUS_26750 22539 23957 gene locus_tag LOCUS_26760 gene phr 22539 23957 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_26760 25540 24056 gene locus_tag LOCUS_26770 25540 24056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 26000 26446 gene locus_tag LOCUS_26780 26000 26446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 28813 26465 gene locus_tag LOCUS_26790 28813 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 29179 30111 gene locus_tag LOCUS_26800 29179 30111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 30735 31529 gene locus_tag LOCUS_26810 30735 31529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 31786 32856 gene locus_tag LOCUS_26820 31786 32856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120381.1 protein_id gnl|my_center|LOCUS_26820 33783 33031 gene locus_tag LOCUS_26830 33783 33031 CDS product endonuclease/exonuclease/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268327.1 protein_id gnl|my_center|LOCUS_26830 34016 34960 gene locus_tag LOCUS_26840 34016 34960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 35295 35816 gene locus_tag LOCUS_26850 35295 35816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 36315 35929 gene locus_tag LOCUS_26860 36315 35929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 37351 36464 gene locus_tag LOCUS_26870 37351 36464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence048 652 221 gene locus_tag LOCUS_26880 652 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1198 812 gene locus_tag LOCUS_26890 1198 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 1746 1282 gene locus_tag LOCUS_26900 1746 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3947 2610 gene locus_tag LOCUS_26910 3947 2610 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_26910 4574 5338 gene locus_tag LOCUS_26920 4574 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 6822 5443 gene locus_tag LOCUS_26930 6822 5443 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_26930 7332 18083 gene locus_tag LOCUS_26940 7332 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 18611 18177 gene locus_tag LOCUS_26950 18611 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071321.1 protein_id gnl|my_center|LOCUS_26950 19913 18984 gene locus_tag LOCUS_26960 19913 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 21871 20096 gene locus_tag LOCUS_26970 21871 20096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 23005 22163 gene locus_tag LOCUS_26980 23005 22163 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123158.1 protein_id gnl|my_center|LOCUS_26980 23610 23224 gene locus_tag LOCUS_26990 23610 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 24580 25365 gene locus_tag LOCUS_27000 24580 25365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_27000 25643 26848 gene locus_tag LOCUS_27010 25643 26848 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531061.1 protein_id gnl|my_center|LOCUS_27010 27311 27093 gene locus_tag LOCUS_27020 27311 27093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 28592 27768 gene locus_tag LOCUS_27030 28592 27768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 29484 30434 gene locus_tag LOCUS_27040 29484 30434 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_27040 31383 35357 gene locus_tag LOCUS_27050 31383 35357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 35385 36620 gene locus_tag LOCUS_27060 35385 36620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence049 686 288 gene locus_tag LOCUS_27070 686 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 854 1636 gene locus_tag LOCUS_27080 gene rpsB 854 1636 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH4 protein_id gnl|my_center|LOCUS_27080 1870 2859 gene locus_tag LOCUS_27090 gene tsf 1870 2859 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH3 protein_id gnl|my_center|LOCUS_27090 3151 3810 gene locus_tag LOCUS_27100 gene pyrH 3151 3810 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH1 protein_id gnl|my_center|LOCUS_27100 3993 4553 gene locus_tag LOCUS_27110 gene frr 3993 4553 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH0 protein_id gnl|my_center|LOCUS_27110 7069 8850 gene locus_tag LOCUS_27120 7069 8850 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_27120 10022 8964 gene locus_tag LOCUS_27130 10022 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 10913 10353 gene locus_tag LOCUS_27140 10913 10353 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530095.1 protein_id gnl|my_center|LOCUS_27140 12793 10964 gene locus_tag LOCUS_27150 12793 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 14556 13123 gene locus_tag LOCUS_27160 14556 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 15201 14944 gene locus_tag LOCUS_27170 15201 14944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 16535 15504 gene locus_tag LOCUS_27180 16535 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 17073 16528 gene locus_tag LOCUS_27190 17073 16528 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UV68 protein_id gnl|my_center|LOCUS_27190 17698 17528 gene locus_tag LOCUS_27200 17698 17528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 18271 17717 gene locus_tag LOCUS_27210 18271 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119186.1 protein_id gnl|my_center|LOCUS_27210 19596 18676 gene locus_tag LOCUS_27220 19596 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 20903 19593 gene locus_tag LOCUS_27230 20903 19593 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_27230 23019 21226 gene locus_tag LOCUS_27240 23019 21226 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122637.1 protein_id gnl|my_center|LOCUS_27240 24065 24601 gene locus_tag LOCUS_27250 24065 24601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 24647 25147 gene locus_tag LOCUS_27260 24647 25147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 26104 25298 gene locus_tag LOCUS_27270 26104 25298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 26458 27096 gene locus_tag LOCUS_27280 26458 27096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 27265 27564 gene locus_tag LOCUS_27290 27265 27564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 28898 30052 gene locus_tag LOCUS_27300 gene xylR 28898 30052 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_27300 30388 31401 gene locus_tag LOCUS_27310 30388 31401 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_27310 31501 31965 gene locus_tag LOCUS_27320 31501 31965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 33521 32025 gene locus_tag LOCUS_27330 gene aslA 33521 32025 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_27330 34140 33889 gene locus_tag LOCUS_27340 34140 33889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 34636 34133 gene locus_tag LOCUS_27350 34636 34133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 34870 35181 gene locus_tag LOCUS_27360 34870 35181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 35573 36265 gene locus_tag LOCUS_27370 35573 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 protein_id gnl|my_center|LOCUS_27370 36513 36791 gene locus_tag LOCUS_27380 36513 36791 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035652.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence050 <1 2776 gene locus_tag LOCUS_27390 <1 2776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119380.1:general secretion pathway protein 3009 3761 gene locus_tag LOCUS_27400 3009 3761 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888988.1 protein_id gnl|my_center|LOCUS_27400 3897 4337 gene locus_tag LOCUS_27410 3897 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 4930 4454 gene locus_tag LOCUS_27420 4930 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 5190 5669 gene locus_tag LOCUS_27430 gene nrdR 5190 5669 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6W9 protein_id gnl|my_center|LOCUS_27430 6931 5897 gene locus_tag LOCUS_27440 6931 5897 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121274.1 protein_id gnl|my_center|LOCUS_27440 7443 7000 gene locus_tag LOCUS_27450 gene moaC 7443 7000 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX95 protein_id gnl|my_center|LOCUS_27450 8414 7842 gene locus_tag LOCUS_27460 8414 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_27460 10032 9097 gene locus_tag LOCUS_27470 10032 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 10301 11095 gene locus_tag LOCUS_27480 10301 11095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 11698 11156 gene locus_tag LOCUS_27490 11698 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 13222 11945 gene locus_tag LOCUS_27500 gene eno 13222 11945 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR2 protein_id gnl|my_center|LOCUS_27500 14824 13415 gene locus_tag LOCUS_27510 gene arsA 14824 13415 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_27510 15014 15637 gene locus_tag LOCUS_27520 gene ribE 15014 15637 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_870472.2 protein_id gnl|my_center|LOCUS_27520 15643 16587 gene locus_tag LOCUS_27530 gene rsmA 15643 16587 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR4 protein_id gnl|my_center|LOCUS_27530 16760 17413 gene locus_tag LOCUS_27540 16760 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 20796 17410 gene locus_tag LOCUS_27550 20796 17410 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122141.1 protein_id gnl|my_center|LOCUS_27550 21677 20802 gene locus_tag LOCUS_27560 gene hasC 21677 20802 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122140.1 protein_id gnl|my_center|LOCUS_27560 21965 22894 gene locus_tag LOCUS_27570 21965 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_27570 24206 22965 gene locus_tag LOCUS_27580 gene hemL 24206 22965 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPM9 protein_id gnl|my_center|LOCUS_27580 25676 24336 gene locus_tag LOCUS_27590 25676 24336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 26045 29302 gene locus_tag LOCUS_27600 26045 29302 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_27600 29304 30734 gene locus_tag LOCUS_27610 29304 30734 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121859.1 protein_id gnl|my_center|LOCUS_27610 32399 30810 gene locus_tag LOCUS_27620 32399 30810 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence051 <1 1678 gene locus_tag LOCUS_27630 <1 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115028.1:sulfate transporter 2726 1872 gene locus_tag LOCUS_27640 2726 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2879 2733 gene locus_tag LOCUS_27650 2879 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 4720 3047 gene locus_tag LOCUS_27660 4720 3047 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_27660 6368 4797 gene locus_tag LOCUS_27670 gene guaA 6368 4797 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFS3 protein_id gnl|my_center|LOCUS_27670 6574 7458 gene locus_tag LOCUS_27680 gene surE 6574 7458 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT6 protein_id gnl|my_center|LOCUS_27680 7539 8087 gene locus_tag LOCUS_27690 gene mogA 7539 8087 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140668.1 protein_id gnl|my_center|LOCUS_27690 8845 9876 gene locus_tag LOCUS_27700 8845 9876 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_27700 9948 10502 gene locus_tag LOCUS_27710 9948 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 11687 10680 gene locus_tag LOCUS_27720 11687 10680 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118916.1 protein_id gnl|my_center|LOCUS_27720 12159 15599 gene locus_tag LOCUS_27730 12159 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 15618 17420 gene locus_tag LOCUS_27740 15618 17420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 17487 18698 gene locus_tag LOCUS_27750 17487 18698 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_27750 19058 20251 gene locus_tag LOCUS_27760 19058 20251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 21068 20355 gene locus_tag LOCUS_27770 21068 20355 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122587.1 protein_id gnl|my_center|LOCUS_27770 22656 21142 gene locus_tag LOCUS_27780 22656 21142 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_27780 22955 23197 gene locus_tag LOCUS_27790 22955 23197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 26723 23274 gene locus_tag LOCUS_27800 26723 23274 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118092.1 protein_id gnl|my_center|LOCUS_27800 28429 26825 gene locus_tag LOCUS_27810 28429 26825 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118094.1 protein_id gnl|my_center|LOCUS_27810 29120 28491 gene locus_tag LOCUS_27820 29120 28491 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118095.1 protein_id gnl|my_center|LOCUS_27820 29986 30414 gene locus_tag LOCUS_27830 29986 30414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 30575 31453 gene locus_tag LOCUS_27840 30575 31453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 31463 32362 gene locus_tag LOCUS_27850 31463 32362 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_27850 32439 32747 gene locus_tag LOCUS_27860 32439 32747 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527935.1 protein_id gnl|my_center|LOCUS_27860 34402 32900 gene locus_tag LOCUS_27870 34402 32900 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_27870 35308 34556 gene locus_tag LOCUS_27880 35308 34556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 36227 35718 gene locus_tag LOCUS_27890 36227 35718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence052 1199 123 gene locus_tag LOCUS_27900 1199 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 4612 1355 gene locus_tag LOCUS_27910 4612 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_27910 5105 5560 gene locus_tag LOCUS_27920 5105 5560 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123451.1 protein_id gnl|my_center|LOCUS_27920 5657 8002 gene locus_tag LOCUS_27930 gene pknB 5657 8002 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337392.1 protein_id gnl|my_center|LOCUS_27930 8208 9116 gene locus_tag LOCUS_27940 8208 9116 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_27940 9141 10649 gene locus_tag LOCUS_27950 9141 10649 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_27950 10717 11625 gene locus_tag LOCUS_27960 10717 11625 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_27960 14012 12285 gene locus_tag LOCUS_27970 gene polB 14012 12285 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118392.1 protein_id gnl|my_center|LOCUS_27970 14315 14767 gene locus_tag LOCUS_27980 14315 14767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 15875 16258 gene locus_tag LOCUS_27990 15875 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 16270 16752 gene locus_tag LOCUS_28000 16270 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 16753 17871 gene locus_tag LOCUS_28010 16753 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 18250 20322 gene locus_tag LOCUS_28020 18250 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_28020 20426 21280 gene locus_tag LOCUS_28030 gene fdhD 20426 21280 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_28030 22548 21286 gene locus_tag LOCUS_28040 gene proA 22548 21286 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLY9 protein_id gnl|my_center|LOCUS_28040 23872 22739 gene locus_tag LOCUS_28050 gene proB1 23872 22739 CDS product glutamate 5-kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB3 protein_id gnl|my_center|LOCUS_28050 23975 25489 gene locus_tag LOCUS_28060 23975 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 25580 28318 gene locus_tag LOCUS_28070 25580 28318 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:26672..26674,aa:Sec) note codon on position 365 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_28070 28394 31222 gene locus_tag LOCUS_28080 28394 31222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 31676 33241 gene locus_tag LOCUS_28090 31676 33241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 33660 33301 gene locus_tag LOCUS_28100 33660 33301 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_28100 34678 34220 gene locus_tag LOCUS_28110 34678 34220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 35628 34762 gene locus_tag LOCUS_28120 35628 34762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence053 3823 2855 gene locus_tag LOCUS_28130 3823 2855 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_28130 4247 3840 gene locus_tag LOCUS_28140 gene gntR 4247 3840 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_28140 4990 4787 gene locus_tag LOCUS_28150 4990 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 4949 5197 gene locus_tag LOCUS_28160 4949 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 6829 5663 gene locus_tag LOCUS_28170 6829 5663 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_28170 7349 7876 gene locus_tag LOCUS_28180 7349 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 9179 8523 gene locus_tag LOCUS_28190 9179 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 9681 9169 gene locus_tag LOCUS_28200 9681 9169 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124116.1 protein_id gnl|my_center|LOCUS_28200 11383 10019 gene locus_tag LOCUS_28210 11383 10019 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118037.1 protein_id gnl|my_center|LOCUS_28210 13994 11478 gene locus_tag LOCUS_28220 13994 11478 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123585.1 protein_id gnl|my_center|LOCUS_28220 14911 14393 gene locus_tag LOCUS_28230 14911 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 15545 15084 gene locus_tag LOCUS_28240 15545 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 15967 18420 gene locus_tag LOCUS_28250 15967 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119154.1 protein_id gnl|my_center|LOCUS_28250 18425 19777 gene locus_tag LOCUS_28260 18425 19777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119155.1 protein_id gnl|my_center|LOCUS_28260 19774 21291 gene locus_tag LOCUS_28270 19774 21291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 22021 25584 gene locus_tag LOCUS_28280 22021 25584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 25774 26313 gene locus_tag LOCUS_28290 25774 26313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 26357 26896 gene locus_tag LOCUS_28300 26357 26896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28300 28734 27442 gene locus_tag LOCUS_28310 28734 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 28986 28768 gene locus_tag LOCUS_28320 28986 28768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 29507 29265 gene locus_tag LOCUS_28330 29507 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 31297 29504 gene locus_tag LOCUS_28340 31297 29504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 32604 31423 gene locus_tag LOCUS_28350 32604 31423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 33235 32717 gene locus_tag LOCUS_28360 33235 32717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 34257 33772 gene locus_tag LOCUS_28370 34257 33772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 34291 34512 gene locus_tag LOCUS_28380 34291 34512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 34535 34798 gene locus_tag LOCUS_28390 34535 34798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 35246 36058 gene locus_tag LOCUS_28400 35246 36058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence054 1333 353 gene locus_tag LOCUS_28410 1333 353 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_28410 2689 1727 gene locus_tag LOCUS_28420 2689 1727 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_28420 3160 5631 gene locus_tag LOCUS_28430 3160 5631 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124101.1 protein_id gnl|my_center|LOCUS_28430 6094 6474 gene locus_tag LOCUS_28440 6094 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 6777 7970 gene locus_tag LOCUS_28450 6777 7970 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_28450 8483 8016 gene locus_tag LOCUS_28460 8483 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 8946 8557 gene locus_tag LOCUS_28470 8946 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 10681 9107 gene locus_tag LOCUS_28480 10681 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 11178 10789 gene locus_tag LOCUS_28490 11178 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 11636 12007 gene locus_tag LOCUS_28500 11636 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540506.1 protein_id gnl|my_center|LOCUS_28500 12129 12674 gene locus_tag LOCUS_28510 12129 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 12774 13625 gene locus_tag LOCUS_28520 12774 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 13679 14365 gene locus_tag LOCUS_28530 gene ank2 13679 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122199.1 protein_id gnl|my_center|LOCUS_28530 15243 14374 gene locus_tag LOCUS_28540 15243 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 15571 16809 gene locus_tag LOCUS_28550 gene mexE 15571 16809 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122350.1 protein_id gnl|my_center|LOCUS_28550 16874 20230 gene locus_tag LOCUS_28560 gene mexF 16874 20230 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122351.1 protein_id gnl|my_center|LOCUS_28560 20481 21134 gene locus_tag LOCUS_28570 20481 21134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 21249 22643 gene locus_tag LOCUS_28580 21249 22643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 24844 22694 gene locus_tag LOCUS_28590 24844 22694 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_28590 26086 25085 gene locus_tag LOCUS_28600 26086 25085 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938897.1 protein_id gnl|my_center|LOCUS_28600 27431 26208 gene locus_tag LOCUS_28610 27431 26208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 27564 27872 gene locus_tag LOCUS_28620 gene arsR 27564 27872 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123144.1 protein_id gnl|my_center|LOCUS_28620 28286 30295 gene locus_tag LOCUS_28630 28286 30295 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_28630 31600 30335 gene locus_tag LOCUS_28640 31600 30335 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120219.1 protein_id gnl|my_center|LOCUS_28640 32313 31597 gene locus_tag LOCUS_28650 32313 31597 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326208.1 protein_id gnl|my_center|LOCUS_28650 33442 32492 gene locus_tag LOCUS_28660 33442 32492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 33941 35482 gene locus_tag LOCUS_28670 33941 35482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence055 109 1545 gene locus_tag LOCUS_28680 109 1545 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_28680 1617 4496 gene locus_tag LOCUS_28690 1617 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 4493 5722 gene locus_tag LOCUS_28700 4493 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_28700 7683 5761 gene locus_tag LOCUS_28710 7683 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 9167 7818 gene locus_tag LOCUS_28720 9167 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259695.1 protein_id gnl|my_center|LOCUS_28720 9085 9267 gene locus_tag LOCUS_28730 9085 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 9973 9557 gene locus_tag LOCUS_28740 9973 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_28740 10110 10907 gene locus_tag LOCUS_28750 gene araC 10110 10907 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_28750 11432 12754 gene locus_tag LOCUS_28760 11432 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119155.1 protein_id gnl|my_center|LOCUS_28760 12909 15542 gene locus_tag LOCUS_28770 12909 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119154.1 protein_id gnl|my_center|LOCUS_28770 15647 17212 gene locus_tag LOCUS_28780 15647 17212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 17564 17322 gene locus_tag LOCUS_28790 17564 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 17452 18789 gene locus_tag LOCUS_28800 17452 18789 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_28800 18782 20185 gene locus_tag LOCUS_28810 18782 20185 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_28810 21638 20295 gene locus_tag LOCUS_28820 21638 20295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 21856 24327 gene locus_tag LOCUS_28830 21856 24327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 25969 24647 gene locus_tag LOCUS_28840 25969 24647 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224950.1 protein_id gnl|my_center|LOCUS_28840 26885 26025 gene locus_tag LOCUS_28850 gene hpcE 26885 26025 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970602.1 protein_id gnl|my_center|LOCUS_28850 27717 26965 gene locus_tag LOCUS_28860 27717 26965 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYG0 protein_id gnl|my_center|LOCUS_28860 27993 29846 gene locus_tag LOCUS_28870 27993 29846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 29943 29869 gene locus_tag LOCUS_t00270 29943 29869 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29970 30248 gene locus_tag LOCUS_28880 29970 30248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 30515 31444 gene locus_tag LOCUS_28890 gene xynB 30515 31444 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_28890 31560 32981 gene locus_tag LOCUS_28900 31560 32981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence056 264 1742 gene locus_tag LOCUS_28910 gene aslA 264 1742 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120007.1 protein_id gnl|my_center|LOCUS_28910 2956 1871 gene locus_tag LOCUS_28920 2956 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3053 3223 gene locus_tag LOCUS_28930 3053 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 3848 5356 gene locus_tag LOCUS_28940 3848 5356 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_28940 5862 6572 gene locus_tag LOCUS_28950 5862 6572 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124028.1 protein_id gnl|my_center|LOCUS_28950 7327 6725 gene locus_tag LOCUS_28960 7327 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124039.1 protein_id gnl|my_center|LOCUS_28960 8170 7364 gene locus_tag LOCUS_28970 gene folE2 8170 7364 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DU0 protein_id gnl|my_center|LOCUS_28970 8776 8570 gene locus_tag LOCUS_28980 8776 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 9011 9916 gene locus_tag LOCUS_28990 9011 9916 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120424.1 protein_id gnl|my_center|LOCUS_28990 10207 10641 gene locus_tag LOCUS_29000 gene fur 10207 10641 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_29000 11931 10828 gene locus_tag LOCUS_29010 11931 10828 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124037.1 protein_id gnl|my_center|LOCUS_29010 13028 12234 gene locus_tag LOCUS_29020 13028 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 13853 14200 gene locus_tag LOCUS_29030 13853 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 14694 16142 gene locus_tag LOCUS_29040 14694 16142 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_29040 17385 16180 gene locus_tag LOCUS_29050 17385 16180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 18516 17473 gene locus_tag LOCUS_29060 18516 17473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 19643 18642 gene locus_tag LOCUS_29070 19643 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 20267 22873 gene locus_tag LOCUS_29080 20267 22873 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117697.1 protein_id gnl|my_center|LOCUS_29080 22985 24271 gene locus_tag LOCUS_29090 22985 24271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123786.1 protein_id gnl|my_center|LOCUS_29090 24268 27033 gene locus_tag LOCUS_29100 24268 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122570.1 protein_id gnl|my_center|LOCUS_29100 27982 27143 gene locus_tag LOCUS_29110 gene lpqP 27982 27143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_29110 28192 28347 gene locus_tag LOCUS_29120 28192 28347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 28708 29904 gene locus_tag LOCUS_29130 28708 29904 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899005.1 protein_id gnl|my_center|LOCUS_29130 31659 30109 gene locus_tag LOCUS_29140 31659 30109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 32930 31755 gene locus_tag LOCUS_29150 32930 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence057 320 1642 gene locus_tag LOCUS_29160 320 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 2056 2700 gene locus_tag LOCUS_29170 2056 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2788 3528 gene locus_tag LOCUS_29180 2788 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3539 3466 gene locus_tag LOCUS_t00280 3539 3466 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4554 3847 gene locus_tag LOCUS_29190 4554 3847 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118951.1 protein_id gnl|my_center|LOCUS_29190 5408 4710 gene locus_tag LOCUS_29200 gene phoU 5408 4710 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_29200 6345 5485 gene locus_tag LOCUS_29210 gene pstB 6345 5485 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP21 protein_id gnl|my_center|LOCUS_29210 7837 6380 gene locus_tag LOCUS_29220 7837 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 8814 7837 gene locus_tag LOCUS_29230 gene pstC 8814 7837 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP19 protein_id gnl|my_center|LOCUS_29230 9958 8885 gene locus_tag LOCUS_29240 gene sphX 9958 8885 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121294.1 protein_id gnl|my_center|LOCUS_29240 10141 10353 gene locus_tag LOCUS_29250 10141 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 10428 12575 gene locus_tag LOCUS_29260 10428 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118363.1 protein_id gnl|my_center|LOCUS_29260 14405 12660 gene locus_tag LOCUS_29270 gene phoR 14405 12660 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_29270 14731 15405 gene locus_tag LOCUS_29280 14731 15405 CDS product UPF0111 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7M3 protein_id gnl|my_center|LOCUS_29280 15496 16998 gene locus_tag LOCUS_29290 15496 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 17227 19527 gene locus_tag LOCUS_29300 17227 19527 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119027.1 protein_id gnl|my_center|LOCUS_29300 19632 20219 gene locus_tag LOCUS_29310 19632 20219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 20330 24283 gene locus_tag LOCUS_29320 20330 24283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 25621 24371 gene locus_tag LOCUS_29330 gene hisD 25621 24371 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q039B1 protein_id gnl|my_center|LOCUS_29330 26815 25751 gene locus_tag LOCUS_29340 26815 25751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 27707 26952 gene locus_tag LOCUS_29350 gene hisF 27707 26952 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66567 protein_id gnl|my_center|LOCUS_29350 28297 27701 gene locus_tag LOCUS_29360 gene hisH 28297 27701 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW0 protein_id gnl|my_center|LOCUS_29360 30088 28373 gene locus_tag LOCUS_29370 30088 28373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 31060 30185 gene locus_tag LOCUS_29380 gene hisG1 31060 30185 CDS product ATP phosphoribosyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60804 protein_id gnl|my_center|LOCUS_29380 32399 31308 gene locus_tag LOCUS_29390 32399 31308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence058 989 420 gene locus_tag LOCUS_29400 gene dcd 989 420 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_29400 1392 2117 gene locus_tag LOCUS_29410 1392 2117 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_29410 2161 2868 gene locus_tag LOCUS_29420 gene lon 2161 2868 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_29420 3259 3828 gene locus_tag LOCUS_29430 3259 3828 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729836.1 protein_id gnl|my_center|LOCUS_29430 3867 5123 gene locus_tag LOCUS_29440 3867 5123 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257883.1 protein_id gnl|my_center|LOCUS_29440 5307 7403 gene locus_tag LOCUS_29450 5307 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 7805 7458 gene locus_tag LOCUS_29460 7805 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 9752 7833 gene locus_tag LOCUS_29470 9752 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122284.1 protein_id gnl|my_center|LOCUS_29470 10742 9756 gene locus_tag LOCUS_29480 10742 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_29480 12225 11080 gene locus_tag LOCUS_29490 12225 11080 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117842.1 protein_id gnl|my_center|LOCUS_29490 13029 12334 gene locus_tag LOCUS_29500 gene yqjF 13029 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_29500 13309 15108 gene locus_tag LOCUS_29510 13309 15108 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_29510 15313 16050 gene locus_tag LOCUS_29520 15313 16050 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865376.1 protein_id gnl|my_center|LOCUS_29520 16050 18131 gene locus_tag LOCUS_29530 16050 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 18366 20198 gene locus_tag LOCUS_29540 18366 20198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 21707 20214 gene locus_tag LOCUS_29550 gene GALNS 21707 20214 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121448.1 protein_id gnl|my_center|LOCUS_29550 22005 22322 gene locus_tag LOCUS_29560 22005 22322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 23993 22392 gene locus_tag LOCUS_29570 gene ilvA 23993 22392 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQS3 protein_id gnl|my_center|LOCUS_29570 25164 24163 gene locus_tag LOCUS_29580 gene ilvC 25164 24163 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CA6 protein_id gnl|my_center|LOCUS_29580 25789 28569 gene locus_tag LOCUS_29590 gene ppc 25789 28569 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHN1 protein_id gnl|my_center|LOCUS_29590 30126 28804 gene locus_tag LOCUS_29600 30126 28804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 <30902 30366 gene locus_tag LOCUS_29610 <30902 30366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SLE8:porphobilinogen deaminase >Feature sequence059 2515 80 gene locus_tag LOCUS_29620 gene pepN 2515 80 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_29620 4352 5320 gene locus_tag LOCUS_29630 4352 5320 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886895.1 protein_id gnl|my_center|LOCUS_29630 6259 5321 gene locus_tag LOCUS_29640 gene yhaQ 6259 5321 CDS product putative ABC transporter ATP-binding protein YhaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SPB4 protein_id gnl|my_center|LOCUS_29640 7284 6400 gene locus_tag LOCUS_29650 7284 6400 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325365.1 protein_id gnl|my_center|LOCUS_29650 9376 7583 gene locus_tag LOCUS_29660 9376 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 10169 12142 gene locus_tag LOCUS_29670 10169 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 12149 13321 gene locus_tag LOCUS_29680 12149 13321 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLM9 protein_id gnl|my_center|LOCUS_29680 14338 13364 gene locus_tag LOCUS_29690 14338 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919405.1 protein_id gnl|my_center|LOCUS_29690 15790 14354 gene locus_tag LOCUS_29700 15790 14354 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_29700 18875 15828 gene locus_tag LOCUS_29710 18875 15828 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121568.1 protein_id gnl|my_center|LOCUS_29710 19086 20687 gene locus_tag LOCUS_29720 19086 20687 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120298.1 protein_id gnl|my_center|LOCUS_29720 21290 22012 gene locus_tag LOCUS_29730 21290 22012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 22288 22749 gene locus_tag LOCUS_29740 22288 22749 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970503.1 protein_id gnl|my_center|LOCUS_29740 22773 23906 gene locus_tag LOCUS_29750 22773 23906 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122352.1 protein_id gnl|my_center|LOCUS_29750 24309 25358 gene locus_tag LOCUS_29760 24309 25358 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_29760 25533 26408 gene locus_tag LOCUS_29770 25533 26408 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_29770 26405 27457 gene locus_tag LOCUS_29780 26405 27457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 27454 28560 gene locus_tag LOCUS_29790 gene batA 27454 28560 CDS product aerotolerance regulator BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_29790 28580 29710 gene locus_tag LOCUS_29800 28580 29710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence060 1815 517 gene locus_tag LOCUS_29810 gene glgC 1815 517 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337168.1 protein_id gnl|my_center|LOCUS_29810 3270 2395 gene locus_tag LOCUS_29820 3270 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 3627 5237 gene locus_tag LOCUS_29830 gene ggt 3627 5237 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703698.1 protein_id gnl|my_center|LOCUS_29830 5313 6056 gene locus_tag LOCUS_29840 5313 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 6166 6630 gene locus_tag LOCUS_29850 6166 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_29850 6687 7226 gene locus_tag LOCUS_29860 6687 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337215.1 protein_id gnl|my_center|LOCUS_29860 7241 8152 gene locus_tag LOCUS_29870 7241 8152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119259.1 protein_id gnl|my_center|LOCUS_29870 8149 9117 gene locus_tag LOCUS_29880 8149 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119258.1 protein_id gnl|my_center|LOCUS_29880 9710 9183 gene locus_tag LOCUS_29890 gene yfiT 9710 9183 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_29890 11165 9756 gene locus_tag LOCUS_29900 gene uxaC 11165 9756 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_29900 12026 11214 gene locus_tag LOCUS_29910 12026 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 13387 12341 gene locus_tag LOCUS_29920 13387 12341 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_29920 14266 13478 gene locus_tag LOCUS_29930 14266 13478 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_29930 14798 16321 gene locus_tag LOCUS_29940 14798 16321 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118438.1 protein_id gnl|my_center|LOCUS_29940 16496 17140 gene locus_tag LOCUS_29950 16496 17140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 17974 19893 gene locus_tag LOCUS_29960 17974 19893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 21083 19956 gene locus_tag LOCUS_29970 21083 19956 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_29970 22535 21165 gene locus_tag LOCUS_29980 22535 21165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_29980 24932 22557 gene locus_tag LOCUS_29990 24932 22557 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 protein_id gnl|my_center|LOCUS_29990 25289 25612 gene locus_tag LOCUS_30000 gene hup 25289 25612 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329747.1 protein_id gnl|my_center|LOCUS_30000 25970 27172 gene locus_tag LOCUS_30010 gene aspC2 25970 27172 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_30010 29211 27289 gene locus_tag LOCUS_30020 29211 27289 CDS product IRE (iron responsive element) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120811.1 protein_id gnl|my_center|LOCUS_30020 >Feature sequence061 681 4244 gene locus_tag LOCUS_30030 gene gspD 681 4244 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118422.1 protein_id gnl|my_center|LOCUS_30030 4332 5321 gene locus_tag LOCUS_30040 4332 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 5382 6365 gene locus_tag LOCUS_30050 5382 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 7124 6396 gene locus_tag LOCUS_30060 7124 6396 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_30060 7996 7196 gene locus_tag LOCUS_30070 gene fabG 7996 7196 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 protein_id gnl|my_center|LOCUS_30070 9802 8198 gene locus_tag LOCUS_30080 9802 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 10963 11700 gene locus_tag LOCUS_30090 10963 11700 CDS product beta-1,4-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208414.1 protein_id gnl|my_center|LOCUS_30090 12677 11790 gene locus_tag LOCUS_30100 gene mtdA 12677 11790 CDS product MtdA bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_30100 13336 12839 gene locus_tag LOCUS_30110 gene fae 13336 12839 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122706.1 protein_id gnl|my_center|LOCUS_30110 13529 14815 gene locus_tag LOCUS_30120 13529 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 15387 14866 gene locus_tag LOCUS_30130 15387 14866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 16126 17895 gene locus_tag LOCUS_30140 16126 17895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 19155 18073 gene locus_tag LOCUS_30150 gene fabH 19155 18073 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123917.1 protein_id gnl|my_center|LOCUS_30150 19750 20499 gene locus_tag LOCUS_30160 gene guaA 19750 20499 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_30160 21016 22125 gene locus_tag LOCUS_30170 21016 22125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 22514 22888 gene locus_tag LOCUS_30180 22514 22888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 24007 22973 gene locus_tag LOCUS_30190 24007 22973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 25025 25246 gene locus_tag LOCUS_30200 25025 25246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 26557 25247 gene locus_tag LOCUS_30210 26557 25247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_30210 27187 26612 gene locus_tag LOCUS_30220 27187 26612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 27613 28623 gene locus_tag LOCUS_30230 27613 28623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence062 1324 2358 gene locus_tag LOCUS_30240 1324 2358 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638870.1 protein_id gnl|my_center|LOCUS_30240 2398 2997 gene locus_tag LOCUS_30250 2398 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3445 4722 gene locus_tag LOCUS_30260 3445 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 4839 5090 gene locus_tag LOCUS_30270 gene rpmA 4839 5090 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_30270 5186 6265 gene locus_tag LOCUS_30280 gene obg 5186 6265 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH6 protein_id gnl|my_center|LOCUS_30280 6256 7038 gene locus_tag LOCUS_30290 6256 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 7075 8211 gene locus_tag LOCUS_30300 gene trmE 7075 8211 CDS product tRNA modification GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120877.1 protein_id gnl|my_center|LOCUS_30300 9518 8247 gene locus_tag LOCUS_30310 9518 8247 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 protein_id gnl|my_center|LOCUS_30310 10956 9745 gene locus_tag LOCUS_30320 gene moxR 10956 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119708.1 protein_id gnl|my_center|LOCUS_30320 12158 10995 gene locus_tag LOCUS_30330 12158 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 13002 12151 gene locus_tag LOCUS_30340 13002 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 13914 13018 gene locus_tag LOCUS_30350 13914 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 14902 13904 gene locus_tag LOCUS_30360 14902 13904 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336191.1 protein_id gnl|my_center|LOCUS_30360 15918 14899 gene locus_tag LOCUS_30370 15918 14899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 17536 16121 gene locus_tag LOCUS_30380 17536 16121 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120948.1 protein_id gnl|my_center|LOCUS_30380 17765 17505 gene locus_tag LOCUS_30390 17765 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 18589 17990 gene locus_tag LOCUS_30400 gene recR 18589 17990 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ68 protein_id gnl|my_center|LOCUS_30400 19099 18704 gene locus_tag LOCUS_30410 19099 18704 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPZ1 protein_id gnl|my_center|LOCUS_30410 21152 19158 gene locus_tag LOCUS_30420 gene dnaX 21152 19158 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120949.1 protein_id gnl|my_center|LOCUS_30420 23512 21593 gene locus_tag LOCUS_30430 23512 21593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 25272 23863 gene locus_tag LOCUS_30440 gene degP 25272 23863 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123891.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence063 1662 4406 gene locus_tag LOCUS_30450 gene topB 1662 4406 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBN9 protein_id gnl|my_center|LOCUS_30450 5152 6006 gene locus_tag LOCUS_30460 5152 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 6026 6622 gene locus_tag LOCUS_30470 6026 6622 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_30470 6868 7248 gene locus_tag LOCUS_30480 6868 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 7732 8907 gene locus_tag LOCUS_30490 7732 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 12009 9187 gene locus_tag LOCUS_30500 12009 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 13016 12063 gene locus_tag LOCUS_30510 13016 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 13625 13164 gene locus_tag LOCUS_30520 13625 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 14454 13948 gene locus_tag LOCUS_30530 14454 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 15521 14472 gene locus_tag LOCUS_30540 15521 14472 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124007.1 protein_id gnl|my_center|LOCUS_30540 16188 16580 gene locus_tag LOCUS_30550 16188 16580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 17466 17392 gene locus_tag LOCUS_t00290 17466 17392 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18071 17892 gene locus_tag LOCUS_30560 18071 17892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 18180 19847 gene locus_tag LOCUS_30570 18180 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 20042 21553 gene locus_tag LOCUS_30580 20042 21553 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_30580 22421 22912 gene locus_tag LOCUS_30590 22421 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061165.1 protein_id gnl|my_center|LOCUS_30590 23100 23018 gene locus_tag LOCUS_t00300 23100 23018 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24761 23535 gene locus_tag LOCUS_30600 24761 23535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 26030 26227 gene locus_tag LOCUS_30610 26030 26227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 <27089 26318 gene locus_tag LOCUS_30620 <27089 26318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMK2:transcription termination factor Rho >Feature sequence064 667 1581 gene locus_tag LOCUS_30630 gene xynB 667 1581 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_30630 1720 2997 gene locus_tag LOCUS_30640 1720 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 3057 4274 gene locus_tag LOCUS_30650 3057 4274 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_30650 4497 5189 gene locus_tag LOCUS_30660 4497 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 5393 6994 gene locus_tag LOCUS_30670 5393 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 7136 7630 gene locus_tag LOCUS_30680 7136 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 10155 7681 gene locus_tag LOCUS_30690 10155 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 12655 10256 gene locus_tag LOCUS_30700 12655 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 14289 12700 gene locus_tag LOCUS_30710 14289 12700 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_30710 15781 14291 gene locus_tag LOCUS_30720 15781 14291 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_30720 16787 15816 gene locus_tag LOCUS_30730 16787 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 17207 19096 gene locus_tag LOCUS_30740 17207 19096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 19282 20166 gene locus_tag LOCUS_30750 19282 20166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 20202 21095 gene locus_tag LOCUS_30760 20202 21095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 21181 22494 gene locus_tag LOCUS_30770 21181 22494 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 protein_id gnl|my_center|LOCUS_30770 23729 22548 gene locus_tag LOCUS_30780 23729 22548 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404177.1 protein_id gnl|my_center|LOCUS_30780 24344 25720 gene locus_tag LOCUS_30790 gene sasR 24344 25720 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330317.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence065 <1 1592 gene locus_tag LOCUS_30800 <1 1592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ULV7:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG 1687 3084 gene locus_tag LOCUS_30810 1687 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3969 3220 gene locus_tag LOCUS_30820 3969 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30820 4703 5296 gene locus_tag LOCUS_30830 4703 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 5404 6792 gene locus_tag LOCUS_30840 5404 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 6929 8596 gene locus_tag LOCUS_30850 6929 8596 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_30850 8801 9667 gene locus_tag LOCUS_30860 8801 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 9991 9734 gene locus_tag LOCUS_30870 9991 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 10109 11461 gene locus_tag LOCUS_30880 10109 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 11640 12518 gene locus_tag LOCUS_30890 11640 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 12725 15037 gene locus_tag LOCUS_30900 12725 15037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_30900 15103 16425 gene locus_tag LOCUS_30910 15103 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_30910 17963 16497 gene locus_tag LOCUS_30920 17963 16497 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122408.1 protein_id gnl|my_center|LOCUS_30920 18283 19545 gene locus_tag LOCUS_30930 18283 19545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122571.1 protein_id gnl|my_center|LOCUS_30930 19536 22502 gene locus_tag LOCUS_30940 19536 22502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 23621 22539 gene locus_tag LOCUS_30950 gene leuB 23621 22539 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 protein_id gnl|my_center|LOCUS_30950 24883 23678 gene locus_tag LOCUS_30960 gene bcpC 24883 23678 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_868623.2 protein_id gnl|my_center|LOCUS_30960 <25684 24969 gene locus_tag LOCUS_30970 <25684 24969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFK4:homoserine dehydrogenase >Feature sequence066 586 1401 gene locus_tag LOCUS_30980 gene ypuG 586 1401 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327962.1 protein_id gnl|my_center|LOCUS_30980 2241 1429 gene locus_tag LOCUS_30990 2241 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 5530 2810 gene locus_tag LOCUS_31000 5530 2810 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121470.1 protein_id gnl|my_center|LOCUS_31000 5923 6624 gene locus_tag LOCUS_31010 5923 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 7798 6737 gene locus_tag LOCUS_31020 7798 6737 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120584.1 protein_id gnl|my_center|LOCUS_31020 7999 8409 gene locus_tag LOCUS_31030 7999 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_31030 9436 8396 gene locus_tag LOCUS_31040 9436 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 10139 9903 gene locus_tag LOCUS_31050 10139 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 10771 11199 gene locus_tag LOCUS_31060 10771 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_31060 11196 11579 gene locus_tag LOCUS_31070 11196 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 11656 14487 gene locus_tag LOCUS_31080 gene uvrA 11656 14487 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WT72 protein_id gnl|my_center|LOCUS_31080 14650 15102 gene locus_tag LOCUS_31090 14650 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 16515 15133 gene locus_tag LOCUS_31100 16515 15133 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405421.1 protein_id gnl|my_center|LOCUS_31100 16857 18092 gene locus_tag LOCUS_31110 16857 18092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_31110 19558 18089 gene locus_tag LOCUS_31120 19558 18089 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_31120 20113 19622 gene locus_tag LOCUS_31130 20113 19622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 20687 21829 gene locus_tag LOCUS_31140 gene iscS 20687 21829 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_31140 23240 21897 gene locus_tag LOCUS_31150 23240 21897 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930429.1 protein_id gnl|my_center|LOCUS_31150 25077 23578 gene locus_tag LOCUS_31160 25077 23578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118733.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence067 515 240 gene locus_tag LOCUS_31170 gene rpoA 515 240 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326741.1 protein_id gnl|my_center|LOCUS_31170 752 3115 gene locus_tag LOCUS_31180 gene pcrA 752 3115 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR9 protein_id gnl|my_center|LOCUS_31180 3310 4770 gene locus_tag LOCUS_31190 3310 4770 CDS product putative Na(+)/H(+) antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57007 protein_id gnl|my_center|LOCUS_31190 5480 4791 gene locus_tag LOCUS_31200 5480 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 6041 5619 gene locus_tag LOCUS_31210 6041 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 6221 7141 gene locus_tag LOCUS_31220 gene nfo 6221 7141 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WII8 protein_id gnl|my_center|LOCUS_31220 8449 7157 gene locus_tag LOCUS_31230 8449 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 8765 9790 gene locus_tag LOCUS_31240 gene hofF 8765 9790 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123458.1 protein_id gnl|my_center|LOCUS_31240 9914 10723 gene locus_tag LOCUS_31250 9914 10723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_31250 10724 11401 gene locus_tag LOCUS_31260 10724 11401 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_31260 13170 11467 gene locus_tag LOCUS_31270 13170 11467 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_31270 13915 13268 gene locus_tag LOCUS_31280 13915 13268 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925735.1 protein_id gnl|my_center|LOCUS_31280 15446 14082 gene locus_tag LOCUS_31290 15446 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 16063 17553 gene locus_tag LOCUS_31300 gene ffh 16063 17553 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_31300 17855 18367 gene locus_tag LOCUS_31310 17855 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 18374 19060 gene locus_tag LOCUS_31320 gene trmD 18374 19060 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY8 protein_id gnl|my_center|LOCUS_31320 19147 19497 gene locus_tag LOCUS_31330 gene rplS 19147 19497 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI13 protein_id gnl|my_center|LOCUS_31330 19809 20681 gene locus_tag LOCUS_31340 gene suhB 19809 20681 CDS product fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33832 protein_id gnl|my_center|LOCUS_31340 21614 20742 gene locus_tag LOCUS_31350 21614 20742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_31350 22979 21678 gene locus_tag LOCUS_31360 22979 21678 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_31360 23707 25140 gene locus_tag LOCUS_31370 23707 25140 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_31370 >Feature sequence068 4304 3819 gene locus_tag LOCUS_31380 gene ilvH 4304 3819 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_31380 6149 4416 gene locus_tag LOCUS_31390 gene ilvB 6149 4416 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_31390 7184 6552 gene locus_tag LOCUS_31400 7184 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 7204 7395 gene locus_tag LOCUS_31410 7204 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 8853 7459 gene locus_tag LOCUS_31420 8853 7459 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405165.1 protein_id gnl|my_center|LOCUS_31420 9105 10316 gene locus_tag LOCUS_31430 9105 10316 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122189.1 protein_id gnl|my_center|LOCUS_31430 10379 10780 gene locus_tag LOCUS_31440 10379 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 11256 14027 gene locus_tag LOCUS_31450 11256 14027 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119791.1 protein_id gnl|my_center|LOCUS_31450 14070 15494 gene locus_tag LOCUS_31460 14070 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119690.1 protein_id gnl|my_center|LOCUS_31460 15594 17654 gene locus_tag LOCUS_31470 15594 17654 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_31470 19235 17715 gene locus_tag LOCUS_31480 19235 17715 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124076.1 protein_id gnl|my_center|LOCUS_31480 19475 20053 gene locus_tag LOCUS_31490 19475 20053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328132.1 protein_id gnl|my_center|LOCUS_31490 20417 21898 gene locus_tag LOCUS_31500 20417 21898 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_31500 22348 21950 gene locus_tag LOCUS_31510 22348 21950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 22667 22350 gene locus_tag LOCUS_31520 22667 22350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence069 241 861 gene locus_tag LOCUS_31530 241 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 1021 2001 gene locus_tag LOCUS_31540 1021 2001 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_31540 2234 3505 gene locus_tag LOCUS_31550 2234 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 4848 6767 gene locus_tag LOCUS_31560 4848 6767 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_31560 6792 9848 gene locus_tag LOCUS_31570 6792 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 9966 11213 gene locus_tag LOCUS_31580 9966 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122571.1 protein_id gnl|my_center|LOCUS_31580 11210 13681 gene locus_tag LOCUS_31590 11210 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122570.1 protein_id gnl|my_center|LOCUS_31590 14781 13780 gene locus_tag LOCUS_31600 14781 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 15420 15494 gene locus_tag LOCUS_t00310 15420 15494 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15724 16695 gene locus_tag LOCUS_31610 15724 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 17384 18709 gene locus_tag LOCUS_31620 gene rpoA 17384 18709 CDS product RNA polymerase subunit alpha domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328259.1 protein_id gnl|my_center|LOCUS_31620 18842 19966 gene locus_tag LOCUS_31630 gene tgt 18842 19966 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWK9 protein_id gnl|my_center|LOCUS_31630 20372 20779 gene locus_tag LOCUS_31640 20372 20779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence070 1157 501 gene locus_tag LOCUS_31650 1157 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2524 1784 gene locus_tag LOCUS_31660 2524 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_31660 2989 2609 gene locus_tag LOCUS_31670 2989 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 4413 4096 gene locus_tag LOCUS_31680 4413 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 5122 4526 gene locus_tag LOCUS_31690 5122 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 5790 5311 gene locus_tag LOCUS_31700 5790 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 6997 5876 gene locus_tag LOCUS_31710 6997 5876 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409667.1 protein_id gnl|my_center|LOCUS_31710 8588 7113 gene locus_tag LOCUS_31720 8588 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 11186 9696 gene locus_tag LOCUS_31730 11186 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 11786 11310 gene locus_tag LOCUS_31740 11786 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 12992 12180 gene locus_tag LOCUS_31750 12992 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 14027 13065 gene locus_tag LOCUS_31760 14027 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 14882 14178 gene locus_tag LOCUS_31770 14882 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_31770 15210 15013 gene locus_tag LOCUS_31780 15210 15013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 15872 15243 gene locus_tag LOCUS_31790 15872 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118781.1 protein_id gnl|my_center|LOCUS_31790 16484 16107 gene locus_tag LOCUS_31800 16484 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 17758 16601 gene locus_tag LOCUS_31810 17758 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 18605 17907 gene locus_tag LOCUS_31820 18605 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 19201 18875 gene locus_tag LOCUS_31830 19201 18875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 19859 19347 gene locus_tag LOCUS_31840 19859 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 20364 20008 gene locus_tag LOCUS_31850 20364 20008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 22147 20603 gene locus_tag LOCUS_31860 22147 20603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_31860 22628 22317 gene locus_tag LOCUS_31870 22628 22317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 22977 22771 gene locus_tag LOCUS_31880 22977 22771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence071 1234 1707 gene locus_tag LOCUS_31890 1234 1707 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446103.1 protein_id gnl|my_center|LOCUS_31890 1735 2703 gene locus_tag LOCUS_31900 gene thrB 1735 2703 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC9 protein_id gnl|my_center|LOCUS_31900 2690 3973 gene locus_tag LOCUS_31910 2690 3973 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095511.1 protein_id gnl|my_center|LOCUS_31910 4218 4146 gene locus_tag LOCUS_t00320 4218 4146 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4494 4712 gene locus_tag LOCUS_31920 4494 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 5822 4878 gene locus_tag LOCUS_31930 5822 4878 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120192.1 protein_id gnl|my_center|LOCUS_31930 5998 6408 gene locus_tag LOCUS_31940 5998 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 6740 8665 gene locus_tag LOCUS_31950 gene dnaK 6740 8665 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM31 protein_id gnl|my_center|LOCUS_31950 8762 9559 gene locus_tag LOCUS_31960 8762 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 9791 12433 gene locus_tag LOCUS_31970 gene clpB 9791 12433 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM33 protein_id gnl|my_center|LOCUS_31970 12682 12467 gene locus_tag LOCUS_31980 12682 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 13509 12766 gene locus_tag LOCUS_31990 13509 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 15276 13549 gene locus_tag LOCUS_32000 15276 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 16321 15362 gene locus_tag LOCUS_32010 16321 15362 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_32010 17780 16434 gene locus_tag LOCUS_32020 17780 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 19820 17784 gene locus_tag LOCUS_32030 19820 17784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 20779 19949 gene locus_tag LOCUS_32040 20779 19949 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120600.1 protein_id gnl|my_center|LOCUS_32040 >Feature sequence072 2409 67 gene locus_tag LOCUS_32050 2409 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119154.1 protein_id gnl|my_center|LOCUS_32050 3821 2511 gene locus_tag LOCUS_32060 3821 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119155.1 protein_id gnl|my_center|LOCUS_32060 5344 4157 gene locus_tag LOCUS_32070 5344 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 6315 5533 gene locus_tag LOCUS_32080 6315 5533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932435.1 protein_id gnl|my_center|LOCUS_32080 6818 7759 gene locus_tag LOCUS_32090 6818 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 8269 7934 gene locus_tag LOCUS_32100 8269 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 8705 9526 gene locus_tag LOCUS_32110 8705 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 11593 9683 gene locus_tag LOCUS_32120 11593 9683 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118947.1 protein_id gnl|my_center|LOCUS_32120 12060 11782 gene locus_tag LOCUS_32130 gene rpmE2 12060 11782 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_32130 12277 12825 gene locus_tag LOCUS_32140 12277 12825 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1U6 protein_id gnl|my_center|LOCUS_32140 14138 12879 gene locus_tag LOCUS_32150 14138 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120802.1 protein_id gnl|my_center|LOCUS_32150 14797 14204 gene locus_tag LOCUS_32160 14797 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 15371 15685 gene locus_tag LOCUS_32170 15371 15685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 15770 17032 gene locus_tag LOCUS_32180 15770 17032 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889265.1 protein_id gnl|my_center|LOCUS_32180 17341 17928 gene locus_tag LOCUS_32190 17341 17928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 17925 19373 gene locus_tag LOCUS_32200 17925 19373 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_32200 20893 19763 gene locus_tag LOCUS_32210 20893 19763 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_32210 21370 22416 gene locus_tag LOCUS_32220 21370 22416 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190668.1 protein_id gnl|my_center|LOCUS_32220 >Feature sequence073 882 700 gene locus_tag LOCUS_32230 882 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 2403 1465 gene locus_tag LOCUS_32240 gene dagK 2403 1465 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31502 protein_id gnl|my_center|LOCUS_32240 3489 2512 gene locus_tag LOCUS_32250 3489 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 5021 3738 gene locus_tag LOCUS_32260 5021 3738 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_32260 5238 5029 gene locus_tag LOCUS_32270 5238 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 5288 5452 gene locus_tag LOCUS_32280 5288 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 5763 7040 gene locus_tag LOCUS_32290 5763 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 8546 7080 gene locus_tag LOCUS_32300 8546 7080 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_32300 10852 8543 gene locus_tag LOCUS_32310 10852 8543 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123585.1 protein_id gnl|my_center|LOCUS_32310 11135 15334 gene locus_tag LOCUS_32320 11135 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 19948 15473 gene locus_tag LOCUS_32330 19948 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 21233 21754 gene locus_tag LOCUS_32340 21233 21754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence074 336 1343 gene locus_tag LOCUS_32350 gene serA 336 1343 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_32350 1497 2660 gene locus_tag LOCUS_32360 1497 2660 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117901.1 protein_id gnl|my_center|LOCUS_32360 2884 2657 gene locus_tag LOCUS_32370 2884 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 3248 4282 gene locus_tag LOCUS_32380 gene rluD 3248 4282 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX8 protein_id gnl|my_center|LOCUS_32380 5018 4377 gene locus_tag LOCUS_32390 5018 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121172.1 protein_id gnl|my_center|LOCUS_32390 5738 5097 gene locus_tag LOCUS_32400 5738 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 6807 6001 gene locus_tag LOCUS_32410 gene fabI 6807 6001 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_32410 7373 6933 gene locus_tag LOCUS_32420 gene fabZ 7373 6933 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121723.1 protein_id gnl|my_center|LOCUS_32420 8824 7379 gene locus_tag LOCUS_32430 8824 7379 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118315.1 protein_id gnl|my_center|LOCUS_32430 8973 10391 gene locus_tag LOCUS_32440 8973 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 11502 10771 gene locus_tag LOCUS_32450 gene sqdC 11502 10771 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120934.1 protein_id gnl|my_center|LOCUS_32450 12713 11814 gene locus_tag LOCUS_32460 12713 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 14082 12910 gene locus_tag LOCUS_32470 14082 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121577.1 protein_id gnl|my_center|LOCUS_32470 15629 14148 gene locus_tag LOCUS_32480 gene yidJ 15629 14148 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122680.1 protein_id gnl|my_center|LOCUS_32480 16551 15889 gene locus_tag LOCUS_32490 16551 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 16774 17955 gene locus_tag LOCUS_32500 16774 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 18582 18052 gene locus_tag LOCUS_32510 18582 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 <21782 19760 gene locus_tag LOCUS_32520 <21782 19760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P32051:putative lipoprotein YdeK >Feature sequence075 308 1546 gene locus_tag LOCUS_32530 308 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_32530 2684 1572 gene locus_tag LOCUS_32540 2684 1572 CDS product calcium sensor EFh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119349.1 protein_id gnl|my_center|LOCUS_32540 4041 2857 gene locus_tag LOCUS_32550 4041 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120425.1 protein_id gnl|my_center|LOCUS_32550 6073 4328 gene locus_tag LOCUS_32560 6073 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_32560 7852 6602 gene locus_tag LOCUS_32570 7852 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121818.1 protein_id gnl|my_center|LOCUS_32570 8599 10122 gene locus_tag LOCUS_32580 8599 10122 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGU7 protein_id gnl|my_center|LOCUS_32580 10754 13807 gene locus_tag LOCUS_32590 10754 13807 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_32590 15050 13899 gene locus_tag LOCUS_32600 15050 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 15719 16135 gene locus_tag LOCUS_32610 15719 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 16153 17616 gene locus_tag LOCUS_32620 16153 17616 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095454.1 protein_id gnl|my_center|LOCUS_32620 18686 17658 gene locus_tag LOCUS_32630 gene radC 18686 17658 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122474.1 protein_id gnl|my_center|LOCUS_32630 19875 18790 gene locus_tag LOCUS_32640 19875 18790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 19957 20745 gene locus_tag LOCUS_32650 19957 20745 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_32650 >Feature sequence076 3000 22 gene locus_tag LOCUS_32660 3000 22 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US04 protein_id gnl|my_center|LOCUS_32660 5972 2994 gene locus_tag LOCUS_32670 5972 2994 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_32670 7073 6117 gene locus_tag LOCUS_32680 7073 6117 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR86 protein_id gnl|my_center|LOCUS_32680 7269 8042 gene locus_tag LOCUS_32690 7269 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123725.1 protein_id gnl|my_center|LOCUS_32690 8110 8586 gene locus_tag LOCUS_32700 gene tadA 8110 8586 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIP0 protein_id gnl|my_center|LOCUS_32700 8590 10389 gene locus_tag LOCUS_32710 8590 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 11092 10430 gene locus_tag LOCUS_32720 11092 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 12227 11151 gene locus_tag LOCUS_32730 12227 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 13532 12666 gene locus_tag LOCUS_32740 13532 12666 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_32740 14111 13590 gene locus_tag LOCUS_32750 14111 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 14980 14306 gene locus_tag LOCUS_32760 14980 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_32760 16542 15049 gene locus_tag LOCUS_32770 16542 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 17149 19596 gene locus_tag LOCUS_32780 17149 19596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 19646 20338 gene locus_tag LOCUS_32790 19646 20338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence077 146 1594 gene locus_tag LOCUS_32800 146 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 1748 4213 gene locus_tag LOCUS_32810 1748 4213 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_32810 5118 4261 gene locus_tag LOCUS_32820 5118 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122690.1 protein_id gnl|my_center|LOCUS_32820 5455 7989 gene locus_tag LOCUS_32830 5455 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121739.1 protein_id gnl|my_center|LOCUS_32830 7986 8840 gene locus_tag LOCUS_32840 7986 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 8885 9901 gene locus_tag LOCUS_32850 gene moxR 8885 9901 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121741.1 protein_id gnl|my_center|LOCUS_32850 10034 10927 gene locus_tag LOCUS_32860 10034 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_32860 10924 13113 gene locus_tag LOCUS_32870 10924 13113 CDS product inter-alpha-trypsin inhibitor heavy chain H2 [precursor] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_32870 13113 16853 gene locus_tag LOCUS_32880 13113 16853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 protein_id gnl|my_center|LOCUS_32880 16853 19213 gene locus_tag LOCUS_32890 16853 19213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_32890 >Feature sequence078 259 813 gene locus_tag LOCUS_32900 259 813 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120437.1 protein_id gnl|my_center|LOCUS_32900 813 2264 gene locus_tag LOCUS_32910 813 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 2359 3951 gene locus_tag LOCUS_32920 2359 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 4018 5181 gene locus_tag LOCUS_32930 gene moxR 4018 5181 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120739.1 protein_id gnl|my_center|LOCUS_32930 5269 6159 gene locus_tag LOCUS_32940 5269 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_32940 6159 8315 gene locus_tag LOCUS_32950 6159 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 8315 10528 gene locus_tag LOCUS_32960 8315 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 10587 11837 gene locus_tag LOCUS_32970 10587 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 11834 15658 gene locus_tag LOCUS_32980 11834 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 15728 16768 gene locus_tag LOCUS_32990 gene moxR 15728 16768 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120739.1 protein_id gnl|my_center|LOCUS_32990 16912 18540 gene locus_tag LOCUS_33000 16912 18540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence079 2763 4025 gene locus_tag LOCUS_33010 2763 4025 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_33010 4635 5618 gene locus_tag LOCUS_33020 4635 5618 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123060.1 protein_id gnl|my_center|LOCUS_33020 5647 5826 gene locus_tag LOCUS_33030 5647 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 7310 6087 gene locus_tag LOCUS_33040 7310 6087 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_33040 7268 7492 gene locus_tag LOCUS_33050 7268 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 8412 7489 gene locus_tag LOCUS_33060 8412 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 9003 8446 gene locus_tag LOCUS_33070 gene wzb 9003 8446 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125896.1 protein_id gnl|my_center|LOCUS_33070 9311 9126 gene locus_tag LOCUS_33080 9311 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 10827 9481 gene locus_tag LOCUS_33090 10827 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_33090 12379 10865 gene locus_tag LOCUS_33100 12379 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 12702 13742 gene locus_tag LOCUS_33110 12702 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 15273 13963 gene locus_tag LOCUS_33120 15273 13963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_33120 18193 15320 gene locus_tag LOCUS_33130 18193 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120757.1 protein_id gnl|my_center|LOCUS_33130 19076 18234 gene locus_tag LOCUS_33140 19076 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 19617 19057 gene locus_tag LOCUS_33150 19617 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence080 618 980 gene locus_tag LOCUS_33160 618 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 1347 2867 gene locus_tag LOCUS_33170 1347 2867 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_33170 4909 2900 gene locus_tag LOCUS_33180 4909 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 5989 5033 gene locus_tag LOCUS_33190 5989 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 8319 6193 gene locus_tag LOCUS_33200 gene fusA 8319 6193 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URV2 protein_id gnl|my_center|LOCUS_33200 9581 12958 gene locus_tag LOCUS_33210 gene gdhP 9581 12958 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_33210 14637 13063 gene locus_tag LOCUS_33220 14637 13063 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121514.1 protein_id gnl|my_center|LOCUS_33220 15092 14922 gene locus_tag LOCUS_33230 15092 14922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 15101 16411 gene locus_tag LOCUS_33240 gene trx 15101 16411 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120612.1 protein_id gnl|my_center|LOCUS_33240 16805 17572 gene locus_tag LOCUS_33250 16805 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence081 135 61 gene locus_tag LOCUS_t00330 135 61 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 569 387 gene locus_tag LOCUS_33260 569 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 547 1482 gene locus_tag LOCUS_33270 gene pyrF 547 1482 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_33270 2160 1540 gene locus_tag LOCUS_33280 gene ychE 2160 1540 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_33280 2906 2289 gene locus_tag LOCUS_33290 2906 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 8067 3055 gene locus_tag LOCUS_33300 8067 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 9587 8802 gene locus_tag LOCUS_33310 9587 8802 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_33310 10759 9983 gene locus_tag LOCUS_33320 10759 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 13559 11175 gene locus_tag LOCUS_33330 13559 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 14017 14865 gene locus_tag LOCUS_33340 14017 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803961.1 protein_id gnl|my_center|LOCUS_33340 14937 15245 gene locus_tag LOCUS_33350 14937 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 16551 15298 gene locus_tag LOCUS_33360 16551 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120328.1 protein_id gnl|my_center|LOCUS_33360 17520 16993 gene locus_tag LOCUS_33370 17520 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 17681 17517 gene locus_tag LOCUS_33380 17681 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 17698 17916 gene locus_tag LOCUS_33390 17698 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 17935 19101 gene locus_tag LOCUS_33400 17935 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence082 42 1550 gene locus_tag LOCUS_33410 42 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 1873 3186 gene locus_tag LOCUS_33420 1873 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 4816 3194 gene locus_tag LOCUS_33430 4816 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 5163 7037 gene locus_tag LOCUS_33440 5163 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 7072 10704 gene locus_tag LOCUS_33450 gene smc 7072 10704 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQV4 protein_id gnl|my_center|LOCUS_33450 11154 10729 gene locus_tag LOCUS_33460 11154 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 11466 12002 gene locus_tag LOCUS_33470 gene apt 11466 12002 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR74 protein_id gnl|my_center|LOCUS_33470 12098 13669 gene locus_tag LOCUS_33480 12098 13669 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_33480 13672 14748 gene locus_tag LOCUS_33490 13672 14748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_33490 14893 16020 gene locus_tag LOCUS_33500 gene rlmN 14893 16020 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L68 protein_id gnl|my_center|LOCUS_33500 17182 16061 gene locus_tag LOCUS_33510 17182 16061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 18514 17270 gene locus_tag LOCUS_33520 18514 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 >Feature sequence083 1895 186 gene locus_tag LOCUS_33530 1895 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122727.1 protein_id gnl|my_center|LOCUS_33530 2231 2719 gene locus_tag LOCUS_33540 2231 2719 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337214.1 protein_id gnl|my_center|LOCUS_33540 2833 2702 gene locus_tag LOCUS_33550 2833 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 4390 2864 gene locus_tag LOCUS_33560 4390 2864 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_33560 4452 5294 gene locus_tag LOCUS_33570 gene hpaG 4452 5294 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_33570 5542 6108 gene locus_tag LOCUS_33580 5542 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 6272 7942 gene locus_tag LOCUS_33590 6272 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 8125 10032 gene locus_tag LOCUS_33600 8125 10032 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_33600 10887 10531 gene locus_tag LOCUS_33610 gene rnpA 10887 10531 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNR1 protein_id gnl|my_center|LOCUS_33610 12029 11061 gene locus_tag LOCUS_33620 gene dnaJ 12029 11061 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_33620 12473 13981 gene locus_tag LOCUS_33630 12473 13981 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_33630 14359 14111 gene locus_tag LOCUS_33640 14359 14111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 14444 15580 gene locus_tag LOCUS_33650 14444 15580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 15832 16824 gene locus_tag LOCUS_33660 15832 16824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124130.1 protein_id gnl|my_center|LOCUS_33660 16965 17993 gene locus_tag LOCUS_33670 gene ddlA 16965 17993 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence084 1 498 gene locus_tag LOCUS_33680 1 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 1573 626 gene locus_tag LOCUS_33690 1573 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 2261 1872 gene locus_tag LOCUS_33700 2261 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 2799 3491 gene locus_tag LOCUS_33710 2799 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 5152 5316 gene locus_tag LOCUS_33720 5152 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 5620 6324 gene locus_tag LOCUS_33730 5620 6324 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_33730 6537 7043 gene locus_tag LOCUS_33740 6537 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 9401 7155 gene locus_tag LOCUS_33750 9401 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 10435 13524 gene locus_tag LOCUS_33760 10435 13524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 16260 14137 gene locus_tag LOCUS_33770 16260 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 17217 16291 gene locus_tag LOCUS_33780 gene nagA 17217 16291 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_33780 17977 17219 gene locus_tag LOCUS_33790 gene nagB 17977 17219 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_33790 >Feature sequence085 417 2042 gene locus_tag LOCUS_33800 gene yclF 417 2042 CDS product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 protein_id gnl|my_center|LOCUS_33800 2849 2154 gene locus_tag LOCUS_33810 2849 2154 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123968.1 protein_id gnl|my_center|LOCUS_33810 4822 3014 gene locus_tag LOCUS_33820 4822 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 5031 6017 gene locus_tag LOCUS_33830 5031 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 6208 6056 gene locus_tag LOCUS_33840 6208 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 6293 7696 gene locus_tag LOCUS_33850 gene hflX 6293 7696 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD7 protein_id gnl|my_center|LOCUS_33850 7731 8519 gene locus_tag LOCUS_33860 7731 8519 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121199.1 protein_id gnl|my_center|LOCUS_33860 8771 10324 gene locus_tag LOCUS_33870 gene lysS 8771 10324 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK37 protein_id gnl|my_center|LOCUS_33870 10431 12170 gene locus_tag LOCUS_33880 gene lolC 10431 12170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_33880 12163 12990 gene locus_tag LOCUS_33890 gene lolD2 12163 12990 CDS product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPK3 protein_id gnl|my_center|LOCUS_33890 13527 14105 gene locus_tag LOCUS_33900 13527 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 14218 15555 gene locus_tag LOCUS_33910 14218 15555 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120940.1 protein_id gnl|my_center|LOCUS_33910 17210 15672 gene locus_tag LOCUS_33920 gene leuA 17210 15672 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI51 protein_id gnl|my_center|LOCUS_33920 >Feature sequence086 2899 653 gene locus_tag LOCUS_33930 2899 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 5556 2992 gene locus_tag LOCUS_33940 5556 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 8080 5669 gene locus_tag LOCUS_33950 8080 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 10447 8111 gene locus_tag LOCUS_33960 10447 8111 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120924.1 protein_id gnl|my_center|LOCUS_33960 11485 10568 gene locus_tag LOCUS_33970 11485 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_33970 12641 11571 gene locus_tag LOCUS_33980 gene moxR 12641 11571 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_33980 13333 14310 gene locus_tag LOCUS_33990 13333 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 14282 16366 gene locus_tag LOCUS_34000 14282 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 16524 17243 gene locus_tag LOCUS_34010 16524 17243 CDS product LmbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_34010 17312 18100 gene locus_tag LOCUS_34020 17312 18100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 >Feature sequence087 4028 1134 gene locus_tag LOCUS_34030 4028 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123573.1 protein_id gnl|my_center|LOCUS_34030 4549 5214 gene locus_tag LOCUS_34040 4549 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 5324 6751 gene locus_tag LOCUS_34050 gene GALNS 5324 6751 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121448.1 protein_id gnl|my_center|LOCUS_34050 7375 9003 gene locus_tag LOCUS_34060 7375 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 9347 10867 gene locus_tag LOCUS_34070 9347 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 13486 10979 gene locus_tag LOCUS_34080 13486 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 15806 13743 gene locus_tag LOCUS_34090 15806 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 15947 17422 gene locus_tag LOCUS_34100 15947 17422 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920650.1 protein_id gnl|my_center|LOCUS_34100 17471 18088 gene locus_tag LOCUS_34110 17471 18088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence088 260 436 gene locus_tag LOCUS_34120 260 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 549 1568 gene locus_tag LOCUS_34130 gene tsaD 549 1568 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM42 protein_id gnl|my_center|LOCUS_34130 2414 1674 gene locus_tag LOCUS_34140 2414 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 2854 4839 gene locus_tag LOCUS_34150 2854 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 5051 6388 gene locus_tag LOCUS_34160 gene trkA 5051 6388 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_34160 6685 7092 gene locus_tag LOCUS_34170 6685 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 7159 8385 gene locus_tag LOCUS_34180 7159 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 9407 8391 gene locus_tag LOCUS_34190 9407 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 10662 9751 gene locus_tag LOCUS_34200 10662 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 10817 12799 gene locus_tag LOCUS_34210 10817 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 12877 13872 gene locus_tag LOCUS_34220 gene galE 12877 13872 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120830.1 protein_id gnl|my_center|LOCUS_34220 15005 13941 gene locus_tag LOCUS_34230 15005 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 15761 15132 gene locus_tag LOCUS_34240 gene upp 15761 15132 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFD1 protein_id gnl|my_center|LOCUS_34240 15936 17213 gene locus_tag LOCUS_34250 15936 17213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence089 2328 889 gene locus_tag LOCUS_34260 2328 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 2383 2571 gene locus_tag LOCUS_34270 2383 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 2656 3663 gene locus_tag LOCUS_34280 gene pmi 2656 3663 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_34280 3775 4095 gene locus_tag LOCUS_34290 3775 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 5303 4179 gene locus_tag LOCUS_34300 gene aspC 5303 4179 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG06 protein_id gnl|my_center|LOCUS_34300 5479 7095 gene locus_tag LOCUS_34310 gene purF 5479 7095 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGS5 protein_id gnl|my_center|LOCUS_34310 7830 7189 gene locus_tag LOCUS_34320 gene trmB 7830 7189 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN36 protein_id gnl|my_center|LOCUS_34320 9255 8242 gene locus_tag LOCUS_34330 gene trpD 9255 8242 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYS5 protein_id gnl|my_center|LOCUS_34330 9462 10406 gene locus_tag LOCUS_34340 gene iunH 9462 10406 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324951.1 protein_id gnl|my_center|LOCUS_34340 11667 10435 gene locus_tag LOCUS_34350 gene htrA 11667 10435 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122274.1 protein_id gnl|my_center|LOCUS_34350 12216 11782 gene locus_tag LOCUS_34360 12216 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 12663 14444 gene locus_tag LOCUS_34370 12663 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 15462 14455 gene locus_tag LOCUS_34380 15462 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118962.1 protein_id gnl|my_center|LOCUS_34380 15918 15556 gene locus_tag LOCUS_34390 gene queF 15918 15556 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG9 protein_id gnl|my_center|LOCUS_34390 16216 16761 gene locus_tag LOCUS_34400 16216 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 >Feature sequence090 1732 257 gene locus_tag LOCUS_34410 1732 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 3231 2215 gene locus_tag LOCUS_34420 3231 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 3995 4636 gene locus_tag LOCUS_34430 gene coaE 3995 4636 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCU7 protein_id gnl|my_center|LOCUS_34430 4698 6194 gene locus_tag LOCUS_34440 gene rho 4698 6194 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGV0 protein_id gnl|my_center|LOCUS_34440 6390 6869 gene locus_tag LOCUS_34450 gene ribH 6390 6869 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGV1 protein_id gnl|my_center|LOCUS_34450 7037 7474 gene locus_tag LOCUS_34460 gene nusB 7037 7474 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USA9 protein_id gnl|my_center|LOCUS_34460 7535 8524 gene locus_tag LOCUS_34470 gene ftsY 7535 8524 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT17 protein_id gnl|my_center|LOCUS_34470 9119 8952 gene locus_tag LOCUS_34480 9119 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 9404 9138 gene locus_tag LOCUS_34490 9404 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 9961 10230 gene locus_tag LOCUS_34500 gene rpsO 9961 10230 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR97 protein_id gnl|my_center|LOCUS_34500 10595 12898 gene locus_tag LOCUS_34510 gene pnp 10595 12898 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR95 protein_id gnl|my_center|LOCUS_34510 13167 13874 gene locus_tag LOCUS_34520 13167 13874 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121114.1 protein_id gnl|my_center|LOCUS_34520 13957 14895 gene locus_tag LOCUS_34530 gene ribF 13957 14895 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFW8 protein_id gnl|my_center|LOCUS_34530 14959 15975 gene locus_tag LOCUS_34540 14959 15975 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_34540 16111 16662 gene locus_tag LOCUS_34550 16111 16662 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_34550 >Feature sequence091 104 1012 gene locus_tag LOCUS_34560 104 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 1066 1488 gene locus_tag LOCUS_34570 1066 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 2893 1607 gene locus_tag LOCUS_34580 gene atrB 2893 1607 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887159.1 protein_id gnl|my_center|LOCUS_34580 4384 2972 gene locus_tag LOCUS_34590 4384 2972 CDS product putative L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67554 protein_id gnl|my_center|LOCUS_34590 5978 4773 gene locus_tag LOCUS_34600 5978 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_34600 7169 6084 gene locus_tag LOCUS_34610 7169 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119245.1 protein_id gnl|my_center|LOCUS_34610 8567 7434 gene locus_tag LOCUS_34620 8567 7434 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_34620 9339 8677 gene locus_tag LOCUS_34630 9339 8677 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727992.1 protein_id gnl|my_center|LOCUS_34630 10075 9377 gene locus_tag LOCUS_34640 gene atoD 10075 9377 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_34640 11645 10134 gene locus_tag LOCUS_34650 11645 10134 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_34650 14095 11663 gene locus_tag LOCUS_34660 14095 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 15409 14129 gene locus_tag LOCUS_34670 15409 14129 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_34670 15660 16163 gene locus_tag LOCUS_34680 15660 16163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 16201 16899 gene locus_tag LOCUS_34690 16201 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence092 <1 827 gene locus_tag LOCUS_34700 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44914:dTDP-glucose 4,6-dehydratase 1018 1926 gene locus_tag LOCUS_34710 gene fcl 1018 1926 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVN0 protein_id gnl|my_center|LOCUS_34710 2013 3032 gene locus_tag LOCUS_34720 gene gmd 2013 3032 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVN3 protein_id gnl|my_center|LOCUS_34720 3068 5197 gene locus_tag LOCUS_34730 3068 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 5258 6589 gene locus_tag LOCUS_34740 5258 6589 CDS product O-unit flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_34740 6586 7308 gene locus_tag LOCUS_34750 6586 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 7359 8573 gene locus_tag LOCUS_34760 7359 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 8570 9262 gene locus_tag LOCUS_34770 8570 9262 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203390.1 protein_id gnl|my_center|LOCUS_34770 9267 9899 gene locus_tag LOCUS_34780 9267 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 10001 11149 gene locus_tag LOCUS_34790 10001 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 11169 12509 gene locus_tag LOCUS_34800 11169 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 12677 13828 gene locus_tag LOCUS_34810 12677 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 13914 14519 gene locus_tag LOCUS_34820 13914 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 14516 15562 gene locus_tag LOCUS_34830 14516 15562 CDS product UDP-N-acetylglucosamine 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203384.1 protein_id gnl|my_center|LOCUS_34830 15555 16787 gene locus_tag LOCUS_34840 15555 16787 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202923.1 protein_id gnl|my_center|LOCUS_34840 >Feature sequence093 1054 614 gene locus_tag LOCUS_34850 1054 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 protein_id gnl|my_center|LOCUS_34850 2734 1106 gene locus_tag LOCUS_34860 gene pyrG 2734 1106 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_34860 3627 2875 gene locus_tag LOCUS_34870 gene kdsB 3627 2875 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI86 protein_id gnl|my_center|LOCUS_34870 4122 4856 gene locus_tag LOCUS_34880 4122 4856 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027449.1 protein_id gnl|my_center|LOCUS_34880 4932 6854 gene locus_tag LOCUS_34890 gene sdhA 4932 6854 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_34890 6851 7627 gene locus_tag LOCUS_34900 6851 7627 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_34900 8595 7726 gene locus_tag LOCUS_34910 8595 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 protein_id gnl|my_center|LOCUS_34910 9779 8619 gene locus_tag LOCUS_34920 9779 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 10360 10010 gene locus_tag LOCUS_34930 10360 10010 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USG1 protein_id gnl|my_center|LOCUS_34930 11079 10495 gene locus_tag LOCUS_34940 11079 10495 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_34940 12957 11080 gene locus_tag LOCUS_34950 12957 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 13775 13383 gene locus_tag LOCUS_34960 13775 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 13825 15966 gene locus_tag LOCUS_34970 gene hppA1 13825 15966 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_34970 >Feature sequence094 121 609 gene locus_tag LOCUS_34980 121 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 817 1149 gene locus_tag LOCUS_34990 817 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 1251 2009 gene locus_tag LOCUS_35000 1251 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681735.1 protein_id gnl|my_center|LOCUS_35000 2488 3303 gene locus_tag LOCUS_35010 2488 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 3416 3931 gene locus_tag LOCUS_35020 3416 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 12088 4316 gene locus_tag LOCUS_35030 12088 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 15570 12085 gene locus_tag LOCUS_35040 15570 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 16219 16007 gene locus_tag LOCUS_35050 16219 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 16598 16404 gene locus_tag LOCUS_35060 16598 16404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence095 2503 116 gene locus_tag LOCUS_35070 2503 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 2930 3697 gene locus_tag LOCUS_35080 2930 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3830 5242 gene locus_tag LOCUS_35090 3830 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 7677 6331 gene locus_tag LOCUS_35100 gene ndh 7677 6331 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_35100 8124 7789 gene locus_tag LOCUS_35110 gene cyoD 8124 7789 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036359.1 protein_id gnl|my_center|LOCUS_35110 8749 8117 gene locus_tag LOCUS_35120 8749 8117 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 protein_id gnl|my_center|LOCUS_35120 10832 8742 gene locus_tag LOCUS_35130 gene cyoB 10832 8742 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931208.1 protein_id gnl|my_center|LOCUS_35130 12264 10825 gene locus_tag LOCUS_35140 12264 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 13107 13034 gene locus_tag LOCUS_t00340 13107 13034 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13207 14394 gene locus_tag LOCUS_35150 13207 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 14375 14761 gene locus_tag LOCUS_35160 14375 14761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 15606 15986 gene locus_tag LOCUS_35170 15606 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 >Feature sequence096 1160 426 gene locus_tag LOCUS_35180 1160 426 CDS product glycosyl transferase family 25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971875.1 protein_id gnl|my_center|LOCUS_35180 3077 1434 gene locus_tag LOCUS_35190 3077 1434 CDS product putative sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702286.1 protein_id gnl|my_center|LOCUS_35190 4513 3266 gene locus_tag LOCUS_35200 gene phoD 4513 3266 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_35200 5790 4846 gene locus_tag LOCUS_35210 5790 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 6878 6171 gene locus_tag LOCUS_35220 6878 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 7352 7035 gene locus_tag LOCUS_35230 7352 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 8629 7709 gene locus_tag LOCUS_35240 8629 7709 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_35240 8842 12225 gene locus_tag LOCUS_35250 8842 12225 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117969.1 protein_id gnl|my_center|LOCUS_35250 12264 13733 gene locus_tag LOCUS_35260 12264 13733 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_35260 13801 14673 gene locus_tag LOCUS_35270 13801 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 15376 14861 gene locus_tag LOCUS_35280 15376 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence097 566 3592 gene locus_tag LOCUS_35290 gene purL 566 3592 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URX8 protein_id gnl|my_center|LOCUS_35290 3664 4443 gene locus_tag LOCUS_35300 gene pfaS 3664 4443 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_35300 5706 4522 gene locus_tag LOCUS_35310 5706 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 7719 5797 gene locus_tag LOCUS_35320 gene glgB 7719 5797 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH1 protein_id gnl|my_center|LOCUS_35320 8901 8164 gene locus_tag LOCUS_35330 8901 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 9769 11589 gene locus_tag LOCUS_35340 9769 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 11902 12612 gene locus_tag LOCUS_35350 11902 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence098 2219 900 gene locus_tag LOCUS_35360 gene arsA 2219 900 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_35360 4077 2251 gene locus_tag LOCUS_35370 4077 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 4512 4979 gene locus_tag LOCUS_35380 4512 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 6216 5140 gene locus_tag LOCUS_35390 6216 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 7784 6387 gene locus_tag LOCUS_35400 7784 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 9587 8010 gene locus_tag LOCUS_35410 9587 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 12094 9596 gene locus_tag LOCUS_35420 12094 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 14022 12169 gene locus_tag LOCUS_35430 14022 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 15438 14311 gene locus_tag LOCUS_35440 15438 14311 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120079.1 protein_id gnl|my_center|LOCUS_35440 >Feature sequence099 162 710 gene locus_tag LOCUS_35450 162 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121374.1 protein_id gnl|my_center|LOCUS_35450 1457 783 gene locus_tag LOCUS_35460 1457 783 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_35460 2276 3034 gene locus_tag LOCUS_35470 2276 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 3235 4185 gene locus_tag LOCUS_35480 3235 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123914.1 protein_id gnl|my_center|LOCUS_35480 4729 6447 gene locus_tag LOCUS_35490 gene groL1 4729 6447 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM99 protein_id gnl|my_center|LOCUS_35490 6583 6879 gene locus_tag LOCUS_35500 gene groS1 6583 6879 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM98 protein_id gnl|my_center|LOCUS_35500 6951 8570 gene locus_tag LOCUS_35510 gene groL2 6951 8570 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM97 protein_id gnl|my_center|LOCUS_35510 8795 9931 gene locus_tag LOCUS_35520 gene dnaJ 8795 9931 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM96 protein_id gnl|my_center|LOCUS_35520 10031 10645 gene locus_tag LOCUS_35530 gene grpE 10031 10645 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM95 protein_id gnl|my_center|LOCUS_35530 10719 11048 gene locus_tag LOCUS_35540 10719 11048 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_35540 11291 12808 gene locus_tag LOCUS_35550 11291 12808 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_35550 12792 14285 gene locus_tag LOCUS_35560 12792 14285 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_35560 14326 15762 gene locus_tag LOCUS_35570 14326 15762 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence100 1291 677 gene locus_tag LOCUS_35580 1291 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117882.1 protein_id gnl|my_center|LOCUS_35580 1657 1355 gene locus_tag LOCUS_35590 gene kptA 1657 1355 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117883.1 protein_id gnl|my_center|LOCUS_35590 1856 1635 gene locus_tag LOCUS_35600 1856 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 1953 2495 gene locus_tag LOCUS_35610 1953 2495 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_35610 4527 2638 gene locus_tag LOCUS_35620 4527 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 6487 5105 gene locus_tag LOCUS_35630 6487 5105 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120374.1 protein_id gnl|my_center|LOCUS_35630 7731 6526 gene locus_tag LOCUS_35640 7731 6526 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_35640 8629 8240 gene locus_tag LOCUS_35650 8629 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 10228 9005 gene locus_tag LOCUS_35660 10228 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_35660 10397 10215 gene locus_tag LOCUS_35670 10397 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 11062 10652 gene locus_tag LOCUS_35680 11062 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 11921 11397 gene locus_tag LOCUS_35690 11921 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 12680 12165 gene locus_tag LOCUS_35700 12680 12165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 13465 13112 gene locus_tag LOCUS_35710 13465 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 14995 13718 gene locus_tag LOCUS_35720 14995 13718 CDS product putative beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703566.1 protein_id gnl|my_center|LOCUS_35720 >Feature sequence101 1893 676 gene locus_tag LOCUS_35730 gene carA 1893 676 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_35730 2432 3658 gene locus_tag LOCUS_35740 gene tet 2432 3658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242239.1 protein_id gnl|my_center|LOCUS_35740 4324 3722 gene locus_tag LOCUS_35750 gene lexA 4324 3722 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNQ7 protein_id gnl|my_center|LOCUS_35750 4968 4717 gene locus_tag LOCUS_35760 4968 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 5049 6392 gene locus_tag LOCUS_35770 gene nqrA 5049 6392 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS5 protein_id gnl|my_center|LOCUS_35770 6400 7692 gene locus_tag LOCUS_35780 gene nqrB 6400 7692 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_35780 7682 8554 gene locus_tag LOCUS_35790 gene nqrC 7682 8554 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG54 protein_id gnl|my_center|LOCUS_35790 8544 9173 gene locus_tag LOCUS_35800 gene nqrD 8544 9173 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS2 protein_id gnl|my_center|LOCUS_35800 9176 9769 gene locus_tag LOCUS_35810 gene nqrE 9176 9769 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_35810 9847 11064 gene locus_tag LOCUS_35820 gene nqrF 9847 11064 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_35820 11285 11746 gene locus_tag LOCUS_35830 11285 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 11843 13132 gene locus_tag LOCUS_35840 gene apbE 11843 13132 CDS product thiamine biosynthesis protein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118544.1 protein_id gnl|my_center|LOCUS_35840 >Feature sequence102 1728 352 gene locus_tag LOCUS_35850 1728 352 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_35850 2573 3751 gene locus_tag LOCUS_35860 2573 3751 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119840.1 protein_id gnl|my_center|LOCUS_35860 3763 4299 gene locus_tag LOCUS_35870 3763 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119839.1 protein_id gnl|my_center|LOCUS_35870 4354 5898 gene locus_tag LOCUS_35880 4354 5898 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_35880 5984 6670 gene locus_tag LOCUS_35890 5984 6670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119837.1 protein_id gnl|my_center|LOCUS_35890 6670 7815 gene locus_tag LOCUS_35900 6670 7815 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119834.1 protein_id gnl|my_center|LOCUS_35900 7978 9339 gene locus_tag LOCUS_35910 7978 9339 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_35910 9509 10384 gene locus_tag LOCUS_35920 9509 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 11191 10433 gene locus_tag LOCUS_35930 gene rnc 11191 10433 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ7 protein_id gnl|my_center|LOCUS_35930 12731 11361 gene locus_tag LOCUS_35940 gene dhs1 12731 11361 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_35940 >Feature sequence103 2710 1367 gene locus_tag LOCUS_35950 2710 1367 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_35950 3157 4647 gene locus_tag LOCUS_35960 3157 4647 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_35960 4736 6565 gene locus_tag LOCUS_35970 4736 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 6693 7601 gene locus_tag LOCUS_35980 6693 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316074.1 protein_id gnl|my_center|LOCUS_35980 8090 7812 gene locus_tag LOCUS_35990 8090 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 8302 8090 gene locus_tag LOCUS_36000 8302 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902953.1 protein_id gnl|my_center|LOCUS_36000 9359 10624 gene locus_tag LOCUS_36010 9359 10624 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119285.1 protein_id gnl|my_center|LOCUS_36010 10628 12046 gene locus_tag LOCUS_36020 gene dpoL 10628 12046 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119624.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence104 <1 2391 gene locus_tag LOCUS_36030 <1 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118986.1:cytochrome c 2397 3887 gene locus_tag LOCUS_36040 2397 3887 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_36040 4123 4932 gene locus_tag LOCUS_36050 4123 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 5795 4980 gene locus_tag LOCUS_36060 5795 4980 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_36060 7582 5888 gene locus_tag LOCUS_36070 7582 5888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118270.1 protein_id gnl|my_center|LOCUS_36070 8888 7674 gene locus_tag LOCUS_36080 gene argG 8888 7674 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFW4 protein_id gnl|my_center|LOCUS_36080 9058 10101 gene locus_tag LOCUS_36090 9058 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 10397 12301 gene locus_tag LOCUS_36100 10397 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 12267 13952 gene locus_tag LOCUS_36110 12267 13952 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_36110 >Feature sequence105 1061 1435 gene locus_tag LOCUS_36120 1061 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 1713 3641 gene locus_tag LOCUS_36130 1713 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 3634 4878 gene locus_tag LOCUS_36140 3634 4878 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124024.1 protein_id gnl|my_center|LOCUS_36140 4878 6299 gene locus_tag LOCUS_36150 4878 6299 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124025.1 protein_id gnl|my_center|LOCUS_36150 6296 7144 gene locus_tag LOCUS_36160 6296 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 7148 8065 gene locus_tag LOCUS_36170 7148 8065 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334794.1 protein_id gnl|my_center|LOCUS_36170 8127 8462 gene locus_tag LOCUS_36180 8127 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 8459 9442 gene locus_tag LOCUS_36190 8459 9442 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124021.1 protein_id gnl|my_center|LOCUS_36190 9495 10604 gene locus_tag LOCUS_36200 9495 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 10718 12628 gene locus_tag LOCUS_36210 10718 12628 CDS product secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124043.1 protein_id gnl|my_center|LOCUS_36210 12625 13164 gene locus_tag LOCUS_36220 12625 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124044.1 protein_id gnl|my_center|LOCUS_36220 13164 13892 gene locus_tag LOCUS_36230 gene pilF 13164 13892 CDS product type IV fimbrial biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124045.1 protein_id gnl|my_center|LOCUS_36230 >Feature sequence106 491 1771 gene locus_tag LOCUS_36240 491 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_36240 1768 4254 gene locus_tag LOCUS_36250 1768 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 4448 5662 gene locus_tag LOCUS_36260 4448 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_36260 5678 7258 gene locus_tag LOCUS_36270 5678 7258 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_36270 7394 9178 gene locus_tag LOCUS_36280 7394 9178 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123572.1 protein_id gnl|my_center|LOCUS_36280 9238 10155 gene locus_tag LOCUS_36290 9238 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 10181 11986 gene locus_tag LOCUS_36300 10181 11986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 12105 13625 gene locus_tag LOCUS_36310 12105 13625 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_36310 >Feature sequence107 22 1983 gene locus_tag LOCUS_36320 gene acsA 22 1983 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59872 protein_id gnl|my_center|LOCUS_36320 2529 3593 gene locus_tag LOCUS_36330 2529 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 3648 7763 gene locus_tag LOCUS_36340 3648 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 8372 7884 gene locus_tag LOCUS_36350 gene fsxA 8372 7884 CDS product exclusion protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938508.1 protein_id gnl|my_center|LOCUS_36350 8747 9307 gene locus_tag LOCUS_36360 8747 9307 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118402.1 protein_id gnl|my_center|LOCUS_36360 9569 10420 gene locus_tag LOCUS_36370 9569 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975431.1 protein_id gnl|my_center|LOCUS_36370 12222 10498 gene locus_tag LOCUS_36380 12222 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 13128 13457 gene locus_tag LOCUS_36390 13128 13457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence108 890 1870 gene locus_tag LOCUS_36400 890 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 3066 1906 gene locus_tag LOCUS_36410 3066 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 4437 3121 gene locus_tag LOCUS_36420 4437 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 6190 4505 gene locus_tag LOCUS_36430 6190 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057740.1 protein_id gnl|my_center|LOCUS_36430 7429 6398 gene locus_tag LOCUS_36440 7429 6398 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123060.1 protein_id gnl|my_center|LOCUS_36440 8167 9192 gene locus_tag LOCUS_36450 8167 9192 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123060.1 protein_id gnl|my_center|LOCUS_36450 9354 9443 gene locus_tag LOCUS_t00350 9354 9443 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9939 9712 gene locus_tag LOCUS_36460 9939 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 10001 13513 gene locus_tag LOCUS_36470 10001 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence109 119 1378 gene locus_tag LOCUS_36480 119 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 1638 2150 gene locus_tag LOCUS_36490 1638 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 2161 2880 gene locus_tag LOCUS_36500 2161 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 3040 3786 gene locus_tag LOCUS_36510 3040 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 3797 4762 gene locus_tag LOCUS_36520 3797 4762 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_36520 4762 5709 gene locus_tag LOCUS_36530 4762 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 5752 6867 gene locus_tag LOCUS_36540 5752 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 6899 7954 gene locus_tag LOCUS_36550 6899 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 7965 8945 gene locus_tag LOCUS_36560 7965 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 9091 9978 gene locus_tag LOCUS_36570 9091 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 10256 10537 gene locus_tag LOCUS_36580 10256 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 10540 12108 gene locus_tag LOCUS_36590 gene fadD 10540 12108 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 protein_id gnl|my_center|LOCUS_36590 12242 13603 gene locus_tag LOCUS_36600 gene lysA 12242 13603 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971789.1 protein_id gnl|my_center|LOCUS_36600 >Feature sequence110 161 961 gene locus_tag LOCUS_36610 161 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 protein_id gnl|my_center|LOCUS_36610 1164 1577 gene locus_tag LOCUS_36620 1164 1577 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974224.1 protein_id gnl|my_center|LOCUS_36620 2015 1611 gene locus_tag LOCUS_36630 2015 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 3193 2282 gene locus_tag LOCUS_36640 3193 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 3609 4340 gene locus_tag LOCUS_36650 3609 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 4842 4393 gene locus_tag LOCUS_36660 4842 4393 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_36660 6071 4854 gene locus_tag LOCUS_36670 6071 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 6335 7453 gene locus_tag LOCUS_36680 6335 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 7607 8320 gene locus_tag LOCUS_36690 7607 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123868.1 protein_id gnl|my_center|LOCUS_36690 8403 9737 gene locus_tag LOCUS_36700 8403 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 10783 9788 gene locus_tag LOCUS_36710 10783 9788 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_36710 11907 10885 gene locus_tag LOCUS_36720 gene fadB5 11907 10885 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_36720 12363 11974 gene locus_tag LOCUS_36730 12363 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325780.1 protein_id gnl|my_center|LOCUS_36730 >Feature sequence111 284 24 gene locus_tag LOCUS_36740 284 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 1524 568 gene locus_tag LOCUS_36750 1524 568 CDS product malate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119988.1 protein_id gnl|my_center|LOCUS_36750 2824 1868 gene locus_tag LOCUS_36760 2824 1868 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_36760 4635 3229 gene locus_tag LOCUS_36770 4635 3229 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_36770 5741 4737 gene locus_tag LOCUS_36780 5741 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_36780 6381 8423 gene locus_tag LOCUS_36790 gene tkt 6381 8423 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123963.1 protein_id gnl|my_center|LOCUS_36790 8619 10700 gene locus_tag LOCUS_36800 8619 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_36800 10700 11215 gene locus_tag LOCUS_36810 10700 11215 CDS product hypothetical phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703771.1 protein_id gnl|my_center|LOCUS_36810 11403 11492 gene locus_tag LOCUS_t00360 11403 11492 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12272 12835 gene locus_tag LOCUS_36820 gene cynT 12272 12835 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8P6 protein_id gnl|my_center|LOCUS_36820 >Feature sequence112 1910 1314 gene locus_tag LOCUS_36830 1910 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 2077 2997 gene locus_tag LOCUS_36840 2077 2997 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_36840 7005 3001 gene locus_tag LOCUS_36850 7005 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 7957 7334 gene locus_tag LOCUS_36860 7957 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 8385 9791 gene locus_tag LOCUS_36870 8385 9791 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700859.1 protein_id gnl|my_center|LOCUS_36870 9927 11183 gene locus_tag LOCUS_36880 9927 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_36880 12553 11426 gene locus_tag LOCUS_36890 12553 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence113 659 3484 gene locus_tag LOCUS_36900 659 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 3493 4938 gene locus_tag LOCUS_36910 3493 4938 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118987.1 protein_id gnl|my_center|LOCUS_36910 5263 5487 gene locus_tag LOCUS_36920 5263 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 6114 6680 gene locus_tag LOCUS_36930 6114 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 6792 9356 gene locus_tag LOCUS_36940 6792 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 10305 9670 gene locus_tag LOCUS_36950 10305 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 10992 11393 gene locus_tag LOCUS_36960 10992 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 12040 11663 gene locus_tag LOCUS_36970 12040 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 >Feature sequence114 965 93 gene locus_tag LOCUS_36980 965 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 2339 1230 gene locus_tag LOCUS_36990 2339 1230 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_36990 2965 3885 gene locus_tag LOCUS_37000 2965 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 3887 4108 gene locus_tag LOCUS_37010 3887 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 4370 5527 gene locus_tag LOCUS_37020 gene rimK 4370 5527 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_37020 6444 5545 gene locus_tag LOCUS_37030 gene ilvE 6444 5545 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_37030 6738 7211 gene locus_tag LOCUS_37040 6738 7211 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886918.1 protein_id gnl|my_center|LOCUS_37040 7787 7227 gene locus_tag LOCUS_37050 7787 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 8299 7784 gene locus_tag LOCUS_37060 8299 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 8817 8371 gene locus_tag LOCUS_37070 8817 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328582.1 protein_id gnl|my_center|LOCUS_37070 9073 9537 gene locus_tag LOCUS_37080 9073 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 11330 9672 gene locus_tag LOCUS_37090 11330 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 <12545 11442 gene locus_tag LOCUS_37100 <12545 11442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120765.1:TolB protein >Feature sequence115 169 834 gene locus_tag LOCUS_37110 gene epsE 169 834 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_37110 863 1951 gene locus_tag LOCUS_37120 863 1951 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_37120 1948 2532 gene locus_tag LOCUS_37130 1948 2532 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_37130 2588 3712 gene locus_tag LOCUS_37140 2588 3712 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_37140 4033 5085 gene locus_tag LOCUS_37150 4033 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 5082 6530 gene locus_tag LOCUS_37160 5082 6530 CDS product succinoglycan biosynthesis transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_37160 6575 7663 gene locus_tag LOCUS_37170 6575 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 7712 9028 gene locus_tag LOCUS_37180 7712 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 9021 10238 gene locus_tag LOCUS_37190 9021 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 10260 11264 gene locus_tag LOCUS_37200 10260 11264 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876089.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence116 383 33 gene locus_tag LOCUS_37210 383 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 1975 824 gene locus_tag LOCUS_37220 gene nanH 1975 824 CDS product neuraminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122061.1 protein_id gnl|my_center|LOCUS_37220 4042 2030 gene locus_tag LOCUS_37230 gene atsA 4042 2030 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121572.1 protein_id gnl|my_center|LOCUS_37230 4455 4952 gene locus_tag LOCUS_37240 4455 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 5171 5599 gene locus_tag LOCUS_37250 5171 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 5792 6256 gene locus_tag LOCUS_37260 5792 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 6454 6909 gene locus_tag LOCUS_37270 6454 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 7186 8556 gene locus_tag LOCUS_37280 7186 8556 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202061.1 protein_id gnl|my_center|LOCUS_37280 8566 9792 gene locus_tag LOCUS_37290 8566 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 9939 11378 gene locus_tag LOCUS_37300 9939 11378 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 protein_id gnl|my_center|LOCUS_37300 >Feature sequence117 <1 1042 gene locus_tag LOCUS_37310 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943292.1:MATE family efflux transporter 1317 2408 gene locus_tag LOCUS_37320 gene dipZ 1317 2408 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121113.1 protein_id gnl|my_center|LOCUS_37320 2727 3233 gene locus_tag LOCUS_37330 2727 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 3276 3725 gene locus_tag LOCUS_37340 3276 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 4660 3770 gene locus_tag LOCUS_37350 4660 3770 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119404.1 protein_id gnl|my_center|LOCUS_37350 6904 4736 gene locus_tag LOCUS_37360 6904 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 7606 8643 gene locus_tag LOCUS_37370 7606 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 11064 8806 gene locus_tag LOCUS_37380 11064 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 11874 11104 gene locus_tag LOCUS_37390 11874 11104 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_37390 >Feature sequence118 601 416 gene locus_tag LOCUS_37400 601 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 792 1616 gene locus_tag LOCUS_37410 gene hemD 792 1616 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889975.1 protein_id gnl|my_center|LOCUS_37410 2605 1613 gene locus_tag LOCUS_37420 2605 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120366.1 protein_id gnl|my_center|LOCUS_37420 3046 5256 gene locus_tag LOCUS_37430 3046 5256 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969367.1 protein_id gnl|my_center|LOCUS_37430 5333 6913 gene locus_tag LOCUS_37440 gene aslA 5333 6913 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122345.1 protein_id gnl|my_center|LOCUS_37440 8351 6948 gene locus_tag LOCUS_37450 8351 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_37450 11138 8529 gene locus_tag LOCUS_37460 11138 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_37460 >Feature sequence119 245 1786 gene locus_tag LOCUS_37470 gene gatA 245 1786 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_37470 1838 3274 gene locus_tag LOCUS_37480 1838 3274 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252933.1 protein_id gnl|my_center|LOCUS_37480 3354 4463 gene locus_tag LOCUS_37490 3354 4463 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_37490 4586 5056 gene locus_tag LOCUS_37500 4586 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 6078 5305 gene locus_tag LOCUS_37510 6078 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 8772 6334 gene locus_tag LOCUS_37520 8772 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37520 9021 8776 gene locus_tag LOCUS_37530 9021 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37530 9610 10020 gene locus_tag LOCUS_37540 9610 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 10368 10141 gene locus_tag LOCUS_37550 10368 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence120 1099 2496 gene locus_tag LOCUS_37560 1099 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 2875 5874 gene locus_tag LOCUS_37570 2875 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 5889 7283 gene locus_tag LOCUS_37580 5889 7283 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_37580 7380 7946 gene locus_tag LOCUS_37590 7380 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 8387 9001 gene locus_tag LOCUS_37600 8387 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 10790 9240 gene locus_tag LOCUS_37610 10790 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 >Feature sequence121 1273 1485 gene locus_tag LOCUS_37620 1273 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 1557 3695 gene locus_tag LOCUS_37630 gene ligA 1557 3695 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180F3 protein_id gnl|my_center|LOCUS_37630 4033 3749 gene locus_tag LOCUS_37640 4033 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 5154 6071 gene locus_tag LOCUS_37650 5154 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 6308 7258 gene locus_tag LOCUS_37660 6308 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_37660 8828 7371 gene locus_tag LOCUS_37670 8828 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 9190 10446 gene locus_tag LOCUS_37680 9190 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 >Feature sequence122 703 2724 gene locus_tag LOCUS_37690 703 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_37690 2903 3991 gene locus_tag LOCUS_37700 2903 3991 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_37700 5466 4090 gene locus_tag LOCUS_37710 5466 4090 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_37710 6956 5511 gene locus_tag LOCUS_37720 6956 5511 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_37720 8049 7270 gene locus_tag LOCUS_37730 8049 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 8484 8308 gene locus_tag LOCUS_37740 8484 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 9370 9158 gene locus_tag LOCUS_37750 9370 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 9435 10694 gene locus_tag LOCUS_37760 9435 10694 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124034.1 protein_id gnl|my_center|LOCUS_37760 >Feature sequence123 3606 2320 gene locus_tag LOCUS_37770 3606 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_37770 6242 3603 gene locus_tag LOCUS_37780 6242 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120136.1 protein_id gnl|my_center|LOCUS_37780 7833 6394 gene locus_tag LOCUS_37790 7833 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 8381 7830 gene locus_tag LOCUS_37800 8381 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 8808 9800 gene locus_tag LOCUS_37810 8808 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 9907 10551 gene locus_tag LOCUS_37820 9907 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 >Feature sequence124 478 741 gene locus_tag LOCUS_37830 478 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 905 1444 gene locus_tag LOCUS_37840 905 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 1612 1382 gene locus_tag LOCUS_37850 1612 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 2415 3287 gene locus_tag LOCUS_37860 2415 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 3566 4033 gene locus_tag LOCUS_37870 3566 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 4322 4744 gene locus_tag LOCUS_37880 4322 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 4901 5437 gene locus_tag LOCUS_37890 4901 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 5632 5853 gene locus_tag LOCUS_37900 5632 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 6050 6487 gene locus_tag LOCUS_37910 6050 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 6710 7249 gene locus_tag LOCUS_37920 6710 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 7723 8322 gene locus_tag LOCUS_37930 7723 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 8648 8433 gene locus_tag LOCUS_37940 8648 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 9392 10207 gene locus_tag LOCUS_37950 9392 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 >Feature sequence125 3835 2006 gene locus_tag LOCUS_37960 3835 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 4832 3867 gene locus_tag LOCUS_37970 4832 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 5260 6648 gene locus_tag LOCUS_37980 5260 6648 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_37980 8111 6654 gene locus_tag LOCUS_37990 8111 6654 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942685.1 protein_id gnl|my_center|LOCUS_37990 8561 10045 gene locus_tag LOCUS_38000 gene htrA 8561 10045 CDS product putative periplasmic serine endoprotease DegP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6T0 protein_id gnl|my_center|LOCUS_38000 >Feature sequence126 150 1586 gene locus_tag LOCUS_38010 gene pykF 150 1586 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC19 protein_id gnl|my_center|LOCUS_38010 2520 2077 gene locus_tag LOCUS_38020 2520 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329468.1 protein_id gnl|my_center|LOCUS_38020 2839 3768 gene locus_tag LOCUS_38030 2839 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 3917 4279 gene locus_tag LOCUS_38040 3917 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 5467 4481 gene locus_tag LOCUS_38050 5467 4481 CDS product hemolysin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324277.1 protein_id gnl|my_center|LOCUS_38050 6735 5464 gene locus_tag LOCUS_38060 6735 5464 CDS product hemolysin activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120735.1 protein_id gnl|my_center|LOCUS_38060 8602 6728 gene locus_tag LOCUS_38070 8602 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335479.1 protein_id gnl|my_center|LOCUS_38070 9056 9631 gene locus_tag LOCUS_38080 9056 9631 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79VI1 protein_id gnl|my_center|LOCUS_38080 >Feature sequence127 1411 482 gene locus_tag LOCUS_38090 1411 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_38090 2459 1416 gene locus_tag LOCUS_38100 gene moxR 2459 1416 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_38100 5628 3460 gene locus_tag LOCUS_38110 5628 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 7573 5663 gene locus_tag LOCUS_38120 7573 5663 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118381.1 protein_id gnl|my_center|LOCUS_38120 8128 9030 gene locus_tag LOCUS_38130 8128 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence128 113 331 gene locus_tag LOCUS_38140 113 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 328 873 gene locus_tag LOCUS_38150 gene cinA 328 873 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122795.1 protein_id gnl|my_center|LOCUS_38150 1158 2726 gene locus_tag LOCUS_38160 gene purH 1158 2726 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ8 protein_id gnl|my_center|LOCUS_38160 2846 3838 gene locus_tag LOCUS_38170 2846 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 4146 3955 gene locus_tag LOCUS_38180 4146 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 4386 4171 gene locus_tag LOCUS_38190 4386 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 6115 4571 gene locus_tag LOCUS_38200 6115 4571 CDS product spore cortex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121721.1 protein_id gnl|my_center|LOCUS_38200 >Feature sequence129 1597 4245 gene locus_tag LOCUS_38210 1597 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 4294 5064 gene locus_tag LOCUS_38220 4294 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 5920 5135 gene locus_tag LOCUS_38230 5920 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 7124 5985 gene locus_tag LOCUS_38240 7124 5985 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_38240 7283 7678 gene locus_tag LOCUS_38250 7283 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 <9100 7941 gene locus_tag LOCUS_38260 <9100 7941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328832.1:prepilin-type N-terminal cleavage/methylation domain-containing protein >Feature sequence130 <1 3145 gene locus_tag LOCUS_38270 <1 3145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein 3135 6017 gene locus_tag LOCUS_38280 3135 6017 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117769.1 protein_id gnl|my_center|LOCUS_38280 7221 6157 gene locus_tag LOCUS_38290 7221 6157 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXK8 protein_id gnl|my_center|LOCUS_38290 7534 8034 gene locus_tag LOCUS_38300 7534 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 8221 8628 gene locus_tag LOCUS_38310 8221 8628 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325564.1 protein_id gnl|my_center|LOCUS_38310 >Feature sequence131 448 1821 gene locus_tag LOCUS_38320 448 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 1973 2647 gene locus_tag LOCUS_38330 1973 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 2945 4816 gene locus_tag LOCUS_38340 2945 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 5059 6039 gene locus_tag LOCUS_38350 5059 6039 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_38350 6657 6145 gene locus_tag LOCUS_38360 gene gntK 6657 6145 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92VK3 protein_id gnl|my_center|LOCUS_38360 6953 7513 gene locus_tag LOCUS_38370 6953 7513 CDS product antitermination factor NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327462.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence132 1114 131 gene locus_tag LOCUS_38380 1114 131 CDS product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120147.1 protein_id gnl|my_center|LOCUS_38380 1156 1524 gene locus_tag LOCUS_38390 1156 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 2000 2227 gene locus_tag LOCUS_38400 2000 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 3722 2253 gene locus_tag LOCUS_38410 3722 2253 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_38410 3995 5314 gene locus_tag LOCUS_38420 3995 5314 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_38420 5404 7893 gene locus_tag LOCUS_38430 5404 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence133 1896 913 gene locus_tag LOCUS_38440 1896 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 2414 1893 gene locus_tag LOCUS_38450 2414 1893 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_38450 4267 2852 gene locus_tag LOCUS_38460 4267 2852 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_38460 5229 4267 gene locus_tag LOCUS_38470 5229 4267 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118295.1 protein_id gnl|my_center|LOCUS_38470 5355 6206 gene locus_tag LOCUS_38480 5355 6206 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122864.1 protein_id gnl|my_center|LOCUS_38480 6343 7770 gene locus_tag LOCUS_38490 gene aslA 6343 7770 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_38490 >Feature sequence134 3350 4606 gene locus_tag LOCUS_38500 3350 4606 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38500 4745 5287 gene locus_tag LOCUS_38510 4745 5287 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_38510 5284 6756 gene locus_tag LOCUS_38520 5284 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence135 1147 134 gene locus_tag LOCUS_38530 gene gnl 1147 134 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 protein_id gnl|my_center|LOCUS_38530 3869 1275 gene locus_tag LOCUS_38540 3869 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 4051 5604 gene locus_tag LOCUS_38550 gene gltB2 4051 5604 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_38550 5665 6504 gene locus_tag LOCUS_38560 gene suhB 5665 6504 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120572.1 protein_id gnl|my_center|LOCUS_38560 >Feature sequence136 50 472 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgccagagaagatagatcactcacct 2469 1084 gene locus_tag LOCUS_38570 2469 1084 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 protein_id gnl|my_center|LOCUS_38570 3126 2617 gene locus_tag LOCUS_38580 3126 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3953 3639 gene locus_tag LOCUS_38590 3953 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 5204 4626 gene locus_tag LOCUS_38600 5204 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 5428 5961 gene locus_tag LOCUS_38610 5428 5961 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_38610 6318 6094 gene locus_tag LOCUS_38620 6318 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 >Feature sequence137 1520 2113 gene locus_tag LOCUS_38630 gene pfpI 1520 2113 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328160.1 protein_id gnl|my_center|LOCUS_38630 3905 2166 gene locus_tag LOCUS_38640 3905 2166 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_38640 4157 5713 gene locus_tag LOCUS_38650 4157 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118384.1 protein_id gnl|my_center|LOCUS_38650 >Feature sequence138 95 427 gene locus_tag LOCUS_38660 95 427 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405420.1 protein_id gnl|my_center|LOCUS_38660 612 529 gene locus_tag LOCUS_t00370 612 529 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 907 2697 gene locus_tag LOCUS_38670 907 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 3181 2798 gene locus_tag LOCUS_38680 gene mscL 3181 2798 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910489.1 protein_id gnl|my_center|LOCUS_38680 3454 5292 gene locus_tag LOCUS_38690 3454 5292 CDS product 4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117803.1 protein_id gnl|my_center|LOCUS_38690 5489 6337 gene locus_tag LOCUS_38700 5489 6337 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970849.1 protein_id gnl|my_center|LOCUS_38700 6761 6988 gene locus_tag LOCUS_38710 6761 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 >Feature sequence139 139 1638 gene locus_tag LOCUS_38720 139 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_38720 3266 1674 gene locus_tag LOCUS_38730 gene mdsA 3266 1674 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121930.1 protein_id gnl|my_center|LOCUS_38730 3432 4721 gene locus_tag LOCUS_38740 3432 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122571.1 protein_id gnl|my_center|LOCUS_38740 >Feature sequence140 565 1566 gene locus_tag LOCUS_38750 565 1566 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_38750 1557 1886 gene locus_tag LOCUS_38760 1557 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123084.1 protein_id gnl|my_center|LOCUS_38760 3644 2076 gene locus_tag LOCUS_38770 3644 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence141 1100 1843 gene locus_tag LOCUS_38780 1100 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 1907 3184 gene locus_tag LOCUS_38790 1907 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 3239 4597 gene locus_tag LOCUS_38800 gene aslA 3239 4597 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120007.1 protein_id gnl|my_center|LOCUS_38800 >Feature sequence142 876 280 gene locus_tag LOCUS_38810 876 280 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 protein_id gnl|my_center|LOCUS_38810 1253 1399 gene locus_tag LOCUS_38820 1253 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 5351 1842 gene locus_tag LOCUS_38830 5351 1842 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120793.1 protein_id gnl|my_center|LOCUS_38830 >Feature sequence143 1539 478 gene locus_tag LOCUS_38840 1539 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120927.1 protein_id gnl|my_center|LOCUS_38840 5951 1536 gene locus_tag LOCUS_38850 5951 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 >Feature sequence144 361 843 gene locus_tag LOCUS_38860 361 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 827 2623 gene locus_tag LOCUS_38870 gene lepA2 827 2623 CDS product elongation factor 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE01 protein_id gnl|my_center|LOCUS_38870 4090 2846 gene locus_tag LOCUS_38880 4090 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103754.1 protein_id gnl|my_center|LOCUS_38880 5414 5154 gene locus_tag LOCUS_38890 5414 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 >Feature sequence145 2629 4626 gene locus_tag LOCUS_38900 gene capD 2629 4626 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902060.1 protein_id gnl|my_center|LOCUS_38900 >Feature sequence146 1522 101 gene locus_tag LOCUS_38910 1522 101 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_38910 2529 1597 gene locus_tag LOCUS_38920 2529 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327229.1 protein_id gnl|my_center|LOCUS_38920 3855 2584 gene locus_tag LOCUS_38930 3855 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence147 2461 1028 gene locus_tag LOCUS_38940 2461 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 protein_id gnl|my_center|LOCUS_38940 4068 2575 gene locus_tag LOCUS_38950 4068 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 >Feature sequence148 1167 1 gene locus_tag LOCUS_38960 1167 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118488.1 protein_id gnl|my_center|LOCUS_38960 1560 2972 gene locus_tag LOCUS_38970 gene mntH 1560 2972 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_38970 3044 4060 gene locus_tag LOCUS_38980 gene yjgB 3044 4060 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_38980 4392 4320 gene locus_tag LOCUS_t00380 4392 4320 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence149 332 1627 gene locus_tag LOCUS_38990 332 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 2210 3214 gene locus_tag LOCUS_39000 2210 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887046.1 protein_id gnl|my_center|LOCUS_39000 3269 4294 gene locus_tag LOCUS_39010 3269 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886924.1 protein_id gnl|my_center|LOCUS_39010 4544 4470 gene locus_tag LOCUS_t00390 4544 4470 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence150 656 2815 gene locus_tag LOCUS_39020 656 2815 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_39020 3024 4190 gene locus_tag LOCUS_39030 3024 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence151 3275 1629 gene locus_tag LOCUS_39040 3275 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 3827 4141 gene locus_tag LOCUS_39050 3827 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 >Feature sequence152 128 694 gene locus_tag LOCUS_39060 128 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 1850 1083 gene locus_tag LOCUS_39070 1850 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 2363 2145 gene locus_tag LOCUS_39080 2363 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 2883 2737 gene locus_tag LOCUS_39090 2883 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 3224 3697 gene locus_tag LOCUS_39100 3224 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 3824 4252 gene locus_tag LOCUS_39110 3824 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence153 1330 2736 gene locus_tag LOCUS_39120 1330 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 3831 4238 gene locus_tag LOCUS_39130 3831 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence154 >Feature sequence155 <1 797 gene locus_tag LOCUS_39140 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118433.1:ATP-dependent DNA ligase 919 3393 gene locus_tag LOCUS_39150 gene helX 919 3393 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118436.1 protein_id gnl|my_center|LOCUS_39150 3399 4247 gene locus_tag LOCUS_39160 3399 4247 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_39160 >Feature sequence156 1382 210 gene locus_tag LOCUS_39170 1382 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 1530 1610 gene locus_tag LOCUS_t00400 1530 1610 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3644 2034 gene locus_tag LOCUS_39180 3644 2034 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_39180 >Feature sequence157 <1 3192 gene locus_tag LOCUS_39190 <1 3192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121109.1:9-O-acetylesterase 3432 3235 gene locus_tag LOCUS_39200 3432 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 3633 3794 gene locus_tag LOCUS_39210 3633 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence158 451 98 gene locus_tag LOCUS_39220 451 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 662 1075 gene locus_tag LOCUS_39230 662 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 1421 1143 gene locus_tag LOCUS_39240 1421 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 2437 1523 gene locus_tag LOCUS_39250 2437 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 3139 2507 gene locus_tag LOCUS_39260 3139 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119419.1 protein_id gnl|my_center|LOCUS_39260 3822 3283 gene locus_tag LOCUS_39270 3822 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence159 1496 2965 gene locus_tag LOCUS_39280 1496 2965 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_39280 3700 3209 gene locus_tag LOCUS_39290 3700 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 >Feature sequence160 590 2212 gene locus_tag LOCUS_39300 gene gspK 590 2212 CDS product general secretion pathway protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120491.1 protein_id gnl|my_center|LOCUS_39300 >Feature sequence161 340 819 gene locus_tag LOCUS_39310 340 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39310 1143 2816 gene locus_tag LOCUS_39320 1143 2816 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_39320 <3798 2929 gene locus_tag LOCUS_39330 <3798 2929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_858205.1:IS1294 transposase >Feature sequence162 1574 1842 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggacgcggcggagcgggcgg 3365 2094 gene locus_tag LOCUS_39340 3365 2094 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728377.1 protein_id gnl|my_center|LOCUS_39340 >Feature sequence163 <1 1319 gene locus_tag LOCUS_39350 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin 1461 3341 gene locus_tag LOCUS_39360 1461 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 >Feature sequence164 218 445 gene locus_tag LOCUS_39370 218 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 2587 2961 gene locus_tag LOCUS_39380 2587 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 >Feature sequence165 312 166 gene locus_tag LOCUS_39390 312 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 1085 825 gene locus_tag LOCUS_39400 1085 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39400 1244 2272 gene locus_tag LOCUS_39410 1244 2272 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_39410 >Feature sequence166 <1 1001 gene locus_tag LOCUS_39420 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118858.1:capsular polysaccharide biosynthesis protein 1987 1052 gene locus_tag LOCUS_39430 1987 1052 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URI8 protein_id gnl|my_center|LOCUS_39430 <3220 2066 gene locus_tag LOCUS_39440 <3220 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119310.1:N-acylglucosamine 2-epimerase >Feature sequence167 >Feature sequence168 >Feature sequence169 94 1584 gene locus_tag LOCUS_39450 94 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 >Feature sequence170 >Feature sequence171 924 568 gene locus_tag LOCUS_39460 924 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 1506 1204 gene locus_tag LOCUS_39470 1506 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 1783 1559 gene locus_tag LOCUS_39480 1783 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 2556 2197 gene locus_tag LOCUS_39490 2556 2197 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477812.1 protein_id gnl|my_center|LOCUS_39490 >Feature sequence172 43 594 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgccagaggagataggtcact 1206 1484 gene locus_tag LOCUS_39500 1206 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence173 >Feature sequence174 <1 687 gene locus_tag LOCUS_39510 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330716.1:general secretion pathway protein GspE 775 1983 gene locus_tag LOCUS_39520 775 1983 CDS product type IV pilus biogenesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_39520 2056 2478 gene locus_tag LOCUS_39530 gene gspG 2056 2478 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070566.1 protein_id gnl|my_center|LOCUS_39530 >Feature sequence175 776 934 gene locus_tag LOCUS_39540 776 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 2186 993 gene locus_tag LOCUS_39550 2186 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 >Feature sequence176 1197 268 gene locus_tag LOCUS_39560 1197 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 1651 1199 gene locus_tag LOCUS_39570 1651 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 2262 1648 gene locus_tag LOCUS_39580 2262 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 >Feature sequence177 >Feature sequence178 994 2118 gene locus_tag LOCUS_39590 994 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 >Feature sequence179 403 621 gene locus_tag LOCUS_39600 403 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 901 701 gene locus_tag LOCUS_39610 901 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 1215 2204 gene locus_tag LOCUS_39620 gene pfkA 1215 2204 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C1 protein_id gnl|my_center|LOCUS_39620 >Feature sequence180 >Feature sequence181 <1 2082 gene locus_tag LOCUS_39630 <1 2082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404205.1:protein kinase >Feature sequence182 >Feature sequence183 >Feature sequence184 >Feature sequence185 821 207 gene locus_tag LOCUS_39640 821 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 1328 906 gene locus_tag LOCUS_39650 gene gspG 1328 906 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070566.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence186 >Feature sequence187 1553 522 gene locus_tag LOCUS_39660 1553 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 1816 1658 gene locus_tag LOCUS_39670 1816 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 >Feature sequence188 1753 425 gene locus_tag LOCUS_39680 1753 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 >Feature sequence189 <1774 221 gene locus_tag LOCUS_39690 <1774 221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263947.1:ATP-dependent DNA helicase RecQ >Feature sequence190 <1759 569 gene locus_tag LOCUS_39700 <1759 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330748.1:glucosamine-6-phosphate deaminase >Feature sequence191 1604 414 gene locus_tag LOCUS_39710 1604 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087425.1 protein_id gnl|my_center|LOCUS_39710 >Feature sequence192 820 278 gene locus_tag LOCUS_39720 820 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 1079 813 gene locus_tag LOCUS_39730 1079 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 1732 1181 gene locus_tag LOCUS_39740 1732 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence193 1167 73 gene locus_tag LOCUS_39750 1167 73 CDS product stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257881.1 protein_id gnl|my_center|LOCUS_39750 >Feature sequence194 299 448 gene locus_tag LOCUS_39760 299 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 512 1267 gene locus_tag LOCUS_39770 512 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 >Feature sequence195 <1 1026 gene locus_tag LOCUS_39780 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121233.1:transporter >Feature sequence196 766 1494 gene locus_tag LOCUS_39790 766 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790