>Feature sequence001 44 853 gene locus_tag LOCUS_00010 44 853 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_00010 1056 1826 gene locus_tag LOCUS_00020 1056 1826 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_00020 1899 3248 gene locus_tag LOCUS_00030 gene pbrT 1899 3248 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122077.1 protein_id gnl|my_center|LOCUS_00030 3329 4156 gene locus_tag LOCUS_00040 gene ctaC 3329 4156 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL9 protein_id gnl|my_center|LOCUS_00040 4274 6106 gene locus_tag LOCUS_00050 gene ctaD 4274 6106 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM0 protein_id gnl|my_center|LOCUS_00050 6179 7219 gene locus_tag LOCUS_00060 6179 7219 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123498.1 protein_id gnl|my_center|LOCUS_00060 7216 8208 gene locus_tag LOCUS_00070 gene ctaB 7216 8208 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJF4 protein_id gnl|my_center|LOCUS_00070 8264 9205 gene locus_tag LOCUS_00080 8264 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9254 9784 gene locus_tag LOCUS_00090 9254 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9738 10445 gene locus_tag LOCUS_00100 9738 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10442 10930 gene locus_tag LOCUS_00110 10442 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10927 11256 gene locus_tag LOCUS_00120 10927 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11316 12656 gene locus_tag LOCUS_00130 11316 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12827 13771 gene locus_tag LOCUS_00140 gene mdh 12827 13771 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC6 protein_id gnl|my_center|LOCUS_00140 13941 14678 gene locus_tag LOCUS_00150 13941 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14745 15245 gene locus_tag LOCUS_00160 14745 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15292 16749 gene locus_tag LOCUS_00170 15292 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16788 17423 gene locus_tag LOCUS_00180 16788 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17423 18340 gene locus_tag LOCUS_00190 gene fliP 17423 18340 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXG5 protein_id gnl|my_center|LOCUS_00190 18411 18665 gene locus_tag LOCUS_00200 18411 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 18677 19543 gene locus_tag LOCUS_00210 18677 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19540 20250 gene locus_tag LOCUS_00220 19540 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21708 20257 gene locus_tag LOCUS_00230 gene purB 21708 20257 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFU0 protein_id gnl|my_center|LOCUS_00230 22832 21705 gene locus_tag LOCUS_00240 22832 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24809 23034 gene locus_tag LOCUS_00250 24809 23034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 25035 25337 gene locus_tag LOCUS_00260 25035 25337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25342 26631 gene locus_tag LOCUS_00270 gene clpX 25342 26631 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU7 protein_id gnl|my_center|LOCUS_00270 27766 26639 gene locus_tag LOCUS_00280 gene aspC 27766 26639 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG06 protein_id gnl|my_center|LOCUS_00280 28255 27773 gene locus_tag LOCUS_00290 28255 27773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 >Feature sequence002 1139 198 gene locus_tag LOCUS_00300 1139 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 1577 2188 gene locus_tag LOCUS_00310 gene sodA 1577 2188 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0F8 protein_id gnl|my_center|LOCUS_00310 3945 3604 gene locus_tag LOCUS_00320 3945 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_00320 4148 5095 gene locus_tag LOCUS_00330 4148 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 5211 5285 gene locus_tag LOCUS_t00010 5211 5285 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5334 6158 gene locus_tag LOCUS_00340 5334 6158 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114078.1 protein_id gnl|my_center|LOCUS_00340 7330 6188 gene locus_tag LOCUS_00350 7330 6188 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117901.1 protein_id gnl|my_center|LOCUS_00350 8564 7377 gene locus_tag LOCUS_00360 gene serA 8564 7377 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_00360 8662 9633 gene locus_tag LOCUS_00370 8662 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 9695 11380 gene locus_tag LOCUS_00380 9695 11380 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_00380 11875 13944 gene locus_tag LOCUS_00390 11875 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 15069 14029 gene locus_tag LOCUS_00400 15069 14029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 15332 16381 gene locus_tag LOCUS_00410 15332 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 16558 18102 gene locus_tag LOCUS_00420 16558 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970471.1 protein_id gnl|my_center|LOCUS_00420 18123 21386 gene locus_tag LOCUS_00430 gene dnaE2 18123 21386 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXK9 protein_id gnl|my_center|LOCUS_00430 21476 22408 gene locus_tag LOCUS_00440 gene purC 21476 22408 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ19 protein_id gnl|my_center|LOCUS_00440 22596 23735 gene locus_tag LOCUS_00450 gene aroC 22596 23735 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL4 protein_id gnl|my_center|LOCUS_00450 23785 25005 gene locus_tag LOCUS_00460 23785 25005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 25217 26239 gene locus_tag LOCUS_00470 25217 26239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 26341 26610 gene locus_tag LOCUS_00480 gene rpsO 26341 26610 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR97 protein_id gnl|my_center|LOCUS_00480 >Feature sequence003 1169 216 gene locus_tag LOCUS_00490 1169 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257879.1 protein_id gnl|my_center|LOCUS_00490 2719 1166 gene locus_tag LOCUS_00500 2719 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_00500 2920 3699 gene locus_tag LOCUS_00510 2920 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 protein_id gnl|my_center|LOCUS_00510 3950 3705 gene locus_tag LOCUS_00520 3950 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 5830 4100 gene locus_tag LOCUS_00530 5830 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_00530 5973 6044 gene locus_tag LOCUS_t00020 5973 6044 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6197 7237 gene locus_tag LOCUS_00540 6197 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7271 7510 gene locus_tag LOCUS_00550 7271 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 7507 7968 gene locus_tag LOCUS_00560 7507 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 8042 9037 gene locus_tag LOCUS_00570 8042 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 9233 9550 gene locus_tag LOCUS_00580 9233 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 9668 10513 gene locus_tag LOCUS_00590 9668 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 10553 11203 gene locus_tag LOCUS_00600 gene atpH 10553 11203 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S433 protein_id gnl|my_center|LOCUS_00600 11163 12707 gene locus_tag LOCUS_00610 gene atpA2 11163 12707 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB7 protein_id gnl|my_center|LOCUS_00610 12725 13612 gene locus_tag LOCUS_00620 gene atpG 12725 13612 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_00620 13656 15110 gene locus_tag LOCUS_00630 gene atpD 13656 15110 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB5 protein_id gnl|my_center|LOCUS_00630 15150 15584 gene locus_tag LOCUS_00640 gene atpC 15150 15584 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB4 protein_id gnl|my_center|LOCUS_00640 16587 15586 gene locus_tag LOCUS_00650 16587 15586 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_00650 17489 16764 gene locus_tag LOCUS_00660 gene hisA 17489 16764 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG70 protein_id gnl|my_center|LOCUS_00660 18128 17514 gene locus_tag LOCUS_00670 gene hisH 18128 17514 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULP3 protein_id gnl|my_center|LOCUS_00670 19029 18196 gene locus_tag LOCUS_00680 19029 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 <20248 19153 gene locus_tag LOCUS_00690 <20248 19153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119702.1:prepilin peptidase >Feature sequence004 <1 593 gene locus_tag LOCUS_00700 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SIT1:UPF0173 metal-dependent hydrolase 963 625 gene locus_tag LOCUS_00710 gene nasE 963 625 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_00710 1040 1897 gene locus_tag LOCUS_00720 1040 1897 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_00720 2141 2665 gene locus_tag LOCUS_00730 2141 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 2662 3573 gene locus_tag LOCUS_00740 2662 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 4372 3740 gene locus_tag LOCUS_00750 4372 3740 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335404.1 protein_id gnl|my_center|LOCUS_00750 4793 4518 gene locus_tag LOCUS_00760 4793 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 4686 4961 gene locus_tag LOCUS_00770 4686 4961 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_00770 5636 4983 gene locus_tag LOCUS_00780 5636 4983 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_00780 5962 6285 gene locus_tag LOCUS_00790 5962 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117893.1 protein_id gnl|my_center|LOCUS_00790 6421 7497 gene locus_tag LOCUS_00800 6421 7497 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_00800 8525 7518 gene locus_tag LOCUS_00810 8525 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 9886 8522 gene locus_tag LOCUS_00820 gene purD 9886 8522 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPZ8 protein_id gnl|my_center|LOCUS_00820 10317 11366 gene locus_tag LOCUS_00830 10317 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 11426 12199 gene locus_tag LOCUS_00840 11426 12199 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272191.1 protein_id gnl|my_center|LOCUS_00840 12245 13570 gene locus_tag LOCUS_00850 12245 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 13624 18213 gene locus_tag LOCUS_00860 13624 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 >Feature sequence005 2463 1048 gene locus_tag LOCUS_00870 gene fumC 2463 1048 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RR70 protein_id gnl|my_center|LOCUS_00870 4482 2581 gene locus_tag LOCUS_00880 4482 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 7779 6769 gene locus_tag LOCUS_00890 gene holB 7779 6769 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 protein_id gnl|my_center|LOCUS_00890 8470 7832 gene locus_tag LOCUS_00900 gene tmk 8470 7832 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72A57 protein_id gnl|my_center|LOCUS_00900 8922 8467 gene locus_tag LOCUS_00910 8922 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 9060 10133 gene locus_tag LOCUS_00920 gene mutY 9060 10133 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_00920 12015 10120 gene locus_tag LOCUS_00930 gene glmS 12015 10120 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA9 protein_id gnl|my_center|LOCUS_00930 12159 12962 gene locus_tag LOCUS_00940 gene kdsB 12159 12962 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI86 protein_id gnl|my_center|LOCUS_00940 14933 13119 gene locus_tag LOCUS_00950 14933 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 15973 15143 gene locus_tag LOCUS_00960 15973 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119258.1 protein_id gnl|my_center|LOCUS_00960 16966 16034 gene locus_tag LOCUS_00970 16966 16034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119259.1 protein_id gnl|my_center|LOCUS_00970 17861 17022 gene locus_tag LOCUS_00980 17861 17022 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHH5 protein_id gnl|my_center|LOCUS_00980 >Feature sequence006 612 839 gene locus_tag LOCUS_00990 612 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 841 1965 gene locus_tag LOCUS_01000 gene aroB 841 1965 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWN8 protein_id gnl|my_center|LOCUS_01000 3355 1976 gene locus_tag LOCUS_01010 3355 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 3510 5381 gene locus_tag LOCUS_01020 gene recQ 3510 5381 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120701.1 protein_id gnl|my_center|LOCUS_01020 6726 5497 gene locus_tag LOCUS_01030 6726 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7805 6723 gene locus_tag LOCUS_01040 7805 6723 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894640.1 protein_id gnl|my_center|LOCUS_01040 8719 7802 gene locus_tag LOCUS_01050 8719 7802 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_01050 10011 8776 gene locus_tag LOCUS_01060 10011 8776 CDS product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228602.1 protein_id gnl|my_center|LOCUS_01060 12349 10103 gene locus_tag LOCUS_01070 gene rlmL 12349 10103 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_01070 15721 12404 gene locus_tag LOCUS_01080 gene carB 15721 12404 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ58 protein_id gnl|my_center|LOCUS_01080 15796 16335 gene locus_tag LOCUS_01090 15796 16335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence007 <1 534 gene locus_tag LOCUS_01100 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UN19:50S ribosomal protein L4 538 858 gene locus_tag LOCUS_01110 gene rplW 538 858 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN18 protein_id gnl|my_center|LOCUS_01110 935 1792 gene locus_tag LOCUS_01120 gene rplB 935 1792 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN17 protein_id gnl|my_center|LOCUS_01120 1887 2153 gene locus_tag LOCUS_01130 gene rpsS 1887 2153 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN16 protein_id gnl|my_center|LOCUS_01130 2167 2541 gene locus_tag LOCUS_01140 gene rplV 2167 2541 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN15 protein_id gnl|my_center|LOCUS_01140 2599 3294 gene locus_tag LOCUS_01150 gene rpsC 2599 3294 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN14 protein_id gnl|my_center|LOCUS_01150 3233 3649 gene locus_tag LOCUS_01160 gene rplP 3233 3649 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN13 protein_id gnl|my_center|LOCUS_01160 3667 3915 gene locus_tag LOCUS_01170 gene rpmC 3667 3915 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN12 protein_id gnl|my_center|LOCUS_01170 3995 4375 gene locus_tag LOCUS_01180 gene rpsQ 3995 4375 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN11 protein_id gnl|my_center|LOCUS_01180 4375 4743 gene locus_tag LOCUS_01190 gene rplN 4375 4743 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN10 protein_id gnl|my_center|LOCUS_01190 4743 5105 gene locus_tag LOCUS_01200 gene rplX 4743 5105 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN09 protein_id gnl|my_center|LOCUS_01200 5191 5811 gene locus_tag LOCUS_01210 gene rplE 5191 5811 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN08 protein_id gnl|my_center|LOCUS_01210 5868 6053 gene locus_tag LOCUS_01220 gene rpsZ 5868 6053 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN07 protein_id gnl|my_center|LOCUS_01220 6066 6461 gene locus_tag LOCUS_01230 gene rpsH 6066 6461 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN06 protein_id gnl|my_center|LOCUS_01230 6562 7107 gene locus_tag LOCUS_01240 gene rplF 6562 7107 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN05 protein_id gnl|my_center|LOCUS_01240 7167 7535 gene locus_tag LOCUS_01250 gene rplR 7167 7535 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ6 protein_id gnl|my_center|LOCUS_01250 7652 8074 gene locus_tag LOCUS_01260 gene rpsE 7652 8074 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN03 protein_id gnl|my_center|LOCUS_01260 8168 8704 gene locus_tag LOCUS_01270 gene rplO 8168 8704 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN02 protein_id gnl|my_center|LOCUS_01270 8770 10158 gene locus_tag LOCUS_01280 gene secY 8770 10158 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN01 protein_id gnl|my_center|LOCUS_01280 10290 10859 gene locus_tag LOCUS_01290 gene adk 10290 10859 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD15 protein_id gnl|my_center|LOCUS_01290 10973 11794 gene locus_tag LOCUS_01300 10973 11794 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_01300 12394 12777 gene locus_tag LOCUS_01310 gene rpsM 12394 12777 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC7 protein_id gnl|my_center|LOCUS_01310 12873 13250 gene locus_tag LOCUS_01320 gene rpsK 12873 13250 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC6 protein_id gnl|my_center|LOCUS_01320 13317 13943 gene locus_tag LOCUS_01330 gene rpsD 13317 13943 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80373 protein_id gnl|my_center|LOCUS_01330 13999 14985 gene locus_tag LOCUS_01340 gene rpoA 13999 14985 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC5 protein_id gnl|my_center|LOCUS_01340 15082 15651 gene locus_tag LOCUS_01350 gene rplQ 15082 15651 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC4 protein_id gnl|my_center|LOCUS_01350 >Feature sequence008 1534 311 gene locus_tag LOCUS_01360 1534 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 1695 2954 gene locus_tag LOCUS_01370 1695 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 3156 4460 gene locus_tag LOCUS_01380 3156 4460 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123398.1 protein_id gnl|my_center|LOCUS_01380 4512 5489 gene locus_tag LOCUS_01390 gene thiL 4512 5489 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPP0 protein_id gnl|my_center|LOCUS_01390 5476 5994 gene locus_tag LOCUS_01400 5476 5994 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 protein_id gnl|my_center|LOCUS_01400 6026 6559 gene locus_tag LOCUS_01410 6026 6559 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_01410 7404 6565 gene locus_tag LOCUS_01420 7404 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 8321 7413 gene locus_tag LOCUS_01430 gene murB 8321 7413 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVF9 protein_id gnl|my_center|LOCUS_01430 9972 8461 gene locus_tag LOCUS_01440 gene murE 9972 8461 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGC9 protein_id gnl|my_center|LOCUS_01440 10238 11107 gene locus_tag LOCUS_01450 10238 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 11189 12097 gene locus_tag LOCUS_01460 11189 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 13075 12116 gene locus_tag LOCUS_01470 13075 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 13329 13072 gene locus_tag LOCUS_01480 13329 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 14499 13549 gene locus_tag LOCUS_01490 gene htrB 14499 13549 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_01490 15422 14601 gene locus_tag LOCUS_01500 15422 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 16012 15419 gene locus_tag LOCUS_01510 16012 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 >Feature sequence009 5369 6640 gene locus_tag LOCUS_01520 5369 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 6931 8106 gene locus_tag LOCUS_01530 6931 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 8255 8569 gene locus_tag LOCUS_01540 8255 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120854.1 protein_id gnl|my_center|LOCUS_01540 8562 8903 gene locus_tag LOCUS_01550 8562 8903 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_01550 13187 9081 gene locus_tag LOCUS_01560 13187 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 14583 13282 gene locus_tag LOCUS_01570 14583 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 14639 16036 gene locus_tag LOCUS_01580 14639 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence010 687 373 gene locus_tag LOCUS_01590 687 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 859 1845 gene locus_tag LOCUS_01600 859 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2765 1893 gene locus_tag LOCUS_01610 2765 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3718 2762 gene locus_tag LOCUS_01620 3718 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 5716 3785 gene locus_tag LOCUS_01630 gene dxs 5716 3785 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB7 protein_id gnl|my_center|LOCUS_01630 6798 5836 gene locus_tag LOCUS_01640 gene ggpP 6798 5836 CDS product geranylgeranyl pyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_01640 7273 6878 gene locus_tag LOCUS_01650 7273 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 8483 7248 gene locus_tag LOCUS_01660 gene xseA 8483 7248 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTZ9 protein_id gnl|my_center|LOCUS_01660 8612 9970 gene locus_tag LOCUS_01670 8612 9970 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_01670 11234 9951 gene locus_tag LOCUS_01680 11234 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 11355 12200 gene locus_tag LOCUS_01690 11355 12200 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121375.1 protein_id gnl|my_center|LOCUS_01690 12354 14504 gene locus_tag LOCUS_01700 gene prc 12354 14504 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_01700 <15077 14523 gene locus_tag LOCUS_01710 <15077 14523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118641.1:NAD(P)-dependent oxidoreductase >Feature sequence011 8942 7809 gene locus_tag LOCUS_01720 8942 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 9792 8935 gene locus_tag LOCUS_01730 9792 8935 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941295.1 protein_id gnl|my_center|LOCUS_01730 10873 9863 gene locus_tag LOCUS_01740 gene fcl 10873 9863 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_01740 12081 10870 gene locus_tag LOCUS_01750 12081 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 >Feature sequence012 447 1253 gene locus_tag LOCUS_01760 gene tolQ 447 1253 CDS product tolQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119635.1 protein_id gnl|my_center|LOCUS_01760 1350 1745 gene locus_tag LOCUS_01770 1350 1745 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_01770 1749 2243 gene locus_tag LOCUS_01780 1749 2243 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119636.1 protein_id gnl|my_center|LOCUS_01780 3175 2282 gene locus_tag LOCUS_01790 gene xerC 3175 2282 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQK2 protein_id gnl|my_center|LOCUS_01790 7029 3334 gene locus_tag LOCUS_01800 gene metH 7029 3334 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122502.1 protein_id gnl|my_center|LOCUS_01800 7603 8301 gene locus_tag LOCUS_01810 7603 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 8298 9008 gene locus_tag LOCUS_01820 8298 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 10164 8989 gene locus_tag LOCUS_01830 10164 8989 CDS product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 protein_id gnl|my_center|LOCUS_01830 11197 10157 gene locus_tag LOCUS_01840 11197 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118659.1 protein_id gnl|my_center|LOCUS_01840 11872 11276 gene locus_tag LOCUS_01850 11872 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 11828 12127 gene locus_tag LOCUS_01860 11828 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 12298 13530 gene locus_tag LOCUS_01870 gene trpB 12298 13530 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG9 protein_id gnl|my_center|LOCUS_01870 13573 14403 gene locus_tag LOCUS_01880 gene trpA 13573 14403 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URN0 protein_id gnl|my_center|LOCUS_01880 >Feature sequence013 1882 2898 gene locus_tag LOCUS_01890 1882 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_01890 2992 4038 gene locus_tag LOCUS_01900 gene moxR 2992 4038 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_01900 4004 4921 gene locus_tag LOCUS_01910 4004 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_01910 4978 7317 gene locus_tag LOCUS_01920 4978 7317 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118533.1 protein_id gnl|my_center|LOCUS_01920 7338 9821 gene locus_tag LOCUS_01930 7338 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 9858 12143 gene locus_tag LOCUS_01940 9858 12143 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118596.1 protein_id gnl|my_center|LOCUS_01940 12202 13911 gene locus_tag LOCUS_01950 12202 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118595.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence014 3591 832 gene locus_tag LOCUS_01960 gene ppc 3591 832 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHN1 protein_id gnl|my_center|LOCUS_01960 3869 5308 gene locus_tag LOCUS_01970 3869 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118694.1 protein_id gnl|my_center|LOCUS_01970 6058 5324 gene locus_tag LOCUS_01980 gene pdxJ 6058 5324 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKM1 protein_id gnl|my_center|LOCUS_01980 7667 6138 gene locus_tag LOCUS_01990 gene degP 7667 6138 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_01990 7955 8710 gene locus_tag LOCUS_02000 gene rnc 7955 8710 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ7 protein_id gnl|my_center|LOCUS_02000 9562 8972 gene locus_tag LOCUS_02010 9562 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 10016 9666 gene locus_tag LOCUS_02020 10016 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 10300 11412 gene locus_tag LOCUS_02030 10300 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 13715 11505 gene locus_tag LOCUS_02040 13715 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence015 1384 122 gene locus_tag LOCUS_02050 1384 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 1974 1384 gene locus_tag LOCUS_02060 1974 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4541 1974 gene locus_tag LOCUS_02070 4541 1974 CDS product 7TM receptor with intracellular metal dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330940.1 protein_id gnl|my_center|LOCUS_02070 5252 4590 gene locus_tag LOCUS_02080 5252 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 5154 5615 gene locus_tag LOCUS_02090 5154 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6674 5721 gene locus_tag LOCUS_02100 6674 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 7441 6671 gene locus_tag LOCUS_02110 gene uppS 7441 6671 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF53 protein_id gnl|my_center|LOCUS_02110 8787 7438 gene locus_tag LOCUS_02120 gene purA 8787 7438 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW3 protein_id gnl|my_center|LOCUS_02120 8996 10039 gene locus_tag LOCUS_02130 8996 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 10125 10679 gene locus_tag LOCUS_02140 10125 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 10793 10723 gene locus_tag LOCUS_t00030 10793 10723 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10922 12019 gene locus_tag LOCUS_02150 10922 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 12154 13134 gene locus_tag LOCUS_02160 12154 13134 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence016 1272 58 gene locus_tag LOCUS_02170 gene argE 1272 58 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_02170 1512 1907 gene locus_tag LOCUS_02180 gene nuoA 1512 1907 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCU8 protein_id gnl|my_center|LOCUS_02180 1898 2539 gene locus_tag LOCUS_02190 gene nuoB 1898 2539 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYI7 protein_id gnl|my_center|LOCUS_02190 2565 3092 gene locus_tag LOCUS_02200 2565 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 3126 4349 gene locus_tag LOCUS_02210 gene nuoD2 3126 4349 CDS product NADH-quinone oxidoreductase subunit D 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFK4 protein_id gnl|my_center|LOCUS_02210 4346 4843 gene locus_tag LOCUS_02220 gene nuoE2 4346 4843 CDS product NADH-quinone oxidoreductase subunit E 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56910 protein_id gnl|my_center|LOCUS_02220 4840 6204 gene locus_tag LOCUS_02230 gene nuoF2 4840 6204 CDS product NADH-quinone oxidoreductase subunit F 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56913 protein_id gnl|my_center|LOCUS_02230 6228 7865 gene locus_tag LOCUS_02240 6228 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 7901 9199 gene locus_tag LOCUS_02250 gene nuoH2 7901 9199 CDS product NADH-quinone oxidoreductase subunit H 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746T2 protein_id gnl|my_center|LOCUS_02250 9201 9734 gene locus_tag LOCUS_02260 gene nuoI 9201 9734 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q5 protein_id gnl|my_center|LOCUS_02260 9731 10555 gene locus_tag LOCUS_02270 9731 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 10552 11019 gene locus_tag LOCUS_02280 10552 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence017 1709 756 gene locus_tag LOCUS_02290 gene argB 1709 756 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ8 protein_id gnl|my_center|LOCUS_02290 2482 1961 gene locus_tag LOCUS_02300 gene msrB 2482 1961 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_02300 3738 2668 gene locus_tag LOCUS_02310 3738 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4158 4667 gene locus_tag LOCUS_02320 4158 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4741 5124 gene locus_tag LOCUS_02330 4741 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 5132 6841 gene locus_tag LOCUS_02340 gene pilB 5132 6841 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123899.1 protein_id gnl|my_center|LOCUS_02340 6969 7868 gene locus_tag LOCUS_02350 6969 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 9435 7879 gene locus_tag LOCUS_02360 9435 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_02360 9643 11883 gene locus_tag LOCUS_02370 gene sul1 9643 11883 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123067.1 protein_id gnl|my_center|LOCUS_02370 12916 11837 gene locus_tag LOCUS_02380 gene tsaD 12916 11837 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM42 protein_id gnl|my_center|LOCUS_02380 >Feature sequence018 31 414 gene locus_tag LOCUS_02390 31 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 517 1758 gene locus_tag LOCUS_02400 gene fabF 517 1758 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY0 protein_id gnl|my_center|LOCUS_02400 1833 3131 gene locus_tag LOCUS_02410 1833 3131 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_02410 3352 4809 gene locus_tag LOCUS_02420 gene nusA 3352 4809 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URQ7 protein_id gnl|my_center|LOCUS_02420 4921 7608 gene locus_tag LOCUS_02430 gene infB 4921 7608 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR0 protein_id gnl|my_center|LOCUS_02430 7659 8051 gene locus_tag LOCUS_02440 7659 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 8048 9418 gene locus_tag LOCUS_02450 8048 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9456 10205 gene locus_tag LOCUS_02460 9456 10205 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR4 protein_id gnl|my_center|LOCUS_02460 11810 10317 gene locus_tag LOCUS_02470 11810 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence019 897 1064 gene locus_tag LOCUS_02480 gene rpmG 897 1064 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMN0 protein_id gnl|my_center|LOCUS_02480 2157 1090 gene locus_tag LOCUS_02490 gene lpxK 2157 1090 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW7 protein_id gnl|my_center|LOCUS_02490 2395 6039 gene locus_tag LOCUS_02500 2395 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6036 7781 gene locus_tag LOCUS_02510 gene nadB 6036 7781 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTK8 protein_id gnl|my_center|LOCUS_02510 7961 8671 gene locus_tag LOCUS_02520 7961 8671 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_02520 8842 11598 gene locus_tag LOCUS_02530 8842 11598 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118284.1 protein_id gnl|my_center|LOCUS_02530 >Feature sequence020 539 1573 gene locus_tag LOCUS_02540 539 1573 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_02540 2068 4776 gene locus_tag LOCUS_02550 gene citB 2068 4776 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_02550 4889 7357 gene locus_tag LOCUS_02560 4889 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 10489 7388 gene locus_tag LOCUS_02570 gene czcA 10489 7388 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123153.1 protein_id gnl|my_center|LOCUS_02570 12064 10574 gene locus_tag LOCUS_02580 12064 10574 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence021 1205 159 gene locus_tag LOCUS_02590 gene parB 1205 159 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 protein_id gnl|my_center|LOCUS_02590 1944 1198 gene locus_tag LOCUS_02600 gene parA 1944 1198 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118760.1 protein_id gnl|my_center|LOCUS_02600 3012 2155 gene locus_tag LOCUS_02610 3012 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4640 3327 gene locus_tag LOCUS_02620 gene ahcY 4640 3327 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ5 protein_id gnl|my_center|LOCUS_02620 5471 4749 gene locus_tag LOCUS_02630 gene trpF 5471 4749 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH7 protein_id gnl|my_center|LOCUS_02630 5745 7418 gene locus_tag LOCUS_02640 5745 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 7473 8258 gene locus_tag LOCUS_02650 7473 8258 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118467.1 protein_id gnl|my_center|LOCUS_02650 8255 9352 gene locus_tag LOCUS_02660 gene pfkA 8255 9352 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU2 protein_id gnl|my_center|LOCUS_02660 9412 11376 gene locus_tag LOCUS_02670 gene acsA 9412 11376 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59872 protein_id gnl|my_center|LOCUS_02670 >Feature sequence022 1026 496 gene locus_tag LOCUS_02680 gene TPX 1026 496 CDS product 2-Cys peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326977.1 protein_id gnl|my_center|LOCUS_02680 1302 1472 gene locus_tag LOCUS_02690 1302 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 1846 1568 gene locus_tag LOCUS_02700 1846 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 1835 2524 gene locus_tag LOCUS_02710 1835 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 2639 2896 gene locus_tag LOCUS_02720 2639 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3006 4034 gene locus_tag LOCUS_02730 3006 4034 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUP0 protein_id gnl|my_center|LOCUS_02730 4118 4987 gene locus_tag LOCUS_02740 gene pyrK 4118 4987 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_02740 5284 5006 gene locus_tag LOCUS_02750 gene rpsT 5284 5006 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEF7 protein_id gnl|my_center|LOCUS_02750 6740 5418 gene locus_tag LOCUS_02760 6740 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7061 8587 gene locus_tag LOCUS_02770 gene hemD 7061 8587 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_02770 9715 9527 gene locus_tag LOCUS_02780 9715 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9901 10407 gene locus_tag LOCUS_02790 gene coaD 9901 10407 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG6 protein_id gnl|my_center|LOCUS_02790 11496 10426 gene locus_tag LOCUS_02800 gene yacI 11496 10426 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV3 protein_id gnl|my_center|LOCUS_02800 12056 11493 gene locus_tag LOCUS_02810 gene yacH 12056 11493 CDS product UvrB/UvrC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence023 433 786 gene locus_tag LOCUS_02820 433 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 855 1304 gene locus_tag LOCUS_02830 855 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 1436 1508 gene locus_tag LOCUS_t00040 1436 1508 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1867 2148 gene locus_tag LOCUS_02840 1867 2148 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z854 protein_id gnl|my_center|LOCUS_02840 2391 2978 gene locus_tag LOCUS_02850 2391 2978 CDS product RNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_02850 3998 3114 gene locus_tag LOCUS_02860 3998 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120623.1 protein_id gnl|my_center|LOCUS_02860 4177 5106 gene locus_tag LOCUS_02870 4177 5106 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119030.1 protein_id gnl|my_center|LOCUS_02870 5486 5190 gene locus_tag LOCUS_02880 5486 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6020 5526 gene locus_tag LOCUS_02890 6020 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 6415 7629 gene locus_tag LOCUS_02900 6415 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 9720 7654 gene locus_tag LOCUS_02910 9720 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9960 10937 gene locus_tag LOCUS_02920 9960 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 11054 11959 gene locus_tag LOCUS_02930 11054 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence024 525 857 gene locus_tag LOCUS_02940 gene hisE 525 857 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50935 protein_id gnl|my_center|LOCUS_02940 933 1811 gene locus_tag LOCUS_02950 gene hisG 933 1811 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URL0 protein_id gnl|my_center|LOCUS_02950 3155 1815 gene locus_tag LOCUS_02960 gene trzA 3155 1815 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_02960 4297 3152 gene locus_tag LOCUS_02970 gene mqnC 4297 3152 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT24 protein_id gnl|my_center|LOCUS_02970 5112 4297 gene locus_tag LOCUS_02980 gene mqnA 5112 4297 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_02980 7114 5351 gene locus_tag LOCUS_02990 7114 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7875 7114 gene locus_tag LOCUS_03000 7875 7114 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_03000 8995 7934 gene locus_tag LOCUS_03010 8995 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 9422 9748 gene locus_tag LOCUS_03020 9422 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 10950 9745 gene locus_tag LOCUS_03030 gene aroA 10950 9745 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW43 protein_id gnl|my_center|LOCUS_03030 >Feature sequence025 1065 4433 gene locus_tag LOCUS_03040 1065 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118178.1 protein_id gnl|my_center|LOCUS_03040 4905 4444 gene locus_tag LOCUS_03050 4905 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6224 4968 gene locus_tag LOCUS_03060 6224 4968 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941518.1 protein_id gnl|my_center|LOCUS_03060 6223 8553 gene locus_tag LOCUS_03070 6223 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 8775 9422 gene locus_tag LOCUS_03080 8775 9422 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_03080 9468 9809 gene locus_tag LOCUS_03090 9468 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 10182 9712 gene locus_tag LOCUS_03100 10182 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 11129 10179 gene locus_tag LOCUS_03110 gene dnaJ 11129 10179 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_03110 <11987 11211 gene locus_tag LOCUS_03120 <11987 11211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9S646:polyphosphate kinase >Feature sequence026 1522 317 gene locus_tag LOCUS_03130 1522 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2219 1527 gene locus_tag LOCUS_03140 2219 1527 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764042.1 protein_id gnl|my_center|LOCUS_03140 2795 5767 gene locus_tag LOCUS_03150 2795 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 7022 6363 gene locus_tag LOCUS_03160 7022 6363 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_03160 8206 7322 gene locus_tag LOCUS_03170 gene hemC 8206 7322 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_03170 8849 8355 gene locus_tag LOCUS_03180 8849 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 9061 9291 gene locus_tag LOCUS_03190 9061 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 9285 10415 gene locus_tag LOCUS_03200 9285 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 10633 11073 gene locus_tag LOCUS_03210 gene fliW 10633 11073 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URF1 protein_id gnl|my_center|LOCUS_03210 11134 11403 gene locus_tag LOCUS_03220 gene csrA 11134 11403 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_03220 >Feature sequence027 924 649 gene locus_tag LOCUS_03230 924 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 1632 1219 gene locus_tag LOCUS_03240 1632 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2994 1861 gene locus_tag LOCUS_03250 2994 1861 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120561.1 protein_id gnl|my_center|LOCUS_03250 4479 3253 gene locus_tag LOCUS_03260 4479 3253 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_03260 4884 5069 gene locus_tag LOCUS_03270 4884 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 5096 6280 gene locus_tag LOCUS_03280 5096 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 6793 7374 gene locus_tag LOCUS_03290 6793 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 7392 9161 gene locus_tag LOCUS_03300 7392 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120438.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence028 1453 683 gene locus_tag LOCUS_03310 1453 683 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_03310 1599 2327 gene locus_tag LOCUS_03320 1599 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2635 6084 gene locus_tag LOCUS_03330 gene pyc 2635 6084 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UES1 protein_id gnl|my_center|LOCUS_03330 6868 6212 gene locus_tag LOCUS_03340 gene msrA 6868 6212 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_03340 7538 6921 gene locus_tag LOCUS_03350 7538 6921 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN92 protein_id gnl|my_center|LOCUS_03350 7635 8738 gene locus_tag LOCUS_03360 7635 8738 CDS product DesA-family fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_03360 8780 9871 gene locus_tag LOCUS_03370 gene ychF 8780 9871 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence029 468 2756 gene locus_tag LOCUS_03380 468 2756 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 protein_id gnl|my_center|LOCUS_03380 2810 5575 gene locus_tag LOCUS_03390 2810 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5572 7503 gene locus_tag LOCUS_03400 5572 7503 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510922.1 protein_id gnl|my_center|LOCUS_03400 9176 7728 gene locus_tag LOCUS_03410 9176 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 9263 9826 gene locus_tag LOCUS_03420 9263 9826 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_03420 9920 9992 gene locus_tag LOCUS_t00050 9920 9992 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence030 204 758 gene locus_tag LOCUS_03430 204 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 1031 792 gene locus_tag LOCUS_03440 1031 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 912 2249 gene locus_tag LOCUS_03450 gene astB 912 2249 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMV4 protein_id gnl|my_center|LOCUS_03450 2467 3216 gene locus_tag LOCUS_03460 2467 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3865 3629 gene locus_tag LOCUS_03470 3865 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 3834 4733 gene locus_tag LOCUS_03480 3834 4733 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_03480 5848 4856 gene locus_tag LOCUS_03490 5848 4856 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_03490 6378 5965 gene locus_tag LOCUS_03500 6378 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 8151 6634 gene locus_tag LOCUS_03510 8151 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 9644 8193 gene locus_tag LOCUS_03520 9644 8193 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_03520 >Feature sequence031 <1 1215 gene locus_tag LOCUS_03530 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQN7:transcription-repair-coupling factor 1417 2850 gene locus_tag LOCUS_03540 1417 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2981 4324 gene locus_tag LOCUS_03550 gene gltA 2981 4324 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_03550 4752 4321 gene locus_tag LOCUS_03560 gene tadA 4752 4321 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIP0 protein_id gnl|my_center|LOCUS_03560 5047 5685 gene locus_tag LOCUS_03570 5047 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 5751 5918 gene locus_tag LOCUS_03580 5751 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 6081 6830 gene locus_tag LOCUS_03590 6081 6830 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_03590 6946 7170 gene locus_tag LOCUS_03600 6946 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 8607 7201 gene locus_tag LOCUS_03610 gene hemY 8607 7201 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32397 protein_id gnl|my_center|LOCUS_03610 >Feature sequence032 249 1595 gene locus_tag LOCUS_03620 249 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_03620 4650 1759 gene locus_tag LOCUS_03630 4650 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 7140 4789 gene locus_tag LOCUS_03640 7140 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 9728 7245 gene locus_tag LOCUS_03650 9728 7245 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence033 1996 170 gene locus_tag LOCUS_03660 1996 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 2328 3572 gene locus_tag LOCUS_03670 2328 3572 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_03670 4537 3611 gene locus_tag LOCUS_03680 gene prmC 4537 3611 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_03680 5718 4588 gene locus_tag LOCUS_03690 gene prfA 5718 4588 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT3 protein_id gnl|my_center|LOCUS_03690 6068 5808 gene locus_tag LOCUS_03700 gene rpmE 6068 5808 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT4 protein_id gnl|my_center|LOCUS_03700 7867 6221 gene locus_tag LOCUS_03710 7867 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 8709 7882 gene locus_tag LOCUS_03720 gene kdsA 8709 7882 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ25 protein_id gnl|my_center|LOCUS_03720 9245 9318 gene locus_tag LOCUS_t00060 9245 9318 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 593 408 gene locus_tag LOCUS_03730 593 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 1067 702 gene locus_tag LOCUS_03740 1067 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 1691 2803 gene locus_tag LOCUS_03750 gene dnaN 1691 2803 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKK1 protein_id gnl|my_center|LOCUS_03750 2846 3151 gene locus_tag LOCUS_03760 2846 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3202 5697 gene locus_tag LOCUS_03770 gene gyrB 3202 5697 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM28 protein_id gnl|my_center|LOCUS_03770 6384 5944 gene locus_tag LOCUS_03780 6384 5944 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_03780 7745 6435 gene locus_tag LOCUS_03790 7745 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_03790 7907 8593 gene locus_tag LOCUS_03800 7907 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118676.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence035 384 1496 gene locus_tag LOCUS_03810 384 1496 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887018.1 protein_id gnl|my_center|LOCUS_03810 4132 1562 gene locus_tag LOCUS_03820 4132 1562 CDS product putative trehalose phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701330.1 protein_id gnl|my_center|LOCUS_03820 5574 4129 gene locus_tag LOCUS_03830 gene otsA 5574 4129 CDS product trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4M9 protein_id gnl|my_center|LOCUS_03830 5828 6181 gene locus_tag LOCUS_03840 gene groS 5828 6181 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU13 protein_id gnl|my_center|LOCUS_03840 6298 6208 gene locus_tag LOCUS_t00070 6298 6208 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6465 7706 gene locus_tag LOCUS_03850 6465 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 8190 7771 gene locus_tag LOCUS_03860 8190 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 9100 8570 gene locus_tag LOCUS_03870 9100 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence036 <1 1054 gene locus_tag LOCUS_03880 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A503:putative cation-transporting P-type ATPase C 2030 1065 gene locus_tag LOCUS_03890 2030 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2347 4314 gene locus_tag LOCUS_03900 2347 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4340 5263 gene locus_tag LOCUS_03910 4340 5263 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G39 protein_id gnl|my_center|LOCUS_03910 5269 6534 gene locus_tag LOCUS_03920 5269 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 6531 7580 gene locus_tag LOCUS_03930 6531 7580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_03930 7585 9351 gene locus_tag LOCUS_03940 7585 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence037 <1 614 gene locus_tag LOCUS_03950 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJD8:1,4-dihydroxy-6-naphtoate synthase 611 1768 gene locus_tag LOCUS_03960 611 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 3414 1918 gene locus_tag LOCUS_03970 gene cls-2 3414 1918 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_03970 3518 4981 gene locus_tag LOCUS_03980 3518 4981 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920976.1 protein_id gnl|my_center|LOCUS_03980 5645 5052 gene locus_tag LOCUS_03990 5645 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 6173 5811 gene locus_tag LOCUS_04000 6173 5811 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_04000 6381 7211 gene locus_tag LOCUS_04010 6381 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7305 8102 gene locus_tag LOCUS_04020 7305 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 8620 8126 gene locus_tag LOCUS_04030 8620 8126 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057492.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence038 5870 4719 gene locus_tag LOCUS_04040 5870 4719 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120956.1 protein_id gnl|my_center|LOCUS_04040 6425 7072 gene locus_tag LOCUS_04050 6425 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 7142 8212 gene locus_tag LOCUS_04060 7142 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_04060 <9429 8216 gene locus_tag LOCUS_04070 <9429 8216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119680.1:acetylxylan esterase >Feature sequence039 965 231 gene locus_tag LOCUS_04080 gene araC 965 231 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_04080 1145 2530 gene locus_tag LOCUS_04090 1145 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_04090 2575 4824 gene locus_tag LOCUS_04100 2575 4824 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_04100 5178 8024 gene locus_tag LOCUS_04110 5178 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120348.1 protein_id gnl|my_center|LOCUS_04110 8154 9212 gene locus_tag LOCUS_04120 gene trx 8154 9212 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence040 823 239 gene locus_tag LOCUS_04130 823 239 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_04130 1728 925 gene locus_tag LOCUS_04140 1728 925 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087286.1 protein_id gnl|my_center|LOCUS_04140 2147 1725 gene locus_tag LOCUS_04150 2147 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3918 2272 gene locus_tag LOCUS_04160 gene nuoN 3918 2272 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 protein_id gnl|my_center|LOCUS_04160 5798 3978 gene locus_tag LOCUS_04170 gene ndhD 5798 3978 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_04170 8373 5851 gene locus_tag LOCUS_04180 8373 5851 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258759.1 protein_id gnl|my_center|LOCUS_04180 8787 8440 gene locus_tag LOCUS_04190 gene nuoK 8787 8440 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB6 protein_id gnl|my_center|LOCUS_04190 >Feature sequence041 <1 999 gene locus_tag LOCUS_04200 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122635.1:membrane protein 2998 1022 gene locus_tag LOCUS_04210 gene gpi2 2998 1022 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_04210 3287 4606 gene locus_tag LOCUS_04220 3287 4606 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 protein_id gnl|my_center|LOCUS_04220 4603 6417 gene locus_tag LOCUS_04230 4603 6417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886809.1 protein_id gnl|my_center|LOCUS_04230 6559 6484 gene locus_tag LOCUS_t00080 6559 6484 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8057 6684 gene locus_tag LOCUS_04240 8057 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_04240 <9290 8268 gene locus_tag LOCUS_04250 <9290 8268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338790.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence042 1654 1061 gene locus_tag LOCUS_04260 gene pyrE 1654 1061 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYX5 protein_id gnl|my_center|LOCUS_04260 1788 4073 gene locus_tag LOCUS_04270 1788 4073 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119027.1 protein_id gnl|my_center|LOCUS_04270 4070 4696 gene locus_tag LOCUS_04280 4070 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4792 5799 gene locus_tag LOCUS_04290 4792 5799 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQD2 protein_id gnl|my_center|LOCUS_04290 5815 6588 gene locus_tag LOCUS_04300 5815 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7047 8447 gene locus_tag LOCUS_04310 7047 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence043 1399 1650 gene locus_tag LOCUS_04320 1399 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1902 3557 gene locus_tag LOCUS_04330 1902 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5601 5822 gene locus_tag LOCUS_04340 5601 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6073 6354 gene locus_tag LOCUS_04350 6073 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6496 8850 gene locus_tag LOCUS_04360 6496 8850 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704913.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence044 44 1405 gene locus_tag LOCUS_04370 44 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1548 2039 gene locus_tag LOCUS_04380 1548 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 2315 2854 gene locus_tag LOCUS_04390 gene fabZ 2315 2854 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_04390 2864 3553 gene locus_tag LOCUS_04400 gene trmB 2864 3553 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN36 protein_id gnl|my_center|LOCUS_04400 4838 3537 gene locus_tag LOCUS_04410 4838 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259655.1 protein_id gnl|my_center|LOCUS_04410 6040 4847 gene locus_tag LOCUS_04420 gene proB 6040 4847 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJA8 protein_id gnl|my_center|LOCUS_04420 6243 7817 gene locus_tag LOCUS_04430 gene purF 6243 7817 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGS5 protein_id gnl|my_center|LOCUS_04430 <9227 7834 gene locus_tag LOCUS_04440 <9227 7834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120811.1:IRE (iron responsive element) >Feature sequence045 1319 1618 gene locus_tag LOCUS_04450 1319 1618 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_04450 1615 3822 gene locus_tag LOCUS_04460 1615 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3855 4862 gene locus_tag LOCUS_04470 3855 4862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_04470 4910 5710 gene locus_tag LOCUS_04480 4910 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5751 7010 gene locus_tag LOCUS_04490 5751 7010 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123564.1 protein_id gnl|my_center|LOCUS_04490 7640 8287 gene locus_tag LOCUS_04500 7640 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence046 256 642 gene locus_tag LOCUS_04510 256 642 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887492.1 protein_id gnl|my_center|LOCUS_04510 671 829 gene locus_tag LOCUS_04520 671 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1341 871 gene locus_tag LOCUS_04530 1341 871 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120596.1 protein_id gnl|my_center|LOCUS_04530 1566 2282 gene locus_tag LOCUS_04540 1566 2282 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118095.1 protein_id gnl|my_center|LOCUS_04540 2322 3734 gene locus_tag LOCUS_04550 2322 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3753 7037 gene locus_tag LOCUS_04560 3753 7037 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118092.1 protein_id gnl|my_center|LOCUS_04560 7104 8540 gene locus_tag LOCUS_04570 7104 8540 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939754.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence047 183 986 gene locus_tag LOCUS_04580 gene panB 183 986 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM39 protein_id gnl|my_center|LOCUS_04580 1371 997 gene locus_tag LOCUS_04590 1371 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 1906 2973 gene locus_tag LOCUS_04600 1906 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3347 2946 gene locus_tag LOCUS_04610 3347 2946 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU6 protein_id gnl|my_center|LOCUS_04610 3802 3419 gene locus_tag LOCUS_04620 gene rplS 3802 3419 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI13 protein_id gnl|my_center|LOCUS_04620 4575 3871 gene locus_tag LOCUS_04630 gene trmD 4575 3871 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY8 protein_id gnl|my_center|LOCUS_04630 5147 4608 gene locus_tag LOCUS_04640 5147 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 6832 5357 gene locus_tag LOCUS_04650 gene ffh 6832 5357 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_04650 7837 8736 gene locus_tag LOCUS_04660 7837 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence048 314 958 gene locus_tag LOCUS_04670 314 958 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121754.1 protein_id gnl|my_center|LOCUS_04670 995 2176 gene locus_tag LOCUS_04680 gene iscS 995 2176 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_04680 2295 2633 gene locus_tag LOCUS_04690 2295 2633 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_04690 2673 3917 gene locus_tag LOCUS_04700 2673 3917 CDS product precorrin-6Y-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_04700 3919 4653 gene locus_tag LOCUS_04710 3919 4653 CDS product LmbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_04710 4650 5132 gene locus_tag LOCUS_04720 4650 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 5116 6171 gene locus_tag LOCUS_04730 5116 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_04730 6314 7804 gene locus_tag LOCUS_04740 6314 7804 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence049 <1 936 gene locus_tag LOCUS_04750 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120737.1:sulfatase 1013 1876 gene locus_tag LOCUS_04760 gene aroE 1013 1876 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CUJ9 protein_id gnl|my_center|LOCUS_04760 1873 2874 gene locus_tag LOCUS_04770 1873 2874 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392149.1 protein_id gnl|my_center|LOCUS_04770 2871 4391 gene locus_tag LOCUS_04780 gene rbsA 2871 4391 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225825.1 protein_id gnl|my_center|LOCUS_04780 4450 5742 gene locus_tag LOCUS_04790 4450 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 5931 7559 gene locus_tag LOCUS_04800 5931 7559 CDS product protein-xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123507.1 protein_id gnl|my_center|LOCUS_04800 8375 7629 gene locus_tag LOCUS_04810 8375 7629 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MNL2 protein_id gnl|my_center|LOCUS_04810 >Feature sequence050 3097 1775 gene locus_tag LOCUS_04820 gene ugd 3097 1775 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_04820 5900 3141 gene locus_tag LOCUS_04830 gene gyrA 5900 3141 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMG7 protein_id gnl|my_center|LOCUS_04830 6090 7829 gene locus_tag LOCUS_04840 6090 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143571.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence051 557 1831 gene locus_tag LOCUS_04850 557 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2304 2498 gene locus_tag LOCUS_04860 2304 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3205 2468 gene locus_tag LOCUS_04870 3205 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327171.1 protein_id gnl|my_center|LOCUS_04870 4614 3505 gene locus_tag LOCUS_04880 4614 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 5041 6201 gene locus_tag LOCUS_04890 5041 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120378.1 protein_id gnl|my_center|LOCUS_04890 6315 7484 gene locus_tag LOCUS_04900 6315 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 8490 7693 gene locus_tag LOCUS_04910 8490 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence052 1091 1609 gene locus_tag LOCUS_04920 1091 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117815.1 protein_id gnl|my_center|LOCUS_04920 1664 2989 gene locus_tag LOCUS_04930 gene hisS 1664 2989 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UZ20 protein_id gnl|my_center|LOCUS_04930 4522 3017 gene locus_tag LOCUS_04940 4522 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04940 5615 4671 gene locus_tag LOCUS_04950 5615 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 5917 6606 gene locus_tag LOCUS_04960 5917 6606 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123490.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence053 <1 615 gene locus_tag LOCUS_04970 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190643.1:chemotaxis-related protein 650 3094 gene locus_tag LOCUS_04980 650 3094 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266949.1 protein_id gnl|my_center|LOCUS_04980 4538 3066 gene locus_tag LOCUS_04990 gene amiE 4538 3066 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229130.1 protein_id gnl|my_center|LOCUS_04990 6163 4583 gene locus_tag LOCUS_05000 6163 4583 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118438.1 protein_id gnl|my_center|LOCUS_05000 6329 7012 gene locus_tag LOCUS_05010 6329 7012 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122587.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05010 7169 7402 gene locus_tag LOCUS_05020 7169 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 7424 8347 gene locus_tag LOCUS_05030 gene xerC 7424 8347 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_05030 >Feature sequence054 <1 1305 gene locus_tag LOCUS_05040 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926478.1:MBL fold metallo-hydrolase 1401 2273 gene locus_tag LOCUS_05050 1401 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552088.1 protein_id gnl|my_center|LOCUS_05050 4129 2375 gene locus_tag LOCUS_05060 4129 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4987 4223 gene locus_tag LOCUS_05070 gene drrA 4987 4223 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403350.1 protein_id gnl|my_center|LOCUS_05070 <8577 5185 gene locus_tag LOCUS_05080 <8577 5185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_011298.2:Snf2 family protein >Feature sequence055 695 1675 gene locus_tag LOCUS_05090 695 1675 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_05090 1781 2191 gene locus_tag LOCUS_05100 1781 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3266 2229 gene locus_tag LOCUS_05110 gene nfo 3266 2229 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WII8 protein_id gnl|my_center|LOCUS_05110 3317 3847 gene locus_tag LOCUS_05120 3317 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3904 6054 gene locus_tag LOCUS_05130 3904 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6171 7898 gene locus_tag LOCUS_05140 6171 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence056 1020 5111 gene locus_tag LOCUS_05150 1020 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121833.1 protein_id gnl|my_center|LOCUS_05150 5159 5890 gene locus_tag LOCUS_05160 5159 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 5977 6936 gene locus_tag LOCUS_05170 gene lipA 5977 6936 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH37 protein_id gnl|my_center|LOCUS_05170 8015 6957 gene locus_tag LOCUS_05180 gene atoC 8015 6957 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123506.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence057 146 604 gene locus_tag LOCUS_05190 146 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05190 1819 737 gene locus_tag LOCUS_05200 1819 737 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_05200 4047 1867 gene locus_tag LOCUS_05210 4047 1867 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328585.1 protein_id gnl|my_center|LOCUS_05210 4262 5713 gene locus_tag LOCUS_05220 4262 5713 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_05220 6149 6487 gene locus_tag LOCUS_05230 gene glnB 6149 6487 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508042.1 protein_id gnl|my_center|LOCUS_05230 8209 6656 gene locus_tag LOCUS_05240 gene gltD 8209 6656 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence058 <1 679 gene locus_tag LOCUS_05250 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123804.1:cytochrome c 681 2138 gene locus_tag LOCUS_05260 681 2138 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_05260 2223 3596 gene locus_tag LOCUS_05270 2223 3596 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_05270 5009 3666 gene locus_tag LOCUS_05280 5009 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 6700 6185 gene locus_tag LOCUS_05290 6700 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 7540 6788 gene locus_tag LOCUS_05300 7540 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence059 227 940 gene locus_tag LOCUS_05310 gene cmk 227 940 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEW6 protein_id gnl|my_center|LOCUS_05310 952 1644 gene locus_tag LOCUS_05320 952 1644 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_05320 1780 2841 gene locus_tag LOCUS_05330 1780 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 5018 2931 gene locus_tag LOCUS_05340 gene pheT 5018 2931 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP77 protein_id gnl|my_center|LOCUS_05340 6052 5015 gene locus_tag LOCUS_05350 gene pheS 6052 5015 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP75 protein_id gnl|my_center|LOCUS_05350 6470 6096 gene locus_tag LOCUS_05360 gene rplT 6470 6096 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP74 protein_id gnl|my_center|LOCUS_05360 6811 6608 gene locus_tag LOCUS_05370 gene rpmI 6811 6608 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP72 protein_id gnl|my_center|LOCUS_05370 7402 6887 gene locus_tag LOCUS_05380 gene infC 7402 6887 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ17 protein_id gnl|my_center|LOCUS_05380 >Feature sequence060 1946 654 gene locus_tag LOCUS_05390 1946 654 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_05390 3278 1980 gene locus_tag LOCUS_05400 3278 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_05400 5886 3355 gene locus_tag LOCUS_05410 5886 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120757.1 protein_id gnl|my_center|LOCUS_05410 8099 6093 gene locus_tag LOCUS_05420 8099 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence061 <1 1632 gene locus_tag LOCUS_05430 <1 1632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UR95:polyribonucleotide nucleotidyltransferase 1638 2408 gene locus_tag LOCUS_05440 1638 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 2506 3888 gene locus_tag LOCUS_05450 2506 3888 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_05450 3921 5762 gene locus_tag LOCUS_05460 gene mutL 3921 5762 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PD60 protein_id gnl|my_center|LOCUS_05460 5798 7297 gene locus_tag LOCUS_05470 5798 7297 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ72 protein_id gnl|my_center|LOCUS_05470 7294 7899 gene locus_tag LOCUS_05480 gene aroL 7294 7899 CDS product shikimate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHS6 protein_id gnl|my_center|LOCUS_05480 >Feature sequence062 303 52 gene locus_tag LOCUS_05490 303 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 723 328 gene locus_tag LOCUS_05500 723 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1772 723 gene locus_tag LOCUS_05510 1772 723 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_05510 1950 2279 gene locus_tag LOCUS_05520 1950 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3750 2218 gene locus_tag LOCUS_05530 3750 2218 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_05530 4060 5550 gene locus_tag LOCUS_05540 4060 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 5739 7013 gene locus_tag LOCUS_05550 5739 7013 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_05550 7010 7756 gene locus_tag LOCUS_05560 7010 7756 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972071.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence063 1811 741 gene locus_tag LOCUS_05570 gene waaF 1811 741 CDS product ADP-heptose--LPS heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526219.1 protein_id gnl|my_center|LOCUS_05570 5405 2070 gene locus_tag LOCUS_05580 5405 2070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_05580 6082 5402 gene locus_tag LOCUS_05590 gene lolD1 6082 5402 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_05590 6514 6113 gene locus_tag LOCUS_05600 6514 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6923 6639 gene locus_tag LOCUS_05610 6923 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7511 7155 gene locus_tag LOCUS_05620 7511 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence064 3804 457 gene locus_tag LOCUS_05630 gene gdhP 3804 457 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_05630 4086 7166 gene locus_tag LOCUS_05640 4086 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence065 1936 281 gene locus_tag LOCUS_05650 1936 281 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_05650 2160 1933 gene locus_tag LOCUS_05660 2160 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2684 2256 gene locus_tag LOCUS_05670 gene ybaN 2684 2256 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32J48 protein_id gnl|my_center|LOCUS_05670 2809 3846 gene locus_tag LOCUS_05680 gene fba 2809 3846 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_867402.2 protein_id gnl|my_center|LOCUS_05680 3932 4963 gene locus_tag LOCUS_05690 3932 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122487.1 protein_id gnl|my_center|LOCUS_05690 5000 5569 gene locus_tag LOCUS_05700 gene kdsC 5000 5569 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence066 539 1561 gene locus_tag LOCUS_05710 539 1561 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_05710 1597 2004 gene locus_tag LOCUS_05720 1597 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2133 3062 gene locus_tag LOCUS_05730 gene dapA 2133 3062 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Q28 protein_id gnl|my_center|LOCUS_05730 3109 4269 gene locus_tag LOCUS_05740 3109 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 4284 5330 gene locus_tag LOCUS_05750 4284 5330 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_05750 6471 5314 gene locus_tag LOCUS_05760 6471 5314 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028848.1 protein_id gnl|my_center|LOCUS_05760 6604 7590 gene locus_tag LOCUS_05770 6604 7590 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence067 1300 395 gene locus_tag LOCUS_05780 1300 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1528 3522 gene locus_tag LOCUS_05790 1528 3522 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89C25 protein_id gnl|my_center|LOCUS_05790 3746 4081 gene locus_tag LOCUS_05800 3746 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 5221 4073 gene locus_tag LOCUS_05810 5221 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121691.1 protein_id gnl|my_center|LOCUS_05810 5508 6632 gene locus_tag LOCUS_05820 gene hpnA 5508 6632 CDS product HpnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121915.1 protein_id gnl|my_center|LOCUS_05820 6569 7303 gene locus_tag LOCUS_05830 6569 7303 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_05830 <7978 7292 gene locus_tag LOCUS_05840 <7978 7292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKJ7:indole-3-glycerol phosphate synthase >Feature sequence068 2147 855 gene locus_tag LOCUS_05850 2147 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119562.1 protein_id gnl|my_center|LOCUS_05850 5686 2144 gene locus_tag LOCUS_05860 5686 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 6215 5934 gene locus_tag LOCUS_05870 6215 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 7300 6344 gene locus_tag LOCUS_05880 7300 6344 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence069 1492 95 gene locus_tag LOCUS_05890 1492 95 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_05890 2466 1858 gene locus_tag LOCUS_05900 2466 1858 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_05900 2968 2501 gene locus_tag LOCUS_05910 2968 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3436 2975 gene locus_tag LOCUS_05920 3436 2975 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_05920 4205 3528 gene locus_tag LOCUS_05930 4205 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105540.1 protein_id gnl|my_center|LOCUS_05930 5790 4312 gene locus_tag LOCUS_05940 5790 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6425 5826 gene locus_tag LOCUS_05950 6425 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 6633 7430 gene locus_tag LOCUS_05960 6633 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120236.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence070 2 1393 gene locus_tag LOCUS_05970 2 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1390 3675 gene locus_tag LOCUS_05980 1390 3675 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122941.1 protein_id gnl|my_center|LOCUS_05980 4040 5842 gene locus_tag LOCUS_05990 4040 5842 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119006.1 protein_id gnl|my_center|LOCUS_05990 5823 7292 gene locus_tag LOCUS_06000 5823 7292 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119007.1 protein_id gnl|my_center|LOCUS_06000 <7846 7304 gene locus_tag LOCUS_06010 <7846 7304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNQ7:LexA repressor >Feature sequence071 3060 1246 gene locus_tag LOCUS_06020 gene ptsI 3060 1246 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMU0 protein_id gnl|my_center|LOCUS_06020 3594 3238 gene locus_tag LOCUS_06030 gene ptsH 3594 3238 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332233.1 protein_id gnl|my_center|LOCUS_06030 4105 3629 gene locus_tag LOCUS_06040 gene fruA 4105 3629 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_06040 4453 4133 gene locus_tag LOCUS_06050 4453 4133 CDS product RNA polymerase subunit sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328917.1 protein_id gnl|my_center|LOCUS_06050 7006 4697 gene locus_tag LOCUS_06060 7006 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence072 438 1826 gene locus_tag LOCUS_06070 438 1826 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_06070 1861 4614 gene locus_tag LOCUS_06080 1861 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4616 6883 gene locus_tag LOCUS_06090 4616 6883 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence073 819 2771 gene locus_tag LOCUS_06100 819 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121814.1 protein_id gnl|my_center|LOCUS_06100 5209 2768 gene locus_tag LOCUS_06110 5209 2768 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_06110 5344 5601 gene locus_tag LOCUS_06120 5344 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7422 6145 gene locus_tag LOCUS_06130 7422 6145 CDS product Rho termination factor domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327172.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence074 240 572 gene locus_tag LOCUS_06140 240 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1870 566 gene locus_tag LOCUS_06150 1870 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 2176 2694 gene locus_tag LOCUS_06160 gene mmyF 2176 2694 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_06160 2984 4003 gene locus_tag LOCUS_06170 2984 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 4040 5254 gene locus_tag LOCUS_06180 4040 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 5259 6779 gene locus_tag LOCUS_06190 gene rbsA 5259 6779 CDS product ribose import ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDI2 protein_id gnl|my_center|LOCUS_06190 >Feature sequence075 <1 612 gene locus_tag LOCUS_06200 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UK85:enoyl-[acyl-carrier-protein] reductase [NADH] 622 1071 gene locus_tag LOCUS_06210 622 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1445 1188 gene locus_tag LOCUS_06220 1445 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3391 1442 gene locus_tag LOCUS_06230 3391 1442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_06230 4522 3638 gene locus_tag LOCUS_06240 gene folD 4522 3638 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNN9 protein_id gnl|my_center|LOCUS_06240 4922 4578 gene locus_tag LOCUS_06250 4922 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 6745 4967 gene locus_tag LOCUS_06260 gene pyrG 6745 4967 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_06260 >Feature sequence076 970 1899 gene locus_tag LOCUS_06270 970 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 1919 4105 gene locus_tag LOCUS_06280 1919 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4138 5037 gene locus_tag LOCUS_06290 4138 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 5256 6008 gene locus_tag LOCUS_06300 5256 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6085 6759 gene locus_tag LOCUS_06310 6085 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 6756 7343 gene locus_tag LOCUS_06320 6756 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence077 1988 315 gene locus_tag LOCUS_06330 1988 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 2526 2002 gene locus_tag LOCUS_06340 gene sigD 2526 2002 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972189.1 protein_id gnl|my_center|LOCUS_06340 4898 3060 gene locus_tag LOCUS_06350 4898 3060 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_06350 5147 6799 gene locus_tag LOCUS_06360 gene ppaC 5147 6799 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence078 3 1001 gene locus_tag LOCUS_06370 3 1001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_06370 998 2143 gene locus_tag LOCUS_06380 998 2143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_06380 3161 2088 gene locus_tag LOCUS_06390 3161 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120503.1 protein_id gnl|my_center|LOCUS_06390 3436 4329 gene locus_tag LOCUS_06400 3436 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 4642 4319 gene locus_tag LOCUS_06410 4642 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 5970 4723 gene locus_tag LOCUS_06420 5970 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 <7448 6090 gene locus_tag LOCUS_06430 <7448 6090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122594.1:9-O-acetylesterase >Feature sequence079 2434 1154 gene locus_tag LOCUS_06440 2434 1154 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119140.1 protein_id gnl|my_center|LOCUS_06440 2625 3356 gene locus_tag LOCUS_06450 2625 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4842 3388 gene locus_tag LOCUS_06460 4842 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence080 2791 716 gene locus_tag LOCUS_06470 2791 716 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120518.1 protein_id gnl|my_center|LOCUS_06470 3966 2776 gene locus_tag LOCUS_06480 gene dxr 3966 2776 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_06480 4140 6272 gene locus_tag LOCUS_06490 gene ftsH2 4140 6272 CDS product ATP-dependent zinc metalloprotease FtsH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URM7 protein_id gnl|my_center|LOCUS_06490 6422 6634 gene locus_tag LOCUS_06500 6422 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6687 7085 gene locus_tag LOCUS_06510 6687 7085 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337214.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence081 5101 1559 gene locus_tag LOCUS_06520 5101 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 6239 5373 gene locus_tag LOCUS_06530 6239 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 6599 6249 gene locus_tag LOCUS_06540 6599 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 6483 7127 gene locus_tag LOCUS_06550 6483 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence082 <1 816 gene locus_tag LOCUS_06560 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123048.1:prepilin-type N-terminal cleavage/methylation domain-containing protein 842 1153 gene locus_tag LOCUS_06570 842 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1164 2015 gene locus_tag LOCUS_06580 1164 2015 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_06580 2035 2322 gene locus_tag LOCUS_06590 2035 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2332 2934 gene locus_tag LOCUS_06600 gene trpG 2332 2934 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120844.1 protein_id gnl|my_center|LOCUS_06600 2931 4181 gene locus_tag LOCUS_06610 gene moeA 2931 4181 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_06610 5143 4232 gene locus_tag LOCUS_06620 gene thyX 5143 4232 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9L5 protein_id gnl|my_center|LOCUS_06620 5723 5376 gene locus_tag LOCUS_06630 5723 5376 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_06630 5826 6080 gene locus_tag LOCUS_06640 5826 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_06640 6141 6446 gene locus_tag LOCUS_06650 gene glnB 6141 6446 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327966.1 protein_id gnl|my_center|LOCUS_06650 7239 6436 gene locus_tag LOCUS_06660 7239 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence083 834 2726 gene locus_tag LOCUS_06670 834 2726 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGI3 protein_id gnl|my_center|LOCUS_06670 2842 4113 gene locus_tag LOCUS_06680 2842 4113 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121595.1 protein_id gnl|my_center|LOCUS_06680 5645 4149 gene locus_tag LOCUS_06690 5645 4149 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence084 1407 388 gene locus_tag LOCUS_06700 gene ftsY 1407 388 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT17 protein_id gnl|my_center|LOCUS_06700 1905 1456 gene locus_tag LOCUS_06710 gene nusB 1905 1456 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USA9 protein_id gnl|my_center|LOCUS_06710 2547 2002 gene locus_tag LOCUS_06720 gene ribH 2547 2002 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFR1 protein_id gnl|my_center|LOCUS_06720 3959 2556 gene locus_tag LOCUS_06730 gene rho 3959 2556 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGV0 protein_id gnl|my_center|LOCUS_06730 4767 4123 gene locus_tag LOCUS_06740 4767 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 <7115 4764 gene locus_tag LOCUS_06750 <7115 4764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391261.1:DNA polymerase I >Feature sequence085 244 2406 gene locus_tag LOCUS_06760 244 2406 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975036.1 protein_id gnl|my_center|LOCUS_06760 3319 2396 gene locus_tag LOCUS_06770 3319 2396 CDS product protein BmrU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120987.1 protein_id gnl|my_center|LOCUS_06770 3963 3478 gene locus_tag LOCUS_06780 3963 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4637 3960 gene locus_tag LOCUS_06790 4637 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4871 6358 gene locus_tag LOCUS_06800 4871 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence086 <1 748 gene locus_tag LOCUS_06810 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941349.1:transporter 773 1426 gene locus_tag LOCUS_06820 773 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1845 1474 gene locus_tag LOCUS_06830 1845 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_06830 2779 1898 gene locus_tag LOCUS_06840 2779 1898 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120889.1 protein_id gnl|my_center|LOCUS_06840 2983 4179 gene locus_tag LOCUS_06850 2983 4179 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_06850 4213 5028 gene locus_tag LOCUS_06860 4213 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_06860 5229 5471 gene locus_tag LOCUS_06870 5229 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5809 5441 gene locus_tag LOCUS_06880 5809 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence087 <1 1239 gene locus_tag LOCUS_06890 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121461.1:sigma-54-dependent Fis family transcriptional regulator 6636 1246 gene locus_tag LOCUS_06900 6636 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence088 451 254 gene locus_tag LOCUS_06910 451 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2319 472 gene locus_tag LOCUS_06920 2319 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 2412 4772 gene locus_tag LOCUS_06930 2412 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4895 6346 gene locus_tag LOCUS_06940 4895 6346 CDS product N-acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109363.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence089 2627 1791 gene locus_tag LOCUS_06950 2627 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 4713 3274 gene locus_tag LOCUS_06960 4713 3274 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_06960 5985 5320 gene locus_tag LOCUS_06970 5985 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6193 5963 gene locus_tag LOCUS_06980 6193 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence090 1850 795 gene locus_tag LOCUS_06990 gene apbE 1850 795 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P736 protein_id gnl|my_center|LOCUS_06990 1929 2432 gene locus_tag LOCUS_07000 1929 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120023.1 protein_id gnl|my_center|LOCUS_07000 2780 4291 gene locus_tag LOCUS_07010 2780 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118099.1 protein_id gnl|my_center|LOCUS_07010 4395 4859 gene locus_tag LOCUS_07020 4395 4859 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056590.1 protein_id gnl|my_center|LOCUS_07020 4868 6082 gene locus_tag LOCUS_07030 4868 6082 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119223.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence091 411 151 gene locus_tag LOCUS_07040 411 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1161 469 gene locus_tag LOCUS_07050 gene gmk 1161 469 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP92 protein_id gnl|my_center|LOCUS_07050 2049 1168 gene locus_tag LOCUS_07060 2049 1168 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121239.1 protein_id gnl|my_center|LOCUS_07060 2571 2065 gene locus_tag LOCUS_07070 2571 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3465 2677 gene locus_tag LOCUS_07080 gene tpiA 3465 2677 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_07080 4736 3549 gene locus_tag LOCUS_07090 4736 3549 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_07090 4984 6909 gene locus_tag LOCUS_07100 gene dnaK 4984 6909 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM31 protein_id gnl|my_center|LOCUS_07100 >Feature sequence092 442 2538 gene locus_tag LOCUS_07110 442 2538 CDS product protein-xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123507.1 protein_id gnl|my_center|LOCUS_07110 2639 4087 gene locus_tag LOCUS_07120 gene atsG 2639 4087 CDS product sulfatase atsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122623.1 protein_id gnl|my_center|LOCUS_07120 4167 5924 gene locus_tag LOCUS_07130 4167 5924 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_07130 <6875 5967 gene locus_tag LOCUS_07140 <6875 5967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120139.1:ATP-binding protein >Feature sequence093 1642 2988 gene locus_tag LOCUS_07150 1642 2988 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942594.1 protein_id gnl|my_center|LOCUS_07150 4660 3008 gene locus_tag LOCUS_07160 4660 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4848 6584 gene locus_tag LOCUS_07170 gene sir 4848 6584 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121401.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence094 839 1432 gene locus_tag LOCUS_07180 839 1432 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123703.1 protein_id gnl|my_center|LOCUS_07180 1524 2486 gene locus_tag LOCUS_07190 1524 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333498.1 protein_id gnl|my_center|LOCUS_07190 4602 2536 gene locus_tag LOCUS_07200 gene tkt 4602 2536 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123963.1 protein_id gnl|my_center|LOCUS_07200 6144 4723 gene locus_tag LOCUS_07210 6144 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence095 <1 697 gene locus_tag LOCUS_07220 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038347.1:2,5-dioxovalerate dehydrogenase 1932 1087 gene locus_tag LOCUS_07230 1932 1087 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091510.1 protein_id gnl|my_center|LOCUS_07230 2339 2064 gene locus_tag LOCUS_07240 2339 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334543.1 protein_id gnl|my_center|LOCUS_07240 3763 2495 gene locus_tag LOCUS_07250 3763 2495 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_07250 4341 3847 gene locus_tag LOCUS_07260 4341 3847 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173534.1 protein_id gnl|my_center|LOCUS_07260 5304 4534 gene locus_tag LOCUS_07270 5304 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence096 <1 5028 gene locus_tag LOCUS_07280 <1 5028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123507.1:protein-xanthan lyase 5025 6392 gene locus_tag LOCUS_07290 5025 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence097 <1 647 gene locus_tag LOCUS_07300 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123517.1:hydrolase 1326 685 gene locus_tag LOCUS_07310 1326 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122508.1 protein_id gnl|my_center|LOCUS_07310 2622 1381 gene locus_tag LOCUS_07320 2622 1381 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL80 protein_id gnl|my_center|LOCUS_07320 3482 2622 gene locus_tag LOCUS_07330 3482 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3851 3582 gene locus_tag LOCUS_07340 3851 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 5051 4077 gene locus_tag LOCUS_07350 5051 4077 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119523.1 protein_id gnl|my_center|LOCUS_07350 <6580 5126 gene locus_tag LOCUS_07360 <6580 5126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121181.1:L-sorbosone dehydrogenase >Feature sequence098 <1 526 gene locus_tag LOCUS_07370 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UXF1:alanine dehydrogenase 599 1672 gene locus_tag LOCUS_07380 gene mtnA 599 1672 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ8 protein_id gnl|my_center|LOCUS_07380 1724 3058 gene locus_tag LOCUS_07390 gene der 1724 3058 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URJ8 protein_id gnl|my_center|LOCUS_07390 3797 3030 gene locus_tag LOCUS_07400 3797 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 4431 5210 gene locus_tag LOCUS_07410 4431 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 5294 6076 gene locus_tag LOCUS_07420 5294 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence099 2365 269 gene locus_tag LOCUS_07430 2365 269 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_07430 2279 2572 gene locus_tag LOCUS_07440 2279 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3652 2642 gene locus_tag LOCUS_07450 3652 2642 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_07450 3812 4342 gene locus_tag LOCUS_07460 3812 4342 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_07460 4351 4731 gene locus_tag LOCUS_07470 4351 4731 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_07470 6000 4747 gene locus_tag LOCUS_07480 6000 4747 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence100 2697 766 gene locus_tag LOCUS_07490 2697 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3283 2864 gene locus_tag LOCUS_07500 3283 2864 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120691.1 protein_id gnl|my_center|LOCUS_07500 4159 3386 gene locus_tag LOCUS_07510 4159 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5872 4274 gene locus_tag LOCUS_07520 gene comM 5872 4274 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence101 <1 1832 gene locus_tag LOCUS_07530 <1 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UDY6:protein translocase subunit SecA 1 1836 3212 gene locus_tag LOCUS_07540 gene kdtA 1836 3212 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_07540 3279 4457 gene locus_tag LOCUS_07550 gene metK 3279 4457 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URU7 protein_id gnl|my_center|LOCUS_07550 4617 5405 gene locus_tag LOCUS_07560 4617 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence102 2297 903 gene locus_tag LOCUS_07570 gene folC 2297 903 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05865 protein_id gnl|my_center|LOCUS_07570 2546 3640 gene locus_tag LOCUS_07580 2546 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 4634 3645 gene locus_tag LOCUS_07590 4634 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4848 5483 gene locus_tag LOCUS_07600 4848 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence103 <1 737 gene locus_tag LOCUS_07610 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123891.1:serine protease 1063 851 gene locus_tag LOCUS_07620 1063 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_07620 5620 1544 gene locus_tag LOCUS_07630 5620 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 6236 6006 gene locus_tag LOCUS_07640 6236 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 6315 6461 gene locus_tag LOCUS_07650 6315 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence104 3370 1151 gene locus_tag LOCUS_07660 3370 1151 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121437.1 protein_id gnl|my_center|LOCUS_07660 3648 4181 gene locus_tag LOCUS_07670 gene smpB 3648 4181 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH38 protein_id gnl|my_center|LOCUS_07670 4491 4270 gene locus_tag LOCUS_07680 4491 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4893 6263 gene locus_tag LOCUS_07690 4893 6263 CDS product K+ transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393256.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence105 2670 2005 gene locus_tag LOCUS_07700 2670 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2611 2829 gene locus_tag LOCUS_07710 2611 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3474 4244 gene locus_tag LOCUS_07720 gene nagB 3474 4244 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_07720 4253 5170 gene locus_tag LOCUS_07730 gene nagA 4253 5170 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_07730 <6447 5244 gene locus_tag LOCUS_07740 <6447 5244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089230.1:ABC transporter permease >Feature sequence106 1895 1416 gene locus_tag LOCUS_07750 1895 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2115 4868 gene locus_tag LOCUS_07760 2115 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4890 4964 gene locus_tag LOCUS_t00090 4890 4964 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5035 5643 gene locus_tag LOCUS_07770 gene ruvC 5035 5643 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US71 protein_id gnl|my_center|LOCUS_07770 5646 6275 gene locus_tag LOCUS_07780 gene ruvA 5646 6275 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USB0 protein_id gnl|my_center|LOCUS_07780 >Feature sequence107 1855 974 gene locus_tag LOCUS_07790 1855 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2078 2551 gene locus_tag LOCUS_07800 gene accB 2078 2551 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121914.1 protein_id gnl|my_center|LOCUS_07800 2664 4007 gene locus_tag LOCUS_07810 gene accC 2664 4007 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_07810 4134 5444 gene locus_tag LOCUS_07820 gene pfkA 4134 5444 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121457.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence108 1371 1895 gene locus_tag LOCUS_07830 1371 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2032 3111 gene locus_tag LOCUS_07840 2032 3111 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_07840 3153 3974 gene locus_tag LOCUS_07850 3153 3974 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_07850 4973 3999 gene locus_tag LOCUS_07860 4973 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence109 1909 977 gene locus_tag LOCUS_07870 1909 977 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_07870 1871 2131 gene locus_tag LOCUS_07880 1871 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2169 4373 gene locus_tag LOCUS_07890 2169 4373 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123527.1 protein_id gnl|my_center|LOCUS_07890 4591 5151 gene locus_tag LOCUS_07900 4591 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence110 3876 2926 gene locus_tag LOCUS_07910 3876 2926 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_07910 4979 3897 gene locus_tag LOCUS_07920 gene cheB 4979 3897 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MK5 protein_id gnl|my_center|LOCUS_07920 5209 5745 gene locus_tag LOCUS_07930 gene cheW64H-2 5209 5745 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943214.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence111 493 1848 gene locus_tag LOCUS_07940 493 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2219 4849 gene locus_tag LOCUS_07950 2219 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence112 47 1708 gene locus_tag LOCUS_07960 gene pstA 47 1708 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_07960 1869 2615 gene locus_tag LOCUS_07970 gene pstB 1869 2615 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM15 protein_id gnl|my_center|LOCUS_07970 2674 3333 gene locus_tag LOCUS_07980 gene phoU 2674 3333 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_07980 3702 3229 gene locus_tag LOCUS_07990 3702 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4324 5112 gene locus_tag LOCUS_08000 4324 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5260 6039 gene locus_tag LOCUS_08010 5260 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269372.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence113 1854 1120 gene locus_tag LOCUS_08020 1854 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_08020 2162 3769 gene locus_tag LOCUS_08030 gene ndhF 2162 3769 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118221.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence114 <1 882 gene locus_tag LOCUS_08040 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328443.1:hemolysin D 888 2492 gene locus_tag LOCUS_08050 888 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2588 3463 gene locus_tag LOCUS_08060 gene ykwC 2588 3463 CDS product putative oxidoreductase YkwC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34948 protein_id gnl|my_center|LOCUS_08060 3453 4556 gene locus_tag LOCUS_08070 3453 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4586 5863 gene locus_tag LOCUS_08080 4586 5863 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence115 1251 238 gene locus_tag LOCUS_08090 1251 238 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119412.1 protein_id gnl|my_center|LOCUS_08090 1558 2805 gene locus_tag LOCUS_08100 1558 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_08100 2841 3674 gene locus_tag LOCUS_08110 2841 3674 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117794.1 protein_id gnl|my_center|LOCUS_08110 3709 4167 gene locus_tag LOCUS_08120 3709 4167 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_08120 4287 5219 gene locus_tag LOCUS_08130 4287 5219 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117796.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence116 2057 6 gene locus_tag LOCUS_08140 gene nadE 2057 6 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_08140 3993 2065 gene locus_tag LOCUS_08150 gene speA 3993 2065 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTS2 protein_id gnl|my_center|LOCUS_08150 5424 4138 gene locus_tag LOCUS_08160 5424 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence117 71 271 gene locus_tag LOCUS_08170 71 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 903 214 gene locus_tag LOCUS_08180 903 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1986 1351 gene locus_tag LOCUS_08190 1986 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2989 2012 gene locus_tag LOCUS_08200 2989 2012 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_08200 4317 3022 gene locus_tag LOCUS_08210 4317 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_08210 <6182 4428 gene locus_tag LOCUS_08220 <6182 4428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121151.1:cytochrome c >Feature sequence118 577 431 gene locus_tag LOCUS_08230 577 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1663 1394 gene locus_tag LOCUS_08240 1663 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2755 2943 gene locus_tag LOCUS_08250 2755 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence119 248 3238 gene locus_tag LOCUS_08260 248 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3244 3537 gene locus_tag LOCUS_08270 3244 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3540 3983 gene locus_tag LOCUS_08280 3540 3983 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_08280 4150 5049 gene locus_tag LOCUS_08290 gene moaA 4150 5049 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT69 protein_id gnl|my_center|LOCUS_08290 >Feature sequence120 1678 773 gene locus_tag LOCUS_08300 1678 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1960 3195 gene locus_tag LOCUS_08310 1960 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3501 5117 gene locus_tag LOCUS_08320 3501 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence121 1965 205 gene locus_tag LOCUS_08330 gene ask 1965 205 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_08330 3240 1984 gene locus_tag LOCUS_08340 gene bcpC 3240 1984 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_868623.2 protein_id gnl|my_center|LOCUS_08340 4581 3274 gene locus_tag LOCUS_08350 gene hom 4581 3274 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFK4 protein_id gnl|my_center|LOCUS_08350 4733 5803 gene locus_tag LOCUS_08360 gene celM 4733 5803 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121909.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence122 1566 580 gene locus_tag LOCUS_08370 1566 580 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_08370 2343 1633 gene locus_tag LOCUS_08380 2343 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 3290 2469 gene locus_tag LOCUS_08390 3290 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 3195 3413 gene locus_tag LOCUS_08400 3195 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5790 3451 gene locus_tag LOCUS_08410 5790 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence123 22 1311 gene locus_tag LOCUS_08420 22 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1315 3138 gene locus_tag LOCUS_08430 gene degP 1315 3138 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121355.1 protein_id gnl|my_center|LOCUS_08430 3162 4190 gene locus_tag LOCUS_08440 gene degP 3162 4190 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121356.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence124 674 865 gene locus_tag LOCUS_08450 674 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 862 1074 gene locus_tag LOCUS_08460 862 1074 CDS product addiction module toxin, HicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119264.1 protein_id gnl|my_center|LOCUS_08460 1624 1247 gene locus_tag LOCUS_08470 1624 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2030 3418 gene locus_tag LOCUS_08480 2030 3418 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119957.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence125 1094 4282 gene locus_tag LOCUS_08490 1094 4282 CDS product large multi-functional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119677.1 protein_id gnl|my_center|LOCUS_08490 4288 5580 gene locus_tag LOCUS_08500 4288 5580 CDS product polysaccharide pyruvyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence126 2787 1393 gene locus_tag LOCUS_08510 gene strI 2787 1393 CDS product streptomycin biosynthesis protein StrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence127 2371 1415 gene locus_tag LOCUS_08520 2371 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2607 3497 gene locus_tag LOCUS_08530 2607 3497 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122497.1 protein_id gnl|my_center|LOCUS_08530 3494 4768 gene locus_tag LOCUS_08540 gene hemA 3494 4768 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKZ2 protein_id gnl|my_center|LOCUS_08540 5944 4841 gene locus_tag LOCUS_08550 5944 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119080.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence128 1074 52 gene locus_tag LOCUS_08560 1074 52 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119907.1 protein_id gnl|my_center|LOCUS_08560 1703 1155 gene locus_tag LOCUS_08570 1703 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532362.1 protein_id gnl|my_center|LOCUS_08570 1849 4080 gene locus_tag LOCUS_08580 1849 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4384 4740 gene locus_tag LOCUS_08590 4384 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326218.1 protein_id gnl|my_center|LOCUS_08590 <5975 4764 gene locus_tag LOCUS_08600 <5975 4764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118912.1:oxidoreductase >Feature sequence129 2302 1115 gene locus_tag LOCUS_08610 2302 1115 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_08610 2897 2310 gene locus_tag LOCUS_08620 2897 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3366 4838 gene locus_tag LOCUS_08630 3366 4838 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120429.1 protein_id gnl|my_center|LOCUS_08630 <5925 4858 gene locus_tag LOCUS_08640 <5925 4858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788731.1:phosphate starvation protein PhoH >Feature sequence130 1 339 gene locus_tag LOCUS_08650 1 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 336 854 gene locus_tag LOCUS_08660 336 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950781.1 protein_id gnl|my_center|LOCUS_08660 851 1762 gene locus_tag LOCUS_08670 851 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1731 2063 gene locus_tag LOCUS_08680 1731 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3649 2609 gene locus_tag LOCUS_08690 3649 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121358.1 protein_id gnl|my_center|LOCUS_08690 3744 4655 gene locus_tag LOCUS_08700 3744 4655 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090676.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence131 2047 992 gene locus_tag LOCUS_08710 2047 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5009 2082 gene locus_tag LOCUS_08720 5009 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence132 1447 428 gene locus_tag LOCUS_08730 gene ispH 1447 428 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_08730 1635 1465 gene locus_tag LOCUS_08740 1635 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1651 2457 gene locus_tag LOCUS_08750 gene ctrB 1651 2457 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122225.1 protein_id gnl|my_center|LOCUS_08750 2465 3325 gene locus_tag LOCUS_08760 gene crtB 2465 3325 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_08760 3561 3388 gene locus_tag LOCUS_08770 3561 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3568 4791 gene locus_tag LOCUS_08780 gene pds 3568 4791 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_08780 5003 5359 gene locus_tag LOCUS_08790 5003 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5465 5749 gene locus_tag LOCUS_08800 5465 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence133 2725 836 gene locus_tag LOCUS_08810 2725 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4089 2722 gene locus_tag LOCUS_08820 4089 2722 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_08820 4295 5074 gene locus_tag LOCUS_08830 4295 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence134 2556 1468 gene locus_tag LOCUS_08840 2556 1468 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_08840 2976 2608 gene locus_tag LOCUS_08850 2976 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4753 3161 gene locus_tag LOCUS_08860 gene gppA-2 4753 3161 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence135 2461 473 gene locus_tag LOCUS_08870 gene shc 2461 473 CDS product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_08870 4197 2857 gene locus_tag LOCUS_08880 4197 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 4786 4199 gene locus_tag LOCUS_08890 4786 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 5213 5043 gene locus_tag LOCUS_08900 5213 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence136 <1 640 gene locus_tag LOCUS_08910 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122408.1:N-acetylgalactosamine-6-sulfatase 1601 771 gene locus_tag LOCUS_08920 1601 771 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336826.1 protein_id gnl|my_center|LOCUS_08920 1714 5019 gene locus_tag LOCUS_08930 1714 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence137 2838 1681 gene locus_tag LOCUS_08940 2838 1681 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229351.1 protein_id gnl|my_center|LOCUS_08940 3381 2926 gene locus_tag LOCUS_08950 3381 2926 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_08950 5402 3405 gene locus_tag LOCUS_08960 5402 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence138 417 611 gene locus_tag LOCUS_08970 gene rpsU 417 611 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UZ14 protein_id gnl|my_center|LOCUS_08970 1600 644 gene locus_tag LOCUS_08980 gene nadC 1600 644 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121013.1 protein_id gnl|my_center|LOCUS_08980 1809 2132 gene locus_tag LOCUS_08990 1809 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2137 4224 gene locus_tag LOCUS_09000 gene uvrB 2137 4224 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR2 protein_id gnl|my_center|LOCUS_09000 4240 4911 gene locus_tag LOCUS_09010 4240 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 <5835 4917 gene locus_tag LOCUS_09020 <5835 4917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919474.1:transglutaminase >Feature sequence139 428 1666 gene locus_tag LOCUS_09030 428 1666 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122038.1 protein_id gnl|my_center|LOCUS_09030 2642 1800 gene locus_tag LOCUS_09040 2642 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3119 3970 gene locus_tag LOCUS_09050 3119 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123367.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence140 2362 1055 gene locus_tag LOCUS_09060 gene sucB 2362 1055 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX6 protein_id gnl|my_center|LOCUS_09060 5540 2514 gene locus_tag LOCUS_09070 gene sucA 5540 2514 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326049.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence141 1082 1354 gene locus_tag LOCUS_09080 1082 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1384 1983 gene locus_tag LOCUS_09090 1384 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1980 2216 gene locus_tag LOCUS_09100 1980 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence142 <1 1157 gene locus_tag LOCUS_09110 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056444.1:hopanoid biosynthesis associated radical SAM protein HpnH 2219 1158 gene locus_tag LOCUS_09120 2219 1158 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174053.1 protein_id gnl|my_center|LOCUS_09120 2713 2285 gene locus_tag LOCUS_09130 2713 2285 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256843.1 protein_id gnl|my_center|LOCUS_09130 3659 2766 gene locus_tag LOCUS_09140 3659 2766 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 protein_id gnl|my_center|LOCUS_09140 3924 5597 gene locus_tag LOCUS_09150 3924 5597 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence143 1045 53 gene locus_tag LOCUS_09160 1045 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1144 2961 gene locus_tag LOCUS_09170 1144 2961 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533077.1 protein_id gnl|my_center|LOCUS_09170 3022 4578 gene locus_tag LOCUS_09180 gene glpK 3022 4578 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBZ5 protein_id gnl|my_center|LOCUS_09180 5240 4575 gene locus_tag LOCUS_09190 5240 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence144 <1 1836 gene locus_tag LOCUS_09200 <1 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123096.1:N-acetylgalactosamine-6-sulfatase 2630 2226 gene locus_tag LOCUS_09210 2630 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3931 2972 gene locus_tag LOCUS_09220 3931 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4053 5228 gene locus_tag LOCUS_09230 4053 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 5367 5173 gene locus_tag LOCUS_09240 5367 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence145 >Feature sequence146 1665 3119 gene locus_tag LOCUS_09250 1665 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 3157 4527 gene locus_tag LOCUS_09260 3157 4527 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_09260 4555 5391 gene locus_tag LOCUS_09270 4555 5391 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528434.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence147 637 2682 gene locus_tag LOCUS_09280 637 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_09280 2764 4065 gene locus_tag LOCUS_09290 2764 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_09290 4232 4519 gene locus_tag LOCUS_09300 4232 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence148 <1 1185 gene locus_tag LOCUS_09310 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393094.1:voltage gated Cl- channel protein 2050 1160 gene locus_tag LOCUS_09320 2050 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2250 3293 gene locus_tag LOCUS_09330 2250 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence149 1367 624 gene locus_tag LOCUS_09340 1367 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1677 2504 gene locus_tag LOCUS_09350 gene hydH 1677 2504 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121413.1 protein_id gnl|my_center|LOCUS_09350 2578 4020 gene locus_tag LOCUS_09360 gene chlI 2578 4020 CDS product magnesium protoporphyrin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117844.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence150 756 109 gene locus_tag LOCUS_09370 756 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 898 1380 gene locus_tag LOCUS_09380 898 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121836.1 protein_id gnl|my_center|LOCUS_09380 1611 2795 gene locus_tag LOCUS_09390 gene desA 1611 2795 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125366.1 protein_id gnl|my_center|LOCUS_09390 3134 3481 gene locus_tag LOCUS_09400 3134 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4258 3527 gene locus_tag LOCUS_09410 4258 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence151 744 4451 gene locus_tag LOCUS_09420 gene smc 744 4451 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQV4 protein_id gnl|my_center|LOCUS_09420 4818 5390 gene locus_tag LOCUS_09430 4818 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence152 3304 1727 gene locus_tag LOCUS_09440 3304 1727 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_09440 4440 3301 gene locus_tag LOCUS_09450 4440 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 4873 4646 gene locus_tag LOCUS_09460 4873 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence153 1037 108 gene locus_tag LOCUS_09470 1037 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119429.1 protein_id gnl|my_center|LOCUS_09470 1515 2999 gene locus_tag LOCUS_09480 1515 2999 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_09480 2996 3706 gene locus_tag LOCUS_09490 2996 3706 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_09490 4027 3734 gene locus_tag LOCUS_09500 4027 3734 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_09500 4257 4024 gene locus_tag LOCUS_09510 4257 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 <5578 4347 gene locus_tag LOCUS_09520 <5578 4347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPM9:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence154 445 672 gene locus_tag LOCUS_09530 gene thiS 445 672 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_09530 709 1569 gene locus_tag LOCUS_09540 gene thiG 709 1569 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US84 protein_id gnl|my_center|LOCUS_09540 1581 2363 gene locus_tag LOCUS_09550 gene hisF 1581 2363 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ9 protein_id gnl|my_center|LOCUS_09550 2480 3649 gene locus_tag LOCUS_09560 gene pilT 2480 3649 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence155 1230 2117 gene locus_tag LOCUS_09570 1230 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121285.1 protein_id gnl|my_center|LOCUS_09570 2114 3571 gene locus_tag LOCUS_09580 2114 3571 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122935.1 protein_id gnl|my_center|LOCUS_09580 4625 3711 gene locus_tag LOCUS_09590 4625 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117736.1 protein_id gnl|my_center|LOCUS_09590 <5541 4669 gene locus_tag LOCUS_09600 <5541 4669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404337.1:auracyanin A >Feature sequence156 1440 1991 gene locus_tag LOCUS_09610 1440 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2259 2002 gene locus_tag LOCUS_09620 2259 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2380 3066 gene locus_tag LOCUS_09630 2380 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3214 3141 gene locus_tag LOCUS_t00100 3214 3141 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3392 5182 gene locus_tag LOCUS_09640 3392 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence157 902 1594 gene locus_tag LOCUS_09650 902 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1578 2105 gene locus_tag LOCUS_09660 1578 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2106 3302 gene locus_tag LOCUS_09670 2106 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 <5519 3307 gene locus_tag LOCUS_09680 <5519 3307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121893.1:secretion protein >Feature sequence158 283 708 gene locus_tag LOCUS_09690 283 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2444 1005 gene locus_tag LOCUS_09700 2444 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123574.1 protein_id gnl|my_center|LOCUS_09700 5348 2484 gene locus_tag LOCUS_09710 5348 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123573.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence159 671 1063 gene locus_tag LOCUS_09720 671 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2265 1078 gene locus_tag LOCUS_09730 2265 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2496 2284 gene locus_tag LOCUS_09740 2496 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2885 2586 gene locus_tag LOCUS_09750 2885 2586 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_09750 3511 2972 gene locus_tag LOCUS_09760 gene grpE 3511 2972 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM95 protein_id gnl|my_center|LOCUS_09760 4734 3586 gene locus_tag LOCUS_09770 gene dnaJ 4734 3586 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM96 protein_id gnl|my_center|LOCUS_09770 <5496 4911 gene locus_tag LOCUS_09780 <5496 4911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UM97:60 kDa chaperonin 2 >Feature sequence160 2301 799 gene locus_tag LOCUS_09790 gene GALNS 2301 799 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121448.1 protein_id gnl|my_center|LOCUS_09790 <5461 2306 gene locus_tag LOCUS_09800 <5461 2306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122060.1:cytochrome c >Feature sequence161 1564 671 gene locus_tag LOCUS_09810 1564 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3297 1561 gene locus_tag LOCUS_09820 gene nosR 3297 1561 CDS product NosR regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121575.1 protein_id gnl|my_center|LOCUS_09820 3528 4973 gene locus_tag LOCUS_09830 3528 4973 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767327.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence162 2831 1728 gene locus_tag LOCUS_09840 2831 1728 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_09840 4432 2936 gene locus_tag LOCUS_09850 4432 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4942 4631 gene locus_tag LOCUS_09860 gene yhjQ 4942 4631 CDS product putative cysteine-rich protein YhjQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07571 protein_id gnl|my_center|LOCUS_09860 4824 5084 gene locus_tag LOCUS_09870 4824 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence163 520 305 gene locus_tag LOCUS_09880 520 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 466 1776 gene locus_tag LOCUS_09890 gene rlmN 466 1776 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHU7 protein_id gnl|my_center|LOCUS_09890 1908 1690 gene locus_tag LOCUS_09900 1908 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2643 1933 gene locus_tag LOCUS_09910 2643 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3623 2721 gene locus_tag LOCUS_09920 3623 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3695 4390 gene locus_tag LOCUS_09930 3695 4390 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD9 protein_id gnl|my_center|LOCUS_09930 5313 4375 gene locus_tag LOCUS_09940 5313 4375 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence164 998 2140 gene locus_tag LOCUS_09950 998 2140 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_09950 2204 2656 gene locus_tag LOCUS_09960 gene rpiB 2204 2656 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_09960 3037 3714 gene locus_tag LOCUS_09970 3037 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121374.1 protein_id gnl|my_center|LOCUS_09970 5314 3914 gene locus_tag LOCUS_09980 5314 3914 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence165 1481 639 gene locus_tag LOCUS_09990 1481 639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122565.1 protein_id gnl|my_center|LOCUS_09990 2153 1548 gene locus_tag LOCUS_10000 2153 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2934 2212 gene locus_tag LOCUS_10010 2934 2212 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_10010 3983 2991 gene locus_tag LOCUS_10020 3983 2991 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKE8 protein_id gnl|my_center|LOCUS_10020 5080 4112 gene locus_tag LOCUS_10030 5080 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence166 777 703 gene locus_tag LOCUS_t00110 777 703 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 828 1061 gene locus_tag LOCUS_10040 828 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1976 942 gene locus_tag LOCUS_10050 1976 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2403 2134 gene locus_tag LOCUS_10060 2403 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3589 2909 gene locus_tag LOCUS_10070 gene lplA 3589 2909 CDS product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_10070 3830 4822 gene locus_tag LOCUS_10080 3830 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence167 877 290 gene locus_tag LOCUS_10090 gene dcd 877 290 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_10090 1730 1041 gene locus_tag LOCUS_10100 gene nth 1730 1041 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 protein_id gnl|my_center|LOCUS_10100 1878 2306 gene locus_tag LOCUS_10110 1878 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2299 2991 gene locus_tag LOCUS_10120 gene lon 2299 2991 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_10120 3441 3974 gene locus_tag LOCUS_10130 gene folE 3441 3974 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJJ7 protein_id gnl|my_center|LOCUS_10130 4069 4887 gene locus_tag LOCUS_10140 4069 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence168 <1 597 gene locus_tag LOCUS_10150 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121978.1:prepilin-type N-terminal cleavage/methylation domain-containing protein 608 1129 gene locus_tag LOCUS_10160 608 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1244 2290 gene locus_tag LOCUS_10170 1244 2290 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_10170 2309 2821 gene locus_tag LOCUS_10180 2309 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2909 3934 gene locus_tag LOCUS_10190 2909 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 <5305 3906 gene locus_tag LOCUS_10200 <5305 3906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121306.1:RNA-binding protein >Feature sequence169 1167 469 gene locus_tag LOCUS_10210 1167 469 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_10210 2691 1294 gene locus_tag LOCUS_10220 2691 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 4952 2742 gene locus_tag LOCUS_10230 4952 2742 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence170 941 1792 gene locus_tag LOCUS_10240 941 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2442 3902 gene locus_tag LOCUS_10250 2442 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4004 4933 gene locus_tag LOCUS_10260 4004 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660854.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence171 1986 487 gene locus_tag LOCUS_10270 gene proS 1986 487 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_10270 2108 3127 gene locus_tag LOCUS_10280 2108 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_10280 3181 5244 gene locus_tag LOCUS_10290 gene rnr 3181 5244 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR0 protein_id gnl|my_center|LOCUS_10290 >Feature sequence172 304 1800 gene locus_tag LOCUS_10300 gene lysS 304 1800 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK37 protein_id gnl|my_center|LOCUS_10300 1818 3443 gene locus_tag LOCUS_10310 gene lolC 1818 3443 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_10310 3436 4170 gene locus_tag LOCUS_10320 gene lolD2 3436 4170 CDS product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPK3 protein_id gnl|my_center|LOCUS_10320 4351 5208 gene locus_tag LOCUS_10330 gene ilvE 4351 5208 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence173 474 1499 gene locus_tag LOCUS_10340 474 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118962.1 protein_id gnl|my_center|LOCUS_10340 1543 2814 gene locus_tag LOCUS_10350 gene hemN 1543 2814 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_10350 2968 4782 gene locus_tag LOCUS_10360 2968 4782 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence174 31 252 gene locus_tag LOCUS_10370 gene infA 31 252 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY5 protein_id gnl|my_center|LOCUS_10370 3287 288 gene locus_tag LOCUS_10380 3287 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3595 4887 gene locus_tag LOCUS_10390 gene degT 3595 4887 CDS product pleiotropic regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118241.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence175 2504 1149 gene locus_tag LOCUS_10400 gene argH 2504 1149 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK64 protein_id gnl|my_center|LOCUS_10400 2896 5013 gene locus_tag LOCUS_10410 gene yoaA 2896 5013 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence176 403 996 gene locus_tag LOCUS_10420 403 996 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120644.1 protein_id gnl|my_center|LOCUS_10420 2755 977 gene locus_tag LOCUS_10430 2755 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3036 2785 gene locus_tag LOCUS_10440 3036 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <5154 3132 gene locus_tag LOCUS_10450 <5154 3132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin >Feature sequence177 178 1059 gene locus_tag LOCUS_10460 178 1059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120864.1 protein_id gnl|my_center|LOCUS_10460 1115 1933 gene locus_tag LOCUS_10470 1115 1933 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120863.1 protein_id gnl|my_center|LOCUS_10470 1953 2915 gene locus_tag LOCUS_10480 1953 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031014.1 protein_id gnl|my_center|LOCUS_10480 3122 3982 gene locus_tag LOCUS_10490 3122 3982 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_10490 4624 4265 gene locus_tag LOCUS_10500 4624 4265 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122185.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence178 1033 2553 gene locus_tag LOCUS_10510 1033 2553 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence179 1259 216 gene locus_tag LOCUS_10520 1259 216 CDS product iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_10520 2104 1382 gene locus_tag LOCUS_10530 2104 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2614 3507 gene locus_tag LOCUS_10540 2614 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 4681 3716 gene locus_tag LOCUS_10550 gene accA 4681 3716 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY7 protein_id gnl|my_center|LOCUS_10550 >Feature sequence180 1949 2182 gene locus_tag LOCUS_10560 1949 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2810 2184 gene locus_tag LOCUS_10570 2810 2184 CDS product hydrolase phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123566.1 protein_id gnl|my_center|LOCUS_10570 2878 4557 gene locus_tag LOCUS_10580 gene ilvD 2878 4557 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ69 protein_id gnl|my_center|LOCUS_10580 >Feature sequence181 632 2203 gene locus_tag LOCUS_10590 632 2203 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532746.1 protein_id gnl|my_center|LOCUS_10590 2275 3489 gene locus_tag LOCUS_10600 2275 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence182 <1 952 gene locus_tag LOCUS_10610 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMC0:leucine--tRNA ligase 1162 2487 gene locus_tag LOCUS_10620 gene glgC 1162 2487 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337168.1 protein_id gnl|my_center|LOCUS_10620 2962 2489 gene locus_tag LOCUS_10630 2962 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3908 3099 gene locus_tag LOCUS_10640 3908 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence183 842 51 gene locus_tag LOCUS_10650 842 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1101 850 gene locus_tag LOCUS_10660 1101 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1963 1304 gene locus_tag LOCUS_10670 1963 1304 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325534.1 protein_id gnl|my_center|LOCUS_10670 2970 2134 gene locus_tag LOCUS_10680 2970 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3353 2967 gene locus_tag LOCUS_10690 gene gcvH 3353 2967 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6Y8 protein_id gnl|my_center|LOCUS_10690 4599 3436 gene locus_tag LOCUS_10700 gene gcvT 4599 3436 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNG8 protein_id gnl|my_center|LOCUS_10700 >Feature sequence184 1521 286 gene locus_tag LOCUS_10710 1521 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1761 3962 gene locus_tag LOCUS_10720 1761 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 4620 3982 gene locus_tag LOCUS_10730 4620 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence185 <1 952 gene locus_tag LOCUS_10740 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389780.1:cysteine desulfurase 2798 939 gene locus_tag LOCUS_10750 gene shc 2798 939 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120685.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence186 261 1412 gene locus_tag LOCUS_10760 gene metB 261 1412 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120921.1 protein_id gnl|my_center|LOCUS_10760 1567 3471 gene locus_tag LOCUS_10770 1567 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence187 71 3022 gene locus_tag LOCUS_10780 gene purL 71 3022 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URX8 protein_id gnl|my_center|LOCUS_10780 3073 3855 gene locus_tag LOCUS_10790 gene pfaS 3073 3855 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_10790 3985 4875 gene locus_tag LOCUS_10800 3985 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence188 <1 794 gene locus_tag LOCUS_10810 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887660.1:rRNA methyltransferase 804 2060 gene locus_tag LOCUS_10820 804 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118845.1 protein_id gnl|my_center|LOCUS_10820 2545 2072 gene locus_tag LOCUS_10830 2545 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4272 2782 gene locus_tag LOCUS_10840 gene glgA 4272 2782 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPY2 protein_id gnl|my_center|LOCUS_10840 >Feature sequence189 258 1934 gene locus_tag LOCUS_10850 258 1934 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_10850 2233 4296 gene locus_tag LOCUS_10860 2233 4296 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_10860 <4935 4309 gene locus_tag LOCUS_10870 <4935 4309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ULX4:NAD(P)H-hydrate epimerase >Feature sequence190 507 1349 gene locus_tag LOCUS_10880 gene punA 507 1349 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ11 protein_id gnl|my_center|LOCUS_10880 2385 1354 gene locus_tag LOCUS_10890 2385 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2541 3851 gene locus_tag LOCUS_10900 2541 3851 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence191 1490 348 gene locus_tag LOCUS_10910 1490 348 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_10910 2009 1572 gene locus_tag LOCUS_10920 2009 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2267 4294 gene locus_tag LOCUS_10930 gene flhA 2267 4294 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence192 1810 1142 gene locus_tag LOCUS_10940 1810 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2644 1856 gene locus_tag LOCUS_10950 2644 1856 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086579.1 protein_id gnl|my_center|LOCUS_10950 <4913 2701 gene locus_tag LOCUS_10960 <4913 2701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119311.1:sodium:solute symporter >Feature sequence193 795 142 gene locus_tag LOCUS_10970 795 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 973 1046 gene locus_tag LOCUS_t00120 973 1046 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1237 2691 gene locus_tag LOCUS_10980 gene tig 1237 2691 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URG5 protein_id gnl|my_center|LOCUS_10980 2738 3400 gene locus_tag LOCUS_10990 gene clpP1 2738 3400 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK67 protein_id gnl|my_center|LOCUS_10990 3699 4313 gene locus_tag LOCUS_11000 gene clpP2 3699 4313 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK66 protein_id gnl|my_center|LOCUS_11000 >Feature sequence194 421 2064 gene locus_tag LOCUS_11010 421 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2290 2823 gene locus_tag LOCUS_11020 gene sigD 2290 2823 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972189.1 protein_id gnl|my_center|LOCUS_11020 2820 4349 gene locus_tag LOCUS_11030 2820 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence195 2420 336 gene locus_tag LOCUS_11040 2420 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4110 2761 gene locus_tag LOCUS_11050 4110 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence196 1745 3256 gene locus_tag LOCUS_11060 1745 3256 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118737.1 protein_id gnl|my_center|LOCUS_11060 3253 4818 gene locus_tag LOCUS_11070 3253 4818 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence197 <1 1626 gene locus_tag LOCUS_11080 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123323.1:squalene--hopene cyclase 2105 1608 gene locus_tag LOCUS_11090 gene spoU 2105 1608 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU01 protein_id gnl|my_center|LOCUS_11090 2202 3365 gene locus_tag LOCUS_11100 gene ispG 2202 3365 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWC8 protein_id gnl|my_center|LOCUS_11100 >Feature sequence198 4319 3366 gene locus_tag LOCUS_11110 4319 3366 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence199 1947 970 gene locus_tag LOCUS_11120 1947 970 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_11120 2085 3062 gene locus_tag LOCUS_11130 2085 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence200 <1 2496 gene locus_tag LOCUS_11140 <1 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140940.1:peptidase U32 2534 4741 gene locus_tag LOCUS_11150 2534 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence201 371 1921 gene locus_tag LOCUS_11160 371 1921 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121705.1 protein_id gnl|my_center|LOCUS_11160 2286 3458 gene locus_tag LOCUS_11170 2286 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3757 3497 gene locus_tag LOCUS_11180 3757 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_11180 3985 3770 gene locus_tag LOCUS_11190 3985 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 <4708 4083 gene locus_tag LOCUS_11200 <4708 4083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118678.1:heparan N-sulfatase >Feature sequence202 1786 1082 gene locus_tag LOCUS_11210 1786 1082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_11210 2043 3491 gene locus_tag LOCUS_11220 2043 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4643 3510 gene locus_tag LOCUS_11230 4643 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence203 2 871 gene locus_tag LOCUS_11240 2 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2150 900 gene locus_tag LOCUS_11250 2150 900 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122959.1 protein_id gnl|my_center|LOCUS_11250 2725 2165 gene locus_tag LOCUS_11260 2725 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence204 940 4164 gene locus_tag LOCUS_11270 940 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence205 1541 387 gene locus_tag LOCUS_11280 1541 387 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123502.1 protein_id gnl|my_center|LOCUS_11280 2377 1538 gene locus_tag LOCUS_11290 2377 1538 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123503.1 protein_id gnl|my_center|LOCUS_11290 4008 2374 gene locus_tag LOCUS_11300 4008 2374 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_11300 <4679 4074 gene locus_tag LOCUS_11310 <4679 4074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122696.1:phytoene desaturase >Feature sequence206 13 819 gene locus_tag LOCUS_11320 13 819 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11320 855 1541 gene locus_tag LOCUS_11330 855 1541 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVJ7 protein_id gnl|my_center|LOCUS_11330 1663 1962 gene locus_tag LOCUS_11340 gene eutM 1663 1962 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_11340 2043 2312 gene locus_tag LOCUS_11350 2043 2312 CDS product microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324357.1 protein_id gnl|my_center|LOCUS_11350 2538 3758 gene locus_tag LOCUS_11360 gene ackA 2538 3758 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVK1 protein_id gnl|my_center|LOCUS_11360 3791 3991 gene locus_tag LOCUS_11370 3791 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11370 >Feature sequence207 542 2653 gene locus_tag LOCUS_11380 gene fusA 542 2653 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_11380 2939 3265 gene locus_tag LOCUS_11390 gene rpsJ 2939 3265 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN22 protein_id gnl|my_center|LOCUS_11390 3469 4314 gene locus_tag LOCUS_11400 gene rplC 3469 4314 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN20 protein_id gnl|my_center|LOCUS_11400 >Feature sequence208 2830 1388 gene locus_tag LOCUS_11410 gene dnaB 2830 1388 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWY4 protein_id gnl|my_center|LOCUS_11410 3434 2904 gene locus_tag LOCUS_11420 gene rplI 3434 2904 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV4 protein_id gnl|my_center|LOCUS_11420 4002 3517 gene locus_tag LOCUS_11430 gene ssb 4002 3517 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59932 protein_id gnl|my_center|LOCUS_11430 4499 4143 gene locus_tag LOCUS_11440 gene rpsF 4499 4143 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence209 1474 731 gene locus_tag LOCUS_11450 gene ypuG 1474 731 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327962.1 protein_id gnl|my_center|LOCUS_11450 1610 2155 gene locus_tag LOCUS_11460 1610 2155 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_11460 2152 3312 gene locus_tag LOCUS_11470 gene dgt 2152 3312 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU12 protein_id gnl|my_center|LOCUS_11470 3461 4486 gene locus_tag LOCUS_11480 3461 4486 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330020.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence210 1365 49 gene locus_tag LOCUS_11490 1365 49 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_11490 2162 1362 gene locus_tag LOCUS_11500 2162 1362 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_11500 3031 2159 gene locus_tag LOCUS_11510 gene hydG-2 3031 2159 CDS product Ni/Fe hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_11510 4194 3028 gene locus_tag LOCUS_11520 4194 3028 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948172.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence211 1973 291 gene locus_tag LOCUS_11530 1973 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_11530 2773 1970 gene locus_tag LOCUS_11540 2773 1970 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_11540 3610 2810 gene locus_tag LOCUS_11550 3610 2810 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDY5 protein_id gnl|my_center|LOCUS_11550 3712 4494 gene locus_tag LOCUS_11560 3712 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence212 2040 748 gene locus_tag LOCUS_11570 2040 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3044 2037 gene locus_tag LOCUS_11580 3044 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121108.1 protein_id gnl|my_center|LOCUS_11580 3114 4415 gene locus_tag LOCUS_11590 3114 4415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence213 2471 1155 gene locus_tag LOCUS_11600 2471 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2670 3857 gene locus_tag LOCUS_11610 gene ybhE 2670 3857 CDS product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_11610 3854 4225 gene locus_tag LOCUS_11620 gene panD 3854 4225 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXF8 protein_id gnl|my_center|LOCUS_11620 >Feature sequence214 276 357 gene locus_tag LOCUS_t00130 276 357 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 708 397 gene locus_tag LOCUS_11630 708 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 967 1821 gene locus_tag LOCUS_11640 gene lpxA 967 1821 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZA6 protein_id gnl|my_center|LOCUS_11640 1923 2435 gene locus_tag LOCUS_11650 1923 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2432 3778 gene locus_tag LOCUS_11660 gene wspC 2432 3778 CDS product putative biofilm formation methyltransferase WspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXT5 protein_id gnl|my_center|LOCUS_11660 >Feature sequence215 3162 2230 gene locus_tag LOCUS_11670 gene ldh 3162 2230 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_11670 4353 3481 gene locus_tag LOCUS_11680 4353 3481 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence216 <1 715 gene locus_tag LOCUS_11690 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7US70:cysteine--tRNA ligase 2063 720 gene locus_tag LOCUS_11700 gene thiC 2063 720 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP26 protein_id gnl|my_center|LOCUS_11700 3501 2167 gene locus_tag LOCUS_11710 3501 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence217 <1 779 gene locus_tag LOCUS_11720 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189800.1:D-amino acid aminotransferase 855 1544 gene locus_tag LOCUS_11730 855 1544 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_11730 <4549 1538 gene locus_tag LOCUS_11740 <4549 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPN2:glutamate-ammonia-ligase adenylyltransferase >Feature sequence218 1048 1380 gene locus_tag LOCUS_11750 1048 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1638 2153 gene locus_tag LOCUS_11760 1638 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3938 2292 gene locus_tag LOCUS_11770 3938 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11770 >Feature sequence219 245 1012 gene locus_tag LOCUS_11780 245 1012 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_11780 1009 1521 gene locus_tag LOCUS_11790 1009 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1583 2653 gene locus_tag LOCUS_11800 gene lpxD 1583 2653 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEV1 protein_id gnl|my_center|LOCUS_11800 2681 3616 gene locus_tag LOCUS_11810 2681 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122809.1 protein_id gnl|my_center|LOCUS_11810 3663 4424 gene locus_tag LOCUS_11820 3663 4424 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119082.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence220 >Feature sequence221 2255 3817 gene locus_tag LOCUS_11830 2255 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11830 >Feature sequence222 403 2277 gene locus_tag LOCUS_11840 403 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2274 2876 gene locus_tag LOCUS_11850 gene recR 2274 2876 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ68 protein_id gnl|my_center|LOCUS_11850 >Feature sequence223 412 1782 gene locus_tag LOCUS_11860 gene GALNS 412 1782 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence224 1500 3047 gene locus_tag LOCUS_11870 1500 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3082 4410 gene locus_tag LOCUS_11880 3082 4410 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence225 >Feature sequence226 <1 1178 gene locus_tag LOCUS_11890 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764318.1:9-O-acetylesterase 1365 2207 gene locus_tag LOCUS_11900 1365 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence227 <1 1804 gene locus_tag LOCUS_11910 <1 1804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121781.1:proline dehydrogenase 2090 2911 gene locus_tag LOCUS_11920 2090 2911 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_11920 2942 3901 gene locus_tag LOCUS_11930 2942 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence228 264 1667 gene locus_tag LOCUS_11940 264 1667 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence229 1554 553 gene locus_tag LOCUS_11950 1554 553 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_11950 2886 1702 gene locus_tag LOCUS_11960 2886 1702 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_11960 4278 2929 gene locus_tag LOCUS_11970 4278 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence230 1398 760 gene locus_tag LOCUS_11980 gene dfp 1398 760 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_11980 2127 1423 gene locus_tag LOCUS_11990 2127 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2418 2137 gene locus_tag LOCUS_12000 2418 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3629 2565 gene locus_tag LOCUS_12010 3629 2565 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence231 4241 3810 gene locus_tag LOCUS_12020 gene rplL 4241 3810 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI01 protein_id gnl|my_center|LOCUS_12020 >Feature sequence232 1486 869 gene locus_tag LOCUS_12030 1486 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121172.1 protein_id gnl|my_center|LOCUS_12030 2000 1515 gene locus_tag LOCUS_12040 2000 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2126 2734 gene locus_tag LOCUS_12050 2126 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3507 2719 gene locus_tag LOCUS_12060 gene accD 3507 2719 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX0 protein_id gnl|my_center|LOCUS_12060 <4438 3808 gene locus_tag LOCUS_12070 <4438 3808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGE8:ribulose-phosphate 3-epimerase >Feature sequence233 836 2371 gene locus_tag LOCUS_12080 836 2371 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_12080 2523 3830 gene locus_tag LOCUS_12090 gene GALNS 2523 3830 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence234 2958 1312 gene locus_tag LOCUS_12100 gene serA 2958 1312 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQL2 protein_id gnl|my_center|LOCUS_12100 4212 3109 gene locus_tag LOCUS_12110 gene serC 4212 3109 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQL3 protein_id gnl|my_center|LOCUS_12110 >Feature sequence235 710 1066 gene locus_tag LOCUS_tm00010 710 1066 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1135 1851 gene locus_tag LOCUS_12120 gene glmU 1135 1851 CDS product UDP-N-acetylglucosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121125.1 protein_id gnl|my_center|LOCUS_12120 1986 2930 gene locus_tag LOCUS_12130 gene prs 1986 2930 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPM4 protein_id gnl|my_center|LOCUS_12130 3164 3769 gene locus_tag LOCUS_12140 gene rplY 3164 3769 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU9 protein_id gnl|my_center|LOCUS_12140 3766 4326 gene locus_tag LOCUS_12150 gene pth 3766 4326 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV0 protein_id gnl|my_center|LOCUS_12150 >Feature sequence236 36 701 gene locus_tag LOCUS_12160 36 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 701 1990 gene locus_tag LOCUS_12170 gene pyrC 701 1990 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_12170 1993 2469 gene locus_tag LOCUS_12180 1993 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 <4400 2483 gene locus_tag LOCUS_12190 <4400 2483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119758.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence237 557 306 gene locus_tag LOCUS_12200 557 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1226 819 gene locus_tag LOCUS_12210 gene tesB 1226 819 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331599.1 protein_id gnl|my_center|LOCUS_12210 1474 1977 gene locus_tag LOCUS_12220 gene ilvH 1474 1977 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_12220 2515 2021 gene locus_tag LOCUS_12230 2515 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2685 3353 gene locus_tag LOCUS_12240 2685 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence238 >Feature sequence239 1217 267 gene locus_tag LOCUS_12250 1217 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4312 1316 gene locus_tag LOCUS_12260 4312 1316 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117697.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence240 632 538 gene locus_tag LOCUS_t00140 632 538 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 861 1499 gene locus_tag LOCUS_12270 gene def 861 1499 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ5 protein_id gnl|my_center|LOCUS_12270 1496 2527 gene locus_tag LOCUS_12280 gene fmt 1496 2527 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ6 protein_id gnl|my_center|LOCUS_12280 2538 4046 gene locus_tag LOCUS_12290 gene miaB 2538 4046 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULM9 protein_id gnl|my_center|LOCUS_12290 >Feature sequence241 352 999 gene locus_tag LOCUS_12300 352 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2540 1074 gene locus_tag LOCUS_12310 2540 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 protein_id gnl|my_center|LOCUS_12310 3383 2748 gene locus_tag LOCUS_12320 gene pdxH 3383 2748 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_12320 <4363 3433 gene locus_tag LOCUS_12330 <4363 3433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804353.1:potassium transporter >Feature sequence242 1040 645 gene locus_tag LOCUS_12340 1040 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1321 2781 gene locus_tag LOCUS_12350 1321 2781 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_12350 2836 3639 gene locus_tag LOCUS_12360 gene dapB 2836 3639 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJD7 protein_id gnl|my_center|LOCUS_12360 >Feature sequence243 <1 1973 gene locus_tag LOCUS_12370 <1 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:acriflavine resistance protein B 1984 3390 gene locus_tag LOCUS_12380 gene gadA 1984 3390 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5Y7 protein_id gnl|my_center|LOCUS_12380 4198 3428 gene locus_tag LOCUS_12390 4198 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence244 1971 886 gene locus_tag LOCUS_12400 1971 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1961 2116 gene locus_tag LOCUS_12410 1961 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3255 2188 gene locus_tag LOCUS_12420 3255 2188 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123060.1 protein_id gnl|my_center|LOCUS_12420 <4330 3404 gene locus_tag LOCUS_12430 <4330 3404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123058.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence245 1786 2967 gene locus_tag LOCUS_12440 1786 2967 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_12440 3019 3549 gene locus_tag LOCUS_12450 3019 3549 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FD9 protein_id gnl|my_center|LOCUS_12450 >Feature sequence246 181 579 gene locus_tag LOCUS_12460 gene rplU 181 579 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFG2 protein_id gnl|my_center|LOCUS_12460 2746 854 gene locus_tag LOCUS_12470 2746 854 CDS product 4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117803.1 protein_id gnl|my_center|LOCUS_12470 2865 4214 gene locus_tag LOCUS_12480 2865 4214 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence247 666 1412 gene locus_tag LOCUS_12490 666 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122440.1 protein_id gnl|my_center|LOCUS_12490 1443 2906 gene locus_tag LOCUS_12500 1443 2906 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence248 1266 289 gene locus_tag LOCUS_12510 1266 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1776 3425 gene locus_tag LOCUS_12520 1776 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence249 1571 2992 gene locus_tag LOCUS_12530 gene lpd 1571 2992 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM8 protein_id gnl|my_center|LOCUS_12530 >Feature sequence250 2219 2941 gene locus_tag LOCUS_12540 gene smuG1 2219 2941 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_12540 <4240 3012 gene locus_tag LOCUS_12550 <4240 3012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122805.1:SAM-dependent methyltransferase >Feature sequence251 361 1287 gene locus_tag LOCUS_12560 361 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1663 3939 gene locus_tag LOCUS_12570 1663 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence252 <1 1419 gene locus_tag LOCUS_12580 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120680.1:serine protease 1503 3977 gene locus_tag LOCUS_12590 1503 3977 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence253 <1 1295 gene locus_tag LOCUS_12600 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118124.1:iron dicitrate transporter FecR >Feature sequence254 858 1049 gene locus_tag LOCUS_12610 858 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1046 1810 gene locus_tag LOCUS_12620 gene chcA 1046 1810 CDS product 1-cyclohexenylcarbonyl CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122774.1 protein_id gnl|my_center|LOCUS_12620 1859 3385 gene locus_tag LOCUS_12630 gene acrA1 1859 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122386.1 protein_id gnl|my_center|LOCUS_12630 <4218 3399 gene locus_tag LOCUS_12640 <4218 3399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122854.1:ring-hydroxylating oxygenase subunit alpha >Feature sequence255 <1 1048 gene locus_tag LOCUS_12650 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000919583.1:methyl-accepting chemotaxis protein 1260 2474 gene locus_tag LOCUS_12660 1260 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2623 3450 gene locus_tag LOCUS_12670 2623 3450 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYD1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence256 126 2669 gene locus_tag LOCUS_12680 126 2669 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122368.1 protein_id gnl|my_center|LOCUS_12680 2727 3734 gene locus_tag LOCUS_12690 2727 3734 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144108.1 protein_id gnl|my_center|LOCUS_12690 4165 3791 gene locus_tag LOCUS_12700 4165 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence257 435 1550 gene locus_tag LOCUS_12710 gene rsgA 435 1550 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ6 protein_id gnl|my_center|LOCUS_12710 1547 2914 gene locus_tag LOCUS_12720 gene hflX 1547 2914 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD7 protein_id gnl|my_center|LOCUS_12720 2916 3764 gene locus_tag LOCUS_12730 2916 3764 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121199.1 protein_id gnl|my_center|LOCUS_12730 <4197 3691 gene locus_tag LOCUS_12740 <4197 3691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122705.1:MtdA bifunctional protein >Feature sequence258 2663 1236 gene locus_tag LOCUS_12750 2663 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119562.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence259 3067 11 gene locus_tag LOCUS_12760 3067 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120285.1 protein_id gnl|my_center|LOCUS_12760 3319 3654 gene locus_tag LOCUS_12770 3319 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence260 2819 1560 gene locus_tag LOCUS_12780 2819 1560 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_12780 3791 2964 gene locus_tag LOCUS_12790 3791 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence261 25 98 gene locus_tag LOCUS_t00150 25 98 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 775 245 gene locus_tag LOCUS_12800 775 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence262 1328 2704 gene locus_tag LOCUS_12810 1328 2704 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083816.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence263 289 852 gene locus_tag LOCUS_12820 289 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 849 1769 gene locus_tag LOCUS_12830 849 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 3854 1839 gene locus_tag LOCUS_12840 gene ligA 3854 1839 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKD1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence264 840 679 gene locus_tag LOCUS_12850 840 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1291 911 gene locus_tag LOCUS_12860 1291 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1653 1432 gene locus_tag LOCUS_12870 1653 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545791.1 protein_id gnl|my_center|LOCUS_12870 2972 1995 gene locus_tag LOCUS_12880 gene xynE 2972 1995 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122022.1 protein_id gnl|my_center|LOCUS_12880 3134 3919 gene locus_tag LOCUS_12890 3134 3919 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389792.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence265 1935 67 gene locus_tag LOCUS_12900 1935 67 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_12900 2458 2231 gene locus_tag LOCUS_12910 2458 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327047.1 protein_id gnl|my_center|LOCUS_12910 3495 2566 gene locus_tag LOCUS_12920 gene rsmA 3495 2566 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR4 protein_id gnl|my_center|LOCUS_12920 <4129 3600 gene locus_tag LOCUS_12930 <4129 3600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_870472.2:riboflavin synthase subunit alpha note possible pseudo, internal stop codon >Feature sequence266 2420 1008 gene locus_tag LOCUS_12940 gene GALNS 2420 1008 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121678.1 protein_id gnl|my_center|LOCUS_12940 2725 3573 gene locus_tag LOCUS_12950 2725 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence267 707 1267 gene locus_tag LOCUS_12960 707 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_12960 2859 1480 gene locus_tag LOCUS_12970 2859 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3649 2897 gene locus_tag LOCUS_12980 3649 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence268 96 674 gene locus_tag LOCUS_12990 96 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1387 818 gene locus_tag LOCUS_13000 gene efp 1387 818 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN7 protein_id gnl|my_center|LOCUS_13000 1549 2571 gene locus_tag LOCUS_13010 1549 2571 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 protein_id gnl|my_center|LOCUS_13010 2680 3579 gene locus_tag LOCUS_13020 2680 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence269 677 165 gene locus_tag LOCUS_13030 677 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1731 808 gene locus_tag LOCUS_13040 1731 808 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_13040 1981 3516 gene locus_tag LOCUS_13050 1981 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence270 654 229 gene locus_tag LOCUS_13060 654 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1809 772 gene locus_tag LOCUS_13070 gene gspG 1809 772 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118411.1 protein_id gnl|my_center|LOCUS_13070 2514 2056 gene locus_tag LOCUS_13080 2514 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3617 2550 gene locus_tag LOCUS_13090 3617 2550 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence271 1184 789 gene locus_tag LOCUS_13100 1184 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2778 1381 gene locus_tag LOCUS_13110 2778 1381 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_13110 <4069 3158 gene locus_tag LOCUS_13120 <4069 3158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118381.1:N-acetylgalactosamine-6-sulfatase >Feature sequence272 <1 582 gene locus_tag LOCUS_13130 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205235.1:phosphoglycerate mutase 890 1861 gene locus_tag LOCUS_13140 890 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1890 2159 gene locus_tag LOCUS_13150 1890 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2156 3880 gene locus_tag LOCUS_13160 gene cutE 2156 3880 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AY0 protein_id gnl|my_center|LOCUS_13160 >Feature sequence273 705 145 gene locus_tag LOCUS_13170 gene frr 705 145 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH0 protein_id gnl|my_center|LOCUS_13170 1559 816 gene locus_tag LOCUS_13180 gene pyrH 1559 816 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH1 protein_id gnl|my_center|LOCUS_13180 2500 1658 gene locus_tag LOCUS_13190 gene tsf 2500 1658 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66930 protein_id gnl|my_center|LOCUS_13190 3439 2639 gene locus_tag LOCUS_13200 gene rpsB 3439 2639 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH4 protein_id gnl|my_center|LOCUS_13200 >Feature sequence274 510 1244 gene locus_tag LOCUS_13210 510 1244 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943289.1 protein_id gnl|my_center|LOCUS_13210 1253 1981 gene locus_tag LOCUS_13220 1253 1981 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_13220 1978 3006 gene locus_tag LOCUS_13230 1978 3006 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940539.1 protein_id gnl|my_center|LOCUS_13230 3044 3826 gene locus_tag LOCUS_13240 3044 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence275 <1 1615 gene locus_tag LOCUS_13250 <1 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117896.1:arylsulfatase 3191 1599 gene locus_tag LOCUS_13260 3191 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 3887 3381 gene locus_tag LOCUS_13270 3887 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930535.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence276 2350 563 gene locus_tag LOCUS_13280 2350 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence277 1483 554 gene locus_tag LOCUS_13290 1483 554 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_13290 1634 2971 gene locus_tag LOCUS_13300 gene lsyA-1 1634 2971 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B24 protein_id gnl|my_center|LOCUS_13300 3070 3462 gene locus_tag LOCUS_13310 3070 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence278 965 189 gene locus_tag LOCUS_13320 gene proC 965 189 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK62 protein_id gnl|my_center|LOCUS_13320 2173 1019 gene locus_tag LOCUS_13330 2173 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2286 2825 gene locus_tag LOCUS_13340 2286 2825 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence279 >Feature sequence280 613 221 gene locus_tag LOCUS_13350 613 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1005 829 gene locus_tag LOCUS_13360 1005 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 2033 999 gene locus_tag LOCUS_13370 2033 999 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_13370 3513 2302 gene locus_tag LOCUS_13380 3513 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_13380 4001 3549 gene locus_tag LOCUS_13390 4001 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence281 464 3 gene locus_tag LOCUS_13400 464 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_13400 1875 574 gene locus_tag LOCUS_13410 1875 574 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335856.1 protein_id gnl|my_center|LOCUS_13410 <3994 1887 gene locus_tag LOCUS_13420 <3994 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120793.1:L-sorbosone dehydrogenase >Feature sequence282 2210 2293 gene locus_tag LOCUS_t00160 2210 2293 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence283 881 1432 gene locus_tag LOCUS_13430 881 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1570 1962 gene locus_tag LOCUS_13440 gene acpP 1570 1962 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP48 protein_id gnl|my_center|LOCUS_13440 2080 2595 gene locus_tag LOCUS_13450 gene fabZ 2080 2595 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121272.1 protein_id gnl|my_center|LOCUS_13450 2679 3977 gene locus_tag LOCUS_13460 gene fabF 2679 3977 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence284 337 1128 gene locus_tag LOCUS_13470 gene guaA 337 1128 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_13470 1426 3636 gene locus_tag LOCUS_13480 gene glgB 1426 3636 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence285 56 1303 gene locus_tag LOCUS_13490 56 1303 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_13490 1491 3002 gene locus_tag LOCUS_13500 1491 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3647 3006 gene locus_tag LOCUS_13510 3647 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence286 941 231 gene locus_tag LOCUS_13520 gene mtnC 941 231 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I340 protein_id gnl|my_center|LOCUS_13520 1507 938 gene locus_tag LOCUS_13530 gene mtnD 1507 938 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTC0 protein_id gnl|my_center|LOCUS_13530 2300 1557 gene locus_tag LOCUS_13540 gene mtnB 2300 1557 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 protein_id gnl|my_center|LOCUS_13540 2450 3118 gene locus_tag LOCUS_13550 2450 3118 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118202.1 protein_id gnl|my_center|LOCUS_13550 3118 3951 gene locus_tag LOCUS_13560 gene mqnD 3118 3951 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJD8 protein_id gnl|my_center|LOCUS_13560 >Feature sequence287 1069 440 gene locus_tag LOCUS_13570 1069 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1542 1066 gene locus_tag LOCUS_13580 1542 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2882 1539 gene locus_tag LOCUS_13590 2882 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 3262 2960 gene locus_tag LOCUS_13600 3262 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence288 51 251 gene locus_tag LOCUS_13610 51 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1280 669 gene locus_tag LOCUS_13620 1280 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1539 1267 gene locus_tag LOCUS_13630 1539 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 <3961 1828 gene locus_tag LOCUS_13640 <3961 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119225.1:membrane protein >Feature sequence289 3406 2489 gene locus_tag LOCUS_13650 gene ffsA 3406 2489 CDS product formylmethanofuran--tetrahydromethanopterin formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKZ8 protein_id gnl|my_center|LOCUS_13650 >Feature sequence290 1307 2338 gene locus_tag LOCUS_13660 gene apbE 1307 2338 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTS4 protein_id gnl|my_center|LOCUS_13660 2450 3259 gene locus_tag LOCUS_13670 2450 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence291 528 3791 gene locus_tag LOCUS_13680 gene kefA 528 3791 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120603.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence292 1917 3464 gene locus_tag LOCUS_13690 1917 3464 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_13690 3461 3685 gene locus_tag LOCUS_13700 3461 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3746 3922 gene locus_tag LOCUS_13710 3746 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence293 <3923 2710 gene locus_tag LOCUS_13720 <3923 2710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402885.1:methylamine utilization protein >Feature sequence294 2354 1626 gene locus_tag LOCUS_13730 2354 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3409 2501 gene locus_tag LOCUS_13740 gene dapF 3409 2501 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FS5 protein_id gnl|my_center|LOCUS_13740 3638 3483 gene locus_tag LOCUS_13750 3638 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence295 1283 849 gene locus_tag LOCUS_13760 1283 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2477 1605 gene locus_tag LOCUS_13770 2477 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3503 2484 gene locus_tag LOCUS_13780 gene mch 3503 2484 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPS1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence296 1995 52 gene locus_tag LOCUS_13790 gene ftsH1 1995 52 CDS product ATP-dependent zinc metalloprotease FtsH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ7 protein_id gnl|my_center|LOCUS_13790 2232 2615 gene locus_tag LOCUS_13800 2232 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3307 2627 gene locus_tag LOCUS_13810 3307 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence297 399 1646 gene locus_tag LOCUS_13820 399 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1643 3424 gene locus_tag LOCUS_13830 1643 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence298 <1 606 gene locus_tag LOCUS_13840 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327113.1:phosphodiesterase 705 1259 gene locus_tag LOCUS_13850 705 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1256 3310 gene locus_tag LOCUS_13860 1256 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3510 3334 gene locus_tag LOCUS_13870 3510 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence299 1529 1236 gene locus_tag LOCUS_13880 1529 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 <3853 1728 gene locus_tag LOCUS_13890 <3853 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000896388.1:methyl-accepting chemotaxis protein note possible pseudo, internal stop codon >Feature sequence300 3645 205 gene locus_tag LOCUS_13900 3645 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence301 866 78 gene locus_tag LOCUS_13910 gene sdhC 866 78 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122817.1 protein_id gnl|my_center|LOCUS_13910 1213 2955 gene locus_tag LOCUS_13920 1213 2955 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence302 1029 10 gene locus_tag LOCUS_13930 1029 10 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_13930 1287 2888 gene locus_tag LOCUS_13940 1287 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence303 679 1908 gene locus_tag LOCUS_13950 679 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_13950 <3815 1996 gene locus_tag LOCUS_13960 <3815 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117792.1:N-acetylgalactosamine-6-sulfatase >Feature sequence304 1252 851 gene locus_tag LOCUS_13970 gene secE 1252 851 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY9 protein_id gnl|my_center|LOCUS_13970 1549 1476 gene locus_tag LOCUS_t00170 1549 1476 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2848 1649 gene locus_tag LOCUS_13980 gene tuf 2848 1649 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_13980 3091 3019 gene locus_tag LOCUS_t00180 3091 3019 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3226 3156 gene locus_tag LOCUS_t00190 3226 3156 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3404 3322 gene locus_tag LOCUS_t00200 3404 3322 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3780 3707 gene locus_tag LOCUS_t00210 3780 3707 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence305 216 584 gene locus_tag LOCUS_13990 gene rpsL 216 584 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN32 protein_id gnl|my_center|LOCUS_13990 630 1100 gene locus_tag LOCUS_14000 gene rpsG 630 1100 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN31 protein_id gnl|my_center|LOCUS_14000 3024 1171 gene locus_tag LOCUS_14010 3024 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence306 <1 719 gene locus_tag LOCUS_14020 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335012.1:dehydrogenase 1063 716 gene locus_tag LOCUS_14030 1063 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1171 2883 gene locus_tag LOCUS_14040 1171 2883 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020806.1 protein_id gnl|my_center|LOCUS_14040 2956 3237 gene locus_tag LOCUS_14050 2956 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3224 3583 gene locus_tag LOCUS_14060 3224 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence307 768 124 gene locus_tag LOCUS_14070 gene npdA 768 124 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_14070 842 1105 gene locus_tag LOCUS_14080 842 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1140 1382 gene locus_tag LOCUS_14090 1140 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1989 1492 gene locus_tag LOCUS_14100 1989 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence308 2585 1173 gene locus_tag LOCUS_14110 2585 1173 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_14110 3379 2837 gene locus_tag LOCUS_14120 3379 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence309 74 2023 gene locus_tag LOCUS_14130 74 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2026 3372 gene locus_tag LOCUS_14140 2026 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence310 1057 59 gene locus_tag LOCUS_14150 gene pdxA 1057 59 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ2 protein_id gnl|my_center|LOCUS_14150 2676 1054 gene locus_tag LOCUS_14160 gene leuA 2676 1054 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_14160 3220 2777 gene locus_tag LOCUS_14170 3220 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836250.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence311 2247 1234 gene locus_tag LOCUS_14180 2247 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 protein_id gnl|my_center|LOCUS_14180 2600 2361 gene locus_tag LOCUS_14190 2600 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 <3757 2684 gene locus_tag LOCUS_14200 <3757 2684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525264.1:uroporphyrinogen decarboxylase >Feature sequence312 458 940 gene locus_tag LOCUS_14210 458 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1307 969 gene locus_tag LOCUS_14220 1307 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1319 1471 gene locus_tag LOCUS_14230 1319 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1505 2542 gene locus_tag LOCUS_14240 gene gmd 1505 2542 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_14240 >Feature sequence313 1462 3078 gene locus_tag LOCUS_14250 gene mdsA 1462 3078 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121930.1 protein_id gnl|my_center|LOCUS_14250 3673 3056 gene locus_tag LOCUS_14260 3673 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence314 1055 1393 gene locus_tag LOCUS_14270 1055 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence315 <1 1029 gene locus_tag LOCUS_14280 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122512.1:coproporphyrinogen III oxidase 2507 1050 gene locus_tag LOCUS_14290 gene pntB 2507 1050 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F962 protein_id gnl|my_center|LOCUS_14290 2920 2570 gene locus_tag LOCUS_14300 2920 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434762.1 protein_id gnl|my_center|LOCUS_14300 <3725 2972 gene locus_tag LOCUS_14310 <3725 2972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404932.1:NAD(P) transhydrogenase subunit alpha >Feature sequence316 1338 70 gene locus_tag LOCUS_14320 1338 70 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_14320 2201 1359 gene locus_tag LOCUS_14330 2201 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2430 3365 gene locus_tag LOCUS_14340 gene troA 2430 3365 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence317 1793 456 gene locus_tag LOCUS_14350 1793 456 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_14350 1974 3182 gene locus_tag LOCUS_14360 1974 3182 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_14360 3622 3209 gene locus_tag LOCUS_14370 3622 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence318 1723 398 gene locus_tag LOCUS_14380 1723 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2313 2660 gene locus_tag LOCUS_14390 2313 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 <3691 2809 gene locus_tag LOCUS_14400 <3691 2809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UI51:2-isopropylmalate synthase >Feature sequence319 358 1212 gene locus_tag LOCUS_14410 358 1212 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_14410 1289 2128 gene locus_tag LOCUS_14420 1289 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096902.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence320 >Feature sequence321 <1 1401 gene locus_tag LOCUS_14430 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118918.1:30S ribosomal protein S1 2368 3321 gene locus_tag LOCUS_14440 2368 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence322 663 1454 gene locus_tag LOCUS_14450 gene whiG 663 1454 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFV6 protein_id gnl|my_center|LOCUS_14450 1752 2033 gene locus_tag LOCUS_14460 1752 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2173 2679 gene locus_tag LOCUS_14470 gene fur 2173 2679 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121869.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence323 3113 774 gene locus_tag LOCUS_14480 3113 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3469 3170 gene locus_tag LOCUS_14490 3469 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence324 <1 519 gene locus_tag LOCUS_14500 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123083.1:prepilin-type N-terminal cleavage/methylation domain-containing protein 519 1040 gene locus_tag LOCUS_14510 519 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117810.1 protein_id gnl|my_center|LOCUS_14510 1159 3177 gene locus_tag LOCUS_14520 1159 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence325 541 335 gene locus_tag LOCUS_14530 541 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1311 541 gene locus_tag LOCUS_14540 1311 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3022 1472 gene locus_tag LOCUS_14550 gene crtI 3022 1472 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence326 <1 1004 gene locus_tag LOCUS_14560 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121190.1:NADH-dependent dehydrogenase 2078 1059 gene locus_tag LOCUS_14570 2078 1059 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122136.1 protein_id gnl|my_center|LOCUS_14570 2371 3606 gene locus_tag LOCUS_14580 2371 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence327 2025 1264 gene locus_tag LOCUS_14590 2025 1264 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972794.1 protein_id gnl|my_center|LOCUS_14590 2293 3108 gene locus_tag LOCUS_14600 2293 3108 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence328 2028 334 gene locus_tag LOCUS_14610 2028 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2647 2264 gene locus_tag LOCUS_14620 2647 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence329 925 1539 gene locus_tag LOCUS_14630 925 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_14630 1619 1702 gene locus_tag LOCUS_t00220 1619 1702 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1726 3387 gene locus_tag LOCUS_14640 gene rpsA 1726 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence330 563 1480 gene locus_tag LOCUS_14650 563 1480 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_14650 1484 2656 gene locus_tag LOCUS_14660 gene prpC 1484 2656 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 protein_id gnl|my_center|LOCUS_14660 >Feature sequence331 321 1340 gene locus_tag LOCUS_14670 321 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 <3611 1356 gene locus_tag LOCUS_14680 <3611 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIR9:DNA helicase >Feature sequence332 2808 1009 gene locus_tag LOCUS_14690 2808 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 <3608 3012 gene locus_tag LOCUS_14700 <3608 3012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UYX5:orotate phosphoribosyltransferase >Feature sequence333 485 1261 gene locus_tag LOCUS_14710 485 1261 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896974.1 protein_id gnl|my_center|LOCUS_14710 1296 2003 gene locus_tag LOCUS_14720 1296 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2446 3600 gene locus_tag LOCUS_14730 2446 3600 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975037.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence334 713 1072 gene locus_tag LOCUS_14740 713 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1178 2608 gene locus_tag LOCUS_14750 1178 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3436 2615 gene locus_tag LOCUS_14760 gene cheR 3436 2615 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence335 465 13 gene locus_tag LOCUS_14770 465 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1901 531 gene locus_tag LOCUS_14780 gene phr 1901 531 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 protein_id gnl|my_center|LOCUS_14780 3438 1957 gene locus_tag LOCUS_14790 3438 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence336 1215 682 gene locus_tag LOCUS_14800 gene sixA 1215 682 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_14800 2204 1218 gene locus_tag LOCUS_14810 2204 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_14810 2746 2201 gene locus_tag LOCUS_14820 2746 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2913 3392 gene locus_tag LOCUS_14830 2913 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence337 1 954 gene locus_tag LOCUS_14840 gene tatC 1 954 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFI8 protein_id gnl|my_center|LOCUS_14840 1442 933 gene locus_tag LOCUS_14850 1442 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1606 1692 gene locus_tag LOCUS_t00230 1606 1692 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1820 2068 gene locus_tag LOCUS_14860 1820 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3009 2122 gene locus_tag LOCUS_14870 3009 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence338 3030 457 gene locus_tag LOCUS_14880 3030 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence339 797 1933 gene locus_tag LOCUS_14890 797 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2061 3080 gene locus_tag LOCUS_14900 2061 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence340 184 2262 gene locus_tag LOCUS_14910 184 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120992.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence341 146 397 gene locus_tag LOCUS_14920 gene rpmA 146 397 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_14920 454 1452 gene locus_tag LOCUS_14930 gene obg 454 1452 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH6 protein_id gnl|my_center|LOCUS_14930 1469 2293 gene locus_tag LOCUS_14940 1469 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2293 2778 gene locus_tag LOCUS_14950 gene rsfS 2293 2778 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URC6 protein_id gnl|my_center|LOCUS_14950 >Feature sequence342 2125 236 gene locus_tag LOCUS_14960 2125 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_14960 2483 3451 gene locus_tag LOCUS_14970 2483 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence343 3246 88 gene locus_tag LOCUS_14980 3246 88 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117787.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence344 <1 1458 gene locus_tag LOCUS_14990 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403397.1:arylsulfatase 1559 2506 gene locus_tag LOCUS_15000 1559 2506 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970583.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence345 713 90 gene locus_tag LOCUS_15010 713 90 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGM3 protein_id gnl|my_center|LOCUS_15010 1824 757 gene locus_tag LOCUS_15020 1824 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120290.1 protein_id gnl|my_center|LOCUS_15020 2043 2462 gene locus_tag LOCUS_15030 2043 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 3320 2664 gene locus_tag LOCUS_15040 3320 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence346 73 1455 gene locus_tag LOCUS_15050 73 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2175 1507 gene locus_tag LOCUS_15060 2175 1507 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122734.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence347 220 2430 gene locus_tag LOCUS_15070 220 2430 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117853.1 protein_id gnl|my_center|LOCUS_15070 3170 2493 gene locus_tag LOCUS_15080 3170 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence348 >Feature sequence349 332 1312 gene locus_tag LOCUS_15090 332 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1309 2316 gene locus_tag LOCUS_15100 gene asd 1309 2316 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UL17 protein_id gnl|my_center|LOCUS_15100 2321 3118 gene locus_tag LOCUS_15110 gene truA 2321 3118 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU07 protein_id gnl|my_center|LOCUS_15110 >Feature sequence350 494 1033 gene locus_tag LOCUS_15120 494 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1330 2073 gene locus_tag LOCUS_15130 1330 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2353 3285 gene locus_tag LOCUS_15140 2353 3285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence351 2930 585 gene locus_tag LOCUS_15150 2930 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence352 <3473 2508 gene locus_tag LOCUS_15160 <3473 2508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJJ0:protein RecA >Feature sequence353 2582 357 gene locus_tag LOCUS_15170 2582 357 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence354 >Feature sequence355 1 381 gene locus_tag LOCUS_15180 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1088 390 gene locus_tag LOCUS_15190 gene deoC 1088 390 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRZ2 protein_id gnl|my_center|LOCUS_15190 1552 1088 gene locus_tag LOCUS_15200 1552 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2454 1561 gene locus_tag LOCUS_15210 2454 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 <3463 2460 gene locus_tag LOCUS_15220 <3463 2460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529380.1:MmgE/PrpD family protein >Feature sequence356 <1 567 gene locus_tag LOCUS_15230 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122148.1:ATPase AAA 564 3143 gene locus_tag LOCUS_15240 564 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence357 608 931 gene locus_tag LOCUS_15250 gene groS2 608 931 CDS product 10 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ0 protein_id gnl|my_center|LOCUS_15250 1018 2643 gene locus_tag LOCUS_15260 gene groL3 1018 2643 CDS product 60 kDa chaperonin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY9 protein_id gnl|my_center|LOCUS_15260 2795 3106 gene locus_tag LOCUS_15270 2795 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence358 599 1222 gene locus_tag LOCUS_15280 599 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1425 2336 gene locus_tag LOCUS_15290 1425 2336 CDS product NAD-dependent nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225382.1 protein_id gnl|my_center|LOCUS_15290 3448 2507 gene locus_tag LOCUS_15300 3448 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence359 <3437 1457 gene locus_tag LOCUS_15310 <3437 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117969.1:cytochrome c >Feature sequence360 <1 832 gene locus_tag LOCUS_15320 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7USC2:DNA repair protein RecO 829 2115 gene locus_tag LOCUS_15330 829 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2112 2672 gene locus_tag LOCUS_15340 2112 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence361 <1 1369 gene locus_tag LOCUS_15350 <1 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:choline-sulfatase 1859 1410 gene locus_tag LOCUS_15360 1859 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3388 1955 gene locus_tag LOCUS_15370 3388 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence362 <1 564 gene locus_tag LOCUS_15380 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119349.1:calcium sensor EFh 2177 609 gene locus_tag LOCUS_15390 gene phoD 2177 609 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339980.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence363 1013 153 gene locus_tag LOCUS_15400 gene fabG 1013 153 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_15400 1964 1038 gene locus_tag LOCUS_15410 gene fabD 1964 1038 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY3 protein_id gnl|my_center|LOCUS_15410 2148 1969 gene locus_tag LOCUS_15420 gene rpmF 2148 1969 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_15420 3156 2221 gene locus_tag LOCUS_15430 gene ruvB 3156 2221 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPG4 protein_id gnl|my_center|LOCUS_15430 3076 3276 gene locus_tag LOCUS_15440 3076 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence364 373 1308 gene locus_tag LOCUS_15450 373 1308 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_15450 2503 1412 gene locus_tag LOCUS_15460 2503 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2661 3209 gene locus_tag LOCUS_15470 2661 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence365 1618 326 gene locus_tag LOCUS_15480 1618 326 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_15480 2618 1668 gene locus_tag LOCUS_15490 2618 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3154 2681 gene locus_tag LOCUS_15500 3154 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence366 <1 2169 gene locus_tag LOCUS_15510 <1 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNZ2:isoleucine--tRNA ligase 2209 2841 gene locus_tag LOCUS_15520 gene pur3 2209 2841 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence367 497 1414 gene locus_tag LOCUS_15530 gene oppB 497 1414 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461536.1 protein_id gnl|my_center|LOCUS_15530 1411 2355 gene locus_tag LOCUS_15540 1411 2355 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence368 >Feature sequence369 <1 967 gene locus_tag LOCUS_15550 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q88WI3:anthranilate phosphoribosyltransferase 2191 971 gene locus_tag LOCUS_15560 gene htrA 2191 971 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122274.1 protein_id gnl|my_center|LOCUS_15560 2681 2292 gene locus_tag LOCUS_15570 2681 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence370 2728 1058 gene locus_tag LOCUS_15580 2728 1058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118217.1 protein_id gnl|my_center|LOCUS_15580 3081 2722 gene locus_tag LOCUS_15590 3081 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence371 1812 3278 gene locus_tag LOCUS_15600 1812 3278 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3V1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence372 <1 1140 gene locus_tag LOCUS_15610 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A294:putative K(+)-stimulated pyrophosphate-energized sodium pump 1137 2246 gene locus_tag LOCUS_15620 gene tgt 1137 2246 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWK9 protein_id gnl|my_center|LOCUS_15620 2364 2744 gene locus_tag LOCUS_15630 2364 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence373 >Feature sequence374 343 2643 gene locus_tag LOCUS_15640 343 2643 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence375 98 622 gene locus_tag LOCUS_15650 98 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123400.1 protein_id gnl|my_center|LOCUS_15650 619 2352 gene locus_tag LOCUS_15660 619 2352 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence376 <1 610 gene locus_tag LOCUS_15670 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGW0:sulfate adenylyltransferase subunit 2 978 2912 gene locus_tag LOCUS_15680 gene cysNC 978 2912 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMW2 protein_id gnl|my_center|LOCUS_15680 >Feature sequence377 >Feature sequence378 <1 1506 gene locus_tag LOCUS_15690 <1 1506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704452.1:mechanosensitive ion channel protein MscS 1554 2315 gene locus_tag LOCUS_15700 1554 2315 CDS product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_15700 <3296 2489 gene locus_tag LOCUS_15710 <3296 2489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120935.1:GTP-binding protein >Feature sequence379 <1 630 gene locus_tag LOCUS_15720 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIA6:3-isopropylmalate dehydratase small subunit 674 994 gene locus_tag LOCUS_15730 674 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2040 1000 gene locus_tag LOCUS_15740 gene bioB 2040 1000 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF84 protein_id gnl|my_center|LOCUS_15740 <3288 2144 gene locus_tag LOCUS_15750 <3288 2144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393048.1:peptidase M24 >Feature sequence380 <1 763 gene locus_tag LOCUS_15760 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000810537.1:sodium:proton antiporter 791 1996 gene locus_tag LOCUS_15770 gene rnd 791 1996 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120569.1 protein_id gnl|my_center|LOCUS_15770 2276 1947 gene locus_tag LOCUS_15780 2276 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2713 2629 gene locus_tag LOCUS_t00240 2713 2629 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence381 281 565 gene locus_tag LOCUS_15790 281 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 562 1140 gene locus_tag LOCUS_15800 562 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15800 2067 1741 gene locus_tag LOCUS_15810 2067 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence382 3031 1232 gene locus_tag LOCUS_15820 3031 1232 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence383 569 1534 gene locus_tag LOCUS_15830 569 1534 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118295.1 protein_id gnl|my_center|LOCUS_15830 1681 2112 gene locus_tag LOCUS_15840 1681 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_15840 2851 2144 gene locus_tag LOCUS_15850 2851 2144 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_15850 3056 3217 gene locus_tag LOCUS_15860 3056 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence384 1769 513 gene locus_tag LOCUS_15870 1769 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2864 1887 gene locus_tag LOCUS_15880 2864 1887 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120424.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence385 295 2172 gene locus_tag LOCUS_15890 295 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence386 731 291 gene locus_tag LOCUS_15900 731 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1861 824 gene locus_tag LOCUS_15910 1861 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2733 2056 gene locus_tag LOCUS_15920 2733 2056 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 protein_id gnl|my_center|LOCUS_15920 <3265 2762 gene locus_tag LOCUS_15930 <3265 2762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523251.1:sensor kinase >Feature sequence387 340 1878 gene locus_tag LOCUS_15940 gene trpE 340 1878 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_15940 1892 2809 gene locus_tag LOCUS_15950 1892 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence388 1710 268 gene locus_tag LOCUS_15960 1710 268 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_15960 <3258 1974 gene locus_tag LOCUS_15970 <3258 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120738.1:cytochrome c >Feature sequence389 >Feature sequence390 730 389 gene locus_tag LOCUS_15980 730 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1661 849 gene locus_tag LOCUS_15990 1661 849 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence391 >Feature sequence392 1566 613 gene locus_tag LOCUS_16000 1566 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2797 1856 gene locus_tag LOCUS_16010 gene hemB 2797 1856 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 protein_id gnl|my_center|LOCUS_16010 >Feature sequence393 <1 1665 gene locus_tag LOCUS_16020 <1 1665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQG1:RNA polymerase sigma factor SigA 1815 1624 gene locus_tag LOCUS_16030 1815 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1790 2506 gene locus_tag LOCUS_16040 1790 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_16040 2575 3054 gene locus_tag LOCUS_16050 gene greA 2575 3054 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA0 protein_id gnl|my_center|LOCUS_16050 >Feature sequence394 320 1300 gene locus_tag LOCUS_16060 gene iolI 320 1300 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328910.1 protein_id gnl|my_center|LOCUS_16060 2277 1342 gene locus_tag LOCUS_16070 2277 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence395 2556 1477 gene locus_tag LOCUS_16080 2556 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence396 3091 2294 gene locus_tag LOCUS_16090 3091 2294 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ND7 protein_id gnl|my_center|LOCUS_16090 >Feature sequence397 <1 866 gene locus_tag LOCUS_16100 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404758.1:cation transporter >Feature sequence398 312 239 gene locus_tag LOCUS_t00250 312 239 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 469 395 gene locus_tag LOCUS_t00260 469 395 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 651 2582 gene locus_tag LOCUS_16110 651 2582 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121956.1 protein_id gnl|my_center|LOCUS_16110 2669 2953 gene locus_tag LOCUS_16120 2669 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence399 1316 84 gene locus_tag LOCUS_16130 gene metB 1316 84 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120920.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence400 1750 113 gene locus_tag LOCUS_16140 1750 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2199 1798 gene locus_tag LOCUS_16150 gene exbD 2199 1798 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 protein_id gnl|my_center|LOCUS_16150 3051 2203 gene locus_tag LOCUS_16160 3051 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence401 1127 465 gene locus_tag LOCUS_16170 1127 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 <3180 1560 gene locus_tag LOCUS_16180 <3180 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URW4:DNA-directed RNA polymerase subunit beta' >Feature sequence402 1169 609 gene locus_tag LOCUS_16190 gene hpt 1169 609 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_16190 1267 2034 gene locus_tag LOCUS_16200 1267 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence403 1656 2891 gene locus_tag LOCUS_16210 gene gdhA 1656 2891 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPH7 protein_id gnl|my_center|LOCUS_16210 >Feature sequence404 142 1344 gene locus_tag LOCUS_16220 gene proA 142 1344 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNV2 protein_id gnl|my_center|LOCUS_16220 1477 2619 gene locus_tag LOCUS_16230 gene carA 1477 2619 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_16230 >Feature sequence405 >Feature sequence406 878 1903 gene locus_tag LOCUS_16240 gene moxR 878 1903 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120739.1 protein_id gnl|my_center|LOCUS_16240 1911 2810 gene locus_tag LOCUS_16250 1911 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence407 >Feature sequence408 1342 326 gene locus_tag LOCUS_16260 gene aroG-2 1342 326 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence409 1360 2355 gene locus_tag LOCUS_16270 1360 2355 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_16270 2555 2938 gene locus_tag LOCUS_16280 2555 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence410 354 2477 gene locus_tag LOCUS_16290 354 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence411 486 1490 gene locus_tag LOCUS_16300 gene ilvC 486 1490 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKY0 protein_id gnl|my_center|LOCUS_16300 1564 1839 gene locus_tag LOCUS_16310 1564 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 <3137 1936 gene locus_tag LOCUS_16320 <3137 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120906.1:SAM-dependent methyltransferase >Feature sequence412 1674 2036 gene locus_tag LOCUS_16330 1674 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence413 1169 687 gene locus_tag LOCUS_16340 1169 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2982 1213 gene locus_tag LOCUS_16350 2982 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16350 >Feature sequence414 494 1453 gene locus_tag LOCUS_16360 494 1453 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_16360 1584 1922 gene locus_tag LOCUS_16370 1584 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2097 3026 gene locus_tag LOCUS_16380 gene dapA 2097 3026 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence415 1294 623 gene locus_tag LOCUS_16390 1294 623 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_16390 2944 1343 gene locus_tag LOCUS_16400 gene guaA 2944 1343 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFS3 protein_id gnl|my_center|LOCUS_16400 >Feature sequence416 2532 1234 gene locus_tag LOCUS_16410 gene mntB 2532 1234 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_16410 <3121 2532 gene locus_tag LOCUS_16420 <3121 2532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123736.1:manganese ABC transporter permease >Feature sequence417 <1 1098 gene locus_tag LOCUS_16430 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938554.1:glutamine synthetase 1095 1787 gene locus_tag LOCUS_16440 1095 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2769 1978 gene locus_tag LOCUS_16450 2769 1978 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192015.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence418 <1 750 gene locus_tag LOCUS_16460 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120391.1:lipolytic enzyme 2699 792 gene locus_tag LOCUS_16470 2699 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence419 455 147 gene locus_tag LOCUS_16480 455 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1237 452 gene locus_tag LOCUS_16490 1237 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120568.1 protein_id gnl|my_center|LOCUS_16490 1896 1234 gene locus_tag LOCUS_16500 1896 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence420 1661 357 gene locus_tag LOCUS_16510 1661 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence421 855 100 gene locus_tag LOCUS_16520 855 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1726 875 gene locus_tag LOCUS_16530 1726 875 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123406.1 protein_id gnl|my_center|LOCUS_16530 2845 1799 gene locus_tag LOCUS_16540 2845 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence422 <1 2947 gene locus_tag LOCUS_16550 <1 2947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097341.1:glycoside hydrolase >Feature sequence423 <1 847 gene locus_tag LOCUS_16560 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262832.1:type II secretion system protein GspE 873 1874 gene locus_tag LOCUS_16570 873 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2643 1894 gene locus_tag LOCUS_16580 2643 1894 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence424 <1 893 gene locus_tag LOCUS_16590 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123616.1:integrase 899 825 gene locus_tag LOCUS_t00270 899 825 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1042 2994 gene locus_tag LOCUS_16600 1042 2994 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence425 <1 748 gene locus_tag LOCUS_16610 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121115.1:aspartate aminotransferase 1406 792 gene locus_tag LOCUS_16620 1406 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1999 1523 gene locus_tag LOCUS_16630 1999 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence426 960 346 gene locus_tag LOCUS_16640 960 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1632 1021 gene locus_tag LOCUS_16650 1632 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1925 2878 gene locus_tag LOCUS_16660 1925 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence427 1038 769 gene locus_tag LOCUS_16670 1038 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1470 2099 gene locus_tag LOCUS_16680 1470 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2575 2501 gene locus_tag LOCUS_t00280 2575 2501 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence428 >Feature sequence429 <1 722 gene locus_tag LOCUS_16690 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142194.1:glycosyl transferase family 1 764 3007 gene locus_tag LOCUS_16700 764 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence430 1689 232 gene locus_tag LOCUS_16710 1689 232 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121659.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence431 442 1263 gene locus_tag LOCUS_16720 442 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1263 2030 gene locus_tag LOCUS_16730 gene natA 1263 2030 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence432 2 74 gene locus_tag LOCUS_t00290 2 74 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 645 448 gene locus_tag LOCUS_16740 645 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 568 939 gene locus_tag LOCUS_16750 568 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1412 1248 gene locus_tag LOCUS_16760 1412 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2396 1440 gene locus_tag LOCUS_16770 gene scd 2396 1440 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123795.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence433 >Feature sequence434 <1 1038 gene locus_tag LOCUS_16780 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121212.1:filamin 1035 2375 gene locus_tag LOCUS_16790 1035 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence435 1047 133 gene locus_tag LOCUS_16800 1047 133 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_16800 1962 1174 gene locus_tag LOCUS_16810 1962 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 <3028 2045 gene locus_tag LOCUS_16820 <3028 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120741.1:phosphomannomutase >Feature sequence436 1422 892 gene locus_tag LOCUS_16830 1422 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2072 1422 gene locus_tag LOCUS_16840 2072 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2638 2111 gene locus_tag LOCUS_16850 2638 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence437 1406 660 gene locus_tag LOCUS_16860 1406 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_16860 1600 2637 gene locus_tag LOCUS_16870 1600 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence438 <1 1384 gene locus_tag LOCUS_16880 <1 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UU96:pyruvate dehydrogenase E1 component 1543 2889 gene locus_tag LOCUS_16890 gene aceF 1543 2889 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU97 protein_id gnl|my_center|LOCUS_16890 >Feature sequence439 1755 799 gene locus_tag LOCUS_16900 gene cdsA 1755 799 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328412.1 protein_id gnl|my_center|LOCUS_16900 2446 1778 gene locus_tag LOCUS_16910 2446 1778 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332043.1 protein_id gnl|my_center|LOCUS_16910 <2993 2491 gene locus_tag LOCUS_16920 <2993 2491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002218182.1:MBL fold metallo-hydrolase >Feature sequence440 <1 1181 gene locus_tag LOCUS_16930 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267720.1:alpha-amylase 2288 1188 gene locus_tag LOCUS_16940 2288 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 <2987 2373 gene locus_tag LOCUS_16950 <2987 2373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122134.1:ABC transporter ATP-binding protein >Feature sequence441 2962 1529 gene locus_tag LOCUS_16960 gene arsA 2962 1529 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence442 1048 71 gene locus_tag LOCUS_16970 gene pknB 1048 71 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 protein_id gnl|my_center|LOCUS_16970 1319 1819 gene locus_tag LOCUS_16980 1319 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085261.1 protein_id gnl|my_center|LOCUS_16980 2641 1946 gene locus_tag LOCUS_16990 2641 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2983 2774 gene locus_tag LOCUS_17000 2983 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence443 699 2039 gene locus_tag LOCUS_17010 699 2039 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_17010 2295 2555 gene locus_tag LOCUS_17020 2295 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17020 >Feature sequence444 1527 334 gene locus_tag LOCUS_17030 1527 334 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence445 2026 707 gene locus_tag LOCUS_17040 2026 707 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_17040 2559 2227 gene locus_tag LOCUS_17050 2559 2227 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence446 <1 2424 gene locus_tag LOCUS_17060 <1 2424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121935.1:cytochrome c biogenesis protein >Feature sequence447 88 663 gene locus_tag LOCUS_17070 88 663 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_17070 720 2609 gene locus_tag LOCUS_17080 720 2609 CDS product metal-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120156.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence448 1879 680 gene locus_tag LOCUS_17090 1879 680 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268059.1 protein_id gnl|my_center|LOCUS_17090 2918 1881 gene locus_tag LOCUS_17100 gene xylA 2918 1881 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R507 protein_id gnl|my_center|LOCUS_17100 >Feature sequence449 3 188 gene locus_tag LOCUS_17110 3 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence450 339 749 gene locus_tag LOCUS_17120 339 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 712 1728 gene locus_tag LOCUS_17130 gene ilvC 712 1728 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B738 protein_id gnl|my_center|LOCUS_17130 1753 1980 gene locus_tag LOCUS_17140 1753 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2128 2547 gene locus_tag LOCUS_17150 2128 2547 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529654.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence451 <1 621 gene locus_tag LOCUS_17160 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117844.1:magnesium protoporphyrin chelatase 626 2347 gene locus_tag LOCUS_17170 626 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_17170 2693 2337 gene locus_tag LOCUS_17180 2693 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence452 1 2901 gene locus_tag LOCUS_17190 1 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence453 1223 234 gene locus_tag LOCUS_17200 1223 234 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123521.1 protein_id gnl|my_center|LOCUS_17200 1836 1312 gene locus_tag LOCUS_17210 gene blc 1836 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114468.1 protein_id gnl|my_center|LOCUS_17210 <2940 2073 gene locus_tag LOCUS_17220 <2940 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123442.1:DNA translocase FtsK >Feature sequence454 2747 447 gene locus_tag LOCUS_17230 gene fdhF 2747 447 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence455 571 1581 gene locus_tag LOCUS_17240 571 1581 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_17240 1581 2027 gene locus_tag LOCUS_17250 1581 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence456 970 5 gene locus_tag LOCUS_17260 970 5 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122686.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence457 2187 823 gene locus_tag LOCUS_17270 gene aslA 2187 823 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence458 686 381 gene locus_tag LOCUS_17280 686 381 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118932.1 protein_id gnl|my_center|LOCUS_17280 1482 718 gene locus_tag LOCUS_17290 1482 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1754 1494 gene locus_tag LOCUS_17300 1754 1494 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118934.1 protein_id gnl|my_center|LOCUS_17300 <2910 1795 gene locus_tag LOCUS_17310 <2910 1795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333579.1:aldehyde dehydrogenase >Feature sequence459 1465 65 gene locus_tag LOCUS_17320 1465 65 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122491.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence460 <1 691 gene locus_tag LOCUS_17330 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000101415.1:alpha/beta hydrolase 809 2206 gene locus_tag LOCUS_17340 809 2206 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence461 >Feature sequence462 <1 1107 gene locus_tag LOCUS_17350 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122735.1:membrane protein 1182 2702 gene locus_tag LOCUS_17360 gene pepA 1182 2702 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ62 protein_id gnl|my_center|LOCUS_17360 >Feature sequence463 1450 560 gene locus_tag LOCUS_17370 gene rfbD 1450 560 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_17370 2336 1344 gene locus_tag LOCUS_17380 2336 1344 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJP9 protein_id gnl|my_center|LOCUS_17380 <2896 2371 gene locus_tag LOCUS_17390 <2896 2371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942724.1:dTDP-4-dehydrorhamnose 3,5-epimerase >Feature sequence464 402 2120 gene locus_tag LOCUS_17400 402 2120 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123340.1 protein_id gnl|my_center|LOCUS_17400 2174 2662 gene locus_tag LOCUS_17410 gene rnhA 2174 2662 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF86 protein_id gnl|my_center|LOCUS_17410 >Feature sequence465 >Feature sequence466 >Feature sequence467 >Feature sequence468 <1 731 gene locus_tag LOCUS_17420 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UVA9:aminodeoxyfutalosine synthase <2859 749 gene locus_tag LOCUS_17430 <2859 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118187.1:ATP-dependent DNA helicase RecG >Feature sequence469 1336 257 gene locus_tag LOCUS_17440 gene rsmC 1336 257 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122163.1 protein_id gnl|my_center|LOCUS_17440 2062 1619 gene locus_tag LOCUS_17450 gene vapc24 2062 1619 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P1K5 protein_id gnl|my_center|LOCUS_17450 2300 2049 gene locus_tag LOCUS_17460 2300 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence470 1334 321 gene locus_tag LOCUS_17470 1334 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence471 <2853 1626 gene locus_tag LOCUS_17480 <2853 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119558.1:ATP-binding protein >Feature sequence472 119 1636 gene locus_tag LOCUS_17490 119 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence473 85 708 gene locus_tag LOCUS_17500 85 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 705 1136 gene locus_tag LOCUS_17510 705 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1133 2218 gene locus_tag LOCUS_17520 1133 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2319 2669 gene locus_tag LOCUS_17530 2319 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence474 1376 384 gene locus_tag LOCUS_17540 1376 384 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_17540 1811 1443 gene locus_tag LOCUS_17550 1811 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence475 <1 1617 gene locus_tag LOCUS_17560 <1 1617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URP3:methionine--tRNA ligase 1675 2139 gene locus_tag LOCUS_17570 gene usp-2 1675 2139 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E46 protein_id gnl|my_center|LOCUS_17570 >Feature sequence476 55 924 gene locus_tag LOCUS_17580 55 924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121261.1 protein_id gnl|my_center|LOCUS_17580 927 1820 gene locus_tag LOCUS_17590 927 1820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence477 888 487 gene locus_tag LOCUS_17600 888 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_17600 <2831 1008 gene locus_tag LOCUS_17610 <2831 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UXH9:valine--tRNA ligase >Feature sequence478 1535 264 gene locus_tag LOCUS_17620 1535 264 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419222.1 protein_id gnl|my_center|LOCUS_17620 2338 1784 gene locus_tag LOCUS_17630 2338 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2631 2329 gene locus_tag LOCUS_17640 2631 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence479 <1 1152 gene locus_tag LOCUS_17650 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122217.1:SAM-dependent methyltransferase 2006 1110 gene locus_tag LOCUS_17660 2006 1110 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence480 1796 348 gene locus_tag LOCUS_17670 1796 348 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGU7 protein_id gnl|my_center|LOCUS_17670 2772 2101 gene locus_tag LOCUS_17680 gene trpG 2772 2101 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence481 888 415 gene locus_tag LOCUS_17690 888 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1333 953 gene locus_tag LOCUS_17700 1333 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1793 1335 gene locus_tag LOCUS_17710 1793 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 <2806 1831 gene locus_tag LOCUS_17720 <2806 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203328.1:9-O-acetylesterase >Feature sequence482 1559 1068 gene locus_tag LOCUS_17730 gene ispF 1559 1068 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J62 protein_id gnl|my_center|LOCUS_17730 1455 2678 gene locus_tag LOCUS_17740 1455 2678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120248.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence483 1633 1328 gene locus_tag LOCUS_17750 gene groS1 1633 1328 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM98 protein_id gnl|my_center|LOCUS_17750 <2800 1744 gene locus_tag LOCUS_17760 <2800 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UM99:60 kDa chaperonin 1 >Feature sequence484 >Feature sequence485 436 1509 gene locus_tag LOCUS_17770 436 1509 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_17770 1731 2027 gene locus_tag LOCUS_17780 1731 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence486 >Feature sequence487 1617 520 gene locus_tag LOCUS_17790 1617 520 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_17790 2753 1665 gene locus_tag LOCUS_17800 2753 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence488 1369 86 gene locus_tag LOCUS_17810 1369 86 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331299.1 protein_id gnl|my_center|LOCUS_17810 1607 2683 gene locus_tag LOCUS_17820 gene rfbB 1607 2683 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J0 protein_id gnl|my_center|LOCUS_17820 >Feature sequence489 1234 137 gene locus_tag LOCUS_17830 1234 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence490 <2780 483 gene locus_tag LOCUS_17840 <2780 483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFZ2:membrane protein insertase YidC >Feature sequence491 <2775 237 gene locus_tag LOCUS_17850 <2775 237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121080.1:ATP-dependent Clp protease ATP-binding protein >Feature sequence492 2389 935 gene locus_tag LOCUS_17860 2389 935 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence493 <2773 686 gene locus_tag LOCUS_17870 <2773 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268123.1:multidrug efflux RND transporter permease subunit >Feature sequence494 <1 2736 gene locus_tag LOCUS_17880 <1 2736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972354.1:multidrug efflux RND transporter permease subunit >Feature sequence495 1333 59 gene locus_tag LOCUS_17890 gene serS 1333 59 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXX6 protein_id gnl|my_center|LOCUS_17890 1440 1793 gene locus_tag LOCUS_17900 1440 1793 CDS product ATP-dependent Clp protease ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_17900 2436 2728 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgctgctcaggaaccatcttgca >Feature sequence496 1828 296 gene locus_tag LOCUS_17910 gene lysS 1828 296 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK37 protein_id gnl|my_center|LOCUS_17910 2012 2389 gene locus_tag LOCUS_17920 2012 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence497 693 34 gene locus_tag LOCUS_17930 693 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1873 794 gene locus_tag LOCUS_17940 1873 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2466 1870 gene locus_tag LOCUS_17950 2466 1870 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118125.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence498 91 699 gene locus_tag LOCUS_17960 91 699 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_17960 1901 714 gene locus_tag LOCUS_17970 gene pepT 1901 714 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121827.1 protein_id gnl|my_center|LOCUS_17970 2156 2563 gene locus_tag LOCUS_17980 2156 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence499 >Feature sequence500 109 732 gene locus_tag LOCUS_17990 gene can-1 109 732 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H26 protein_id gnl|my_center|LOCUS_17990 1164 2105 gene locus_tag LOCUS_18000 1164 2105 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence501 1385 2344 gene locus_tag LOCUS_18010 1385 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence502 >Feature sequence503 1850 249 gene locus_tag LOCUS_18020 gene asnB 1850 249 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_18020 2067 2540 gene locus_tag LOCUS_18030 2067 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence504 >Feature sequence505 1609 149 gene locus_tag LOCUS_18040 gene g6pD 1609 149 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVB9 protein_id gnl|my_center|LOCUS_18040 <2693 1859 gene locus_tag LOCUS_18050 <2693 1859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332279.1:D-mannonate oxidoreductase >Feature sequence506 >Feature sequence507 709 500 gene locus_tag LOCUS_18060 709 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 822 1937 gene locus_tag LOCUS_18070 gene pstS 822 1937 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_18070 >Feature sequence508 >Feature sequence509 1164 547 gene locus_tag LOCUS_18080 1164 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2198 1161 gene locus_tag LOCUS_18090 2198 1161 CDS product tetrahydromethanopterin-linked C1 transfer pathway inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120803.1 protein_id gnl|my_center|LOCUS_18090 2683 2198 gene locus_tag LOCUS_18100 2683 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence510 >Feature sequence511 603 160 gene locus_tag LOCUS_18110 603 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1630 605 gene locus_tag LOCUS_18120 gene gspG 1630 605 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118411.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence512 1606 119 gene locus_tag LOCUS_18130 1606 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2280 1759 gene locus_tag LOCUS_18140 2280 1759 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UV68 protein_id gnl|my_center|LOCUS_18140 >Feature sequence513 1257 190 gene locus_tag LOCUS_18150 1257 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2458 1307 gene locus_tag LOCUS_18160 2458 1307 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence514 <1 1925 gene locus_tag LOCUS_18170 <1 1925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003380455.1:multidrug efflux RND transporter permease subunit <2665 1999 gene locus_tag LOCUS_18180 <2665 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940504.1:RND transporter >Feature sequence515 2 859 gene locus_tag LOCUS_18190 2 859 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_18190 1125 2066 gene locus_tag LOCUS_18200 1125 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence516 3 2141 gene locus_tag LOCUS_18210 3 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence517 1497 694 gene locus_tag LOCUS_18220 1497 694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089229.1 protein_id gnl|my_center|LOCUS_18220 2571 1510 gene locus_tag LOCUS_18230 2571 1510 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence518 1316 720 gene locus_tag LOCUS_18240 gene rpsH 1316 720 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_18240 1563 2606 gene locus_tag LOCUS_18250 1563 2606 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122130.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence519 >Feature sequence520 246 25 gene locus_tag LOCUS_18260 gene infA 246 25 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY5 protein_id gnl|my_center|LOCUS_18260 1426 326 gene locus_tag LOCUS_18270 gene prfB 1426 326 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ31 protein_id gnl|my_center|LOCUS_18270 2570 1527 gene locus_tag LOCUS_18280 gene dprA 2570 1527 CDS product DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122801.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence521 1091 75 gene locus_tag LOCUS_18290 1091 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2007 2546 gene locus_tag LOCUS_18300 2007 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence522 399 1478 gene locus_tag LOCUS_18310 gene idh 399 1478 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119305.1 protein_id gnl|my_center|LOCUS_18310 1544 2482 gene locus_tag LOCUS_18320 1544 2482 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809454.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence523 >Feature sequence524 1914 52 gene locus_tag LOCUS_18330 1914 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence525 1149 637 gene locus_tag LOCUS_18340 gene purE 1149 637 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF4 protein_id gnl|my_center|LOCUS_18340 1298 2392 gene locus_tag LOCUS_18350 1298 2392 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHN0 protein_id gnl|my_center|LOCUS_18350 2465 2538 gene locus_tag LOCUS_t00300 2465 2538 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence526 >Feature sequence527 505 879 gene locus_tag LOCUS_18360 505 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence528 579 97 gene locus_tag LOCUS_18370 579 97 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831496.1 protein_id gnl|my_center|LOCUS_18370 959 732 gene locus_tag LOCUS_18380 959 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1515 886 gene locus_tag LOCUS_18390 1515 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence529 65 583 gene locus_tag LOCUS_18400 65 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1034 588 gene locus_tag LOCUS_18410 gene dtd 1034 588 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT1 protein_id gnl|my_center|LOCUS_18410 1143 1943 gene locus_tag LOCUS_18420 1143 1943 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence530 >Feature sequence531 720 28 gene locus_tag LOCUS_18430 720 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2190 1102 gene locus_tag LOCUS_18440 2190 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence532 684 1409 gene locus_tag LOCUS_18450 684 1409 CDS product glutamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121301.1 protein_id gnl|my_center|LOCUS_18450 <2581 1442 gene locus_tag LOCUS_18460 <2581 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120955.1:polyketide synthase >Feature sequence533 517 870 gene locus_tag LOCUS_18470 517 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124225.1 protein_id gnl|my_center|LOCUS_18470 971 2383 gene locus_tag LOCUS_18480 gene glnA 971 2383 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C40 protein_id gnl|my_center|LOCUS_18480 >Feature sequence534 2031 910 gene locus_tag LOCUS_18490 2031 910 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_18490 2324 2028 gene locus_tag LOCUS_18500 2324 2028 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence535 185 1306 gene locus_tag LOCUS_18510 185 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence536 >Feature sequence537 <1 1497 gene locus_tag LOCUS_18520 <1 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin 1592 1837 gene locus_tag LOCUS_18530 1592 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1834 2268 gene locus_tag LOCUS_18540 gene vapC43 1834 2268 CDS product ribonuclease VapC43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF55 protein_id gnl|my_center|LOCUS_18540 >Feature sequence538 2061 349 gene locus_tag LOCUS_18550 2061 349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_18550 <2556 2037 gene locus_tag LOCUS_18560 <2556 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124041.1:Fur family transcriptional regulator >Feature sequence539 >Feature sequence540 1475 675 gene locus_tag LOCUS_18570 1475 675 CDS product UvrB/UvrC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_18570 2110 1607 gene locus_tag LOCUS_18580 2110 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence541 1387 38 gene locus_tag LOCUS_18590 1387 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence542 569 1549 gene locus_tag LOCUS_18600 569 1549 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_18600 1536 1967 gene locus_tag LOCUS_18610 1536 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence543 1381 698 gene locus_tag LOCUS_18620 1381 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence544 201 119 gene locus_tag LOCUS_t00310 201 119 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 289 1557 gene locus_tag LOCUS_18630 289 1557 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119694.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence545 <2515 1279 gene locus_tag LOCUS_18640 <2515 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGY4:glutamyl-tRNA(Gln) amidotransferase subunit A >Feature sequence546 534 1607 gene locus_tag LOCUS_18650 534 1607 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331718.1 protein_id gnl|my_center|LOCUS_18650 1662 2129 gene locus_tag LOCUS_18660 1662 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence547 479 652 gene locus_tag LOCUS_18670 479 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1637 639 gene locus_tag LOCUS_18680 1637 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence548 <2507 1064 gene locus_tag LOCUS_18690 <2507 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119349.1:calcium sensor EFh >Feature sequence549 <1 1102 gene locus_tag LOCUS_18700 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117959.1:glycosyl hydrolase 2071 1187 gene locus_tag LOCUS_18710 2071 1187 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence550 <1 1168 gene locus_tag LOCUS_18720 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119232.1:carboxyl-terminal processing protease >Feature sequence551 758 2224 gene locus_tag LOCUS_18730 758 2224 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence552 1953 310 gene locus_tag LOCUS_18740 gene trx 1953 310 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120612.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence553 <1 514 gene locus_tag LOCUS_18750 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461664.1:cysteine synthase A 616 701 gene locus_tag LOCUS_t00320 616 701 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 901 975 gene locus_tag LOCUS_t00330 901 975 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1807 920 gene locus_tag LOCUS_18760 gene gluQ 1807 920 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_18760 >Feature sequence554 <1 584 gene locus_tag LOCUS_18770 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118487.1:dihydropteroate synthase 604 2154 gene locus_tag LOCUS_18780 gene pabB 604 2154 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084887.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence555 <1 1290 gene locus_tag LOCUS_18790 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933346.1:pyruvate, phosphate dikinase >Feature sequence556 1144 2175 gene locus_tag LOCUS_18800 gene fabH 1144 2175 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59814 protein_id gnl|my_center|LOCUS_18800 >Feature sequence557 >Feature sequence558 785 273 gene locus_tag LOCUS_18810 gene apt 785 273 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR74 protein_id gnl|my_center|LOCUS_18810 1694 804 gene locus_tag LOCUS_18820 1694 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 <2477 1901 gene locus_tag LOCUS_18830 <2477 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898793.1:metallophosphatase >Feature sequence559 851 1321 gene locus_tag LOCUS_18840 851 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1355 2305 gene locus_tag LOCUS_18850 1355 2305 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence560 <1 1845 gene locus_tag LOCUS_18860 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWI5:protein translocase subunit SecA 2 >Feature sequence561 1525 68 gene locus_tag LOCUS_18870 1525 68 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389166.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence562 >Feature sequence563 <2460 1454 gene locus_tag LOCUS_18880 <2460 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121859.1:sulfatase >Feature sequence564 1807 851 gene locus_tag LOCUS_18890 1807 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2286 2131 gene locus_tag LOCUS_18900 2286 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence565 1045 2061 gene locus_tag LOCUS_18910 1045 2061 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU2 protein_id gnl|my_center|LOCUS_18910 >Feature sequence566 509 1612 gene locus_tag LOCUS_18920 509 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2433 1681 gene locus_tag LOCUS_18930 gene ugpQ 2433 1681 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence567 >Feature sequence568 1980 2387 gene locus_tag LOCUS_18940 1980 2387 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831496.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence569 >Feature sequence570 1432 65 gene locus_tag LOCUS_18950 1432 65 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence571 >Feature sequence572 <1 651 gene locus_tag LOCUS_18960 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392987.1:two-component sensor histidine kinase 943 1572 gene locus_tag LOCUS_18970 943 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_18970 1639 2421 gene locus_tag LOCUS_18980 1639 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence573 754 1374 gene locus_tag LOCUS_18990 754 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence574 1555 818 gene locus_tag LOCUS_19000 gene rex 1555 818 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW59 protein_id gnl|my_center|LOCUS_19000 >Feature sequence575 2393 993 gene locus_tag LOCUS_19010 2393 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence576 619 2061 gene locus_tag LOCUS_19020 619 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence577 1152 2246 gene locus_tag LOCUS_19030 1152 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence578 <1 1401 gene locus_tag LOCUS_19040 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747D6:pyruvate kinase >Feature sequence579 <1 1344 gene locus_tag LOCUS_19050 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UM33:chaperone protein ClpB 1658 1464 gene locus_tag LOCUS_19060 1658 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1808 1896 gene locus_tag LOCUS_t00340 1808 1896 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence580 366 1247 gene locus_tag LOCUS_19070 366 1247 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121978.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence581 766 536 gene locus_tag LOCUS_19080 766 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence582 1415 333 gene locus_tag LOCUS_19090 1415 333 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122231.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence583 >Feature sequence584 >Feature sequence585 >Feature sequence586 603 2075 gene locus_tag LOCUS_19100 gene arsA 603 2075 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence587 <1 1621 gene locus_tag LOCUS_19110 <1 1621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120416.1:sulfatase >Feature sequence588 823 1182 gene locus_tag LOCUS_19120 823 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 <2366 1184 gene locus_tag LOCUS_19130 <2366 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPD6:UvrABC system protein C >Feature sequence589 506 2050 gene locus_tag LOCUS_19140 506 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence590 999 2297 gene locus_tag LOCUS_19150 999 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence591 1273 2343 gene locus_tag LOCUS_19160 gene queA 1273 2343 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGI9 protein_id gnl|my_center|LOCUS_19160 >Feature sequence592 1024 347 gene locus_tag LOCUS_19170 1024 347 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258628.1 protein_id gnl|my_center|LOCUS_19170 1388 1002 gene locus_tag LOCUS_19180 gene hypA 1388 1002 CDS product putative hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK98 protein_id gnl|my_center|LOCUS_19180 1432 2136 gene locus_tag LOCUS_19190 1432 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence593 <1 772 gene locus_tag LOCUS_19200 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883557.1:long chain fatty acid--ACP ligase 1152 823 gene locus_tag LOCUS_19210 1152 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1343 1125 gene locus_tag LOCUS_19220 1343 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402859.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence594 1724 156 gene locus_tag LOCUS_19230 gene aslA 1724 156 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123091.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence595 192 1139 gene locus_tag LOCUS_19240 192 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence596 <2328 860 gene locus_tag LOCUS_19250 <2328 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63PL2:glycine dehydrogenase (decarboxylating) >Feature sequence597 2170 998 gene locus_tag LOCUS_19260 2170 998 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence598 398 1426 gene locus_tag LOCUS_19270 398 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence599 1317 220 gene locus_tag LOCUS_19280 1317 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2215 1550 gene locus_tag LOCUS_19290 2215 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035630.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence600 1826 1086 gene locus_tag LOCUS_19300 gene ispD 1826 1086 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM15 protein_id gnl|my_center|LOCUS_19300 >Feature sequence601 1535 2050 gene locus_tag LOCUS_19310 1535 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence602 <1 1050 gene locus_tag LOCUS_19320 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118296.1:NADH:flavin oxidoreductase >Feature sequence603 1066 1470 gene locus_tag LOCUS_19330 1066 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence604 250 939 gene locus_tag LOCUS_19340 250 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 <2308 1015 gene locus_tag LOCUS_19350 <2308 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117906.1:sulfatase >Feature sequence605 >Feature sequence606 <2307 60 gene locus_tag LOCUS_19360 <2307 60 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119679.1:ATP-dependent helicase HrpB >Feature sequence607 663 1445 gene locus_tag LOCUS_19370 663 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence608 110 775 gene locus_tag LOCUS_19380 110 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 901 827 gene locus_tag LOCUS_t00350 901 827 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1712 1128 gene locus_tag LOCUS_19390 1712 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120344.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence609 291 2084 gene locus_tag LOCUS_19400 291 2084 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence610 >Feature sequence611 >Feature sequence612 <1 1188 gene locus_tag LOCUS_19410 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119589.1:aryl-sulfate sulfohydrolase >Feature sequence613 <2285 1584 gene locus_tag LOCUS_19420 <2285 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947926.1:chitinase >Feature sequence614 <1 1417 gene locus_tag LOCUS_19430 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015207.1:ABC transporter permease 1655 2200 gene locus_tag LOCUS_19440 1655 2200 CDS product raiA ribosome-associated inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence615 1523 609 gene locus_tag LOCUS_19450 gene argF 1523 609 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ6 protein_id gnl|my_center|LOCUS_19450 <2282 1597 gene locus_tag LOCUS_19460 <2282 1597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GU3:acetylornithine aminotransferase >Feature sequence616 <1 554 gene locus_tag LOCUS_19470 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121080.1:ATP-dependent Clp protease ATP-binding protein 636 1571 gene locus_tag LOCUS_19480 636 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 <2279 1584 gene locus_tag LOCUS_19490 <2279 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121006.1:arylsulfatase >Feature sequence617 2123 615 gene locus_tag LOCUS_19500 2123 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence618 1427 339 gene locus_tag LOCUS_19510 1427 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 <2277 1443 gene locus_tag LOCUS_19520 <2277 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939731.1:peptide ABC transporter permease >Feature sequence619 1000 188 gene locus_tag LOCUS_19530 1000 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence620 455 1633 gene locus_tag LOCUS_19540 gene sbcD 455 1633 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124855.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence621 >Feature sequence622 <1 1347 gene locus_tag LOCUS_19550 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119791.1:cytochrome c >Feature sequence623 >Feature sequence624 1573 344 gene locus_tag LOCUS_19560 gene nuoH 1573 344 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 protein_id gnl|my_center|LOCUS_19560 <2253 1738 gene locus_tag LOCUS_19570 <2253 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WED7:NADH-quinone oxidoreductase subunit D 1 >Feature sequence625 <1 1611 gene locus_tag LOCUS_19580 <1 1611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121383.1:membrane protein containing membrane-bound dehydrogenase >Feature sequence626 <2252 1305 gene locus_tag LOCUS_19590 <2252 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123682.1:arylsulfatase >Feature sequence627 945 16 gene locus_tag LOCUS_19600 945 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 977 1051 gene locus_tag LOCUS_t00360 977 1051 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1080 1385 gene locus_tag LOCUS_19610 1080 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence628 679 1971 gene locus_tag LOCUS_19620 gene eno 679 1971 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR2 protein_id gnl|my_center|LOCUS_19620 >Feature sequence629 1751 1527 gene locus_tag LOCUS_19630 1751 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence630 2059 209 gene locus_tag LOCUS_19640 2059 209 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence631 <1 1533 gene locus_tag LOCUS_19650 <1 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119288.1:N-acetylgalactosamine-6-sulfatase >Feature sequence632 469 603 gene locus_tag LOCUS_19660 469 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 796 1824 gene locus_tag LOCUS_19670 gene glnII 796 1824 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_19670 >Feature sequence633 >Feature sequence634 1904 1365 gene locus_tag LOCUS_19680 1904 1365 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118125.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence635 >Feature sequence636 876 280 gene locus_tag LOCUS_19690 876 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1054 860 gene locus_tag LOCUS_19700 1054 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence637 977 390 gene locus_tag LOCUS_19710 977 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 1085 2008 gene locus_tag LOCUS_19720 1085 2008 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258229.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence638 34 933 gene locus_tag LOCUS_19730 34 933 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333052.1 protein_id gnl|my_center|LOCUS_19730 1892 960 gene locus_tag LOCUS_19740 1892 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence639 779 853 gene locus_tag LOCUS_t00370 779 853 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1185 1559 gene locus_tag LOCUS_19750 1185 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence640 <1 2053 gene locus_tag LOCUS_19760 <1 2053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120440.1:cytochrome c >Feature sequence641 479 1891 gene locus_tag LOCUS_19770 479 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence642 1481 696 gene locus_tag LOCUS_19780 1481 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 <2212 1534 gene locus_tag LOCUS_19790 <2212 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122564.1:Fe-S cluster assembly protein SufD >Feature sequence643 637 2121 gene locus_tag LOCUS_19800 gene arsA 637 2121 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence644 1809 2024 gene locus_tag LOCUS_19810 1809 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence645 3 941 gene locus_tag LOCUS_19820 gene uxuA 3 941 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MV13 protein_id gnl|my_center|LOCUS_19820 <2190 1366 gene locus_tag LOCUS_19830 <2190 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124073.1:lipase >Feature sequence646 <1 1990 gene locus_tag LOCUS_19840 <1 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010928938.1:cyanophycin synthetase >Feature sequence647 809 240 gene locus_tag LOCUS_19850 809 240 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW63 protein_id gnl|my_center|LOCUS_19850 <2172 979 gene locus_tag LOCUS_19860 <2172 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S008:phosphoenolpyruvate carboxykinase [ATP] 2 >Feature sequence648 1403 330 gene locus_tag LOCUS_19870 1403 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 <2167 1397 gene locus_tag LOCUS_19880 <2167 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UTQ8:pantothenate synthetase >Feature sequence649 2128 860 gene locus_tag LOCUS_19890 gene glyA 2128 860 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN2 protein_id gnl|my_center|LOCUS_19890 >Feature sequence650 2026 1709 gene locus_tag LOCUS_19900 2026 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence651 646 1365 gene locus_tag LOCUS_19910 gene menG 646 1365 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59912 protein_id gnl|my_center|LOCUS_19910 1362 1973 gene locus_tag LOCUS_19920 gene ubiX 1362 1973 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA7 protein_id gnl|my_center|LOCUS_19920 >Feature sequence652 703 1596 gene locus_tag LOCUS_19930 gene dapA 703 1596 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVB1 protein_id gnl|my_center|LOCUS_19930 <2161 1633 gene locus_tag LOCUS_19940 <2161 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532030.1:beta-ribofuranosylaminobenzene 5'-phosphate synthase >Feature sequence653 3 1307 gene locus_tag LOCUS_19950 3 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence654 1126 92 gene locus_tag LOCUS_19960 1126 92 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence655 >Feature sequence656 2152 1478 gene locus_tag LOCUS_19970 2152 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence657 34 1863 gene locus_tag LOCUS_19980 34 1863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325469.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence658 1476 184 gene locus_tag LOCUS_19990 1476 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence659 1540 200 gene locus_tag LOCUS_20000 1540 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence660 8 1936 gene locus_tag LOCUS_20010 8 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence661 <1 1482 gene locus_tag LOCUS_20020 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118432.1:general secretion pathway protein GspD 1526 1915 gene locus_tag LOCUS_20030 1526 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216764.1 protein_id gnl|my_center|LOCUS_20030 2122 1919 gene locus_tag LOCUS_20040 2122 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence662 <1 1821 gene locus_tag LOCUS_20050 <1 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020360.1:peptide ABC transporter substrate-binding protein >Feature sequence663 >Feature sequence664 <1 1810 gene locus_tag LOCUS_20060 <1 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671244.1:chemotaxis protein CheA >Feature sequence665 <1 1081 gene locus_tag LOCUS_20070 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122408.1:N-acetylgalactosamine-6-sulfatase >Feature sequence666 601 1446 gene locus_tag LOCUS_20080 601 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence667 <1 616 gene locus_tag LOCUS_20090 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979317.1:DNA topoisomerase VI subunit A 1055 1942 gene locus_tag LOCUS_20100 1055 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence668 533 2092 gene locus_tag LOCUS_20110 gene gltX 533 2092 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNF9 protein_id gnl|my_center|LOCUS_20110 >Feature sequence669 <1 1558 gene locus_tag LOCUS_20120 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGK9:signal peptidase I >Feature sequence670 127 1047 gene locus_tag LOCUS_20130 127 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 <2093 1092 gene locus_tag LOCUS_20140 <2093 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJW8:peptidyl-prolyl cis-trans isomerase >Feature sequence671 <1 776 gene locus_tag LOCUS_20150 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085833.1:C4-dicarboxylate ABC transporter permease 895 1845 gene locus_tag LOCUS_20160 gene dapA 895 1845 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122009.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence672 <1 1005 gene locus_tag LOCUS_20170 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121568.1:xanthan lyase >Feature sequence673 1854 124 gene locus_tag LOCUS_20180 1854 124 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence674 <1 1722 gene locus_tag LOCUS_20190 <1 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UUS6:DNA-directed DNA polymerase >Feature sequence675 >Feature sequence676 >Feature sequence677 <1 1005 gene locus_tag LOCUS_20200 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329803.1:Fe-S cluster assembly protein SufB >Feature sequence678 575 817 gene locus_tag LOCUS_20210 575 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence679 1234 338 gene locus_tag LOCUS_20220 1234 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence680 >Feature sequence681 944 1411 gene locus_tag LOCUS_20230 944 1411 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG74 protein_id gnl|my_center|LOCUS_20230 >Feature sequence682 1382 609 gene locus_tag LOCUS_20240 1382 609 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence683 1720 263 gene locus_tag LOCUS_20250 gene yidJ 1720 263 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122680.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence684 554 1999 gene locus_tag LOCUS_20260 gene pgi 554 1999 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYT0 protein_id gnl|my_center|LOCUS_20260 >Feature sequence685 <2061 1182 gene locus_tag LOCUS_20270 <2061 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122306.1:large multi-functional protein >Feature sequence686 >Feature sequence687 >Feature sequence688 <2052 229 gene locus_tag LOCUS_20280 <2052 229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase >Feature sequence689 <2052 726 gene locus_tag LOCUS_20290 <2052 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118712.1:mechanosensitive ion channel protein MscS >Feature sequence690 805 1689 gene locus_tag LOCUS_20300 gene rluD 805 1689 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX8 protein_id gnl|my_center|LOCUS_20300 >Feature sequence691 1057 1407 gene locus_tag LOCUS_20310 1057 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1404 1910 gene locus_tag LOCUS_20320 1404 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence692 >Feature sequence693 <2045 419 gene locus_tag LOCUS_20330 <2045 419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728459.1:asparagine synthetase B >Feature sequence694 538 984 gene locus_tag LOCUS_20340 gene cheD 538 984 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X005 protein_id gnl|my_center|LOCUS_20340 1011 1400 gene locus_tag LOCUS_20350 1011 1400 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence695 >Feature sequence696 <1 1172 gene locus_tag LOCUS_20360 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118392.1:DNA polymerase/3'-5' exonuclease PolX >Feature sequence697 1658 309 gene locus_tag LOCUS_20370 1658 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_20370 2027 1806 gene locus_tag LOCUS_20380 2027 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence698 1989 1207 gene locus_tag LOCUS_20390 1989 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence699 <2032 392 gene locus_tag LOCUS_20400 <2032 392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122818.1:succinate dehydrogenase flavoprotein subunit >Feature sequence700 1369 596 gene locus_tag LOCUS_20410 gene surE 1369 596 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT6 protein_id gnl|my_center|LOCUS_20410 >Feature sequence701 1847 420 gene locus_tag LOCUS_20420 1847 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence702 >Feature sequence703 <2019 1223 gene locus_tag LOCUS_20430 <2019 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121488.1:Fe-S oxidoreductase >Feature sequence704 <2018 25 gene locus_tag LOCUS_20440 <2018 25 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122783.1:hemolysin D >Feature sequence705 884 1408 gene locus_tag LOCUS_20450 884 1408 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123277.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence706 <1 1384 gene locus_tag LOCUS_20460 <1 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728458.1:GNAT family N-acetyltransferase >Feature sequence707 591 1382 gene locus_tag LOCUS_20470 591 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence708 <1 914 gene locus_tag LOCUS_20480 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UXN8:magnesium transporter MgtE >Feature sequence709 1129 404 gene locus_tag LOCUS_20490 1129 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence710 281 952 gene locus_tag LOCUS_20500 281 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_20500 1264 1830 gene locus_tag LOCUS_20510 1264 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence711 <1 765 gene locus_tag LOCUS_20520 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQA4:tryptophan--tRNA ligase 762 1181 gene locus_tag LOCUS_20530 gene acpS 762 1181 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE72 protein_id gnl|my_center|LOCUS_20530 1998 1201 gene locus_tag LOCUS_20540 1998 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence712 >Feature sequence713 1115 204 gene locus_tag LOCUS_20550 gene cysD 1115 204 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_20550 1691 1434 gene locus_tag LOCUS_20560 1691 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence714 1978 302 gene locus_tag LOCUS_20570 1978 302 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119516.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence715 6 530 gene locus_tag LOCUS_20580 6 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 540 1850 gene locus_tag LOCUS_20590 540 1850 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence716 <1978 1000 gene locus_tag LOCUS_20600 <1978 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120638.1:beta-galactosidase >Feature sequence717 <1 871 gene locus_tag LOCUS_20610 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU27:NADH-quinone oxidoreductase subunit N >Feature sequence718 1240 65 gene locus_tag LOCUS_20620 1240 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence719 1347 25 gene locus_tag LOCUS_20630 1347 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120254.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence720 1410 1628 gene locus_tag LOCUS_20640 1410 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence721 >Feature sequence722 <1 1164 gene locus_tag LOCUS_20650 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UX39:histidinol dehydrogenase <1964 1310 gene locus_tag LOCUS_20660 <1964 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707869.1:IS110 family transposase >Feature sequence723 1852 383 gene locus_tag LOCUS_20670 gene guaB 1852 383 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJL3 protein_id gnl|my_center|LOCUS_20670 >Feature sequence724 1344 163 gene locus_tag LOCUS_20680 1344 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence725 1690 329 gene locus_tag LOCUS_20690 1690 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence726 1358 564 gene locus_tag LOCUS_20700 1358 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence727 402 1628 gene locus_tag LOCUS_20710 402 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence728 <1940 38 gene locus_tag LOCUS_20720 <1940 38 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFQ0:primosomal protein N' >Feature sequence729 1341 472 gene locus_tag LOCUS_20730 1341 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence730 >Feature sequence731 <1 858 gene locus_tag LOCUS_20740 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038153.1:xylanase >Feature sequence732 >Feature sequence733 1647 745 gene locus_tag LOCUS_20750 1647 745 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence734 736 59 gene locus_tag LOCUS_20760 736 59 CDS product septum formation inhibitor Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868834.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence735 <1 678 gene locus_tag LOCUS_20770 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122238.1:hemolysin D >Feature sequence736 >Feature sequence737 369 1895 gene locus_tag LOCUS_20780 369 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence738 399 1370 gene locus_tag LOCUS_20790 gene pyrD 399 1370 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UML7 protein_id gnl|my_center|LOCUS_20790 >Feature sequence739 372 208 gene locus_tag LOCUS_20800 372 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 545 1333 gene locus_tag LOCUS_20810 545 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 <1915 1266 gene locus_tag LOCUS_20820 <1915 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EXU6:ATP-dependent 6-phosphofructokinase >Feature sequence740 >Feature sequence741 <1 1368 gene locus_tag LOCUS_20830 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117969.1:cytochrome c >Feature sequence742 332 1618 gene locus_tag LOCUS_20840 332 1618 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence743 <1 567 gene locus_tag LOCUS_20850 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403751.1:C4-dicarboxylate ABC transporter 815 1570 gene locus_tag LOCUS_20860 815 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence744 >Feature sequence745 1896 526 gene locus_tag LOCUS_20870 1896 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence746 >Feature sequence747 737 1252 gene locus_tag LOCUS_20880 737 1252 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDH6 protein_id gnl|my_center|LOCUS_20880 >Feature sequence748 376 1182 gene locus_tag LOCUS_20890 376 1182 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531396.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence749 <1 1117 gene locus_tag LOCUS_20900 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119295.1:cytochrome c <1886 1133 gene locus_tag LOCUS_20910 <1886 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119046.1:NADH-dependent dehydrogenase >Feature sequence750 >Feature sequence751 >Feature sequence752 805 104 gene locus_tag LOCUS_20920 805 104 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902576.1 protein_id gnl|my_center|LOCUS_20920 <1881 865 gene locus_tag LOCUS_20930 <1881 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIE0:aminotransferase >Feature sequence753 <1 619 gene locus_tag LOCUS_20940 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259146.1:agmatine deiminase 1008 1502 gene locus_tag LOCUS_20950 1008 1502 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976297.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence754 75 1562 gene locus_tag LOCUS_20960 75 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence755 1603 1088 gene locus_tag LOCUS_20970 1603 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence756 553 317 gene locus_tag LOCUS_20980 553 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 <1873 710 gene locus_tag LOCUS_20990 <1873 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326676.1:sulfatase >Feature sequence757 >Feature sequence758 >Feature sequence759 746 516 gene locus_tag LOCUS_21000 746 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 741 1454 gene locus_tag LOCUS_21010 741 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence760 1710 175 gene locus_tag LOCUS_21020 gene aslA1 1710 175 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976039.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence761 >Feature sequence762 778 1452 gene locus_tag LOCUS_21030 gene nadD 778 1452 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFN6 protein_id gnl|my_center|LOCUS_21030 1689 1405 gene locus_tag LOCUS_21040 1689 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence763 >Feature sequence764 >Feature sequence765 <1 696 gene locus_tag LOCUS_21050 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123507.1:protein-xanthan lyase >Feature sequence766 >Feature sequence767 570 1493 gene locus_tag LOCUS_21060 570 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124104.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence768 >Feature sequence769 1013 1837 gene locus_tag LOCUS_21070 1013 1837 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324393.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence770 >Feature sequence771 1365 1829 gene locus_tag LOCUS_21080 1365 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence772 <1 1392 gene locus_tag LOCUS_21090 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118986.1:cytochrome c >Feature sequence773 >Feature sequence774 3 839 gene locus_tag LOCUS_21100 3 839 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229478.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence775 837 1058 gene locus_tag LOCUS_21110 837 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence776 <1817 567 gene locus_tag LOCUS_21120 <1817 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123862.1:permease >Feature sequence777 2 1474 gene locus_tag LOCUS_21130 2 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence778 564 1382 gene locus_tag LOCUS_21140 564 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence779 1169 894 gene locus_tag LOCUS_21150 gene acpP 1169 894 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV7 protein_id gnl|my_center|LOCUS_21150 <1811 1212 gene locus_tag LOCUS_21160 <1811 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404147.1:chalcone synthase >Feature sequence780 1710 763 gene locus_tag LOCUS_21170 1710 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence781 494 949 gene locus_tag LOCUS_21180 494 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_21180 1048 1665 gene locus_tag LOCUS_21190 1048 1665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence782 1261 509 gene locus_tag LOCUS_21200 1261 509 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123968.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence783 <1803 1270 gene locus_tag LOCUS_21210 <1803 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118996.1:iduronate-2-sulfatase >Feature sequence784 892 1488 gene locus_tag LOCUS_21220 892 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence785 >Feature sequence786 >Feature sequence787 >Feature sequence788 1386 361 gene locus_tag LOCUS_21230 1386 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence789 <1 1087 gene locus_tag LOCUS_21240 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120793.1:L-sorbosone dehydrogenase >Feature sequence790 1013 411 gene locus_tag LOCUS_21250 gene rplA 1013 411 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI03 protein_id gnl|my_center|LOCUS_21250 1629 1204 gene locus_tag LOCUS_21260 gene rplK 1629 1204 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY7 protein_id gnl|my_center|LOCUS_21260 >Feature sequence791 >Feature sequence792 <1 822 gene locus_tag LOCUS_21270 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121020.1:prepilin-type N-terminal cleavage/methylation domain-containing protein >Feature sequence793 502 1023 gene locus_tag LOCUS_21280 502 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 1418 1068 gene locus_tag LOCUS_21290 1418 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence794 >Feature sequence795 <1 623 gene locus_tag LOCUS_21300 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121186.1:UDP-N-acetylhexosamine pyrophosphorylase >Feature sequence796 >Feature sequence797 1415 36 gene locus_tag LOCUS_21310 1415 36 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence798 783 1280 gene locus_tag LOCUS_21320 gene fae 783 1280 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122706.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence799 >Feature sequence800 <1 1533 gene locus_tag LOCUS_21330 <1 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120962.1:cytochrome c >Feature sequence801 >Feature sequence802 <1759 1024 gene locus_tag LOCUS_21340 <1759 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UEN7:UPF0721 transmembrane protein >Feature sequence803 371 60 gene locus_tag LOCUS_21350 371 60 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122082.1 protein_id gnl|my_center|LOCUS_21350 1685 633 gene locus_tag LOCUS_21360 1685 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence804 >Feature sequence805 >Feature sequence806 440 1006 gene locus_tag LOCUS_21370 440 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence807 324 497 gene locus_tag LOCUS_21380 324 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1650 571 gene locus_tag LOCUS_21390 1650 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21390 >Feature sequence808 36 1241 gene locus_tag LOCUS_21400 36 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence809 570 1694 gene locus_tag LOCUS_21410 570 1694 CDS product 3-chlorobenzoate-3,4-dioxygenase dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence810 904 752 gene locus_tag LOCUS_21420 904 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence811 <1744 264 gene locus_tag LOCUS_21430 <1744 264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964341.1:transporter >Feature sequence812 1482 187 gene locus_tag LOCUS_21440 1482 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence813 >Feature sequence814 <1 555 gene locus_tag LOCUS_21450 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291837.1:isocitrate dehydrogenase >Feature sequence815 616 1554 gene locus_tag LOCUS_21460 gene iunH 616 1554 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324951.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence816 <1 1077 gene locus_tag LOCUS_21470 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122003.1:L-fucose isomerase >Feature sequence817 1461 835 gene locus_tag LOCUS_21480 1461 835 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence818 102 428 gene locus_tag LOCUS_21490 102 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence819 <1721 333 gene locus_tag LOCUS_21500 <1721 333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URC7:arginine--tRNA ligase >Feature sequence820 <1 859 gene locus_tag LOCUS_21510 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963447.1:methyl-accepting chemotaxis protein 1055 1351 gene locus_tag LOCUS_21520 1055 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence821 >Feature sequence822 1681 362 gene locus_tag LOCUS_21530 1681 362 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence823 <1717 1130 gene locus_tag LOCUS_21540 <1717 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123732.1:sulfatase >Feature sequence824 1 654 gene locus_tag LOCUS_21550 1 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence825 >Feature sequence826 >Feature sequence827 443 371 gene locus_tag LOCUS_t00380 443 371 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence828 <1707 1014 gene locus_tag LOCUS_21560 <1707 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122819.1:succinate dehydrogenase iron-sulfur subunit >Feature sequence829 >Feature sequence830 >Feature sequence831 >Feature sequence832 763 8 gene locus_tag LOCUS_21570 gene lpxC 763 8 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ2 protein_id gnl|my_center|LOCUS_21570 >Feature sequence833 1503 1006 gene locus_tag LOCUS_21580 1503 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence834 1 942 gene locus_tag LOCUS_21590 1 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022099.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence835 1447 446 gene locus_tag LOCUS_21600 1447 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence836 >Feature sequence837 510 91 gene locus_tag LOCUS_21610 510 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1535 576 gene locus_tag LOCUS_21620 gene ispE 1535 576 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37550 protein_id gnl|my_center|LOCUS_21620 >Feature sequence838 >Feature sequence839 >Feature sequence840 >Feature sequence841 >Feature sequence842 150 1103 gene locus_tag LOCUS_21630 150 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence843 <1656 453 gene locus_tag LOCUS_21640 <1656 453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120799.1:choline-sulfatase >Feature sequence844 884 288 gene locus_tag LOCUS_21650 gene hisB 884 288 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC2 protein_id gnl|my_center|LOCUS_21650 <1656 909 gene locus_tag LOCUS_21660 <1656 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNC3:histidinol-phosphate aminotransferase >Feature sequence845 >Feature sequence846 >Feature sequence847 >Feature sequence848 <1 967 gene locus_tag LOCUS_21670 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UK56:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B >Feature sequence849 1112 369 gene locus_tag LOCUS_21680 1112 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_21680 1642 1286 gene locus_tag LOCUS_21690 1642 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence850 1287 46 gene locus_tag LOCUS_21700 1287 46 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence851 411 845 gene locus_tag LOCUS_21710 411 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1075 1203 gene locus_tag LOCUS_21720 1075 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence852 >Feature sequence853 1269 574 gene locus_tag LOCUS_21730 1269 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence854 <1624 869 gene locus_tag LOCUS_21740 <1624 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase >Feature sequence855 >Feature sequence856 >Feature sequence857 >Feature sequence858 1371 598 gene locus_tag LOCUS_21750 1371 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence859 877 1308 gene locus_tag LOCUS_21760 877 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence860 515 417 gene locus_tag LOCUS_t00390 515 417 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence861 >Feature sequence862 <1 771 gene locus_tag LOCUS_21770 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327631.1:peptide ABC transporter permease >Feature sequence863 1220 342 gene locus_tag LOCUS_21780 1220 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence864 <1 1422 gene locus_tag LOCUS_21790 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123517.1:hydrolase >Feature sequence865 76 750 gene locus_tag LOCUS_21800 76 750 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_21800 <1604 762 gene locus_tag LOCUS_21810 <1604 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YH51:RNA-splicing ligase RtcB >Feature sequence866 >Feature sequence867 302 1330 gene locus_tag LOCUS_21820 302 1330 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence868 >Feature sequence869 <1 1333 gene locus_tag LOCUS_21830 <1 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118999.1:cytochrome c >Feature sequence870 >Feature sequence871 >Feature sequence872 >Feature sequence873 >Feature sequence874 >Feature sequence875 >Feature sequence876 1205 753 gene locus_tag LOCUS_21840 1205 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence877 >Feature sequence878 <1 1080 gene locus_tag LOCUS_21850 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122824.1:gluconate permease 1352 1098 gene locus_tag LOCUS_21860 1352 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21860 >Feature sequence879 >Feature sequence880 >Feature sequence881 1570 215 gene locus_tag LOCUS_21870 1570 215 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence882 >Feature sequence883 286 513 gene locus_tag LOCUS_21880 286 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 470 1456 gene locus_tag LOCUS_21890 470 1456 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence884 >Feature sequence885 >Feature sequence886 >Feature sequence887 3 218 gene locus_tag LOCUS_21900 3 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 754 667 gene locus_tag LOCUS_t00400 754 667 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 951 1208 gene locus_tag LOCUS_21910 951 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence888 504 1550 gene locus_tag LOCUS_21920 gene moeB 504 1550 CDS product molybdopterin-synthase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31702 protein_id gnl|my_center|LOCUS_21920 >Feature sequence889 <1 585 gene locus_tag LOCUS_21930 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJ72:GDP-mannose 4,6-dehydratase >Feature sequence890 >Feature sequence891 1517 21 gene locus_tag LOCUS_21940 1517 21 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117906.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence892 >Feature sequence893 >Feature sequence894 >Feature sequence895 1024 1368 gene locus_tag LOCUS_21950 1024 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence896 <1 870 gene locus_tag LOCUS_21960 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119017.1:4-hydroxybenzoate octaprenyltransferase >Feature sequence897 <1535 447 gene locus_tag LOCUS_21970 <1535 447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085632.1:transporter >Feature sequence898 >Feature sequence899 >Feature sequence900 >Feature sequence901 >Feature sequence902 <1522 929 gene locus_tag LOCUS_21980 <1522 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189844.1:hydrolase >Feature sequence903 292 1098 gene locus_tag LOCUS_21990 gene comB 292 1098 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM81 protein_id gnl|my_center|LOCUS_21990 >Feature sequence904 >Feature sequence905 >Feature sequence906 <1516 272 gene locus_tag LOCUS_22000 <1516 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118029.1:N-acetylgalactosamine-6-sulfatase >Feature sequence907 >Feature sequence908 >Feature sequence909 >Feature sequence910 274 558 gene locus_tag LOCUS_22010 274 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 706 918 gene locus_tag LOCUS_22020 706 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1092 1424 gene locus_tag LOCUS_22030 1092 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22030 >Feature sequence911 937 95 gene locus_tag LOCUS_22040 937 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1107 952 gene locus_tag LOCUS_22050 1107 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence912 385 708 gene locus_tag LOCUS_22060 385 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328015.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence913 994 485 gene locus_tag LOCUS_22070 994 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070