>Feature sequence001 <1 657 gene locus_tag LOCUS_00010 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S2T8:chromosomal replication initiator protein DnaA 1007 2122 gene locus_tag LOCUS_00020 gene dnaN 1007 2122 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKK1 protein_id gnl|my_center|LOCUS_00020 2129 2494 gene locus_tag LOCUS_00030 2129 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2521 5031 gene locus_tag LOCUS_00040 gene gyrB 2521 5031 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM28 protein_id gnl|my_center|LOCUS_00040 5622 5056 gene locus_tag LOCUS_00050 5622 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00050 5958 5647 gene locus_tag LOCUS_00060 5958 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00060 7042 5993 gene locus_tag LOCUS_00070 gene moxR 7042 5993 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122148.1 protein_id gnl|my_center|LOCUS_00070 10387 7049 gene locus_tag LOCUS_00080 10387 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 >Feature sequence002 701 4870 gene locus_tag LOCUS_00090 701 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5042 7258 gene locus_tag LOCUS_00100 5042 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_00100 7268 7969 gene locus_tag LOCUS_00110 7268 7969 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_00110 8847 7966 gene locus_tag LOCUS_00120 8847 7966 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_00120 9870 8890 gene locus_tag LOCUS_00130 gene gmd 9870 8890 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_00130 >Feature sequence003 700 257 gene locus_tag LOCUS_00140 gene tadA 700 257 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIP0 protein_id gnl|my_center|LOCUS_00140 1372 731 gene locus_tag LOCUS_00150 1372 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 2551 1409 gene locus_tag LOCUS_00160 2551 1409 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_00160 4739 2796 gene locus_tag LOCUS_00170 4739 2796 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_00170 5320 4955 gene locus_tag LOCUS_00180 5320 4955 CDS product nuclear scaffold-like protein p76 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333113.1 protein_id gnl|my_center|LOCUS_00180 6328 5438 gene locus_tag LOCUS_00190 6328 5438 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121957.1 protein_id gnl|my_center|LOCUS_00190 7498 6368 gene locus_tag LOCUS_00200 7498 6368 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_00200 <8844 7621 gene locus_tag LOCUS_00210 <8844 7621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118609.1:pyruvate, phosphate dikinase >Feature sequence004 1678 758 gene locus_tag LOCUS_00220 1678 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 4987 1715 gene locus_tag LOCUS_00230 4987 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 6129 5089 gene locus_tag LOCUS_00240 6129 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 6311 7303 gene locus_tag LOCUS_00250 6311 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 >Feature sequence005 1922 3160 gene locus_tag LOCUS_00260 1922 3160 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_00260 3264 3336 gene locus_tag LOCUS_t00010 3264 3336 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3359 4321 gene locus_tag LOCUS_00270 3359 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 4409 5302 gene locus_tag LOCUS_00280 gene pss 4409 5302 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119571.1 protein_id gnl|my_center|LOCUS_00280 >Feature sequence006 1014 1793 gene locus_tag LOCUS_00290 1014 1793 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_00290 1821 2873 gene locus_tag LOCUS_00300 gene hemH 1821 2873 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFZ7 protein_id gnl|my_center|LOCUS_00300 2934 3008 gene locus_tag LOCUS_t00020 2934 3008 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4214 3075 gene locus_tag LOCUS_00310 4214 3075 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119834.1 protein_id gnl|my_center|LOCUS_00310 4920 4228 gene locus_tag LOCUS_00320 4920 4228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119837.1 protein_id gnl|my_center|LOCUS_00320 6465 4936 gene locus_tag LOCUS_00330 6465 4936 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_00330 7016 6486 gene locus_tag LOCUS_00340 7016 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119839.1 protein_id gnl|my_center|LOCUS_00340 <8192 7042 gene locus_tag LOCUS_00350 <8192 7042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119840.1:ABC transporter substrate-binding protein >Feature sequence007 2350 1211 gene locus_tag LOCUS_00360 gene trmE 2350 1211 CDS product tRNA modification GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120877.1 protein_id gnl|my_center|LOCUS_00360 3129 2350 gene locus_tag LOCUS_00370 3129 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 4177 3176 gene locus_tag LOCUS_00380 gene obg 4177 3176 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH6 protein_id gnl|my_center|LOCUS_00380 4536 4285 gene locus_tag LOCUS_00390 gene rpmA 4536 4285 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_00390 6123 4627 gene locus_tag LOCUS_00400 6123 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 7610 6297 gene locus_tag LOCUS_00410 7610 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 >Feature sequence008 <1 555 gene locus_tag LOCUS_00420 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKY0:ketol-acid reductoisomerase (NADP(+)) 633 1529 gene locus_tag LOCUS_00430 633 1529 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_00430 1542 1841 gene locus_tag LOCUS_00440 1542 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 2099 5665 gene locus_tag LOCUS_00450 gene dnaE 2099 5665 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUS6 protein_id gnl|my_center|LOCUS_00450 6312 5704 gene locus_tag LOCUS_00460 6312 5704 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334179.1 protein_id gnl|my_center|LOCUS_00460 6509 7681 gene locus_tag LOCUS_00470 6509 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 7872 7678 gene locus_tag LOCUS_00480 7872 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence009 1109 591 gene locus_tag LOCUS_00490 gene ilvN 1109 591 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122509.1 protein_id gnl|my_center|LOCUS_00490 1726 1217 gene locus_tag LOCUS_00500 gene dsbD 1726 1217 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124088.1 protein_id gnl|my_center|LOCUS_00500 3766 1838 gene locus_tag LOCUS_00510 3766 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 4157 4083 gene locus_tag LOCUS_t00030 4157 4083 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4376 5032 gene locus_tag LOCUS_00520 4376 5032 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333247.1 protein_id gnl|my_center|LOCUS_00520 5339 5046 gene locus_tag LOCUS_00530 5339 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 >Feature sequence010 <1 711 gene locus_tag LOCUS_00540 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121332.1:glucose 1-dehydrogenase 813 1373 gene locus_tag LOCUS_00550 813 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 1370 2179 gene locus_tag LOCUS_00560 1370 2179 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933566.1 protein_id gnl|my_center|LOCUS_00560 2703 2167 gene locus_tag LOCUS_00570 2703 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 4723 2882 gene locus_tag LOCUS_00580 4723 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 6411 4843 gene locus_tag LOCUS_00590 6411 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 <7688 6432 gene locus_tag LOCUS_00600 <7688 6432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121346.1:DEAD/DEAH box helicase >Feature sequence011 2324 972 gene locus_tag LOCUS_00610 2324 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 2552 3601 gene locus_tag LOCUS_00620 2552 3601 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068709.1 protein_id gnl|my_center|LOCUS_00620 4454 3573 gene locus_tag LOCUS_00630 4454 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 7010 4593 gene locus_tag LOCUS_00640 gene yprA 7010 4593 CDS product putative ATP-dependent helicase YprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50830 protein_id gnl|my_center|LOCUS_00640 >Feature sequence012 1823 3115 gene locus_tag LOCUS_00650 gene purD 1823 3115 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPZ8 protein_id gnl|my_center|LOCUS_00650 3142 3594 gene locus_tag LOCUS_00660 gene rnhA 3142 3594 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF86 protein_id gnl|my_center|LOCUS_00660 5739 3607 gene locus_tag LOCUS_00670 gene recG 5739 3607 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118187.1 protein_id gnl|my_center|LOCUS_00670 <7429 5736 gene locus_tag LOCUS_00680 <7429 5736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123340.1:two-component sensor histidine kinase >Feature sequence013 80 550 gene locus_tag LOCUS_00690 80 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1713 631 gene locus_tag LOCUS_00700 1713 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 1851 3029 gene locus_tag LOCUS_00710 gene aspC 1851 3029 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4R3 protein_id gnl|my_center|LOCUS_00710 3129 3308 gene locus_tag LOCUS_00720 3129 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 3378 3692 gene locus_tag LOCUS_00730 3378 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00730 5737 3824 gene locus_tag LOCUS_00740 gene atsG 5737 3824 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_00740 6044 7240 gene locus_tag LOCUS_00750 6044 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence014 <1 4149 gene locus_tag LOCUS_00760 <1 4149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin 4188 4436 gene locus_tag LOCUS_00770 4188 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 4606 6030 gene locus_tag LOCUS_00780 gene fumC 4606 6030 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE6 protein_id gnl|my_center|LOCUS_00780 >Feature sequence015 410 1777 gene locus_tag LOCUS_00790 gene hisS 410 1777 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UZ20 protein_id gnl|my_center|LOCUS_00790 2954 1788 gene locus_tag LOCUS_00800 gene degT 2954 1788 CDS product pleiotropic regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118241.1 protein_id gnl|my_center|LOCUS_00800 4156 3173 gene locus_tag LOCUS_00810 4156 3173 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061890.1 protein_id gnl|my_center|LOCUS_00810 4404 5744 gene locus_tag LOCUS_00820 4404 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_00820 >Feature sequence016 1444 68 gene locus_tag LOCUS_00830 1444 68 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_00830 1838 3853 gene locus_tag LOCUS_00840 1838 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 3859 5307 gene locus_tag LOCUS_00850 3859 5307 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_00850 5377 6813 gene locus_tag LOCUS_00860 5377 6813 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_00860 >Feature sequence017 22 1146 gene locus_tag LOCUS_00870 22 1146 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_00870 1158 2177 gene locus_tag LOCUS_00880 gene fabH 1158 2177 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59814 protein_id gnl|my_center|LOCUS_00880 2240 4078 gene locus_tag LOCUS_00890 2240 4078 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_00890 5143 4139 gene locus_tag LOCUS_00900 5143 4139 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_00900 5451 6482 gene locus_tag LOCUS_00910 5451 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 6486 6902 gene locus_tag LOCUS_00920 6486 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 >Feature sequence018 <1 1189 gene locus_tag LOCUS_00930 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120382.1:arylsulfatase 1314 3377 gene locus_tag LOCUS_00940 1314 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3429 4511 gene locus_tag LOCUS_00950 3429 4511 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979259.1 protein_id gnl|my_center|LOCUS_00950 6067 4508 gene locus_tag LOCUS_00960 6067 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 >Feature sequence019 2659 1367 gene locus_tag LOCUS_00970 2659 1367 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_00970 3589 2810 gene locus_tag LOCUS_00980 3589 2810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121328.1 protein_id gnl|my_center|LOCUS_00980 4338 3586 gene locus_tag LOCUS_00990 4338 3586 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_00990 4509 4952 gene locus_tag LOCUS_01000 4509 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 5413 4964 gene locus_tag LOCUS_01010 gene infC 5413 4964 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ17 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01010 <6777 5633 gene locus_tag LOCUS_01020 <6777 5633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807926.1:mechanosensitive ion channel protein >Feature sequence020 1860 1075 gene locus_tag LOCUS_01030 1860 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3041 1863 gene locus_tag LOCUS_01040 3041 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 3465 3034 gene locus_tag LOCUS_01050 3465 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 5155 3455 gene locus_tag LOCUS_01060 5155 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5963 5172 gene locus_tag LOCUS_01070 5963 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 >Feature sequence021 899 1894 gene locus_tag LOCUS_01080 899 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 3211 1919 gene locus_tag LOCUS_01090 gene Pph1 3211 1919 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121826.1 protein_id gnl|my_center|LOCUS_01090 3379 3903 gene locus_tag LOCUS_01100 3379 3903 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122603.1 protein_id gnl|my_center|LOCUS_01100 5107 3908 gene locus_tag LOCUS_01110 5107 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 5958 5104 gene locus_tag LOCUS_01120 5958 5104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_01120 <6574 5955 gene locus_tag LOCUS_01130 <6574 5955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121261.1:ABC transporter permease >Feature sequence022 347 1051 gene locus_tag LOCUS_01140 gene bioD 347 1051 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URG0 protein_id gnl|my_center|LOCUS_01140 1868 1056 gene locus_tag LOCUS_01150 1868 1056 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_01150 2860 1865 gene locus_tag LOCUS_01160 2860 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2987 5281 gene locus_tag LOCUS_01170 2987 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 >Feature sequence023 <1 762 gene locus_tag LOCUS_01180 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121478.1:transporter 1991 933 gene locus_tag LOCUS_01190 1991 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 2617 2009 gene locus_tag LOCUS_01200 gene tmk 2617 2009 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIM1 protein_id gnl|my_center|LOCUS_01200 3160 2738 gene locus_tag LOCUS_01210 3160 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_01210 4002 4226 gene locus_tag LOCUS_01220 4002 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence024 2115 3005 gene locus_tag LOCUS_01230 2115 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 3056 4510 gene locus_tag LOCUS_01240 3056 4510 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_01240 4926 4546 gene locus_tag LOCUS_01250 4926 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056975.1 protein_id gnl|my_center|LOCUS_01250 5080 5727 gene locus_tag LOCUS_01260 gene nth 5080 5727 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 protein_id gnl|my_center|LOCUS_01260 5779 6354 gene locus_tag LOCUS_01270 gene dcd 5779 6354 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9W5 protein_id gnl|my_center|LOCUS_01270 >Feature sequence025 4320 784 gene locus_tag LOCUS_01280 4320 784 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120793.1 protein_id gnl|my_center|LOCUS_01280 4683 5042 gene locus_tag LOCUS_01290 4683 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 5187 5112 gene locus_tag LOCUS_t00040 5187 5112 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <6378 5397 gene locus_tag LOCUS_01300 <6378 5397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118761.1:chromosome partitioning protein ParB >Feature sequence026 2595 2137 gene locus_tag LOCUS_01310 2595 2137 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119076.1 protein_id gnl|my_center|LOCUS_01310 3023 2595 gene locus_tag LOCUS_01320 3023 2595 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_01320 3823 3023 gene locus_tag LOCUS_01330 gene tolQ 3823 3023 CDS product TolQ-type transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 protein_id gnl|my_center|LOCUS_01330 4857 3880 gene locus_tag LOCUS_01340 4857 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 <6365 5058 gene locus_tag LOCUS_01350 <6365 5058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330748.1:glucosamine-6-phosphate deaminase >Feature sequence027 1587 811 gene locus_tag LOCUS_01360 1587 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 1783 2235 gene locus_tag LOCUS_01370 1783 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 6226 2681 gene locus_tag LOCUS_01380 6226 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence028 562 1854 gene locus_tag LOCUS_01390 gene aslA 562 1854 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123091.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01390 1870 2166 gene locus_tag LOCUS_01400 1870 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01400 2223 4643 gene locus_tag LOCUS_01410 2223 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 4812 6152 gene locus_tag LOCUS_01420 4812 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence029 358 32 gene locus_tag LOCUS_01430 358 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 1898 477 gene locus_tag LOCUS_01440 1898 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_01440 2169 2348 gene locus_tag LOCUS_01450 2169 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 2406 3476 gene locus_tag LOCUS_01460 2406 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01460 4647 3484 gene locus_tag LOCUS_01470 4647 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 <6073 4653 gene locus_tag LOCUS_01480 <6073 4653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122061.1:neuraminidase >Feature sequence030 1047 2474 gene locus_tag LOCUS_01490 1047 2474 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121659.1 protein_id gnl|my_center|LOCUS_01490 2677 3381 gene locus_tag LOCUS_01500 2677 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 5166 3394 gene locus_tag LOCUS_01510 5166 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 <6015 5500 gene locus_tag LOCUS_01520 <6015 5500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UK66:ATP-dependent Clp protease proteolytic subunit 2 >Feature sequence031 2445 241 gene locus_tag LOCUS_01530 2445 241 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123527.1 protein_id gnl|my_center|LOCUS_01530 3025 2525 gene locus_tag LOCUS_01540 gene sixA 3025 2525 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121948.1 protein_id gnl|my_center|LOCUS_01540 5143 3041 gene locus_tag LOCUS_01550 gene ppk 5143 3041 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULJ4 protein_id gnl|my_center|LOCUS_01550 <5980 5167 gene locus_tag LOCUS_01560 <5980 5167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123565.1:exopolyphosphatase >Feature sequence032 <1 1660 gene locus_tag LOCUS_01570 <1 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707115.1:sodium/panthothenate symporter 1667 2743 gene locus_tag LOCUS_01580 1667 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 2748 3602 gene locus_tag LOCUS_01590 gene hpaG 2748 3602 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_01590 3685 5256 gene locus_tag LOCUS_01600 3685 5256 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122083.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence033 <1 1081 gene locus_tag LOCUS_01610 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123527.1:acetylxylan esterase 1095 1907 gene locus_tag LOCUS_01620 1095 1907 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URI8 protein_id gnl|my_center|LOCUS_01620 1994 3574 gene locus_tag LOCUS_01630 1994 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5005 3596 gene locus_tag LOCUS_01640 5005 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_01640 >Feature sequence034 324 1115 gene locus_tag LOCUS_01650 324 1115 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDY5 protein_id gnl|my_center|LOCUS_01650 1222 1953 gene locus_tag LOCUS_01660 1222 1953 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_01660 1982 3628 gene locus_tag LOCUS_01670 1982 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_01670 3688 5070 gene locus_tag LOCUS_01680 3688 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence035 3382 2480 gene locus_tag LOCUS_01690 gene dnaJ 3382 2480 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_01690 3588 5141 gene locus_tag LOCUS_01700 3588 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122684.1 protein_id gnl|my_center|LOCUS_01700 >Feature sequence036 <1 535 gene locus_tag LOCUS_01710 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117823.1:glycosyl hydrolase 614 2053 gene locus_tag LOCUS_01720 614 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_01720 2069 3466 gene locus_tag LOCUS_01730 2069 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_01730 3598 5151 gene locus_tag LOCUS_01740 3598 5151 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_01740 >Feature sequence037 2498 243 gene locus_tag LOCUS_01750 2498 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4058 2676 gene locus_tag LOCUS_01760 gene argH 4058 2676 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK64 protein_id gnl|my_center|LOCUS_01760 <5607 4173 gene locus_tag LOCUS_01770 <5607 4173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJ58:carbamoyl-phosphate synthase large chain >Feature sequence038 1809 1564 gene locus_tag LOCUS_01780 1809 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 3698 1827 gene locus_tag LOCUS_01790 3698 1827 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_01790 4343 3711 gene locus_tag LOCUS_01800 4343 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence039 387 1052 gene locus_tag LOCUS_01810 387 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118740.1 protein_id gnl|my_center|LOCUS_01810 2003 1077 gene locus_tag LOCUS_01820 gene lipA 2003 1077 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH37 protein_id gnl|my_center|LOCUS_01820 2717 2007 gene locus_tag LOCUS_01830 2717 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 3319 2765 gene locus_tag LOCUS_01840 gene smpB 3319 2765 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH38 protein_id gnl|my_center|LOCUS_01840 4942 3431 gene locus_tag LOCUS_01850 4942 3431 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_01850 <5536 4939 gene locus_tag LOCUS_01860 <5536 4939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120140.1:ABC transporter ATP-binding protein >Feature sequence040 760 1263 gene locus_tag LOCUS_01870 760 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 2504 1278 gene locus_tag LOCUS_01880 2504 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 4027 2573 gene locus_tag LOCUS_01890 4027 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_01890 >Feature sequence041 1860 445 gene locus_tag LOCUS_01900 1860 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_01900 2924 1881 gene locus_tag LOCUS_01910 2924 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 5258 2946 gene locus_tag LOCUS_01920 5258 2946 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence042 2936 1923 gene locus_tag LOCUS_01930 2936 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 2935 3102 gene locus_tag LOCUS_01940 2935 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 3420 3493 gene locus_tag LOCUS_t00050 3420 3493 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 <1 2835 gene locus_tag LOCUS_01950 <1 2835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121858.1:peptidyl-prolyl cis-trans isomerase 2849 4300 gene locus_tag LOCUS_01960 2849 4300 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117906.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence044 440 1810 gene locus_tag LOCUS_01970 gene fwdB 440 1810 CDS product tungsten-containing formylmethanofuran dehydrogenase 2 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P61154 protein_id gnl|my_center|LOCUS_01970 2323 1814 gene locus_tag LOCUS_01980 2323 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337215.1 protein_id gnl|my_center|LOCUS_01980 2390 4045 gene locus_tag LOCUS_01990 2390 4045 CDS product protein fwdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_01990 4690 4046 gene locus_tag LOCUS_02000 gene mobA 4690 4046 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R169 protein_id gnl|my_center|LOCUS_02000 >Feature sequence045 1108 101 gene locus_tag LOCUS_02010 1108 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_02010 2456 1140 gene locus_tag LOCUS_02020 2456 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_02020 2647 3684 gene locus_tag LOCUS_02030 gene rbsB 2647 3684 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634030.1 protein_id gnl|my_center|LOCUS_02030 3705 5228 gene locus_tag LOCUS_02040 gene rbsA2 3705 5228 CDS product ribose import ATP-binding protein RbsA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDI1 protein_id gnl|my_center|LOCUS_02040 >Feature sequence046 1219 584 gene locus_tag LOCUS_02050 1219 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3135 1264 gene locus_tag LOCUS_02060 gene metG 3135 1264 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URP3 protein_id gnl|my_center|LOCUS_02060 3049 3360 gene locus_tag LOCUS_02070 3049 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 4060 3461 gene locus_tag LOCUS_02080 4060 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 4320 4733 gene locus_tag LOCUS_02090 gene hisI 4320 4733 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62386 protein_id gnl|my_center|LOCUS_02090 4753 5217 gene locus_tag LOCUS_02100 4753 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence047 918 508 gene locus_tag LOCUS_02110 918 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1885 908 gene locus_tag LOCUS_02120 1885 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121229.1 protein_id gnl|my_center|LOCUS_02120 2938 2036 gene locus_tag LOCUS_02130 2938 2036 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_02130 4709 2976 gene locus_tag LOCUS_02140 gene polB 4709 2976 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118392.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence048 514 1479 gene locus_tag LOCUS_02150 gene fmt 514 1479 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ6 protein_id gnl|my_center|LOCUS_02150 1633 2913 gene locus_tag LOCUS_02160 1633 2913 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_02160 3061 4530 gene locus_tag LOCUS_02170 3061 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence049 1 327 gene locus_tag LOCUS_02180 1 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 1255 332 gene locus_tag LOCUS_02190 1255 332 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378982.1 protein_id gnl|my_center|LOCUS_02190 1430 2164 gene locus_tag LOCUS_02200 1430 2164 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759854.1 protein_id gnl|my_center|LOCUS_02200 2584 2195 gene locus_tag LOCUS_02210 2584 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence050 1577 495 gene locus_tag LOCUS_02220 gene proB 1577 495 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJA8 protein_id gnl|my_center|LOCUS_02220 3386 1800 gene locus_tag LOCUS_02230 gene purF 3386 1800 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGS5 protein_id gnl|my_center|LOCUS_02230 4364 3630 gene locus_tag LOCUS_02240 gene nagB 4364 3630 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVM5 protein_id gnl|my_center|LOCUS_02240 >Feature sequence051 822 37 gene locus_tag LOCUS_02250 822 37 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_02250 3414 850 gene locus_tag LOCUS_02260 3414 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 4657 3467 gene locus_tag LOCUS_02270 4657 3467 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249449.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence052 2348 951 gene locus_tag LOCUS_02280 2348 951 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence053 3 623 gene locus_tag LOCUS_02290 3 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1024 620 gene locus_tag LOCUS_02300 gene crcB 1024 620 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER0 protein_id gnl|my_center|LOCUS_02300 1281 3050 gene locus_tag LOCUS_02310 1281 3050 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW9 protein_id gnl|my_center|LOCUS_02310 3067 4530 gene locus_tag LOCUS_02320 3067 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence054 948 2357 gene locus_tag LOCUS_02330 948 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_02330 2398 3798 gene locus_tag LOCUS_02340 2398 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 <5167 3817 gene locus_tag LOCUS_02350 <5167 3817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122155.1:heme-binding protein >Feature sequence055 885 2519 gene locus_tag LOCUS_02360 885 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 2559 4538 gene locus_tag LOCUS_02370 2559 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 >Feature sequence056 1 468 gene locus_tag LOCUS_02380 1 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 487 1563 gene locus_tag LOCUS_02390 487 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3265 1607 gene locus_tag LOCUS_02400 3265 1607 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108630.1 protein_id gnl|my_center|LOCUS_02400 3677 4444 gene locus_tag LOCUS_02410 3677 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4920 4618 gene locus_tag LOCUS_02420 4920 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence057 3 215 gene locus_tag LOCUS_02430 3 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 524 375 gene locus_tag LOCUS_02440 524 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 510 989 gene locus_tag LOCUS_02450 510 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120763.1 protein_id gnl|my_center|LOCUS_02450 1079 2380 gene locus_tag LOCUS_02460 1079 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_02460 2469 2687 gene locus_tag LOCUS_02470 gene infA 2469 2687 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY5 protein_id gnl|my_center|LOCUS_02470 2985 4652 gene locus_tag LOCUS_02480 2985 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123754.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence058 2117 549 gene locus_tag LOCUS_02490 2117 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 2341 3912 gene locus_tag LOCUS_02500 gene arsB 2341 3912 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122841.1 protein_id gnl|my_center|LOCUS_02500 4728 3940 gene locus_tag LOCUS_02510 4728 3940 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090538.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence059 453 2171 gene locus_tag LOCUS_02520 gene pilB 453 2171 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123902.1 protein_id gnl|my_center|LOCUS_02520 2301 3719 gene locus_tag LOCUS_02530 gene pilC 2301 3719 CDS product type II secretion system F domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329380.1 protein_id gnl|my_center|LOCUS_02530 3831 4772 gene locus_tag LOCUS_02540 3831 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence060 786 3254 gene locus_tag LOCUS_02550 786 3254 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_02550 >Feature sequence061 17 712 gene locus_tag LOCUS_02560 gene thyA 17 712 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_02560 742 1227 gene locus_tag LOCUS_02570 gene folA 742 1227 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_02570 1337 2128 gene locus_tag LOCUS_02580 1337 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 2282 3427 gene locus_tag LOCUS_02590 2282 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3430 4803 gene locus_tag LOCUS_02600 3430 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 >Feature sequence062 1282 155 gene locus_tag LOCUS_02610 1282 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121691.1 protein_id gnl|my_center|LOCUS_02610 1596 2606 gene locus_tag LOCUS_02620 1596 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 <5101 2641 gene locus_tag LOCUS_02630 <5101 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119226.1:membrane protein >Feature sequence063 506 1843 gene locus_tag LOCUS_02640 506 1843 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_02640 2219 1971 gene locus_tag LOCUS_02650 2219 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2288 3658 gene locus_tag LOCUS_02660 2288 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4205 3648 gene locus_tag LOCUS_02670 gene pyrE 4205 3648 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYX5 protein_id gnl|my_center|LOCUS_02670 5058 4285 gene locus_tag LOCUS_02680 5058 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123408.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence064 261 1175 gene locus_tag LOCUS_02690 261 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 2303 1209 gene locus_tag LOCUS_02700 gene gcd 2303 1209 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329800.1 protein_id gnl|my_center|LOCUS_02700 2989 2378 gene locus_tag LOCUS_02710 2989 2378 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121612.1 protein_id gnl|my_center|LOCUS_02710 3523 5040 gene locus_tag LOCUS_02720 gene leuA 3523 5040 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI51 protein_id gnl|my_center|LOCUS_02720 >Feature sequence065 1884 841 gene locus_tag LOCUS_02730 1884 841 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_02730 2898 1906 gene locus_tag LOCUS_02740 2898 1906 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_02740 4230 3208 gene locus_tag LOCUS_02750 4230 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 <5076 4247 gene locus_tag LOCUS_02760 <5076 4247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528753.1:amidohydrolase >Feature sequence066 2022 706 gene locus_tag LOCUS_02770 gene pbrT 2022 706 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123499.1 protein_id gnl|my_center|LOCUS_02770 2948 2043 gene locus_tag LOCUS_02780 2948 2043 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_02780 3765 2995 gene locus_tag LOCUS_02790 3765 2995 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence067 1254 2339 gene locus_tag LOCUS_02800 gene trx 1254 2339 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_02800 2430 4184 gene locus_tag LOCUS_02810 2430 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence068 1053 511 gene locus_tag LOCUS_02820 1053 511 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123878.1 protein_id gnl|my_center|LOCUS_02820 2553 1285 gene locus_tag LOCUS_02830 2553 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_02830 4245 2602 gene locus_tag LOCUS_02840 4245 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence069 2373 373 gene locus_tag LOCUS_02850 gene thrS 2373 373 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56881 protein_id gnl|my_center|LOCUS_02850 3911 2541 gene locus_tag LOCUS_02860 3911 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence070 >Feature sequence071 1741 953 gene locus_tag LOCUS_02870 1741 953 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_02870 4054 1853 gene locus_tag LOCUS_02880 4054 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence072 330 2471 gene locus_tag LOCUS_02890 gene pknB 330 2471 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337392.1 protein_id gnl|my_center|LOCUS_02890 3266 2496 gene locus_tag LOCUS_02900 3266 2496 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_02900 3450 4373 gene locus_tag LOCUS_02910 3450 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence073 2461 647 gene locus_tag LOCUS_02920 gene mnmG 2461 647 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULV7 protein_id gnl|my_center|LOCUS_02920 3664 2501 gene locus_tag LOCUS_02930 3664 2501 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence074 777 208 gene locus_tag LOCUS_02940 777 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 1815 925 gene locus_tag LOCUS_02950 gene ffsA 1815 925 CDS product formylmethanofuran--tetrahydromethanopterin formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKZ8 protein_id gnl|my_center|LOCUS_02950 2265 2035 gene locus_tag LOCUS_02960 2265 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 2707 2579 gene locus_tag LOCUS_02970 2707 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence075 562 1488 gene locus_tag LOCUS_02980 gene iunH 562 1488 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324951.1 protein_id gnl|my_center|LOCUS_02980 2597 1497 gene locus_tag LOCUS_02990 gene htrA 2597 1497 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122274.1 protein_id gnl|my_center|LOCUS_02990 3093 2695 gene locus_tag LOCUS_03000 gene dksA 3093 2695 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 protein_id gnl|my_center|LOCUS_03000 4643 3630 gene locus_tag LOCUS_03010 4643 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118962.1 protein_id gnl|my_center|LOCUS_03010 >Feature sequence076 3523 1463 gene locus_tag LOCUS_03020 3523 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 <4862 3847 gene locus_tag LOCUS_03030 <4862 3847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121149.1:undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase >Feature sequence077 3315 376 gene locus_tag LOCUS_03040 3315 376 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117697.1 protein_id gnl|my_center|LOCUS_03040 4203 3427 gene locus_tag LOCUS_03050 4203 3427 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118949.1 protein_id gnl|my_center|LOCUS_03050 4684 4253 gene locus_tag LOCUS_03060 4684 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence078 <1 606 gene locus_tag LOCUS_03070 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330043.1:chromosome partitioning protein ParA 1720 608 gene locus_tag LOCUS_03080 gene aroB 1720 608 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWN8 protein_id gnl|my_center|LOCUS_03080 1971 1750 gene locus_tag LOCUS_03090 1971 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 2386 3702 gene locus_tag LOCUS_03100 2386 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4716 3781 gene locus_tag LOCUS_03110 4716 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence079 3637 2612 gene locus_tag LOCUS_03120 gene ychF 3637 2612 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFN0 protein_id gnl|my_center|LOCUS_03120 4756 3701 gene locus_tag LOCUS_03130 4756 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence080 1243 743 gene locus_tag LOCUS_03140 gene yacH 1243 743 CDS product UvrB/UvrC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_03140 1528 3033 gene locus_tag LOCUS_03150 gene trpE 1528 3033 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_03150 3627 3046 gene locus_tag LOCUS_03160 3627 3046 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_03160 <4747 3631 gene locus_tag LOCUS_03170 <4747 3631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272343.1:xanthine dehydrogenase >Feature sequence081 557 1378 gene locus_tag LOCUS_03180 557 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121285.1 protein_id gnl|my_center|LOCUS_03180 1849 3714 gene locus_tag LOCUS_03190 gene korA 1849 3714 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_03190 >Feature sequence082 850 281 gene locus_tag LOCUS_03200 850 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 2034 1162 gene locus_tag LOCUS_03210 2034 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 2131 2616 gene locus_tag LOCUS_03220 2131 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3961 2651 gene locus_tag LOCUS_03230 3961 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 >Feature sequence083 <1 1078 gene locus_tag LOCUS_03240 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123736.1:manganese ABC transporter permease 1334 1107 gene locus_tag LOCUS_03250 1334 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2276 1419 gene locus_tag LOCUS_03260 gene nfo 2276 1419 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WII8 protein_id gnl|my_center|LOCUS_03260 2809 2273 gene locus_tag LOCUS_03270 2809 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 3395 2814 gene locus_tag LOCUS_03280 3395 2814 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence084 472 1644 gene locus_tag LOCUS_03290 472 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1679 2782 gene locus_tag LOCUS_03300 gene pgl 1679 2782 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGX4 protein_id gnl|my_center|LOCUS_03300 3151 2783 gene locus_tag LOCUS_03310 3151 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 <4706 3510 gene locus_tag LOCUS_03320 <4706 3510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140914.1:MFS transporter >Feature sequence085 41 1000 gene locus_tag LOCUS_03330 41 1000 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_03330 1091 1996 gene locus_tag LOCUS_03340 1091 1996 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_03340 3530 2016 gene locus_tag LOCUS_03350 3530 2016 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_03350 4101 3556 gene locus_tag LOCUS_03360 4101 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence086 269 1945 gene locus_tag LOCUS_03370 269 1945 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144132.1 protein_id gnl|my_center|LOCUS_03370 2065 4080 gene locus_tag LOCUS_03380 2065 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 4096 4647 gene locus_tag LOCUS_03390 4096 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence087 940 32 gene locus_tag LOCUS_03400 940 32 CDS product manganese ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143301.1 protein_id gnl|my_center|LOCUS_03400 2098 1238 gene locus_tag LOCUS_03410 2098 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 2402 2962 gene locus_tag LOCUS_03420 2402 2962 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118402.1 protein_id gnl|my_center|LOCUS_03420 3023 4273 gene locus_tag LOCUS_03430 3023 4273 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence088 874 4239 gene locus_tag LOCUS_03440 874 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence089 56 1855 gene locus_tag LOCUS_03450 gene ctaD 56 1855 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_03450 1965 2957 gene locus_tag LOCUS_03460 1965 2957 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123498.1 protein_id gnl|my_center|LOCUS_03460 2976 3890 gene locus_tag LOCUS_03470 gene ctaB 2976 3890 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJF4 protein_id gnl|my_center|LOCUS_03470 >Feature sequence090 2717 261 gene locus_tag LOCUS_03480 2717 261 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121437.1 protein_id gnl|my_center|LOCUS_03480 3291 2902 gene locus_tag LOCUS_03490 3291 2902 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_03490 3650 4108 gene locus_tag LOCUS_03500 3650 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence091 519 1328 gene locus_tag LOCUS_03510 519 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 1537 2160 gene locus_tag LOCUS_03520 1537 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943559.1 protein_id gnl|my_center|LOCUS_03520 2315 3151 gene locus_tag LOCUS_03530 2315 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 3301 4311 gene locus_tag LOCUS_03540 gene fba 3301 4311 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_867402.2 protein_id gnl|my_center|LOCUS_03540 >Feature sequence092 <1 748 gene locus_tag LOCUS_03550 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123366.1:oxidoreductase 832 1038 gene locus_tag LOCUS_03560 832 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 2203 1052 gene locus_tag LOCUS_03570 2203 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence093 969 1433 gene locus_tag LOCUS_03580 969 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087890.1 protein_id gnl|my_center|LOCUS_03580 1461 4349 gene locus_tag LOCUS_03590 1461 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence094 <1 1096 gene locus_tag LOCUS_03600 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123393.1:3-deoxy-D-manno-octulosonic acid transferase 1149 2318 gene locus_tag LOCUS_03610 gene metK 1149 2318 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URU7 protein_id gnl|my_center|LOCUS_03610 2441 3274 gene locus_tag LOCUS_03620 2441 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence095 2045 1062 gene locus_tag LOCUS_03630 2045 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 3462 2155 gene locus_tag LOCUS_03640 3462 2155 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118005.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence096 2263 587 gene locus_tag LOCUS_03650 2263 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2564 3169 gene locus_tag LOCUS_03660 gene sodA 2564 3169 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_03660 3477 4325 gene locus_tag LOCUS_03670 3477 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 >Feature sequence097 1101 2549 gene locus_tag LOCUS_03680 1101 2549 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121859.1 protein_id gnl|my_center|LOCUS_03680 3978 2569 gene locus_tag LOCUS_03690 3978 2569 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836368.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence098 877 110 gene locus_tag LOCUS_03700 877 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2208 880 gene locus_tag LOCUS_03710 gene nuoH 2208 880 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 protein_id gnl|my_center|LOCUS_03710 3491 2256 gene locus_tag LOCUS_03720 gene nuoD 3491 2256 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_03720 4047 3523 gene locus_tag LOCUS_03730 gene ndhJ 4047 3523 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence099 695 261 gene locus_tag LOCUS_03740 gene rplM 695 261 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY3 protein_id gnl|my_center|LOCUS_03740 1043 2641 gene locus_tag LOCUS_03750 1043 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2662 3168 gene locus_tag LOCUS_03760 2662 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence100 345 767 gene locus_tag LOCUS_03770 345 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 764 1813 gene locus_tag LOCUS_03780 gene rlmN 764 1813 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHU7 protein_id gnl|my_center|LOCUS_03780 2038 2340 gene locus_tag LOCUS_03790 2038 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 <4482 2422 gene locus_tag LOCUS_03800 <4482 2422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121439.1:serine/threonine protein kinase >Feature sequence101 1177 1830 gene locus_tag LOCUS_03810 1177 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 1827 2375 gene locus_tag LOCUS_03820 1827 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2563 3618 gene locus_tag LOCUS_03830 gene moxR 2563 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119708.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence102 3002 1479 gene locus_tag LOCUS_03840 gene xylB 3002 1479 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123533.1 protein_id gnl|my_center|LOCUS_03840 4150 3095 gene locus_tag LOCUS_03850 4150 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence103 2621 642 gene locus_tag LOCUS_03860 2621 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3138 3545 gene locus_tag LOCUS_03870 3138 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3601 3996 gene locus_tag LOCUS_03880 3601 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence104 2654 1668 gene locus_tag LOCUS_03890 2654 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3443 2667 gene locus_tag LOCUS_03900 3443 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 <4395 3462 gene locus_tag LOCUS_03910 <4395 3462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878433.1:branched chain amino acid aminotransferase >Feature sequence105 43 879 gene locus_tag LOCUS_03920 gene mutM 43 879 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_03920 1656 1048 gene locus_tag LOCUS_03930 1656 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2562 1762 gene locus_tag LOCUS_03940 gene trpA 2562 1762 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URN0 protein_id gnl|my_center|LOCUS_03940 3778 2567 gene locus_tag LOCUS_03950 gene trpB 3778 2567 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG9 protein_id gnl|my_center|LOCUS_03950 >Feature sequence106 >Feature sequence107 1100 123 gene locus_tag LOCUS_03960 1100 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119125.1 protein_id gnl|my_center|LOCUS_03960 1197 2354 gene locus_tag LOCUS_03970 gene apbE 1197 2354 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTS4 protein_id gnl|my_center|LOCUS_03970 >Feature sequence108 1715 1185 gene locus_tag LOCUS_03980 gene aroK 1715 1185 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU71 protein_id gnl|my_center|LOCUS_03980 3242 1749 gene locus_tag LOCUS_03990 3242 1749 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ72 protein_id gnl|my_center|LOCUS_03990 3342 3223 gene locus_tag LOCUS_04000 3342 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 <4372 3391 gene locus_tag LOCUS_04010 <4372 3391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMZ3:DNA mismatch repair protein MutL >Feature sequence109 1040 210 gene locus_tag LOCUS_04020 gene punA 1040 210 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ11 protein_id gnl|my_center|LOCUS_04020 1717 1082 gene locus_tag LOCUS_04030 1717 1082 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_04030 3087 1732 gene locus_tag LOCUS_04040 3087 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 <4346 3137 gene locus_tag LOCUS_04050 <4346 3137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:surface protein >Feature sequence110 1622 264 gene locus_tag LOCUS_04060 gene yqhJ 1622 264 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNH0 protein_id gnl|my_center|LOCUS_04060 2045 1647 gene locus_tag LOCUS_04070 gene gcvH 2045 1647 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNG9 protein_id gnl|my_center|LOCUS_04070 2047 2205 gene locus_tag LOCUS_04080 2047 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3285 2221 gene locus_tag LOCUS_04090 gene gcvT 3285 2221 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNG8 protein_id gnl|my_center|LOCUS_04090 >Feature sequence111 200 682 gene locus_tag LOCUS_04100 200 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 2142 1162 gene locus_tag LOCUS_04110 2142 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_04110 3512 2148 gene locus_tag LOCUS_04120 gene uvrC 3512 2148 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD6 protein_id gnl|my_center|LOCUS_04120 4064 3531 gene locus_tag LOCUS_04130 4064 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence112 93 1760 gene locus_tag LOCUS_04140 93 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1767 2432 gene locus_tag LOCUS_04150 1767 2432 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119950.1 protein_id gnl|my_center|LOCUS_04150 2436 2834 gene locus_tag LOCUS_04160 2436 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2945 3967 gene locus_tag LOCUS_04170 2945 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence113 3 1517 gene locus_tag LOCUS_04180 3 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2938 1706 gene locus_tag LOCUS_04190 gene rnd 2938 1706 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120569.1 protein_id gnl|my_center|LOCUS_04190 3136 3711 gene locus_tag LOCUS_04200 3136 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence114 1934 723 gene locus_tag LOCUS_04210 1934 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_04210 3949 2057 gene locus_tag LOCUS_04220 3949 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence115 3685 1139 gene locus_tag LOCUS_04230 3685 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence116 753 3506 gene locus_tag LOCUS_04240 gene ppc 753 3506 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHN1 protein_id gnl|my_center|LOCUS_04240 3887 3552 gene locus_tag LOCUS_04250 3887 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence117 <1 609 gene locus_tag LOCUS_04260 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119052.1:sulfatase 2056 611 gene locus_tag LOCUS_04270 2056 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_04270 2178 3008 gene locus_tag LOCUS_04280 2178 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3025 3387 gene locus_tag LOCUS_04290 3025 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence118 2809 2288 gene locus_tag LOCUS_04300 2809 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3815 2850 gene locus_tag LOCUS_04310 3815 2850 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence119 700 1818 gene locus_tag LOCUS_04320 700 1818 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815495.1 protein_id gnl|my_center|LOCUS_04320 1985 1839 gene locus_tag LOCUS_04330 1985 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3683 2151 gene locus_tag LOCUS_04340 3683 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence120 243 785 gene locus_tag LOCUS_04350 gene rplF 243 785 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN05 protein_id gnl|my_center|LOCUS_04350 838 1206 gene locus_tag LOCUS_04360 gene rplR 838 1206 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN04 protein_id gnl|my_center|LOCUS_04360 1280 1759 gene locus_tag LOCUS_04370 gene rpsE 1280 1759 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN03 protein_id gnl|my_center|LOCUS_04370 1759 2259 gene locus_tag LOCUS_04380 gene rplO 1759 2259 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN02 protein_id gnl|my_center|LOCUS_04380 2336 3727 gene locus_tag LOCUS_04390 gene secY 2336 3727 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN01 protein_id gnl|my_center|LOCUS_04390 >Feature sequence121 <1 1081 gene locus_tag LOCUS_04400 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121135.1:NADH-dependent dehydrogenase 2300 1281 gene locus_tag LOCUS_04410 gene gnl 2300 1281 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120521.1 protein_id gnl|my_center|LOCUS_04410 2772 2470 gene locus_tag LOCUS_04420 gene atpE 2772 2470 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA7 protein_id gnl|my_center|LOCUS_04420 <4235 3008 gene locus_tag LOCUS_04430 <4235 3008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000211345.1:ribose ABC transporter permease >Feature sequence122 >Feature sequence123 <1 610 gene locus_tag LOCUS_04440 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120738.1:cytochrome c 619 2040 gene locus_tag LOCUS_04450 619 2040 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence124 1145 3583 gene locus_tag LOCUS_04460 1145 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117948.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence125 37 1194 gene locus_tag LOCUS_04470 37 1194 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117901.1 protein_id gnl|my_center|LOCUS_04470 2245 1205 gene locus_tag LOCUS_04480 2245 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2435 3127 gene locus_tag LOCUS_04490 2435 3127 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_04490 <4183 3124 gene locus_tag LOCUS_04500 <4183 3124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119758.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence126 1673 519 gene locus_tag LOCUS_04510 gene mqnE 1673 519 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_04510 2653 1805 gene locus_tag LOCUS_04520 2653 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3939 2659 gene locus_tag LOCUS_04530 gene pyrC 3939 2659 CDS product putative dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNR2 protein_id gnl|my_center|LOCUS_04530 4147 3977 gene locus_tag LOCUS_04540 4147 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence127 1801 503 gene locus_tag LOCUS_04550 1801 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119562.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence128 1389 919 gene locus_tag LOCUS_04560 gene rpsG 1389 919 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN31 protein_id gnl|my_center|LOCUS_04560 1821 1453 gene locus_tag LOCUS_04570 gene rpsL 1821 1453 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN32 protein_id gnl|my_center|LOCUS_04570 <4124 2073 gene locus_tag LOCUS_04580 <4124 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URW4:DNA-directed RNA polymerase subunit beta' >Feature sequence129 <1 882 gene locus_tag LOCUS_04590 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIK1:GTP cyclohydrolase-2 3605 885 gene locus_tag LOCUS_04600 3605 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence130 1959 1441 gene locus_tag LOCUS_04610 1959 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2744 2079 gene locus_tag LOCUS_04620 2744 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3727 2780 gene locus_tag LOCUS_04630 gene mdh 3727 2780 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC6 protein_id gnl|my_center|LOCUS_04630 >Feature sequence131 <1 1171 gene locus_tag LOCUS_04640 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJI3:tRNA modification GTPase MnmE 2064 1180 gene locus_tag LOCUS_04650 gene truB 2064 1180 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ0 protein_id gnl|my_center|LOCUS_04650 2292 3251 gene locus_tag LOCUS_04660 2292 3251 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIS5 protein_id gnl|my_center|LOCUS_04660 >Feature sequence132 268 732 gene locus_tag LOCUS_04670 268 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 729 1445 gene locus_tag LOCUS_04680 729 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2020 1451 gene locus_tag LOCUS_04690 2020 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2353 3855 gene locus_tag LOCUS_04700 2353 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence133 1478 48 gene locus_tag LOCUS_04710 1478 48 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence134 357 1757 gene locus_tag LOCUS_04720 357 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_04720 3397 1817 gene locus_tag LOCUS_04730 3397 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence135 186 920 gene locus_tag LOCUS_04740 gene trmD 186 920 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY8 protein_id gnl|my_center|LOCUS_04740 1008 1370 gene locus_tag LOCUS_04750 gene rplS 1008 1370 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI13 protein_id gnl|my_center|LOCUS_04750 1659 1937 gene locus_tag LOCUS_04760 1659 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3553 1991 gene locus_tag LOCUS_04770 3553 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence136 2874 502 gene locus_tag LOCUS_04780 2874 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3795 2899 gene locus_tag LOCUS_04790 3795 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence137 2004 670 gene locus_tag LOCUS_04800 2004 670 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_04800 2539 2153 gene locus_tag LOCUS_04810 2539 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 3211 2576 gene locus_tag LOCUS_04820 3211 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence138 1798 1292 gene locus_tag LOCUS_04830 1798 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3526 1850 gene locus_tag LOCUS_04840 gene ilvD 3526 1850 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ69 protein_id gnl|my_center|LOCUS_04840 >Feature sequence139 629 1276 gene locus_tag LOCUS_04850 629 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1400 2308 gene locus_tag LOCUS_04860 1400 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_04860 2389 3621 gene locus_tag LOCUS_04870 2389 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence140 1693 212 gene locus_tag LOCUS_04880 1693 212 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_04880 <4015 1693 gene locus_tag LOCUS_04890 <4015 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:endo-inulinase >Feature sequence141 1476 556 gene locus_tag LOCUS_04900 gene ribF 1476 556 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFW8 protein_id gnl|my_center|LOCUS_04900 2336 1503 gene locus_tag LOCUS_04910 2336 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 3156 2356 gene locus_tag LOCUS_04920 gene purE 3156 2356 CDS product phosphoribosyl carboxyaminoimidazole mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence142 >Feature sequence143 678 2027 gene locus_tag LOCUS_04930 gene nqrA 678 2027 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS5 protein_id gnl|my_center|LOCUS_04930 2080 3312 gene locus_tag LOCUS_04940 gene nqrB 2080 3312 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_04940 >Feature sequence144 1173 259 gene locus_tag LOCUS_04950 1173 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2420 1170 gene locus_tag LOCUS_04960 2420 1170 CDS product quinohemoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117995.1 protein_id gnl|my_center|LOCUS_04960 2552 3085 gene locus_tag LOCUS_04970 gene msrA 2552 3085 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_04970 >Feature sequence145 <1 1418 gene locus_tag LOCUS_04980 <1 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393980.1:selenocysteine-specific translation elongation factor 1781 2875 gene locus_tag LOCUS_04990 gene selA 1781 2875 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIF3 protein_id gnl|my_center|LOCUS_04990 3091 3864 gene locus_tag LOCUS_05000 3091 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence146 <1 685 gene locus_tag LOCUS_05010 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119084.1:lipoprotein 765 1487 gene locus_tag LOCUS_05020 765 1487 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_05020 1503 3065 gene locus_tag LOCUS_05030 1503 3065 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527970.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence147 <1 3723 gene locus_tag LOCUS_05040 <1 3723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930621.1:5-oxoprolinase >Feature sequence148 1840 440 gene locus_tag LOCUS_05050 1840 440 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_05050 2733 1912 gene locus_tag LOCUS_05060 gene fabI 2733 1912 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_05060 3163 2738 gene locus_tag LOCUS_05070 gene fabZ 3163 2738 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121723.1 protein_id gnl|my_center|LOCUS_05070 <3940 3188 gene locus_tag LOCUS_05080 <3940 3188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118315.1:phytoene dehydrogenase >Feature sequence149 321 1715 gene locus_tag LOCUS_05090 gene arsA 321 1715 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_05090 1861 3171 gene locus_tag LOCUS_05100 gene xylA 1861 3171 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG2 protein_id gnl|my_center|LOCUS_05100 <3925 3216 gene locus_tag LOCUS_05110 <3925 3216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121415.1:oxidoreductase >Feature sequence150 355 1662 gene locus_tag LOCUS_05120 355 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2727 1693 gene locus_tag LOCUS_05130 gene dapA 2727 1693 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence151 1486 2607 gene locus_tag LOCUS_05140 1486 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence152 2662 1943 gene locus_tag LOCUS_05150 2662 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence153 <1 1036 gene locus_tag LOCUS_05160 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122564.1:Fe-S cluster assembly protein SufD 1115 1429 gene locus_tag LOCUS_05170 1115 1429 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_05170 1499 1819 gene locus_tag LOCUS_05180 1499 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326213.1 protein_id gnl|my_center|LOCUS_05180 1887 2861 gene locus_tag LOCUS_05190 1887 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_05190 3464 2901 gene locus_tag LOCUS_05200 3464 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence154 234 1070 gene locus_tag LOCUS_05210 234 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1064 1996 gene locus_tag LOCUS_05220 1064 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1997 3310 gene locus_tag LOCUS_05230 1997 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence155 643 1416 gene locus_tag LOCUS_05240 643 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121361.1 protein_id gnl|my_center|LOCUS_05240 1930 1439 gene locus_tag LOCUS_05250 1930 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2230 3399 gene locus_tag LOCUS_05260 2230 3399 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118418.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence156 647 1210 gene locus_tag LOCUS_05270 647 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1264 3201 gene locus_tag LOCUS_05280 gene uroD 1264 3201 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN37 protein_id gnl|my_center|LOCUS_05280 >Feature sequence157 192 1532 gene locus_tag LOCUS_05290 192 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_05290 1788 1552 gene locus_tag LOCUS_05300 1788 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2130 2396 gene locus_tag LOCUS_05310 2130 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 3795 2416 gene locus_tag LOCUS_05320 3795 2416 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence158 563 1243 gene locus_tag LOCUS_05330 563 1243 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_05330 1271 2593 gene locus_tag LOCUS_05340 gene pyrC 1271 2593 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFD0 protein_id gnl|my_center|LOCUS_05340 2997 2701 gene locus_tag LOCUS_05350 2997 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence159 1593 166 gene locus_tag LOCUS_05360 1593 166 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_05360 <3862 1614 gene locus_tag LOCUS_05370 <3862 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123804.1:cytochrome c >Feature sequence160 2848 368 gene locus_tag LOCUS_05380 2848 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797477.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence161 1723 530 gene locus_tag LOCUS_05390 1723 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 3416 1677 gene locus_tag LOCUS_05400 gene ggtB 3416 1677 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence162 1355 237 gene locus_tag LOCUS_05410 gene aspC 1355 237 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG06 protein_id gnl|my_center|LOCUS_05410 2690 1413 gene locus_tag LOCUS_05420 2690 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123867.1 protein_id gnl|my_center|LOCUS_05420 3420 2701 gene locus_tag LOCUS_05430 3420 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence163 <1 1387 gene locus_tag LOCUS_05440 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146986.1:pyruvate ferredoxin oxidoreductase 2831 1446 gene locus_tag LOCUS_05450 2831 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence164 >Feature sequence165 334 3252 gene locus_tag LOCUS_05460 334 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3444 3274 gene locus_tag LOCUS_05470 3444 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328828.1 protein_id gnl|my_center|LOCUS_05470 3790 3437 gene locus_tag LOCUS_05480 3790 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence166 1631 849 gene locus_tag LOCUS_05490 1631 849 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015757.1 protein_id gnl|my_center|LOCUS_05490 2663 1671 gene locus_tag LOCUS_05500 2663 1671 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_05500 3439 2669 gene locus_tag LOCUS_05510 3439 2669 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence167 964 2331 gene locus_tag LOCUS_05520 964 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2331 3605 gene locus_tag LOCUS_05530 2331 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence168 67 510 gene locus_tag LOCUS_05540 67 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 524 1447 gene locus_tag LOCUS_05550 524 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 1475 1759 gene locus_tag LOCUS_05560 gene fliQ 1475 1759 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35535 protein_id gnl|my_center|LOCUS_05560 1781 2521 gene locus_tag LOCUS_05570 gene fliR 1781 2521 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G26 protein_id gnl|my_center|LOCUS_05570 2540 3250 gene locus_tag LOCUS_05580 2540 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence169 >Feature sequence170 17 1840 gene locus_tag LOCUS_05590 gene typA 17 1840 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120935.1 protein_id gnl|my_center|LOCUS_05590 2061 2405 gene locus_tag LOCUS_05600 2061 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2444 2668 gene locus_tag LOCUS_05610 2444 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2818 2991 gene locus_tag LOCUS_05620 2818 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 <3782 3093 gene locus_tag LOCUS_05630 <3782 3093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121013.1:nicotinate-nucleotide diphosphorylase (carboxylating) >Feature sequence171 2040 3158 gene locus_tag LOCUS_05640 2040 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence172 398 1648 gene locus_tag LOCUS_05650 398 1648 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119140.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence173 2084 2989 gene locus_tag LOCUS_05660 2084 2989 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_05660 3762 3013 gene locus_tag LOCUS_05670 3762 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence174 247 334 gene locus_tag LOCUS_t00060 247 334 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 616 341 gene locus_tag LOCUS_05680 616 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1336 899 gene locus_tag LOCUS_05690 1336 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2268 1606 gene locus_tag LOCUS_05700 gene cmk 2268 1606 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEW6 protein_id gnl|my_center|LOCUS_05700 >Feature sequence175 3489 565 gene locus_tag LOCUS_05710 gene cti 3489 565 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence176 2147 1365 gene locus_tag LOCUS_05720 2147 1365 CDS product N,N-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_05720 2635 2150 gene locus_tag LOCUS_05730 2635 2150 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_05730 3158 2736 gene locus_tag LOCUS_05740 3158 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 <3748 3179 gene locus_tag LOCUS_05750 <3748 3179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762613.1:DNA topoisomerase VI subunit A >Feature sequence177 345 1061 gene locus_tag LOCUS_05760 345 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099724.1 protein_id gnl|my_center|LOCUS_05760 1058 1942 gene locus_tag LOCUS_05770 1058 1942 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_05770 1965 3551 gene locus_tag LOCUS_05780 1965 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 protein_id gnl|my_center|LOCUS_05780 >Feature sequence178 617 174 gene locus_tag LOCUS_05790 617 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 1457 645 gene locus_tag LOCUS_05800 1457 645 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XVF5 protein_id gnl|my_center|LOCUS_05800 2248 1499 gene locus_tag LOCUS_05810 gene surE 2248 1499 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_05810 3329 2238 gene locus_tag LOCUS_05820 3329 2238 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120004.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence179 <1 1683 gene locus_tag LOCUS_05830 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122941.1:membrane protein 2446 1718 gene locus_tag LOCUS_05840 gene lplA 2446 1718 CDS product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_05840 2573 3637 gene locus_tag LOCUS_05850 2573 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence180 188 865 gene locus_tag LOCUS_05860 188 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05860 908 1726 gene locus_tag LOCUS_05870 908 1726 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117794.1 protein_id gnl|my_center|LOCUS_05870 1776 3065 gene locus_tag LOCUS_05880 1776 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081526.1 protein_id gnl|my_center|LOCUS_05880 3099 3548 gene locus_tag LOCUS_05890 3099 3548 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence181 2003 2326 gene locus_tag LOCUS_05900 2003 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2409 3284 gene locus_tag LOCUS_05910 2409 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence182 1354 2697 gene locus_tag LOCUS_05920 gene pfkA1 1354 2697 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08333 protein_id gnl|my_center|LOCUS_05920 2725 3639 gene locus_tag LOCUS_05930 2725 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence183 299 2062 gene locus_tag LOCUS_05940 gene atsA 299 2062 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_05940 2300 2482 gene locus_tag LOCUS_05950 2300 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3059 2526 gene locus_tag LOCUS_05960 3059 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3088 3258 gene locus_tag LOCUS_05970 3088 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3355 3281 gene locus_tag LOCUS_t00070 3355 3281 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence184 2765 1782 gene locus_tag LOCUS_05980 2765 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05980 2809 3060 gene locus_tag LOCUS_05990 2809 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence185 353 1789 gene locus_tag LOCUS_06000 353 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence186 577 1059 gene locus_tag LOCUS_06010 577 1059 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_06010 1123 3396 gene locus_tag LOCUS_06020 1123 3396 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_06020 3405 3668 gene locus_tag LOCUS_06030 3405 3668 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920730.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence187 1307 1146 gene locus_tag LOCUS_06040 1307 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2697 1324 gene locus_tag LOCUS_06050 2697 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 3539 2760 gene locus_tag LOCUS_06060 gene hpaI 3539 2760 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064543.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence188 <1 1338 gene locus_tag LOCUS_06070 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119052.1:sulfatase 2665 1394 gene locus_tag LOCUS_06080 2665 1394 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_06080 2782 2709 gene locus_tag LOCUS_t00080 2782 2709 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <3666 2797 gene locus_tag LOCUS_06090 <3666 2797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118605.1:glucose dehydrogenase >Feature sequence189 1622 813 gene locus_tag LOCUS_06100 gene panC 1622 813 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B8U7 protein_id gnl|my_center|LOCUS_06100 2442 1684 gene locus_tag LOCUS_06110 2442 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2710 2507 gene locus_tag LOCUS_06120 2710 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence190 293 961 gene locus_tag LOCUS_06130 gene lolD1 293 961 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_06130 >Feature sequence191 310 1038 gene locus_tag LOCUS_06140 gene panB 310 1038 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM39 protein_id gnl|my_center|LOCUS_06140 1065 3140 gene locus_tag LOCUS_06150 1065 3140 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948731.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence192 816 184 gene locus_tag LOCUS_06160 gene rplD 816 184 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN19 protein_id gnl|my_center|LOCUS_06160 1617 895 gene locus_tag LOCUS_06170 gene rplC 1617 895 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN20 protein_id gnl|my_center|LOCUS_06170 2081 1758 gene locus_tag LOCUS_06180 gene rpsJ 2081 1758 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN22 protein_id gnl|my_center|LOCUS_06180 <3647 2354 gene locus_tag LOCUS_06190 <3647 2354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121593.1:elongation factor G >Feature sequence193 <1 737 gene locus_tag LOCUS_06200 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001065417.1:thiazole biosynthesis adenylyltransferase ThiF 894 2081 gene locus_tag LOCUS_06210 894 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2118 3464 gene locus_tag LOCUS_06220 gene rbsA 2118 3464 CDS product ribose import ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E343 protein_id gnl|my_center|LOCUS_06220 >Feature sequence194 1245 487 gene locus_tag LOCUS_06230 1245 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2293 1304 gene locus_tag LOCUS_06240 2293 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3582 2365 gene locus_tag LOCUS_06250 gene lpxB 3582 2365 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119004.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence195 3 890 gene locus_tag LOCUS_06260 3 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06260 900 1334 gene locus_tag LOCUS_06270 900 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06270 1398 2792 gene locus_tag LOCUS_06280 1398 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124058.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence196 23 1471 gene locus_tag LOCUS_06290 23 1471 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_06290 2989 1520 gene locus_tag LOCUS_06300 2989 1520 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence197 2443 1178 gene locus_tag LOCUS_06310 gene ftsA 2443 1178 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence198 1075 677 gene locus_tag LOCUS_06320 gene atpC 1075 677 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB4 protein_id gnl|my_center|LOCUS_06320 2524 1079 gene locus_tag LOCUS_06330 gene atpD 2524 1079 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB5 protein_id gnl|my_center|LOCUS_06330 3457 2570 gene locus_tag LOCUS_06340 gene atpG 3457 2570 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_06340 >Feature sequence199 1136 144 gene locus_tag LOCUS_06350 1136 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118424.1 protein_id gnl|my_center|LOCUS_06350 3569 1212 gene locus_tag LOCUS_06360 3569 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence200 450 2654 gene locus_tag LOCUS_06370 450 2654 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence201 <1 575 gene locus_tag LOCUS_06380 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119978.1:asparagine synthetase B 1520 540 gene locus_tag LOCUS_06390 1520 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3509 1872 gene locus_tag LOCUS_06400 3509 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence202 807 1694 gene locus_tag LOCUS_06410 807 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1764 2579 gene locus_tag LOCUS_06420 1764 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence203 2917 1970 gene locus_tag LOCUS_06430 2917 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3188 3457 gene locus_tag LOCUS_06440 gene acyP 3188 3457 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V7 protein_id gnl|my_center|LOCUS_06440 >Feature sequence204 <3583 1036 gene locus_tag LOCUS_06450 <3583 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118043.1:cytochrome c >Feature sequence205 1 477 gene locus_tag LOCUS_06460 1 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 474 2969 gene locus_tag LOCUS_06470 474 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122570.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence206 523 1035 gene locus_tag LOCUS_06480 523 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1985 1071 gene locus_tag LOCUS_06490 1985 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3214 2006 gene locus_tag LOCUS_06500 3214 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence207 <1 957 gene locus_tag LOCUS_06510 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7TTZ4:tRNA-specific 2-thiouridylase MnmA 1085 2155 gene locus_tag LOCUS_06520 gene prfB 1085 2155 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ31 protein_id gnl|my_center|LOCUS_06520 2178 2783 gene locus_tag LOCUS_06530 2178 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence208 >Feature sequence209 1337 864 gene locus_tag LOCUS_06540 1337 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120023.1 protein_id gnl|my_center|LOCUS_06540 3511 1388 gene locus_tag LOCUS_06550 3511 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence210 1953 307 gene locus_tag LOCUS_06560 1953 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence211 260 1174 gene locus_tag LOCUS_06570 260 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1248 2480 gene locus_tag LOCUS_06580 1248 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence212 2374 1058 gene locus_tag LOCUS_06590 2374 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119642.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence213 >Feature sequence214 630 1907 gene locus_tag LOCUS_06600 630 1907 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_06600 2701 1913 gene locus_tag LOCUS_06610 2701 1913 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975713.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence215 76 2 gene locus_tag LOCUS_t00090 76 2 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 427 756 gene locus_tag LOCUS_06620 427 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 887 2239 gene locus_tag LOCUS_06630 887 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118694.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence216 2694 748 gene locus_tag LOCUS_06640 2694 748 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705657.1 protein_id gnl|my_center|LOCUS_06640 <3538 2756 gene locus_tag LOCUS_06650 <3538 2756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941017.1:NADH-quinone oxidoreductase subunit L >Feature sequence217 1398 2333 gene locus_tag LOCUS_06660 1398 2333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_06660 2335 3159 gene locus_tag LOCUS_06670 2335 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence218 1733 939 gene locus_tag LOCUS_06680 1733 939 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_06680 2948 1746 gene locus_tag LOCUS_06690 2948 1746 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_06690 <3517 2973 gene locus_tag LOCUS_06700 <3517 2973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096718.1:DUF1365 domain-containing protein >Feature sequence219 1588 3303 gene locus_tag LOCUS_06710 1588 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence220 698 1195 gene locus_tag LOCUS_06720 698 1195 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence221 1518 328 gene locus_tag LOCUS_06730 1518 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_06730 2762 1806 gene locus_tag LOCUS_06740 2762 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 <3497 2799 gene locus_tag LOCUS_06750 <3497 2799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase >Feature sequence222 <1 1746 gene locus_tag LOCUS_06760 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P6F2:protein TolB 3492 1768 gene locus_tag LOCUS_06770 3492 1768 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence223 509 1234 gene locus_tag LOCUS_06780 509 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 1396 1256 gene locus_tag LOCUS_06790 1396 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2148 1477 gene locus_tag LOCUS_06800 2148 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2704 2267 gene locus_tag LOCUS_06810 2704 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence224 >Feature sequence225 1359 1940 gene locus_tag LOCUS_06820 1359 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2267 2010 gene locus_tag LOCUS_06830 2267 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 2552 3364 gene locus_tag LOCUS_06840 gene hydH 2552 3364 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121413.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence226 2688 1996 gene locus_tag LOCUS_06850 gene cmoA 2688 1996 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206453.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence227 2664 1426 gene locus_tag LOCUS_06860 2664 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence228 2354 1161 gene locus_tag LOCUS_06870 gene tolQ 2354 1161 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_06870 2944 2543 gene locus_tag LOCUS_06880 gene queD 2944 2543 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDY5 protein_id gnl|my_center|LOCUS_06880 >Feature sequence229 <1 1035 gene locus_tag LOCUS_06890 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123804.1:cytochrome c 1039 2448 gene locus_tag LOCUS_06900 1039 2448 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence230 579 2891 gene locus_tag LOCUS_06910 gene priA 579 2891 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFQ0 protein_id gnl|my_center|LOCUS_06910 >Feature sequence231 >Feature sequence232 1440 2426 gene locus_tag LOCUS_06920 1440 2426 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence233 1261 248 gene locus_tag LOCUS_06930 1261 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2783 1356 gene locus_tag LOCUS_06940 2783 1356 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P8 protein_id gnl|my_center|LOCUS_06940 <3400 2780 gene locus_tag LOCUS_06950 <3400 2780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WFJ2:sulfate adenylyltransferase >Feature sequence234 2676 1711 gene locus_tag LOCUS_06960 2676 1711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence235 2230 1262 gene locus_tag LOCUS_06970 gene miaA 2230 1262 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU09 protein_id gnl|my_center|LOCUS_06970 2332 2745 gene locus_tag LOCUS_06980 gene hisE 2332 2745 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60536 protein_id gnl|my_center|LOCUS_06980 >Feature sequence236 <1 636 gene locus_tag LOCUS_06990 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074214.1:peptidase S9 693 1307 gene locus_tag LOCUS_07000 693 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2862 1492 gene locus_tag LOCUS_07010 2862 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3111 3196 gene locus_tag LOCUS_t00100 3111 3196 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence237 <1 1047 gene locus_tag LOCUS_07020 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:surface protein >Feature sequence238 134 1252 gene locus_tag LOCUS_07030 134 1252 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUP0 protein_id gnl|my_center|LOCUS_07030 1260 2132 gene locus_tag LOCUS_07040 gene pyrK 1260 2132 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_07040 <3366 2156 gene locus_tag LOCUS_07050 <3366 2156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121206.1:uroporphyrinogen III methyltransferase >Feature sequence239 2463 124 gene locus_tag LOCUS_07060 2463 124 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_07060 3351 2515 gene locus_tag LOCUS_07070 3351 2515 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122784.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence240 1329 2795 gene locus_tag LOCUS_07080 1329 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_07080 2958 3173 gene locus_tag LOCUS_07090 2958 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence241 133 1008 gene locus_tag LOCUS_07100 133 1008 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090280.1 protein_id gnl|my_center|LOCUS_07100 1118 2269 gene locus_tag LOCUS_07110 1118 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 protein_id gnl|my_center|LOCUS_07110 2374 2529 gene locus_tag LOCUS_07120 2374 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence242 318 506 gene locus_tag LOCUS_07130 318 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07130 550 936 gene locus_tag LOCUS_07140 550 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence243 >Feature sequence244 1934 2962 gene locus_tag LOCUS_07150 1934 2962 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence245 2750 1659 gene locus_tag LOCUS_07160 2750 1659 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731603.1 protein_id gnl|my_center|LOCUS_07160 <3320 2747 gene locus_tag LOCUS_07170 <3320 2747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123366.1:oxidoreductase >Feature sequence246 <1 855 gene locus_tag LOCUS_07180 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120521.1:gluconolactonase 867 1232 gene locus_tag LOCUS_07190 867 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 1254 1718 gene locus_tag LOCUS_07200 1254 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1931 1704 gene locus_tag LOCUS_07210 1931 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence247 91 399 gene locus_tag LOCUS_07220 91 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057944.1 protein_id gnl|my_center|LOCUS_07220 502 1845 gene locus_tag LOCUS_07230 502 1845 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_07230 1931 3187 gene locus_tag LOCUS_07240 1931 3187 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122959.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence248 1543 32 gene locus_tag LOCUS_07250 gene phoD 1543 32 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_07250 1818 1961 gene locus_tag LOCUS_07260 1818 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence249 1222 2733 gene locus_tag LOCUS_07270 1222 2733 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence250 >Feature sequence251 536 2038 gene locus_tag LOCUS_07280 536 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117691.1 protein_id gnl|my_center|LOCUS_07280 2234 2977 gene locus_tag LOCUS_07290 gene kdsA 2234 2977 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ25 protein_id gnl|my_center|LOCUS_07290 >Feature sequence252 1669 920 gene locus_tag LOCUS_07300 1669 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1888 2646 gene locus_tag LOCUS_07310 1888 2646 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence253 1261 788 gene locus_tag LOCUS_07320 1261 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence254 219 1442 gene locus_tag LOCUS_07330 219 1442 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123564.1 protein_id gnl|my_center|LOCUS_07330 <3284 1450 gene locus_tag LOCUS_07340 <3284 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118530.1:peptidase >Feature sequence255 79 1137 gene locus_tag LOCUS_07350 79 1137 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459460.1 protein_id gnl|my_center|LOCUS_07350 1199 2506 gene locus_tag LOCUS_07360 gene eno 1199 2506 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SME1 protein_id gnl|my_center|LOCUS_07360 3280 2741 gene locus_tag LOCUS_07370 3280 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence256 423 824 gene locus_tag LOCUS_07380 423 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_07380 2893 842 gene locus_tag LOCUS_07390 gene tkt 2893 842 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123963.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence257 >Feature sequence258 1073 621 gene locus_tag LOCUS_07400 1073 621 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120493.1 protein_id gnl|my_center|LOCUS_07400 1747 1070 gene locus_tag LOCUS_07410 1747 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2220 1768 gene locus_tag LOCUS_07420 gene gspG 2220 1768 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_07420 <3278 2297 gene locus_tag LOCUS_07430 <3278 2297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328284.1:type IV pilus biogenesis protein PilC >Feature sequence259 <1 671 gene locus_tag LOCUS_07440 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015839.1:membrane protein 829 2448 gene locus_tag LOCUS_07450 829 2448 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_07450 2463 3008 gene locus_tag LOCUS_07460 2463 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence260 <1 600 gene locus_tag LOCUS_07470 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118476.1:radical SAM protein 597 2102 gene locus_tag LOCUS_07480 gene prnC 597 2102 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118477.1 protein_id gnl|my_center|LOCUS_07480 3159 2116 gene locus_tag LOCUS_07490 3159 2116 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence261 606 2042 gene locus_tag LOCUS_07500 606 2042 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence262 272 2719 gene locus_tag LOCUS_07510 272 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence263 1390 107 gene locus_tag LOCUS_07520 1390 107 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_07520 2516 1566 gene locus_tag LOCUS_07530 2516 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 <3257 2619 gene locus_tag LOCUS_07540 <3257 2619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072446.1:transposase >Feature sequence264 1567 1010 gene locus_tag LOCUS_07550 1567 1010 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_07550 1777 2115 gene locus_tag LOCUS_07560 gene glnB 1777 2115 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119123.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence265 >Feature sequence266 618 277 gene locus_tag LOCUS_07570 gene arsC 618 277 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED91 protein_id gnl|my_center|LOCUS_07570 777 3110 gene locus_tag LOCUS_07580 777 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence267 1 450 gene locus_tag LOCUS_07590 1 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 503 2344 gene locus_tag LOCUS_07600 503 2344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325469.1 protein_id gnl|my_center|LOCUS_07600 2341 2574 gene locus_tag LOCUS_07610 2341 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07610 >Feature sequence268 <3240 1861 gene locus_tag LOCUS_07620 <3240 1861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121932.1:formate dehydrogenase >Feature sequence269 87 1454 gene locus_tag LOCUS_07630 87 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1484 1705 gene locus_tag LOCUS_07640 1484 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1950 3224 gene locus_tag LOCUS_07650 1950 3224 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403783.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence270 <1 2044 gene locus_tag LOCUS_07660 <1 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122835.1:glucan biosynthesis protein >Feature sequence271 >Feature sequence272 2794 518 gene locus_tag LOCUS_07670 2794 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence273 1611 91 gene locus_tag LOCUS_07680 1611 91 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_07680 1731 2156 gene locus_tag LOCUS_07690 1731 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2756 2181 gene locus_tag LOCUS_07700 2756 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence274 1620 403 gene locus_tag LOCUS_07710 1620 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3193 1721 gene locus_tag LOCUS_07720 gene guaB 3193 1721 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJL3 protein_id gnl|my_center|LOCUS_07720 >Feature sequence275 1768 2649 gene locus_tag LOCUS_07730 1768 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence276 1689 2540 gene locus_tag LOCUS_07740 1689 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence277 941 2236 gene locus_tag LOCUS_07750 941 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 <3218 2261 gene locus_tag LOCUS_07760 <3218 2261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224909.1:methylmalonate-semialdehyde dehydrogenase (acylating) >Feature sequence278 1207 242 gene locus_tag LOCUS_07770 gene rbsK 1207 242 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MMQ9 protein_id gnl|my_center|LOCUS_07770 1340 2503 gene locus_tag LOCUS_07780 gene dxr 1340 2503 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_07780 >Feature sequence279 1582 530 gene locus_tag LOCUS_07790 1582 530 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085740.1 protein_id gnl|my_center|LOCUS_07790 1699 2754 gene locus_tag LOCUS_07800 gene gspG 1699 2754 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118411.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence280 <1 552 gene locus_tag LOCUS_07810 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UF51:RNA polymerase sigma factor >Feature sequence281 680 1063 gene locus_tag LOCUS_07820 gene acpP 680 1063 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP48 protein_id gnl|my_center|LOCUS_07820 1158 1700 gene locus_tag LOCUS_07830 gene fabZ 1158 1700 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121272.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence282 1605 3035 gene locus_tag LOCUS_07840 1605 3035 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence283 <1 975 gene locus_tag LOCUS_07850 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKZ2:glutamyl-tRNA reductase 2046 979 gene locus_tag LOCUS_07860 2046 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence284 2560 554 gene locus_tag LOCUS_07870 gene bkdA 2560 554 CDS product 2-oxoisovalerate dehydrogenase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence285 296 1372 gene locus_tag LOCUS_07880 296 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120378.1 protein_id gnl|my_center|LOCUS_07880 1396 2328 gene locus_tag LOCUS_07890 1396 2328 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405562.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence286 >Feature sequence287 1878 637 gene locus_tag LOCUS_07900 1878 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence288 1830 799 gene locus_tag LOCUS_07910 1830 799 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_07910 2982 1876 gene locus_tag LOCUS_07920 2982 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence289 <1 549 gene locus_tag LOCUS_07930 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122220.1:aldehyde dehydrogenase 672 1823 gene locus_tag LOCUS_07940 672 1823 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_07940 1946 3142 gene locus_tag LOCUS_07950 1946 3142 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877095.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence290 1609 662 gene locus_tag LOCUS_07960 1609 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 <3162 1638 gene locus_tag LOCUS_07970 <3162 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKJ8:bifunctional purine biosynthesis protein PurH >Feature sequence291 547 2262 gene locus_tag LOCUS_07980 547 2262 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence292 <1 1746 gene locus_tag LOCUS_07990 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326639.1:NADH-dependent dehydrogenase 2079 1750 gene locus_tag LOCUS_08000 2079 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2988 2146 gene locus_tag LOCUS_08010 gene sgaU 2988 2146 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence293 1607 480 gene locus_tag LOCUS_08020 1607 480 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228989.1 protein_id gnl|my_center|LOCUS_08020 2133 1600 gene locus_tag LOCUS_08030 gene nudF 2133 1600 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067038.1 protein_id gnl|my_center|LOCUS_08030 2155 2757 gene locus_tag LOCUS_08040 2155 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence294 1061 2401 gene locus_tag LOCUS_08050 1061 2401 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_08050 3118 2429 gene locus_tag LOCUS_08060 3118 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence295 2422 704 gene locus_tag LOCUS_08070 2422 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence296 1093 2433 gene locus_tag LOCUS_08080 1093 2433 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence297 1810 977 gene locus_tag LOCUS_08090 1810 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2266 1856 gene locus_tag LOCUS_08100 gene rbfA 2266 1856 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR1 protein_id gnl|my_center|LOCUS_08100 <3112 2359 gene locus_tag LOCUS_08110 <3112 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URR0:translation initiation factor IF-2 >Feature sequence298 949 701 gene locus_tag LOCUS_08120 949 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1377 1183 gene locus_tag LOCUS_08130 1377 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1955 1512 gene locus_tag LOCUS_08140 gene fliW 1955 1512 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URF1 protein_id gnl|my_center|LOCUS_08140 2980 2096 gene locus_tag LOCUS_08150 gene hemC 2980 2096 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTD9 protein_id gnl|my_center|LOCUS_08150 >Feature sequence299 875 543 gene locus_tag LOCUS_08160 875 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08160 1097 930 gene locus_tag LOCUS_08170 1097 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1250 1924 gene locus_tag LOCUS_08180 1250 1924 CDS product N-carbamoylsarcosine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_08180 <3096 1919 gene locus_tag LOCUS_08190 <3096 1919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704265.1:selenocysteine synthase >Feature sequence300 2882 2118 gene locus_tag LOCUS_08200 gene hsaE 2882 2118 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419252.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence301 812 456 gene locus_tag LOCUS_08210 812 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2116 839 gene locus_tag LOCUS_08220 gene xseA 2116 839 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTZ9 protein_id gnl|my_center|LOCUS_08220 3018 2284 gene locus_tag LOCUS_08230 3018 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence302 507 2354 gene locus_tag LOCUS_08240 507 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121069.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence303 <1 1285 gene locus_tag LOCUS_08250 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119140.1:serine/threonine protein kinase 2335 1316 gene locus_tag LOCUS_08260 2335 1316 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_08260 <3082 2417 gene locus_tag LOCUS_08270 <3082 2417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGZ7:ribonuclease 3 >Feature sequence304 <1 1184 gene locus_tag LOCUS_08280 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121496.1:sodium extrusion protein NatB 1220 2422 gene locus_tag LOCUS_08290 gene trzA 1220 2422 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence305 >Feature sequence306 <1 597 gene locus_tag LOCUS_08300 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118166.1:imidazolonepropionase 760 2070 gene locus_tag LOCUS_08310 760 2070 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_08310 2658 2179 gene locus_tag LOCUS_08320 2658 2179 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_08320 2830 2648 gene locus_tag LOCUS_08330 2830 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2849 3058 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaaacatgggtgtctatgaata >Feature sequence307 363 1832 gene locus_tag LOCUS_08340 363 1832 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKK4 protein_id gnl|my_center|LOCUS_08340 1842 2960 gene locus_tag LOCUS_08350 1842 2960 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970668.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence308 919 389 gene locus_tag LOCUS_08360 919 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2414 945 gene locus_tag LOCUS_08370 2414 945 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122835.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08370 2892 2707 gene locus_tag LOCUS_08380 2892 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence309 1131 49 gene locus_tag LOCUS_08390 gene moxR 1131 49 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence310 767 955 gene locus_tag LOCUS_08400 767 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1023 2903 gene locus_tag LOCUS_08410 1023 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence311 2488 1712 gene locus_tag LOCUS_08420 2488 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence312 1334 816 gene locus_tag LOCUS_08430 1334 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08430 2420 1338 gene locus_tag LOCUS_08440 2420 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08440 <3031 2438 gene locus_tag LOCUS_08450 <3031 2438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324545.1:permease >Feature sequence313 133 2844 gene locus_tag LOCUS_08460 133 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120757.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence314 <1 680 gene locus_tag LOCUS_08470 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003806995.1:aminotransferase 733 1869 gene locus_tag LOCUS_08480 733 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118718.1 protein_id gnl|my_center|LOCUS_08480 2641 1901 gene locus_tag LOCUS_08490 2641 1901 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976186.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence315 276 1604 gene locus_tag LOCUS_08500 276 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_08500 1775 2128 gene locus_tag LOCUS_08510 1775 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence316 139 1170 gene locus_tag LOCUS_08520 139 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_08520 1258 2397 gene locus_tag LOCUS_08530 1258 2397 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence317 1765 692 gene locus_tag LOCUS_08540 1765 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_08540 1913 2914 gene locus_tag LOCUS_08550 1913 2914 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence318 2 811 gene locus_tag LOCUS_08560 2 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 959 2296 gene locus_tag LOCUS_08570 959 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124058.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence319 1284 514 gene locus_tag LOCUS_08580 gene recO 1284 514 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USC2 protein_id gnl|my_center|LOCUS_08580 2680 1343 gene locus_tag LOCUS_08590 2680 1343 CDS product hemolysin activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119979.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence320 913 407 gene locus_tag LOCUS_08600 gene coaD 913 407 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG6 protein_id gnl|my_center|LOCUS_08600 2191 950 gene locus_tag LOCUS_08610 gene nifS 2191 950 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122862.1 protein_id gnl|my_center|LOCUS_08610 2516 2698 gene locus_tag LOCUS_08620 2516 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence321 1092 2093 gene locus_tag LOCUS_08630 1092 2093 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123521.1 protein_id gnl|my_center|LOCUS_08630 2117 2734 gene locus_tag LOCUS_08640 2117 2734 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073754.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence322 33 980 gene locus_tag LOCUS_08650 33 980 CDS product UDP-glucose 4-epimerase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119533.1 protein_id gnl|my_center|LOCUS_08650 993 1718 gene locus_tag LOCUS_08660 993 1718 CDS product putative polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702942.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence323 >Feature sequence324 1205 1020 gene locus_tag LOCUS_08670 1205 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1630 1289 gene locus_tag LOCUS_08680 1630 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2402 1695 gene locus_tag LOCUS_08690 gene grpE 2402 1695 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM95 protein_id gnl|my_center|LOCUS_08690 <3008 2469 gene locus_tag LOCUS_08700 <3008 2469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UM96:chaperone protein DnaJ >Feature sequence325 985 1749 gene locus_tag LOCUS_08710 gene fabG 985 1749 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_08710 <3004 2033 gene locus_tag LOCUS_08720 <3004 2033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257273.1:peptidase C45 >Feature sequence326 893 821 gene locus_tag LOCUS_t00110 893 821 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2486 1017 gene locus_tag LOCUS_08730 2486 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence327 <2997 1995 gene locus_tag LOCUS_08740 <2997 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120593.1:adenylate cyclase >Feature sequence328 2685 1702 gene locus_tag LOCUS_08750 2685 1702 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence329 812 1843 gene locus_tag LOCUS_08760 gene tdh 812 1843 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence330 193 1821 gene locus_tag LOCUS_08770 193 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2727 1837 gene locus_tag LOCUS_08780 2727 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence331 1071 670 gene locus_tag LOCUS_08790 1071 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2478 1309 gene locus_tag LOCUS_08800 2478 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08800 >Feature sequence332 <1 561 gene locus_tag LOCUS_08810 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118026.1:arylsulfatase >Feature sequence333 <1 803 gene locus_tag LOCUS_08820 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBT8:tricorn protease 990 2096 gene locus_tag LOCUS_08830 990 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence334 327 1622 gene locus_tag LOCUS_08840 327 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 <2973 1657 gene locus_tag LOCUS_08850 <2973 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URV2:elongation factor G >Feature sequence335 1530 19 gene locus_tag LOCUS_08860 gene gatA 1530 19 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT33 protein_id gnl|my_center|LOCUS_08860 1886 1542 gene locus_tag LOCUS_08870 gene gatC 1886 1542 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY3 protein_id gnl|my_center|LOCUS_08870 2212 1937 gene locus_tag LOCUS_08880 gene rpmB 2212 1937 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY96 protein_id gnl|my_center|LOCUS_08880 >Feature sequence336 953 2215 gene locus_tag LOCUS_08890 953 2215 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence337 82 2037 gene locus_tag LOCUS_08900 82 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence338 2522 1287 gene locus_tag LOCUS_08910 2522 1287 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence339 1335 19 gene locus_tag LOCUS_08920 1335 19 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118925.1 protein_id gnl|my_center|LOCUS_08920 2701 1385 gene locus_tag LOCUS_08930 gene ahcY 2701 1385 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ5 protein_id gnl|my_center|LOCUS_08930 >Feature sequence340 <1 1286 gene locus_tag LOCUS_08940 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122380.1:S-layer protein 1771 1968 gene locus_tag LOCUS_08950 1771 1968 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence341 2564 1203 gene locus_tag LOCUS_08960 2564 1203 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123726.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence342 249 1721 gene locus_tag LOCUS_08970 249 1721 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120321.1 protein_id gnl|my_center|LOCUS_08970 <2954 1726 gene locus_tag LOCUS_08980 <2954 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120149.1:acetylglucosamine-6-sulfatase >Feature sequence343 112 1338 gene locus_tag LOCUS_08990 112 1338 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence344 <1 1640 gene locus_tag LOCUS_09000 <1 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMU0:phosphoenolpyruvate-protein phosphotransferase >Feature sequence345 2093 1065 gene locus_tag LOCUS_09010 2093 1065 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118940.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence346 <1 1773 gene locus_tag LOCUS_09020 <1 1773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122594.1:9-O-acetylesterase >Feature sequence347 570 178 gene locus_tag LOCUS_09030 570 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1486 665 gene locus_tag LOCUS_09040 1486 665 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_09040 2409 1483 gene locus_tag LOCUS_09050 2409 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence348 1396 245 gene locus_tag LOCUS_09060 1396 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence349 178 1167 gene locus_tag LOCUS_09070 178 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1344 1748 gene locus_tag LOCUS_09080 1344 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1860 2543 gene locus_tag LOCUS_09090 1860 2543 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence350 1658 492 gene locus_tag LOCUS_09100 gene pilT 1658 492 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_09100 2647 1877 gene locus_tag LOCUS_09110 gene hisF 2647 1877 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ9 protein_id gnl|my_center|LOCUS_09110 >Feature sequence351 >Feature sequence352 <1 1086 gene locus_tag LOCUS_09120 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGK9:signal peptidase I 1160 1918 gene locus_tag LOCUS_09130 1160 1918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120303.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence353 474 94 gene locus_tag LOCUS_09140 474 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2641 629 gene locus_tag LOCUS_09150 2641 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence354 <2907 1665 gene locus_tag LOCUS_09160 <2907 1665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119058.1:protein kinase >Feature sequence355 <2905 848 gene locus_tag LOCUS_09170 <2905 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin >Feature sequence356 108 1646 gene locus_tag LOCUS_09180 108 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence357 1231 416 gene locus_tag LOCUS_09190 1231 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1368 2021 gene locus_tag LOCUS_09200 1368 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence358 579 2498 gene locus_tag LOCUS_09210 579 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence359 <1 904 gene locus_tag LOCUS_09220 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MV13:mannonate dehydratase 1644 901 gene locus_tag LOCUS_09230 1644 901 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403309.1 protein_id gnl|my_center|LOCUS_09230 2751 1645 gene locus_tag LOCUS_09240 2751 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence360 <2887 1697 gene locus_tag LOCUS_09250 <2887 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123477.1:nucleotidyltransferase >Feature sequence361 <1 1323 gene locus_tag LOCUS_09260 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001079544.1:cytochrome-c peroxidase 1356 2747 gene locus_tag LOCUS_09270 1356 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence362 94 426 gene locus_tag LOCUS_09280 94 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 441 1430 gene locus_tag LOCUS_09290 441 1430 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868029.1 protein_id gnl|my_center|LOCUS_09290 2300 1434 gene locus_tag LOCUS_09300 2300 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2604 2293 gene locus_tag LOCUS_09310 2604 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence363 >Feature sequence364 2703 73 gene locus_tag LOCUS_09320 2703 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121404.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence365 25 1305 gene locus_tag LOCUS_09330 25 1305 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_09330 2830 1454 gene locus_tag LOCUS_09340 2830 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence366 909 292 gene locus_tag LOCUS_09350 909 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2165 1152 gene locus_tag LOCUS_09360 2165 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence367 685 1071 gene locus_tag LOCUS_09370 685 1071 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_09370 1886 1095 gene locus_tag LOCUS_09380 1886 1095 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118954.1 protein_id gnl|my_center|LOCUS_09380 2857 1907 gene locus_tag LOCUS_09390 2857 1907 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59806 protein_id gnl|my_center|LOCUS_09390 >Feature sequence368 905 351 gene locus_tag LOCUS_09400 905 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121374.1 protein_id gnl|my_center|LOCUS_09400 1638 1186 gene locus_tag LOCUS_09410 gene rpiB 1638 1186 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_09410 2803 1658 gene locus_tag LOCUS_09420 2803 1658 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence369 <1 585 gene locus_tag LOCUS_09430 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122845.1:iduronate-2-sulfatase >Feature sequence370 1878 502 gene locus_tag LOCUS_09440 1878 502 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence371 <2854 1569 gene locus_tag LOCUS_09450 <2854 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226611.1:X-Pro dipeptidyl-peptidase >Feature sequence372 >Feature sequence373 1979 642 gene locus_tag LOCUS_09460 1979 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 <2848 2074 gene locus_tag LOCUS_09470 <2848 2074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UU68:methionine aminopeptidase >Feature sequence374 2410 1109 gene locus_tag LOCUS_09480 2410 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence375 1321 500 gene locus_tag LOCUS_09490 1321 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 <2841 1599 gene locus_tag LOCUS_09500 <2841 1599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGJ8:apolipoprotein N-acyltransferase >Feature sequence376 2099 1578 gene locus_tag LOCUS_09510 2099 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2798 2160 gene locus_tag LOCUS_09520 2798 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence377 337 996 gene locus_tag LOCUS_09530 337 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2021 1071 gene locus_tag LOCUS_09540 2021 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 <2828 2142 gene locus_tag LOCUS_09550 <2828 2142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122317.1:methyltransferase >Feature sequence378 503 2785 gene locus_tag LOCUS_09560 503 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence379 1 1740 gene locus_tag LOCUS_09570 1 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence380 1948 398 gene locus_tag LOCUS_09580 1948 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09580 >Feature sequence381 2489 2175 gene locus_tag LOCUS_09590 2489 2175 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence382 <1 758 gene locus_tag LOCUS_09600 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase >Feature sequence383 >Feature sequence384 >Feature sequence385 262 1866 gene locus_tag LOCUS_09610 262 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118208.1 protein_id gnl|my_center|LOCUS_09610 1884 2603 gene locus_tag LOCUS_09620 1884 2603 CDS product nickel transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532037.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence386 745 2355 gene locus_tag LOCUS_09630 gene glyQS 745 2355 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_09630 >Feature sequence387 >Feature sequence388 1154 708 gene locus_tag LOCUS_09640 gene nusB 1154 708 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USA9 protein_id gnl|my_center|LOCUS_09640 1650 1177 gene locus_tag LOCUS_09650 gene ribH 1650 1177 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66041 protein_id gnl|my_center|LOCUS_09650 2724 1783 gene locus_tag LOCUS_09660 2724 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence389 2187 1111 gene locus_tag LOCUS_09670 2187 1111 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705181.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence390 1114 218 gene locus_tag LOCUS_09680 1114 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2210 1413 gene locus_tag LOCUS_09690 2210 1413 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887514.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence391 <1 763 gene locus_tag LOCUS_09700 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123462.1:hydrolase <2789 766 gene locus_tag LOCUS_09710 <2789 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329904.1:tail-specific protease >Feature sequence392 <1 954 gene locus_tag LOCUS_09720 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UT24:cyclic dehypoxanthine futalosine synthase 987 1775 gene locus_tag LOCUS_09730 gene natA 987 1775 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence393 1867 1409 gene locus_tag LOCUS_09740 1867 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence394 1940 528 gene locus_tag LOCUS_09750 1940 528 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence395 >Feature sequence396 1286 156 gene locus_tag LOCUS_09760 1286 156 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence397 <1 770 gene locus_tag LOCUS_09770 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120684.1:polyprenyl synthetase 841 1383 gene locus_tag LOCUS_09780 841 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120683.1 protein_id gnl|my_center|LOCUS_09780 1413 2657 gene locus_tag LOCUS_09790 1413 2657 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence398 >Feature sequence399 245 1591 gene locus_tag LOCUS_09800 245 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence400 1638 193 gene locus_tag LOCUS_09810 1638 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_09810 <2760 1649 gene locus_tag LOCUS_09820 <2760 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120962.1:cytochrome c >Feature sequence401 1246 329 gene locus_tag LOCUS_09830 gene pyrF 1246 329 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_09830 1739 1281 gene locus_tag LOCUS_09840 gene ndk 1739 1281 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK7 protein_id gnl|my_center|LOCUS_09840 <2759 1962 gene locus_tag LOCUS_09850 <2759 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122283.1:zinc protease >Feature sequence402 1735 1253 gene locus_tag LOCUS_09860 1735 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09860 <2758 1791 gene locus_tag LOCUS_09870 <2758 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326676.1:sulfatase >Feature sequence403 <1 637 gene locus_tag LOCUS_09880 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQN7:transcription-repair-coupling factor 741 2120 gene locus_tag LOCUS_09890 741 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence404 <1 984 gene locus_tag LOCUS_09900 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975879.1:oxidoreductase 1006 1950 gene locus_tag LOCUS_09910 1006 1950 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530991.1 protein_id gnl|my_center|LOCUS_09910 2026 2217 gene locus_tag LOCUS_09920 2026 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence405 >Feature sequence406 2347 2475 gene locus_tag LOCUS_09930 2347 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence407 1890 1087 gene locus_tag LOCUS_09940 1890 1087 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2I9 protein_id gnl|my_center|LOCUS_09940 <2735 1895 gene locus_tag LOCUS_09950 <2735 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003408279.1:molybdopterin biosynthesis protein MoeX >Feature sequence408 3 233 gene locus_tag LOCUS_09960 3 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 230 1552 gene locus_tag LOCUS_09970 230 1552 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122501.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence409 738 349 gene locus_tag LOCUS_09980 738 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence410 >Feature sequence411 3 1196 gene locus_tag LOCUS_09990 gene oppC 3 1196 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329702.1 protein_id gnl|my_center|LOCUS_09990 1202 2254 gene locus_tag LOCUS_10000 gene oppD 1202 2254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123939.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence412 2069 945 gene locus_tag LOCUS_10010 2069 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence413 <1 657 gene locus_tag LOCUS_10020 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123804.1:cytochrome c 654 2081 gene locus_tag LOCUS_10030 654 2081 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_10030 2265 2588 gene locus_tag LOCUS_10040 2265 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence414 520 2442 gene locus_tag LOCUS_10050 520 2442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence415 209 1732 gene locus_tag LOCUS_10060 209 1732 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence416 <1 1380 gene locus_tag LOCUS_10070 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:surface protein >Feature sequence417 >Feature sequence418 <1 1154 gene locus_tag LOCUS_10080 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118814.1:arylsulfatase 1151 1873 gene locus_tag LOCUS_10090 1151 1873 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122635.1 protein_id gnl|my_center|LOCUS_10090 <2695 1901 gene locus_tag LOCUS_10100 <2695 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141892.1:oxidoreductase >Feature sequence419 1591 2640 gene locus_tag LOCUS_10110 1591 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence420 1068 466 gene locus_tag LOCUS_10120 gene sigW 1068 466 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_10120 >Feature sequence421 >Feature sequence422 1419 703 gene locus_tag LOCUS_10130 1419 703 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_10130 <2687 1527 gene locus_tag LOCUS_10140 <2687 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337250.1:NADH-dependent dehydrogenase >Feature sequence423 1290 2339 gene locus_tag LOCUS_10150 1290 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence424 855 631 gene locus_tag LOCUS_10160 855 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 965 2269 gene locus_tag LOCUS_10170 965 2269 CDS product PhoPQ-activated pathogenicity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120441.1 protein_id gnl|my_center|LOCUS_10170 2683 2438 gene locus_tag LOCUS_10180 2683 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence425 572 829 gene locus_tag LOCUS_10190 gene rpoA 572 829 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326741.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence426 378 1328 gene locus_tag LOCUS_10200 378 1328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808871.1 protein_id gnl|my_center|LOCUS_10200 2613 1348 gene locus_tag LOCUS_10210 2613 1348 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH36 protein_id gnl|my_center|LOCUS_10210 >Feature sequence427 <2679 690 gene locus_tag LOCUS_10220 <2679 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67039:MEMO1 family protein >Feature sequence428 3 224 gene locus_tag LOCUS_10230 3 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 341 1693 gene locus_tag LOCUS_10240 gene thiC 341 1693 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP26 protein_id gnl|my_center|LOCUS_10240 1712 2389 gene locus_tag LOCUS_10250 1712 2389 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence429 >Feature sequence430 2444 1983 gene locus_tag LOCUS_10260 2444 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence431 166 1077 gene locus_tag LOCUS_10270 166 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1320 2615 gene locus_tag LOCUS_10280 1320 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence432 104 772 gene locus_tag LOCUS_10290 104 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_10290 <2666 813 gene locus_tag LOCUS_10300 <2666 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548136.1:alpha-galactosidase >Feature sequence433 >Feature sequence434 2 1186 gene locus_tag LOCUS_10310 gene galM 2 1186 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_10310 1857 1255 gene locus_tag LOCUS_10320 gene lexA 1857 1255 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNQ7 protein_id gnl|my_center|LOCUS_10320 >Feature sequence435 1889 1188 gene locus_tag LOCUS_10330 1889 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence436 466 1707 gene locus_tag LOCUS_10340 gene pgl 466 1707 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34499 protein_id gnl|my_center|LOCUS_10340 2317 1874 gene locus_tag LOCUS_10350 2317 1874 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWU8 protein_id gnl|my_center|LOCUS_10350 >Feature sequence437 85 612 gene locus_tag LOCUS_10360 85 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2655 646 gene locus_tag LOCUS_10370 2655 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence438 1427 267 gene locus_tag LOCUS_10380 1427 267 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369257.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence439 667 1557 gene locus_tag LOCUS_10390 667 1557 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268792.1 protein_id gnl|my_center|LOCUS_10390 1554 2552 gene locus_tag LOCUS_10400 1554 2552 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336191.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence440 1055 2128 gene locus_tag LOCUS_10410 1055 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence441 >Feature sequence442 <1 934 gene locus_tag LOCUS_10420 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119047.1:alcohol dehydrogenase 2449 935 gene locus_tag LOCUS_10430 2449 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence443 423 324 gene locus_tag LOCUS_t00120 423 324 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 714 487 gene locus_tag LOCUS_10440 714 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1666 755 gene locus_tag LOCUS_10450 gene rsmA 1666 755 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR4 protein_id gnl|my_center|LOCUS_10450 2285 1668 gene locus_tag LOCUS_10460 gene ribE 2285 1668 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_870472.2 protein_id gnl|my_center|LOCUS_10460 >Feature sequence444 >Feature sequence445 <1 834 gene locus_tag LOCUS_10470 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120406.1:oxidoreductase 1245 877 gene locus_tag LOCUS_10480 gene arsC 1245 877 CDS product protein ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45947 protein_id gnl|my_center|LOCUS_10480 2628 1351 gene locus_tag LOCUS_10490 2628 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence446 1487 2542 gene locus_tag LOCUS_10500 1487 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence447 <2626 832 gene locus_tag LOCUS_10510 <2626 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118596.1:polyketide synthase >Feature sequence448 1520 369 gene locus_tag LOCUS_10520 gene hemN 1520 369 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence449 <2623 835 gene locus_tag LOCUS_10530 <2623 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117969.1:cytochrome c >Feature sequence450 440 1105 gene locus_tag LOCUS_10540 440 1105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_10540 1102 2262 gene locus_tag LOCUS_10550 1102 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence451 <1 575 gene locus_tag LOCUS_10560 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123424.1:streptomycin biosynthesis protein StrI 1590 601 gene locus_tag LOCUS_10570 1590 601 CDS product thiamine biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461454.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence452 764 582 gene locus_tag LOCUS_10580 764 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 840 2024 gene locus_tag LOCUS_10590 840 2024 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899005.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence453 1670 933 gene locus_tag LOCUS_10600 1670 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10600 <2616 1562 gene locus_tag LOCUS_10610 <2616 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037539.1:peptidase note possible pseudo, frameshifted >Feature sequence454 6 1898 gene locus_tag LOCUS_10620 6 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 <2615 1989 gene locus_tag LOCUS_10630 <2615 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFV6:RNA polymerase sigma factor >Feature sequence455 874 311 gene locus_tag LOCUS_10640 874 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 <2611 891 gene locus_tag LOCUS_10650 <2611 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119027.1:nodulation protein NfeD >Feature sequence456 62 1171 gene locus_tag LOCUS_10660 62 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_10660 1780 1205 gene locus_tag LOCUS_10670 1780 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence457 729 172 gene locus_tag LOCUS_10680 729 172 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_10680 1796 726 gene locus_tag LOCUS_10690 gene adh 1796 726 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120643.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence458 <1 1010 gene locus_tag LOCUS_10700 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H67:protein TolB >Feature sequence459 608 135 gene locus_tag LOCUS_10710 608 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2135 633 gene locus_tag LOCUS_10720 2135 633 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352327.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence460 >Feature sequence461 2287 980 gene locus_tag LOCUS_10730 2287 980 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence462 >Feature sequence463 >Feature sequence464 279 1685 gene locus_tag LOCUS_10740 279 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence465 703 2199 gene locus_tag LOCUS_10750 703 2199 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKK4 protein_id gnl|my_center|LOCUS_10750 >Feature sequence466 2551 1079 gene locus_tag LOCUS_10760 2551 1079 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence467 705 433 gene locus_tag LOCUS_10770 705 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 689 1393 gene locus_tag LOCUS_10780 689 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1442 2506 gene locus_tag LOCUS_10790 gene waaQ 1442 2506 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122214.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence468 <1 2022 gene locus_tag LOCUS_10800 <1 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KTD1:DNA ligase >Feature sequence469 1209 2330 gene locus_tag LOCUS_10810 1209 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence470 1036 290 gene locus_tag LOCUS_10820 1036 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10820 1827 1228 gene locus_tag LOCUS_10830 gene leuD 1827 1228 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA6 protein_id gnl|my_center|LOCUS_10830 <2573 1864 gene locus_tag LOCUS_10840 <2573 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z9I2:3-isopropylmalate dehydratase large subunit >Feature sequence471 353 1333 gene locus_tag LOCUS_10850 353 1333 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_10850 1361 2092 gene locus_tag LOCUS_10860 gene pdxJ 1361 2092 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYK5 protein_id gnl|my_center|LOCUS_10860 >Feature sequence472 872 1369 gene locus_tag LOCUS_10870 gene fae 872 1369 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122706.1 protein_id gnl|my_center|LOCUS_10870 1509 2375 gene locus_tag LOCUS_10880 gene mtdA 1509 2375 CDS product MtdA bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence473 >Feature sequence474 2291 942 gene locus_tag LOCUS_10890 2291 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence475 1106 543 gene locus_tag LOCUS_10900 1106 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1706 1221 gene locus_tag LOCUS_10910 1706 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2504 1737 gene locus_tag LOCUS_10920 2504 1737 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence476 1390 251 gene locus_tag LOCUS_10930 gene nadA 1390 251 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNR5 protein_id gnl|my_center|LOCUS_10930 1687 2268 gene locus_tag LOCUS_10940 gene trpG 1687 2268 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120844.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence477 2319 850 gene locus_tag LOCUS_10950 gene aslA 2319 850 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence478 1919 732 gene locus_tag LOCUS_10960 gene pgk 1919 732 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEX1 protein_id gnl|my_center|LOCUS_10960 <2565 1987 gene locus_tag LOCUS_10970 <2565 1987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFY6:aspartate--tRNA(Asp/Asn) ligase >Feature sequence479 1581 832 gene locus_tag LOCUS_10980 1581 832 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_10980 <2562 1574 gene locus_tag LOCUS_10990 <2562 1574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNW7:tetraacyldisaccharide 4'-kinase >Feature sequence480 >Feature sequence481 <1 1492 gene locus_tag LOCUS_11000 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121117.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence482 101 1117 gene locus_tag LOCUS_11010 101 1117 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence483 573 1706 gene locus_tag LOCUS_11020 573 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence484 >Feature sequence485 1662 586 gene locus_tag LOCUS_11030 1662 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence486 <1 513 gene locus_tag LOCUS_11040 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121859.1:sulfatase 521 1174 gene locus_tag LOCUS_11050 521 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1422 1667 gene locus_tag LOCUS_11060 1422 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1778 2371 gene locus_tag LOCUS_11070 1778 2371 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_11070 2550 2401 gene locus_tag LOCUS_11080 2550 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence487 450 1325 gene locus_tag LOCUS_11090 450 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1356 1772 gene locus_tag LOCUS_11100 gene exbD 1356 1772 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence488 940 1551 gene locus_tag LOCUS_11110 940 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence489 <1 560 gene locus_tag LOCUS_11120 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118059.1:N-acetylgalactosamine-6-sulfatase 1797 589 gene locus_tag LOCUS_11130 1797 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2546 1815 gene locus_tag LOCUS_11140 2546 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence490 1638 307 gene locus_tag LOCUS_11150 1638 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_11150 2494 1754 gene locus_tag LOCUS_11160 2494 1754 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083086.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence491 <2544 1426 gene locus_tag LOCUS_11170 <2544 1426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122155.1:heme-binding protein >Feature sequence492 132 1913 gene locus_tag LOCUS_11180 132 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence493 818 429 gene locus_tag LOCUS_11190 818 429 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120691.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence494 920 1042 gene locus_tag LOCUS_11200 920 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1095 2051 gene locus_tag LOCUS_11210 1095 2051 CDS product Rossman fold protein, TIGR00730 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122653.1 protein_id gnl|my_center|LOCUS_11210 2334 2092 gene locus_tag LOCUS_11220 2334 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence495 >Feature sequence496 564 1247 gene locus_tag LOCUS_11230 564 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11230 >Feature sequence497 <1 821 gene locus_tag LOCUS_11240 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117796.1:oxidoreductase 831 1682 gene locus_tag LOCUS_11250 831 1682 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence498 964 161 gene locus_tag LOCUS_11260 964 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 <2527 1026 gene locus_tag LOCUS_11270 <2527 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3HKK4:microcystinase C >Feature sequence499 <2525 1422 gene locus_tag LOCUS_11280 <2525 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UU96:pyruvate dehydrogenase E1 component >Feature sequence500 1761 370 gene locus_tag LOCUS_11290 gene pgi 1761 370 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYT0 protein_id gnl|my_center|LOCUS_11290 >Feature sequence501 1402 194 gene locus_tag LOCUS_11300 1402 194 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_11300 1575 1883 gene locus_tag LOCUS_11310 1575 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 <2523 1901 gene locus_tag LOCUS_11320 <2523 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888021.1:alanine racemase >Feature sequence502 545 1855 gene locus_tag LOCUS_11330 gene pfkA 545 1855 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121457.1 protein_id gnl|my_center|LOCUS_11330 2494 1907 gene locus_tag LOCUS_11340 gene hisB 2494 1907 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC2 protein_id gnl|my_center|LOCUS_11340 >Feature sequence503 >Feature sequence504 >Feature sequence505 >Feature sequence506 1605 601 gene locus_tag LOCUS_11350 gene pknB 1605 601 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence507 80 1369 gene locus_tag LOCUS_11360 80 1369 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence508 <1 1444 gene locus_tag LOCUS_11370 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118092.1:multidrug transporter 2096 1425 gene locus_tag LOCUS_11380 2096 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence509 <1 1376 gene locus_tag LOCUS_11390 <1 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000842981.1:Xaa-Pro aminopeptidase >Feature sequence510 >Feature sequence511 254 1018 gene locus_tag LOCUS_11400 gene lplA 254 1018 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 protein_id gnl|my_center|LOCUS_11400 1294 1962 gene locus_tag LOCUS_11410 1294 1962 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325534.1 protein_id gnl|my_center|LOCUS_11410 <2502 1998 gene locus_tag LOCUS_11420 <2502 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122811.1:O-linked GlcNAc transferase >Feature sequence512 <1 993 gene locus_tag LOCUS_11430 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124064.1:cytochrome c 1083 2462 gene locus_tag LOCUS_11440 1083 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence513 152 1663 gene locus_tag LOCUS_11450 152 1663 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254206.1 protein_id gnl|my_center|LOCUS_11450 2283 1684 gene locus_tag LOCUS_11460 2283 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338171.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence514 >Feature sequence515 319 1284 gene locus_tag LOCUS_11470 gene trpS 319 1284 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA4 protein_id gnl|my_center|LOCUS_11470 1281 1664 gene locus_tag LOCUS_11480 gene acpS 1281 1664 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA5 protein_id gnl|my_center|LOCUS_11480 <2489 1671 gene locus_tag LOCUS_11490 <2489 1671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KGB3:DNA topoisomerase 1 >Feature sequence516 919 170 gene locus_tag LOCUS_11500 919 170 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_11500 2279 942 gene locus_tag LOCUS_11510 2279 942 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811106.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence517 1 1371 gene locus_tag LOCUS_11520 1 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 <2485 1428 gene locus_tag LOCUS_11530 <2485 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117697.1:L-sorbosone dehydrogenase >Feature sequence518 441 1187 gene locus_tag LOCUS_11540 441 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 1120 1569 gene locus_tag LOCUS_11550 1120 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1920 1510 gene locus_tag LOCUS_11560 1920 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence519 27 1712 gene locus_tag LOCUS_11570 27 1712 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121082.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence520 1155 1427 gene locus_tag LOCUS_11580 1155 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence521 158 1615 gene locus_tag LOCUS_11590 158 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence522 1715 1284 gene locus_tag LOCUS_11600 1715 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence523 <2455 816 gene locus_tag LOCUS_11610 <2455 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330158.1:serine/threonine protein kinase >Feature sequence524 >Feature sequence525 1449 1970 gene locus_tag LOCUS_11620 1449 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence526 1266 343 gene locus_tag LOCUS_11630 1266 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence527 234 578 gene locus_tag LOCUS_11640 234 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120854.1 protein_id gnl|my_center|LOCUS_11640 703 1002 gene locus_tag LOCUS_11650 703 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 995 1339 gene locus_tag LOCUS_11660 995 1339 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405496.1 protein_id gnl|my_center|LOCUS_11660 2169 1336 gene locus_tag LOCUS_11670 2169 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence528 815 612 gene locus_tag LOCUS_11680 815 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1587 1033 gene locus_tag LOCUS_11690 1587 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence529 857 2077 gene locus_tag LOCUS_11700 857 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence530 41 1174 gene locus_tag LOCUS_11710 gene yrbG 41 1174 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_11710 2145 1171 gene locus_tag LOCUS_11720 gene rluD 2145 1171 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX8 protein_id gnl|my_center|LOCUS_11720 >Feature sequence531 <1 1390 gene locus_tag LOCUS_11730 <1 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119791.1:cytochrome c >Feature sequence532 1161 154 gene locus_tag LOCUS_11740 1161 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1597 2298 gene locus_tag LOCUS_11750 1597 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence533 564 648 gene locus_tag LOCUS_t00130 564 648 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 615 2156 gene locus_tag LOCUS_11760 615 2156 CDS product polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122555.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence534 >Feature sequence535 2299 1013 gene locus_tag LOCUS_11770 2299 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence536 >Feature sequence537 178 1017 gene locus_tag LOCUS_11780 178 1017 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120600.1 protein_id gnl|my_center|LOCUS_11780 <2436 1129 gene locus_tag LOCUS_11790 <2436 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767206.1:glycosyl hydrolase family 88 >Feature sequence538 >Feature sequence539 401 1516 gene locus_tag LOCUS_11800 401 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1554 1481 gene locus_tag LOCUS_t00140 1554 1481 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <2434 1697 gene locus_tag LOCUS_11810 <2434 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122938.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence540 <2433 326 gene locus_tag LOCUS_11820 <2433 326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin >Feature sequence541 >Feature sequence542 >Feature sequence543 218 1297 gene locus_tag LOCUS_11830 218 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence544 270 1562 gene locus_tag LOCUS_11840 270 1562 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118148.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence545 1206 385 gene locus_tag LOCUS_11850 1206 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1372 2154 gene locus_tag LOCUS_11860 1372 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence546 <2422 1763 gene locus_tag LOCUS_11870 <2422 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950550.1:dTDP-4-amino-4,6-dideoxy-D-glucose transaminase >Feature sequence547 271 1905 gene locus_tag LOCUS_11880 271 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence548 >Feature sequence549 1774 431 gene locus_tag LOCUS_11890 1774 431 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence550 200 904 gene locus_tag LOCUS_11900 200 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 934 1869 gene locus_tag LOCUS_11910 934 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence551 <1 1170 gene locus_tag LOCUS_11920 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118182.1:glycosyl transferase family 1 1236 1439 gene locus_tag LOCUS_11930 gene rpmI 1236 1439 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP72 protein_id gnl|my_center|LOCUS_11930 1576 1932 gene locus_tag LOCUS_11940 gene rplT 1576 1932 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP74 protein_id gnl|my_center|LOCUS_11940 >Feature sequence552 <1 1740 gene locus_tag LOCUS_11950 <1 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327079.1:transporter <2398 1769 gene locus_tag LOCUS_11960 <2398 1769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120182.1:NADH-dependent dehydrogenase >Feature sequence553 2060 1131 gene locus_tag LOCUS_11970 2060 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence554 >Feature sequence555 59 925 gene locus_tag LOCUS_11980 59 925 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_11980 1886 951 gene locus_tag LOCUS_11990 1886 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122454.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence556 27 1598 gene locus_tag LOCUS_12000 27 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence557 <2385 201 gene locus_tag LOCUS_12010 <2385 201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92TS8:putative ribose/galactose/methyl galactoside import ATP-binding protein 2 >Feature sequence558 2199 982 gene locus_tag LOCUS_12020 2199 982 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence559 >Feature sequence560 144 1166 gene locus_tag LOCUS_12030 144 1166 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084113.1 protein_id gnl|my_center|LOCUS_12030 1175 2074 gene locus_tag LOCUS_12040 gene rsmH 1175 2074 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFX8 protein_id gnl|my_center|LOCUS_12040 >Feature sequence561 187 1431 gene locus_tag LOCUS_12050 gene glyA 187 1431 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN2 protein_id gnl|my_center|LOCUS_12050 1497 1931 gene locus_tag LOCUS_12060 1497 1931 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence562 1503 2285 gene locus_tag LOCUS_12070 1503 2285 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118565.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence563 >Feature sequence564 136 855 gene locus_tag LOCUS_12080 136 855 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence565 468 1340 gene locus_tag LOCUS_12090 468 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1900 1436 gene locus_tag LOCUS_12100 1900 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence566 1190 936 gene locus_tag LOCUS_12110 1190 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_12110 1354 1743 gene locus_tag LOCUS_12120 1354 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1946 2260 gene locus_tag LOCUS_12130 gene glnB 1946 2260 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327966.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence567 >Feature sequence568 <1 796 gene locus_tag LOCUS_12140 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119332.1:RNA-binding protein >Feature sequence569 >Feature sequence570 258 1271 gene locus_tag LOCUS_12150 258 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1383 1652 gene locus_tag LOCUS_12160 1383 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2122 1715 gene locus_tag LOCUS_12170 2122 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence571 278 1480 gene locus_tag LOCUS_12180 gene argD 278 1480 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_12180 >Feature sequence572 1374 262 gene locus_tag LOCUS_12190 1374 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence573 135 413 gene locus_tag LOCUS_12200 135 413 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_12200 1092 517 gene locus_tag LOCUS_12210 1092 517 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_12210 1911 1132 gene locus_tag LOCUS_12220 1911 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence574 254 1678 gene locus_tag LOCUS_12230 254 1678 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence575 23 1363 gene locus_tag LOCUS_12240 23 1363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119153.1 protein_id gnl|my_center|LOCUS_12240 <2331 1360 gene locus_tag LOCUS_12250 <2331 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120406.1:oxidoreductase >Feature sequence576 >Feature sequence577 1343 1924 gene locus_tag LOCUS_12260 1343 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence578 875 800 gene locus_tag LOCUS_t00150 875 800 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2088 895 gene locus_tag LOCUS_12270 gene tuf 2088 895 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_12270 >Feature sequence579 <2317 891 gene locus_tag LOCUS_12280 <2317 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence580 >Feature sequence581 >Feature sequence582 785 1981 gene locus_tag LOCUS_12290 785 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence583 >Feature sequence584 <1 1304 gene locus_tag LOCUS_12300 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533356.1:amidohydrolase >Feature sequence585 971 33 gene locus_tag LOCUS_12310 gene ubiA 971 33 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_12310 1628 981 gene locus_tag LOCUS_12320 gene ubiX 1628 981 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA7 protein_id gnl|my_center|LOCUS_12320 <2307 1621 gene locus_tag LOCUS_12330 <2307 1621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59912:demethylmenaquinone methyltransferase >Feature sequence586 1574 444 gene locus_tag LOCUS_12340 1574 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence587 >Feature sequence588 1580 333 gene locus_tag LOCUS_12350 1580 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123786.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence589 1820 582 gene locus_tag LOCUS_12360 1820 582 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123398.1 protein_id gnl|my_center|LOCUS_12360 2297 2058 gene locus_tag LOCUS_12370 2297 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence590 1428 757 gene locus_tag LOCUS_12380 1428 757 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence591 1431 334 gene locus_tag LOCUS_12390 1431 334 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_12390 <2297 1458 gene locus_tag LOCUS_12400 <2297 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122980.1:CAAX protease family protein >Feature sequence592 1524 34 gene locus_tag LOCUS_12410 1524 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence593 151 699 gene locus_tag LOCUS_12420 gene sigW 151 699 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_12420 1461 736 gene locus_tag LOCUS_12430 1461 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12430 1811 2029 gene locus_tag LOCUS_12440 1811 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence594 105 344 gene locus_tag LOCUS_12450 105 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1745 366 gene locus_tag LOCUS_12460 gene pepC1 1745 366 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101072.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence595 420 1667 gene locus_tag LOCUS_12470 420 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence596 >Feature sequence597 1842 478 gene locus_tag LOCUS_12480 1842 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence598 108 482 gene locus_tag LOCUS_12490 108 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1149 460 gene locus_tag LOCUS_12500 1149 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 <2278 1180 gene locus_tag LOCUS_12510 <2278 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UM14:tyrosine--tRNA ligase >Feature sequence599 1038 88 gene locus_tag LOCUS_12520 1038 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence600 1267 524 gene locus_tag LOCUS_12530 gene pyrH 1267 524 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH1 protein_id gnl|my_center|LOCUS_12530 2221 1367 gene locus_tag LOCUS_12540 gene tsf 2221 1367 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88VJ5 protein_id gnl|my_center|LOCUS_12540 >Feature sequence601 507 310 gene locus_tag LOCUS_12550 507 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1267 599 gene locus_tag LOCUS_12560 1267 599 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122734.1 protein_id gnl|my_center|LOCUS_12560 2265 1282 gene locus_tag LOCUS_12570 2265 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence602 978 331 gene locus_tag LOCUS_12580 gene rsmG 978 331 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMW0 protein_id gnl|my_center|LOCUS_12580 1416 1856 gene locus_tag LOCUS_12590 1416 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence603 2076 1795 gene locus_tag LOCUS_12600 2076 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence604 1516 215 gene locus_tag LOCUS_12610 1516 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence605 1338 427 gene locus_tag LOCUS_12620 gene degP 1338 427 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121356.1 protein_id gnl|my_center|LOCUS_12620 <2261 1469 gene locus_tag LOCUS_12630 <2261 1469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121355.1:serine protease >Feature sequence606 2107 1370 gene locus_tag LOCUS_12640 2107 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence607 <1 970 gene locus_tag LOCUS_12650 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120896.1:PKR inhibitor (translation regulation) 1019 1579 gene locus_tag LOCUS_12660 1019 1579 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_12660 1611 1973 gene locus_tag LOCUS_12670 1611 1973 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USG1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence608 <1 1196 gene locus_tag LOCUS_12680 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase >Feature sequence609 <2255 380 gene locus_tag LOCUS_12690 <2255 380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122380.1:S-layer protein >Feature sequence610 2127 94 gene locus_tag LOCUS_12700 2127 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence611 543 2210 gene locus_tag LOCUS_12710 543 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence612 1599 547 gene locus_tag LOCUS_12720 1599 547 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence613 >Feature sequence614 >Feature sequence615 396 950 gene locus_tag LOCUS_12730 396 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 963 1163 gene locus_tag LOCUS_12740 963 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1174 2046 gene locus_tag LOCUS_12750 gene thiG 1174 2046 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US84 protein_id gnl|my_center|LOCUS_12750 >Feature sequence616 >Feature sequence617 >Feature sequence618 <1 794 gene locus_tag LOCUS_12760 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328924.1:ribonuclease E 1009 1320 gene locus_tag LOCUS_12770 gene rplU 1009 1320 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFG2 protein_id gnl|my_center|LOCUS_12770 >Feature sequence619 >Feature sequence620 >Feature sequence621 <1 1768 gene locus_tag LOCUS_12780 <1 1768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWI5:protein translocase subunit SecA 2 >Feature sequence622 <1 1049 gene locus_tag LOCUS_12790 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120799.1:choline-sulfatase >Feature sequence623 286 489 gene locus_tag LOCUS_12800 286 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 776 1123 gene locus_tag LOCUS_12810 776 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 <2229 1410 gene locus_tag LOCUS_12820 <2229 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGU7:ammonium transporter >Feature sequence624 579 1562 gene locus_tag LOCUS_12830 gene ispE 579 1562 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8YAE1 protein_id gnl|my_center|LOCUS_12830 1665 2228 gene locus_tag LOCUS_12840 1665 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence625 832 5 gene locus_tag LOCUS_12850 832 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2165 840 gene locus_tag LOCUS_12860 2165 840 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence626 716 1156 gene locus_tag LOCUS_12870 716 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence627 <1 1230 gene locus_tag LOCUS_12880 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007339602.1:membrane protein 1329 2156 gene locus_tag LOCUS_12890 1329 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence628 1903 482 gene locus_tag LOCUS_12900 1903 482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_12900 2132 2059 gene locus_tag LOCUS_t00160 2132 2059 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence629 1372 476 gene locus_tag LOCUS_12910 1372 476 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence630 1606 98 gene locus_tag LOCUS_12920 gene htrA 1606 98 CDS product putative periplasmic serine endoprotease DegP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18584 protein_id gnl|my_center|LOCUS_12920 >Feature sequence631 >Feature sequence632 >Feature sequence633 >Feature sequence634 843 1334 gene locus_tag LOCUS_12930 843 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1819 1688 gene locus_tag LOCUS_12940 1819 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence635 88 1566 gene locus_tag LOCUS_12950 88 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_12950 2042 1563 gene locus_tag LOCUS_12960 2042 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence636 >Feature sequence637 2177 1014 gene locus_tag LOCUS_12970 2177 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence638 >Feature sequence639 >Feature sequence640 >Feature sequence641 3 278 gene locus_tag LOCUS_12980 3 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 418 1767 gene locus_tag LOCUS_12990 gene mgtE 418 1767 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN8 protein_id gnl|my_center|LOCUS_12990 >Feature sequence642 174 1775 gene locus_tag LOCUS_13000 gene nadB 174 1775 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTK8 protein_id gnl|my_center|LOCUS_13000 >Feature sequence643 <1 1359 gene locus_tag LOCUS_13010 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121692.1:helicase >Feature sequence644 1312 266 gene locus_tag LOCUS_13020 gene queA 1312 266 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGI9 protein_id gnl|my_center|LOCUS_13020 >Feature sequence645 <1 1220 gene locus_tag LOCUS_13030 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228370.1:RND transporter >Feature sequence646 1374 322 gene locus_tag LOCUS_13040 1374 322 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence647 1783 311 gene locus_tag LOCUS_13050 1783 311 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence648 >Feature sequence649 2073 580 gene locus_tag LOCUS_13060 2073 580 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120429.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence650 >Feature sequence651 691 1812 gene locus_tag LOCUS_13070 691 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence652 <1 1130 gene locus_tag LOCUS_13080 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120685.1:squalene--hopene cyclase >Feature sequence653 <1 1210 gene locus_tag LOCUS_13090 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332450.1:citramalate synthase >Feature sequence654 1354 530 gene locus_tag LOCUS_13100 1354 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence655 834 424 gene locus_tag LOCUS_13110 834 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1590 1042 gene locus_tag LOCUS_13120 1590 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence656 39 1016 gene locus_tag LOCUS_13130 39 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence657 >Feature sequence658 396 824 gene locus_tag LOCUS_13140 gene aroH 396 824 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121986.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence659 >Feature sequence660 >Feature sequence661 906 1085 gene locus_tag LOCUS_13150 906 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 <2131 1109 gene locus_tag LOCUS_13160 <2131 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ND11:S-(hydroxymethyl)glutathione dehydrogenase >Feature sequence662 >Feature sequence663 1213 521 gene locus_tag LOCUS_13170 gene rpe 1213 521 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX51 protein_id gnl|my_center|LOCUS_13170 >Feature sequence664 >Feature sequence665 >Feature sequence666 >Feature sequence667 1 741 gene locus_tag LOCUS_13180 1 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1769 738 gene locus_tag LOCUS_13190 1769 738 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence668 551 1474 gene locus_tag LOCUS_13200 551 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2115 1471 gene locus_tag LOCUS_13210 2115 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence669 318 1232 gene locus_tag LOCUS_13220 318 1232 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036050.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence670 >Feature sequence671 1437 964 gene locus_tag LOCUS_13230 1437 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 <2111 1461 gene locus_tag LOCUS_13240 <2111 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGJ6:carbamoyl-phosphate synthase small chain >Feature sequence672 184 1407 gene locus_tag LOCUS_13250 184 1407 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337844.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence673 >Feature sequence674 335 1669 gene locus_tag LOCUS_13260 335 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence675 2000 594 gene locus_tag LOCUS_13270 2000 594 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence676 >Feature sequence677 456 2030 gene locus_tag LOCUS_13280 456 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence678 <2095 1431 gene locus_tag LOCUS_13290 <2095 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877529.1:proline permease >Feature sequence679 >Feature sequence680 >Feature sequence681 <1 1208 gene locus_tag LOCUS_13300 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123940.1:peptide-binding protein >Feature sequence682 97 1290 gene locus_tag LOCUS_13310 97 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence683 335 1180 gene locus_tag LOCUS_13320 335 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_13320 1560 1258 gene locus_tag LOCUS_13330 gene rpsT 1560 1258 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPC9 protein_id gnl|my_center|LOCUS_13330 >Feature sequence684 1800 874 gene locus_tag LOCUS_13340 1800 874 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974906.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence685 >Feature sequence686 76 1278 gene locus_tag LOCUS_13350 76 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1840 1235 gene locus_tag LOCUS_13360 1840 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence687 389 1648 gene locus_tag LOCUS_13370 389 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence688 <2075 259 gene locus_tag LOCUS_13380 <2075 259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085059.1:sugar ABC transporter permease >Feature sequence689 1402 128 gene locus_tag LOCUS_13390 1402 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 <2074 1479 gene locus_tag LOCUS_13400 <2074 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324798.1:fatty acid desaturase >Feature sequence690 >Feature sequence691 >Feature sequence692 1031 1345 gene locus_tag LOCUS_13410 1031 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2068 1370 gene locus_tag LOCUS_13420 2068 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence693 <1 532 gene locus_tag LOCUS_13430 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414579.1:glutamine synthetase 608 1273 gene locus_tag LOCUS_13440 608 1273 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence694 1062 73 gene locus_tag LOCUS_13450 1062 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence695 259 675 gene locus_tag LOCUS_13460 259 675 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337214.1 protein_id gnl|my_center|LOCUS_13460 1472 696 gene locus_tag LOCUS_13470 gene pfaS 1472 696 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_13470 <2068 1518 gene locus_tag LOCUS_13480 <2068 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URX8:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence696 1597 1007 gene locus_tag LOCUS_13490 1597 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence697 >Feature sequence698 >Feature sequence699 <1 1280 gene locus_tag LOCUS_13500 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105377.1:MFS transporter <2056 1270 gene locus_tag LOCUS_13510 <2056 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528753.1:amidohydrolase >Feature sequence700 >Feature sequence701 2055 274 gene locus_tag LOCUS_13520 2055 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence702 1760 810 gene locus_tag LOCUS_13530 1760 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence703 >Feature sequence704 >Feature sequence705 >Feature sequence706 319 798 gene locus_tag LOCUS_13540 319 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 919 1926 gene locus_tag LOCUS_13550 gene argC 919 1926 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVL4 protein_id gnl|my_center|LOCUS_13550 >Feature sequence707 <2046 352 gene locus_tag LOCUS_13560 <2046 352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97G70:pyruvate-flavodoxin oxidoreductase >Feature sequence708 609 1286 gene locus_tag LOCUS_13570 609 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 <2046 1326 gene locus_tag LOCUS_13580 <2046 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118121.1:sulfatase 1 precursor >Feature sequence709 <1 680 gene locus_tag LOCUS_13590 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UYY3:malonyl CoA-acyl carrier protein transacylase 783 1538 gene locus_tag LOCUS_13600 gene fabG 783 1538 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_13600 1774 2007 gene locus_tag LOCUS_13610 gene acpP 1774 2007 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY2 protein_id gnl|my_center|LOCUS_13610 >Feature sequence710 321 112 gene locus_tag LOCUS_13620 321 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324730.1 protein_id gnl|my_center|LOCUS_13620 <2041 484 gene locus_tag LOCUS_13630 <2041 484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117884.1:fatty acyl-AMP ligase >Feature sequence711 875 597 gene locus_tag LOCUS_13640 875 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1486 881 gene locus_tag LOCUS_13650 1486 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1743 1483 gene locus_tag LOCUS_13660 1743 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence712 234 1547 gene locus_tag LOCUS_13670 234 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence713 568 1197 gene locus_tag LOCUS_13680 gene cnrH 568 1197 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122499.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence714 <1 872 gene locus_tag LOCUS_13690 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121802.1:glycosyl transferase family 1 1014 1895 gene locus_tag LOCUS_13700 1014 1895 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121801.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence715 488 1027 gene locus_tag LOCUS_13710 gene dfp 488 1027 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence716 1772 381 gene locus_tag LOCUS_13720 1772 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence717 <1 917 gene locus_tag LOCUS_13730 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122824.1:gluconate permease 969 1928 gene locus_tag LOCUS_13740 969 1928 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122861.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence718 323 928 gene locus_tag LOCUS_13750 323 928 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGM3 protein_id gnl|my_center|LOCUS_13750 1424 948 gene locus_tag LOCUS_13760 1424 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1835 1506 gene locus_tag LOCUS_13770 1835 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence719 903 88 gene locus_tag LOCUS_13780 903 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1617 964 gene locus_tag LOCUS_13790 1617 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence720 208 1020 gene locus_tag LOCUS_13800 208 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence721 685 17 gene locus_tag LOCUS_13810 685 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1083 1394 gene locus_tag LOCUS_13820 1083 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 <2015 1499 gene locus_tag LOCUS_13830 <2015 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978498.1:GTP-binding protein >Feature sequence722 >Feature sequence723 >Feature sequence724 700 1872 gene locus_tag LOCUS_13840 700 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence725 1763 894 gene locus_tag LOCUS_13850 1763 894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence726 >Feature sequence727 1932 877 gene locus_tag LOCUS_13860 1932 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121174.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence728 3 686 gene locus_tag LOCUS_13870 3 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 679 1791 gene locus_tag LOCUS_13880 gene pstA 679 1791 CDS product phosphate ABC transporter, permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020933.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence729 <1988 418 gene locus_tag LOCUS_13890 <1988 418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URK7:UvrABC system protein A >Feature sequence730 <1987 369 gene locus_tag LOCUS_13900 <1987 369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121144.1:membrane protein >Feature sequence731 1861 974 gene locus_tag LOCUS_13910 gene gtaB 1861 974 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6J3 protein_id gnl|my_center|LOCUS_13910 >Feature sequence732 1049 964 gene locus_tag LOCUS_t00170 1049 964 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <1986 1173 gene locus_tag LOCUS_13920 <1986 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121362.1:xylose isomerase >Feature sequence733 36 1478 gene locus_tag LOCUS_13930 36 1478 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123172.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence734 3 341 gene locus_tag LOCUS_13940 3 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence735 351 1163 gene locus_tag LOCUS_13950 gene lolI 351 1163 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_13950 <1975 1264 gene locus_tag LOCUS_13960 <1975 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118411.1:general secretion pathway protein GspG >Feature sequence736 1283 867 gene locus_tag LOCUS_13970 1283 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1853 1341 gene locus_tag LOCUS_13980 1853 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence737 >Feature sequence738 >Feature sequence739 1530 952 gene locus_tag LOCUS_13990 1530 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence740 364 1794 gene locus_tag LOCUS_14000 gene miaB 364 1794 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULM9 protein_id gnl|my_center|LOCUS_14000 >Feature sequence741 1379 489 gene locus_tag LOCUS_14010 1379 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence742 998 336 gene locus_tag LOCUS_14020 998 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence743 516 680 gene locus_tag LOCUS_14030 516 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1922 636 gene locus_tag LOCUS_14040 1922 636 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence744 >Feature sequence745 >Feature sequence746 985 149 gene locus_tag LOCUS_14050 gene phnX 985 149 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81G82 protein_id gnl|my_center|LOCUS_14050 <1952 990 gene locus_tag LOCUS_14060 <1952 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120646.1:oxidase >Feature sequence747 986 1678 gene locus_tag LOCUS_14070 986 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence748 545 1600 gene locus_tag LOCUS_14080 545 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1948 1601 gene locus_tag LOCUS_14090 1948 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence749 <1 526 gene locus_tag LOCUS_14100 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UXN7:elongation factor P 529 1467 gene locus_tag LOCUS_14110 gene epmA 529 1467 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFS7 protein_id gnl|my_center|LOCUS_14110 >Feature sequence750 <1946 144 gene locus_tag LOCUS_14120 <1946 144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122783.1:hemolysin D >Feature sequence751 1351 653 gene locus_tag LOCUS_14130 1351 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence752 >Feature sequence753 <1 797 gene locus_tag LOCUS_14140 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968809.1:2-hydroxy-acid oxidase >Feature sequence754 <1937 41 gene locus_tag LOCUS_14150 <1937 41 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7US04:DNA helicase >Feature sequence755 26 190 gene locus_tag LOCUS_14160 gene rpmG 26 190 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMN0 protein_id gnl|my_center|LOCUS_14160 >Feature sequence756 >Feature sequence757 780 145 gene locus_tag LOCUS_14170 gene rplY 780 145 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU9 protein_id gnl|my_center|LOCUS_14170 1333 1016 gene locus_tag LOCUS_14180 gene groS 1333 1016 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU13 protein_id gnl|my_center|LOCUS_14180 <1933 1402 gene locus_tag LOCUS_14190 <1933 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPM4:ribose-phosphate pyrophosphokinase >Feature sequence758 1138 965 gene locus_tag LOCUS_14200 1138 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence759 1428 619 gene locus_tag LOCUS_14210 1428 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence760 646 302 gene locus_tag LOCUS_14220 646 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence761 1714 779 gene locus_tag LOCUS_14230 1714 779 CDS product protein BmrU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120987.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence762 >Feature sequence763 >Feature sequence764 941 1687 gene locus_tag LOCUS_14240 941 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence765 >Feature sequence766 1220 177 gene locus_tag LOCUS_14250 1220 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1916 1407 gene locus_tag LOCUS_14260 1916 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence767 1473 784 gene locus_tag LOCUS_14270 1473 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence768 >Feature sequence769 288 1322 gene locus_tag LOCUS_14280 288 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence770 <1 1623 gene locus_tag LOCUS_14290 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404400.1:amidase >Feature sequence771 >Feature sequence772 >Feature sequence773 281 1048 gene locus_tag LOCUS_14300 gene fabG 281 1048 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence774 >Feature sequence775 >Feature sequence776 1569 118 gene locus_tag LOCUS_14310 1569 118 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence777 373 1278 gene locus_tag LOCUS_14320 373 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530905.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence778 <1899 1022 gene locus_tag LOCUS_14330 <1899 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWS0:Na(+)-translocating NADH-quinone reductase subunit F >Feature sequence779 >Feature sequence780 >Feature sequence781 <1896 627 gene locus_tag LOCUS_14340 <1896 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121377.1:peptidase S41 >Feature sequence782 309 911 gene locus_tag LOCUS_14350 309 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14350 930 1262 gene locus_tag LOCUS_14360 930 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14360 >Feature sequence783 653 1324 gene locus_tag LOCUS_14370 653 1324 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence784 <1894 596 gene locus_tag LOCUS_14380 <1894 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122380.1:S-layer protein >Feature sequence785 >Feature sequence786 405 1448 gene locus_tag LOCUS_14390 405 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267192.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence787 >Feature sequence788 473 1525 gene locus_tag LOCUS_14400 473 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence789 682 1737 gene locus_tag LOCUS_14410 682 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence790 <1 1158 gene locus_tag LOCUS_14420 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392815.1:dihydroorotase 1215 1535 gene locus_tag LOCUS_14430 1215 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence791 >Feature sequence792 1122 313 gene locus_tag LOCUS_14440 gene fabG 1122 313 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122369.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence793 >Feature sequence794 >Feature sequence795 <1 550 gene locus_tag LOCUS_14450 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQJ2:UPF0365 protein 620 1444 gene locus_tag LOCUS_14460 620 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence796 <1 1842 gene locus_tag LOCUS_14470 <1 1842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118726.1:vegetatible incompatibility protein HET-E-1 >Feature sequence797 3 1166 gene locus_tag LOCUS_14480 gene rho 3 1166 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMK2 protein_id gnl|my_center|LOCUS_14480 1226 1310 gene locus_tag LOCUS_t00180 1226 1310 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1784 1314 gene locus_tag LOCUS_14490 1784 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence798 >Feature sequence799 1175 537 gene locus_tag LOCUS_14500 1175 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118676.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence800 1191 262 gene locus_tag LOCUS_14510 1191 262 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337243.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence801 1121 390 gene locus_tag LOCUS_14520 1121 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence802 76 363 gene locus_tag LOCUS_14530 76 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 406 1269 gene locus_tag LOCUS_14540 gene ilvE 406 1269 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence803 <1 1057 gene locus_tag LOCUS_14550 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119333.1:RNA-binding protein note possible pseudo, internal stop codon >Feature sequence804 1846 1145 gene locus_tag LOCUS_14560 1846 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence805 571 1173 gene locus_tag LOCUS_14570 571 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence806 >Feature sequence807 <1 743 gene locus_tag LOCUS_14580 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328259.1:RNA polymerase subunit alpha domain protein >Feature sequence808 1575 1054 gene locus_tag LOCUS_14590 1575 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14590 >Feature sequence809 >Feature sequence810 >Feature sequence811 661 185 gene locus_tag LOCUS_14600 661 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence812 1274 474 gene locus_tag LOCUS_14610 1274 474 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_14610 <1835 1293 gene locus_tag LOCUS_14620 <1835 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNN9:bifunctional protein FolD >Feature sequence813 >Feature sequence814 >Feature sequence815 >Feature sequence816 <1 1783 gene locus_tag LOCUS_14630 <1 1783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192277.1:NAD(+) synthase >Feature sequence817 1174 320 gene locus_tag LOCUS_14640 1174 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14640 <1825 1251 gene locus_tag LOCUS_14650 <1825 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933426.1:3-oxoacyl-ACP reductase >Feature sequence818 >Feature sequence819 95 1513 gene locus_tag LOCUS_14660 95 1513 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence820 >Feature sequence821 >Feature sequence822 >Feature sequence823 1812 1564 gene locus_tag LOCUS_14670 1812 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence824 <1814 631 gene locus_tag LOCUS_14680 <1814 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173900.1:CoA transferase >Feature sequence825 >Feature sequence826 <1810 559 gene locus_tag LOCUS_14690 <1810 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence827 >Feature sequence828 1610 1185 gene locus_tag LOCUS_14700 1610 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence829 >Feature sequence830 803 312 gene locus_tag LOCUS_14710 803 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1351 893 gene locus_tag LOCUS_14720 1351 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence831 <1794 364 gene locus_tag LOCUS_14730 <1794 364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117969.1:cytochrome c >Feature sequence832 >Feature sequence833 <1793 636 gene locus_tag LOCUS_14740 <1793 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048068.1:alginate O-acetyltransferase >Feature sequence834 <1793 1027 gene locus_tag LOCUS_14750 <1793 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:surface protein >Feature sequence835 207 1139 gene locus_tag LOCUS_14760 207 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence836 >Feature sequence837 395 1225 gene locus_tag LOCUS_14770 395 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence838 1333 383 gene locus_tag LOCUS_14780 1333 383 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence839 <1 862 gene locus_tag LOCUS_14790 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330518.1:glutamate synthase subunit beta >Feature sequence840 <1783 1244 gene locus_tag LOCUS_14800 <1783 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122080.1:D-amino-acid oxidase >Feature sequence841 >Feature sequence842 <1 717 gene locus_tag LOCUS_14810 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086579.1:demethylmenaquinone methyltransferase >Feature sequence843 >Feature sequence844 >Feature sequence845 63 1049 gene locus_tag LOCUS_14820 63 1049 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_14820 1052 1288 gene locus_tag LOCUS_14830 1052 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence846 <1 808 gene locus_tag LOCUS_14840 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390362.1:universal stress protein UspA >Feature sequence847 >Feature sequence848 >Feature sequence849 >Feature sequence850 <1 956 gene locus_tag LOCUS_14850 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CT9:adenosylmethionine-8-amino-7-oxononanoate aminotransferase >Feature sequence851 <1769 851 gene locus_tag LOCUS_14860 <1769 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120364.1:dihydrodipicolinate synthase family protein >Feature sequence852 318 1622 gene locus_tag LOCUS_14870 318 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence853 1586 735 gene locus_tag LOCUS_14880 1586 735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120863.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence854 <1 1037 gene locus_tag LOCUS_14890 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0C7J0:dTDP-glucose 4,6-dehydratase >Feature sequence855 510 1013 gene locus_tag LOCUS_14900 510 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1183 1734 gene locus_tag LOCUS_14910 1183 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence856 290 1072 gene locus_tag LOCUS_14920 290 1072 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence857 >Feature sequence858 1049 204 gene locus_tag LOCUS_14930 1049 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14930 1313 1666 gene locus_tag LOCUS_14940 1313 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence859 >Feature sequence860 >Feature sequence861 >Feature sequence862 1755 706 gene locus_tag LOCUS_14950 1755 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence863 <1757 694 gene locus_tag LOCUS_14960 <1757 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335012.1:dehydrogenase >Feature sequence864 <1 831 gene locus_tag LOCUS_14970 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031395.1:membrane protein 926 1534 gene locus_tag LOCUS_14980 926 1534 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence865 <1 1730 gene locus_tag LOCUS_14990 <1 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:acriflavine resistance protein B >Feature sequence866 138 407 gene locus_tag LOCUS_15000 gene rpsO 138 407 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR97 protein_id gnl|my_center|LOCUS_15000 >Feature sequence867 >Feature sequence868 <1739 438 gene locus_tag LOCUS_15010 <1739 438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388138.1:gamma-glutamyltransferase >Feature sequence869 <1738 573 gene locus_tag LOCUS_15020 <1738 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119349.1:calcium sensor EFh >Feature sequence870 <1 1174 gene locus_tag LOCUS_15030 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z8C5:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence871 <1738 225 gene locus_tag LOCUS_15040 <1738 225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFZ2:membrane protein insertase YidC >Feature sequence872 311 1216 gene locus_tag LOCUS_15050 311 1216 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence873 1522 800 gene locus_tag LOCUS_15060 gene rph 1522 800 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URE2 protein_id gnl|my_center|LOCUS_15060 >Feature sequence874 >Feature sequence875 >Feature sequence876 >Feature sequence877 <1 1019 gene locus_tag LOCUS_15070 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:PAS domain-containing sensor histidine kinase 1699 1061 gene locus_tag LOCUS_15080 1699 1061 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence878 1189 1623 gene locus_tag LOCUS_15090 1189 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence879 >Feature sequence880 313 1203 gene locus_tag LOCUS_15100 313 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117736.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence881 >Feature sequence882 1611 1075 gene locus_tag LOCUS_15110 1611 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence883 516 1139 gene locus_tag LOCUS_15120 516 1139 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121754.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence884 3 485 gene locus_tag LOCUS_15130 3 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence885 <1 1548 gene locus_tag LOCUS_15140 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P15005:5-methylcytosine-specific restriction enzyme B >Feature sequence886 286 546 gene locus_tag LOCUS_15150 286 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence887 1266 1 gene locus_tag LOCUS_15160 1266 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence888 >Feature sequence889 207 1700 gene locus_tag LOCUS_15170 207 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124058.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence890 >Feature sequence891 <1708 475 gene locus_tag LOCUS_15180 <1708 475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S008:phosphoenolpyruvate carboxykinase [ATP] 2 >Feature sequence892 303 1592 gene locus_tag LOCUS_15190 303 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence893 1307 792 gene locus_tag LOCUS_15200 gene moaB 1307 792 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34457 protein_id gnl|my_center|LOCUS_15200 >Feature sequence894 >Feature sequence895 893 12 gene locus_tag LOCUS_15210 893 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120295.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence896 >Feature sequence897 949 224 gene locus_tag LOCUS_15220 949 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 <1698 1064 gene locus_tag LOCUS_15230 <1698 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122010.1:oxidoreductase >Feature sequence898 252 1481 gene locus_tag LOCUS_15240 252 1481 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence899 1079 105 gene locus_tag LOCUS_15250 gene pmi 1079 105 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence900 >Feature sequence901 >Feature sequence902 1048 818 gene locus_tag LOCUS_15260 gene rpmE 1048 818 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT4 protein_id gnl|my_center|LOCUS_15260 >Feature sequence903 >Feature sequence904 884 1219 gene locus_tag LOCUS_15270 884 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence905 577 1245 gene locus_tag LOCUS_15280 577 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence906 <1 1009 gene locus_tag LOCUS_15290 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_232332.2:sodium/solute symporter 1022 1168 gene locus_tag LOCUS_15300 1022 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence907 >Feature sequence908 >Feature sequence909 <1684 491 gene locus_tag LOCUS_15310 <1684 491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118172.1:O-linked GlcNAc transferase >Feature sequence910 41 469 gene locus_tag LOCUS_15320 41 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence911 >Feature sequence912 >Feature sequence913 1141 368 gene locus_tag LOCUS_15330 1141 368 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence914 <1670 219 gene locus_tag LOCUS_15340 <1670 219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229603.1:acetolactate synthase I/II/III large subunit >Feature sequence915 <1668 1082 gene locus_tag LOCUS_15350 <1668 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964215.1:RND transporter >Feature sequence916 1583 459 gene locus_tag LOCUS_15360 1583 459 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence917 >Feature sequence918 <1 1056 gene locus_tag LOCUS_15370 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085104.1:NADH-quinone oxidoreductase subunit F >Feature sequence919 1232 363 gene locus_tag LOCUS_15380 gene metF 1232 363 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNJ7 protein_id gnl|my_center|LOCUS_15380 >Feature sequence920 >Feature sequence921 <1651 1110 gene locus_tag LOCUS_15390 <1651 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120962.1:cytochrome c >Feature sequence922 560 634 gene locus_tag LOCUS_t00190 560 634 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 865 677 gene locus_tag LOCUS_15400 865 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence923 >Feature sequence924 <1 680 gene locus_tag LOCUS_15410 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120272.1:serine acetyltransferase <1637 765 gene locus_tag LOCUS_15420 <1637 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546422.1:elongation factor G >Feature sequence925 >Feature sequence926 <1 1519 gene locus_tag LOCUS_15430 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120518.1:metalloprotease >Feature sequence927 217 546 gene locus_tag LOCUS_15440 217 546 CDS product ATP-dependent Clp protease ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence928 301 957 gene locus_tag LOCUS_15450 301 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15450 >Feature sequence929 998 489 gene locus_tag LOCUS_15460 gene purE 998 489 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZY2 protein_id gnl|my_center|LOCUS_15460 >Feature sequence930 211 675 gene locus_tag LOCUS_15470 gene accB 211 675 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121914.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence931 <1 645 gene locus_tag LOCUS_15480 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ULU1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase 683 1090 gene locus_tag LOCUS_15490 683 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence932 >Feature sequence933 >Feature sequence934 599 931 gene locus_tag LOCUS_15500 599 931 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence935 <1620 326 gene locus_tag LOCUS_15510 <1620 326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121094.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence936 >Feature sequence937 >Feature sequence938 <1617 99 gene locus_tag LOCUS_15520 <1617 99 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117992.1:arylsulfatase >Feature sequence939 >Feature sequence940 249 935 gene locus_tag LOCUS_15530 249 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence941 <1 751 gene locus_tag LOCUS_15540 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120944.1:coproporphyrinogen III oxidase 748 1221 gene locus_tag LOCUS_15550 gene gcvH 748 1221 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121110.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence942 65 1333 gene locus_tag LOCUS_15560 65 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1499 1425 gene locus_tag LOCUS_t00200 1499 1425 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence943 2 265 gene locus_tag LOCUS_15570 2 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 <1613 389 gene locus_tag LOCUS_15580 <1613 389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120737.1:sulfatase >Feature sequence944 <1 646 gene locus_tag LOCUS_15590 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIR2:enolase >Feature sequence945 81 1406 gene locus_tag LOCUS_15600 81 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence946 >Feature sequence947 69 194 gene locus_tag LOCUS_15610 69 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 252 1568 gene locus_tag LOCUS_15620 252 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence948 <1 706 gene locus_tag LOCUS_15630 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011100883.1:lactate racemization operon protein LarA 1554 715 gene locus_tag LOCUS_15640 1554 715 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122511.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence949 563 1297 gene locus_tag LOCUS_15650 563 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence950 <1 1256 gene locus_tag LOCUS_15660 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122629.1:protein up-regulated by thyroid hormone- PQQ-dependent glucose dehydrogenase >Feature sequence951 377 1213 gene locus_tag LOCUS_15670 377 1213 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122686.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence952 277 1329 gene locus_tag LOCUS_15680 277 1329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120248.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence953 <1 1397 gene locus_tag LOCUS_15690 <1 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121805.1:flagellar biosynthesis protein FlhA >Feature sequence954 240 1592 gene locus_tag LOCUS_15700 240 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120254.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence955 >Feature sequence956 <1 645 gene locus_tag LOCUS_15710 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JNR7:1-deoxy-D-xylulose-5-phosphate synthase 691 1503 gene locus_tag LOCUS_15720 gene folE2 691 1503 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JF5 protein_id gnl|my_center|LOCUS_15720 >Feature sequence957 1536 529 gene locus_tag LOCUS_15730 1536 529 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence958 >Feature sequence959 >Feature sequence960 <1584 653 gene locus_tag LOCUS_15740 <1584 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326269.1:general secretion pathway protein GspE >Feature sequence961 >Feature sequence962 1260 643 gene locus_tag LOCUS_15750 gene lspA 1260 643 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF32 protein_id gnl|my_center|LOCUS_15750 >Feature sequence963 >Feature sequence964 >Feature sequence965 >Feature sequence966 >Feature sequence967 1290 382 gene locus_tag LOCUS_15760 1290 382 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529475.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence968 >Feature sequence969 >Feature sequence970 1277 543 gene locus_tag LOCUS_15770 1277 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1515 1291 gene locus_tag LOCUS_15780 1515 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence971 1543 1253 gene locus_tag LOCUS_15790 1543 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence972 <1 583 gene locus_tag LOCUS_15800 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121146.1:cytochrome c554 1356 601 gene locus_tag LOCUS_15810 1356 601 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2P4 protein_id gnl|my_center|LOCUS_15810 >Feature sequence973 >Feature sequence974 >Feature sequence975 <1528 894 gene locus_tag LOCUS_15820 <1528 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120810.1:epoxyqueuosine reductase >Feature sequence976 120 1058 gene locus_tag LOCUS_15830 120 1058 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_15830 1524 1252 gene locus_tag LOCUS_15840 1524 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15840 >Feature sequence977 634 1176 gene locus_tag LOCUS_15850 634 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence978 >Feature sequence979 >Feature sequence980 <1 750 gene locus_tag LOCUS_15860 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122565.1:ABC transporter ATP-binding protein >Feature sequence981 <1501 511 gene locus_tag LOCUS_15870 <1501 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122777.1:protoporphyrinogen oxidase