>Feature sequence001 3513 4976 gene locus_tag LOCUS_00010 3513 4976 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 protein_id gnl|my_center|LOCUS_00010 5193 4993 gene locus_tag LOCUS_00020 5193 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5726 5478 gene locus_tag LOCUS_00030 5726 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6939 5872 gene locus_tag LOCUS_00040 6939 5872 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_00040 8313 7051 gene locus_tag LOCUS_00050 gene nqrF 8313 7051 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_00050 9139 8453 gene locus_tag LOCUS_00060 gene nqrE 9139 8453 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS1 protein_id gnl|my_center|LOCUS_00060 9879 9259 gene locus_tag LOCUS_00070 gene nqrD 9879 9259 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_00070 10934 9999 gene locus_tag LOCUS_00080 gene nqrC 10934 9999 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS3 protein_id gnl|my_center|LOCUS_00080 12144 10924 gene locus_tag LOCUS_00090 gene nqrB 12144 10924 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_00090 13679 12318 gene locus_tag LOCUS_00100 gene nqrA 13679 12318 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS5 protein_id gnl|my_center|LOCUS_00100 15515 14091 gene locus_tag LOCUS_00110 gene lpd 15515 14091 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM8 protein_id gnl|my_center|LOCUS_00110 17432 15618 gene locus_tag LOCUS_00120 17432 15618 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXQ3 protein_id gnl|my_center|LOCUS_00120 20310 17539 gene locus_tag LOCUS_00130 20310 17539 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU96 protein_id gnl|my_center|LOCUS_00130 21732 20482 gene locus_tag LOCUS_00140 21732 20482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 22903 22052 gene locus_tag LOCUS_00150 22903 22052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23268 24566 gene locus_tag LOCUS_00160 gene GALNS 23268 24566 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_00160 27154 24659 gene locus_tag LOCUS_00170 27154 24659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 30644 27297 gene locus_tag LOCUS_00180 30644 27297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 31834 30641 gene locus_tag LOCUS_00190 gene ispG 31834 30641 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWC8 protein_id gnl|my_center|LOCUS_00190 33174 32035 gene locus_tag LOCUS_00200 33174 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 34421 33213 gene locus_tag LOCUS_00210 34421 33213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 35823 34432 gene locus_tag LOCUS_00220 gene prnC 35823 34432 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118477.1 protein_id gnl|my_center|LOCUS_00220 36888 35956 gene locus_tag LOCUS_00230 36888 35956 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118476.1 protein_id gnl|my_center|LOCUS_00230 38216 36885 gene locus_tag LOCUS_00240 38216 36885 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_00240 38695 38297 gene locus_tag LOCUS_00250 38695 38297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 38903 40102 gene locus_tag LOCUS_00260 38903 40102 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_00260 40475 40155 gene locus_tag LOCUS_00270 40475 40155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 41497 40751 gene locus_tag LOCUS_00280 41497 40751 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_00280 42666 41701 gene locus_tag LOCUS_00290 42666 41701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 43643 44380 gene locus_tag LOCUS_00300 43643 44380 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_00300 44504 47902 gene locus_tag LOCUS_00310 44504 47902 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123849.1 protein_id gnl|my_center|LOCUS_00310 48157 49629 gene locus_tag LOCUS_00320 48157 49629 CDS product molybdopterin oxidoreductase membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_00320 49753 51249 gene locus_tag LOCUS_00330 49753 51249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123851.1 protein_id gnl|my_center|LOCUS_00330 51364 52602 gene locus_tag LOCUS_00340 51364 52602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123852.1 protein_id gnl|my_center|LOCUS_00340 52664 53221 gene locus_tag LOCUS_00350 52664 53221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 53335 54333 gene locus_tag LOCUS_00360 53335 54333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 54571 55683 gene locus_tag LOCUS_00370 gene coxB1 54571 55683 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0S5 protein_id gnl|my_center|LOCUS_00370 >Feature sequence002 2196 850 gene locus_tag LOCUS_00380 2196 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 2537 3691 gene locus_tag LOCUS_00390 2537 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 4735 3752 gene locus_tag LOCUS_00400 4735 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 6285 4861 gene locus_tag LOCUS_00410 6285 4861 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_00410 6458 6772 gene locus_tag LOCUS_00420 6458 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 7490 6876 gene locus_tag LOCUS_00430 7490 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 7773 9446 gene locus_tag LOCUS_00440 7773 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 9542 10066 gene locus_tag LOCUS_00450 9542 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 11530 10130 gene locus_tag LOCUS_00460 gene amtB 11530 10130 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYZ3 protein_id gnl|my_center|LOCUS_00460 11784 12677 gene locus_tag LOCUS_00470 gene truA 11784 12677 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU07 protein_id gnl|my_center|LOCUS_00470 15073 12836 gene locus_tag LOCUS_00480 15073 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 15367 16311 gene locus_tag LOCUS_00490 gene murB 15367 16311 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7A3 protein_id gnl|my_center|LOCUS_00490 16573 17820 gene locus_tag LOCUS_00500 16573 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 19769 17910 gene locus_tag LOCUS_00510 19769 17910 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_00510 21099 19804 gene locus_tag LOCUS_00520 gene hslU 21099 19804 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN2 protein_id gnl|my_center|LOCUS_00520 21254 22099 gene locus_tag LOCUS_00530 21254 22099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975431.1 protein_id gnl|my_center|LOCUS_00530 23219 22176 gene locus_tag LOCUS_00540 23219 22176 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120584.1 protein_id gnl|my_center|LOCUS_00540 23568 24665 gene locus_tag LOCUS_00550 23568 24665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 24717 25847 gene locus_tag LOCUS_00560 24717 25847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 26477 28861 gene locus_tag LOCUS_00570 26477 28861 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 protein_id gnl|my_center|LOCUS_00570 30768 28939 gene locus_tag LOCUS_00580 30768 28939 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122835.1 protein_id gnl|my_center|LOCUS_00580 30864 31232 gene locus_tag LOCUS_00590 30864 31232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 32631 31402 gene locus_tag LOCUS_00600 gene rsgA 32631 31402 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ6 protein_id gnl|my_center|LOCUS_00600 33234 32692 gene locus_tag LOCUS_00610 33234 32692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 33669 35339 gene locus_tag LOCUS_00620 33669 35339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 35427 37481 gene locus_tag LOCUS_00630 35427 37481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 37818 38474 gene locus_tag LOCUS_00640 37818 38474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 39863 38487 gene locus_tag LOCUS_00650 39863 38487 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_00650 40371 40000 gene locus_tag LOCUS_00660 40371 40000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_00660 43416 40528 gene locus_tag LOCUS_00670 43416 40528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118988.1 protein_id gnl|my_center|LOCUS_00670 44115 43498 gene locus_tag LOCUS_00680 44115 43498 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_00680 44248 44682 gene locus_tag LOCUS_00690 44248 44682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 46017 44884 gene locus_tag LOCUS_00700 46017 44884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 <46944 46158 gene locus_tag LOCUS_00710 <46944 46158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404096.1:succinate-semialdehyde dehydrogenase >Feature sequence003 379 1893 gene locus_tag LOCUS_00720 379 1893 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816080.1 protein_id gnl|my_center|LOCUS_00720 3126 2062 gene locus_tag LOCUS_00730 3126 2062 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_00730 3323 4177 gene locus_tag LOCUS_00740 3323 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 4377 5336 gene locus_tag LOCUS_00750 gene ribF 4377 5336 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFW8 protein_id gnl|my_center|LOCUS_00750 6321 5416 gene locus_tag LOCUS_00760 6321 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121591.1 protein_id gnl|my_center|LOCUS_00760 6478 7845 gene locus_tag LOCUS_00770 6478 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 8713 8039 gene locus_tag LOCUS_00780 8713 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 9048 8788 gene locus_tag LOCUS_00790 gene rpmA 9048 8788 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_00790 10032 9232 gene locus_tag LOCUS_00800 10032 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 10798 11313 gene locus_tag LOCUS_00810 gene infC 10798 11313 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ17 protein_id gnl|my_center|LOCUS_00810 11471 11701 gene locus_tag LOCUS_00820 gene rpmI 11471 11701 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817H6 protein_id gnl|my_center|LOCUS_00820 11848 12219 gene locus_tag LOCUS_00830 gene rplT 11848 12219 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP74 protein_id gnl|my_center|LOCUS_00830 13759 12314 gene locus_tag LOCUS_00840 13759 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 13910 16651 gene locus_tag LOCUS_00850 13910 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 17253 16816 gene locus_tag LOCUS_00860 17253 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 18404 17421 gene locus_tag LOCUS_00870 18404 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 19444 19518 gene locus_tag LOCUS_t00010 19444 19518 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19603 20064 gene locus_tag LOCUS_00880 19603 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 20112 20762 gene locus_tag LOCUS_00890 20112 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 23048 20793 gene locus_tag LOCUS_00900 23048 20793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 23381 24775 gene locus_tag LOCUS_00910 gene hemN 23381 24775 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_00910 24912 25634 gene locus_tag LOCUS_00920 24912 25634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 25631 26311 gene locus_tag LOCUS_00930 25631 26311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 26308 26874 gene locus_tag LOCUS_00940 26308 26874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 27075 28436 gene locus_tag LOCUS_00950 27075 28436 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_00950 29201 28488 gene locus_tag LOCUS_00960 29201 28488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 29248 30345 gene locus_tag LOCUS_00970 29248 30345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 30383 31462 gene locus_tag LOCUS_00980 30383 31462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123872.1 protein_id gnl|my_center|LOCUS_00980 32457 31573 gene locus_tag LOCUS_00990 32457 31573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_00990 33299 32601 gene locus_tag LOCUS_01000 33299 32601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 33396 34187 gene locus_tag LOCUS_01010 33396 34187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204774.1 protein_id gnl|my_center|LOCUS_01010 34228 34815 gene locus_tag LOCUS_01020 34228 34815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943559.1 protein_id gnl|my_center|LOCUS_01020 35021 35809 gene locus_tag LOCUS_01030 35021 35809 CDS product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_01030 36347 35829 gene locus_tag LOCUS_01040 36347 35829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 36769 36467 gene locus_tag LOCUS_01050 36769 36467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 36999 37514 gene locus_tag LOCUS_01060 36999 37514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117815.1 protein_id gnl|my_center|LOCUS_01060 37798 37586 gene locus_tag LOCUS_01070 37798 37586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 39567 37978 gene locus_tag LOCUS_01080 39567 37978 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_01080 39781 39578 gene locus_tag LOCUS_01090 39781 39578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 40799 39891 gene locus_tag LOCUS_01100 40799 39891 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence004 2063 1494 gene locus_tag LOCUS_01110 2063 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 3351 2572 gene locus_tag LOCUS_01120 3351 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 3494 5236 gene locus_tag LOCUS_01130 gene nadE 3494 5236 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_01130 5343 5735 gene locus_tag LOCUS_01140 5343 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 5881 6780 gene locus_tag LOCUS_01150 5881 6780 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772946.1 protein_id gnl|my_center|LOCUS_01150 6777 8552 gene locus_tag LOCUS_01160 6777 8552 CDS product quaternary ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957420.1 protein_id gnl|my_center|LOCUS_01160 11804 9624 gene locus_tag LOCUS_01170 11804 9624 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_01170 12607 11858 gene locus_tag LOCUS_01180 12607 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 12643 14724 gene locus_tag LOCUS_01190 12643 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_01190 14794 16098 gene locus_tag LOCUS_01200 14794 16098 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_01200 16218 18542 gene locus_tag LOCUS_01210 16218 18542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 18720 19202 gene locus_tag LOCUS_01220 gene greA 18720 19202 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA0 protein_id gnl|my_center|LOCUS_01220 19243 20211 gene locus_tag LOCUS_01230 19243 20211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 20780 20433 gene locus_tag LOCUS_01240 20780 20433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 21102 22376 gene locus_tag LOCUS_01250 gene pheA 21102 22376 CDS product P-protein (PheA) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122147.1 protein_id gnl|my_center|LOCUS_01250 22886 22392 gene locus_tag LOCUS_01260 22886 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_01260 23779 22919 gene locus_tag LOCUS_01270 gene parB 23779 22919 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 protein_id gnl|my_center|LOCUS_01270 24862 24149 gene locus_tag LOCUS_01280 24862 24149 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_01280 25288 26694 gene locus_tag LOCUS_01290 25288 26694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 26911 28146 gene locus_tag LOCUS_01300 26911 28146 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122959.1 protein_id gnl|my_center|LOCUS_01300 28395 28796 gene locus_tag LOCUS_01310 28395 28796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 28924 29538 gene locus_tag LOCUS_01320 28924 29538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 29672 30187 gene locus_tag LOCUS_01330 gene nuoA 29672 30187 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC3 protein_id gnl|my_center|LOCUS_01330 30189 30701 gene locus_tag LOCUS_01340 30189 30701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 30805 32079 gene locus_tag LOCUS_01350 gene nuoD 30805 32079 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_01350 32126 33010 gene locus_tag LOCUS_01360 32126 33010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 protein_id gnl|my_center|LOCUS_01360 33007 33810 gene locus_tag LOCUS_01370 33007 33810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 35229 33835 gene locus_tag LOCUS_01380 gene der 35229 33835 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URJ8 protein_id gnl|my_center|LOCUS_01380 36967 35399 gene locus_tag LOCUS_01390 36967 35399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 <38676 37112 gene locus_tag LOCUS_01400 <38676 37112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325469.1:ABC transporter permease >Feature sequence005 655 1200 gene locus_tag LOCUS_01410 655 1200 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_01410 1287 1859 gene locus_tag LOCUS_01420 1287 1859 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_01420 3342 1936 gene locus_tag LOCUS_01430 gene secY 3342 1936 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN01 protein_id gnl|my_center|LOCUS_01430 4080 3601 gene locus_tag LOCUS_01440 gene rplO 4080 3601 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN02 protein_id gnl|my_center|LOCUS_01440 4615 4127 gene locus_tag LOCUS_01450 gene rpsE 4615 4127 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_01450 5134 4739 gene locus_tag LOCUS_01460 gene rplR 5134 4739 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C1 protein_id gnl|my_center|LOCUS_01460 5802 5263 gene locus_tag LOCUS_01470 gene rplF 5802 5263 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y444 protein_id gnl|my_center|LOCUS_01470 6347 5955 gene locus_tag LOCUS_01480 gene rpsH 6347 5955 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN06 protein_id gnl|my_center|LOCUS_01480 6660 6475 gene locus_tag LOCUS_01490 gene rpsZ 6660 6475 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN07 protein_id gnl|my_center|LOCUS_01490 7432 6866 gene locus_tag LOCUS_01500 gene rplE 7432 6866 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN08 protein_id gnl|my_center|LOCUS_01500 7860 7507 gene locus_tag LOCUS_01510 gene rplX 7860 7507 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG9 protein_id gnl|my_center|LOCUS_01510 8293 7919 gene locus_tag LOCUS_01520 gene rplN 8293 7919 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN10 protein_id gnl|my_center|LOCUS_01520 8876 8466 gene locus_tag LOCUS_01530 8876 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 9190 8930 gene locus_tag LOCUS_01540 9190 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 9728 9309 gene locus_tag LOCUS_01550 gene rplP 9728 9309 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN13 protein_id gnl|my_center|LOCUS_01550 10365 9667 gene locus_tag LOCUS_01560 gene rpsC 10365 9667 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN14 protein_id gnl|my_center|LOCUS_01560 10786 10433 gene locus_tag LOCUS_01570 gene rplV 10786 10433 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN15 protein_id gnl|my_center|LOCUS_01570 11099 10845 gene locus_tag LOCUS_01580 gene rpsS 11099 10845 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRG4 protein_id gnl|my_center|LOCUS_01580 12032 11178 gene locus_tag LOCUS_01590 gene rplB 12032 11178 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN17 protein_id gnl|my_center|LOCUS_01590 12505 12188 gene locus_tag LOCUS_01600 gene rplW 12505 12188 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN18 protein_id gnl|my_center|LOCUS_01600 13382 12720 gene locus_tag LOCUS_01610 gene rplD 13382 12720 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN19 protein_id gnl|my_center|LOCUS_01610 14203 13472 gene locus_tag LOCUS_01620 gene rplC 14203 13472 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN20 protein_id gnl|my_center|LOCUS_01620 14700 14380 gene locus_tag LOCUS_01630 gene rpsJ 14700 14380 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN22 protein_id gnl|my_center|LOCUS_01630 17206 15035 gene locus_tag LOCUS_01640 17206 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 18741 17848 gene locus_tag LOCUS_01650 18741 17848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_01650 20884 18809 gene locus_tag LOCUS_01660 20884 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 21259 20993 gene locus_tag LOCUS_01670 21259 20993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 21477 22274 gene locus_tag LOCUS_01680 gene pfaS 21477 22274 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_01680 22398 23471 gene locus_tag LOCUS_01690 gene aroA 22398 23471 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121242.1 protein_id gnl|my_center|LOCUS_01690 23561 24307 gene locus_tag LOCUS_01700 gene tpiA 23561 24307 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_01700 24512 25054 gene locus_tag LOCUS_01710 24512 25054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 25169 26056 gene locus_tag LOCUS_01720 25169 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_01720 26122 26778 gene locus_tag LOCUS_01730 gene gmk 26122 26778 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP92 protein_id gnl|my_center|LOCUS_01730 26856 27125 gene locus_tag LOCUS_01740 gene rpoZ 26856 27125 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP93 protein_id gnl|my_center|LOCUS_01740 27155 27700 gene locus_tag LOCUS_01750 27155 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 28010 27717 gene locus_tag LOCUS_01760 28010 27717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 28642 28007 gene locus_tag LOCUS_01770 gene hisH 28642 28007 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULP3 protein_id gnl|my_center|LOCUS_01770 28927 31203 gene locus_tag LOCUS_01780 gene ftsH1 28927 31203 CDS product ATP-dependent zinc metalloprotease FtsH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ7 protein_id gnl|my_center|LOCUS_01780 32238 31285 gene locus_tag LOCUS_01790 32238 31285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 33569 32655 gene locus_tag LOCUS_01800 33569 32655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 34417 33590 gene locus_tag LOCUS_01810 34417 33590 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122966.1 protein_id gnl|my_center|LOCUS_01810 35013 34450 gene locus_tag LOCUS_01820 gene ymdB 35013 34450 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D5CE05 protein_id gnl|my_center|LOCUS_01820 35100 36218 gene locus_tag LOCUS_01830 35100 36218 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence006 940 1767 gene locus_tag LOCUS_01840 940 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 1975 2643 gene locus_tag LOCUS_01850 1975 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 2897 3820 gene locus_tag LOCUS_01860 2897 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 5816 3831 gene locus_tag LOCUS_01870 gene gyrB 5816 3831 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU72 protein_id gnl|my_center|LOCUS_01870 8317 5873 gene locus_tag LOCUS_01880 8317 5873 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H4 protein_id gnl|my_center|LOCUS_01880 8666 8881 gene locus_tag LOCUS_01890 8666 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 9009 9572 gene locus_tag LOCUS_01900 9009 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 9669 10412 gene locus_tag LOCUS_01910 9669 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 10545 11333 gene locus_tag LOCUS_01920 10545 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 12367 11471 gene locus_tag LOCUS_01930 12367 11471 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_01930 12764 12435 gene locus_tag LOCUS_01940 12764 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 13202 12768 gene locus_tag LOCUS_01950 13202 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120443.1 protein_id gnl|my_center|LOCUS_01950 13352 13279 gene locus_tag LOCUS_t00020 13352 13279 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14798 13479 gene locus_tag LOCUS_01960 14798 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 15008 15700 gene locus_tag LOCUS_01970 15008 15700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 15820 16572 gene locus_tag LOCUS_01980 15820 16572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 16687 17778 gene locus_tag LOCUS_01990 gene mraY 16687 17778 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728U5 protein_id gnl|my_center|LOCUS_01990 17844 18983 gene locus_tag LOCUS_02000 gene ftsW 17844 18983 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D5 protein_id gnl|my_center|LOCUS_02000 18980 20023 gene locus_tag LOCUS_02010 gene murG 18980 20023 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A258 protein_id gnl|my_center|LOCUS_02010 21071 20031 gene locus_tag LOCUS_02020 21071 20031 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_02020 22189 21215 gene locus_tag LOCUS_02030 22189 21215 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330332.1 protein_id gnl|my_center|LOCUS_02030 23498 22263 gene locus_tag LOCUS_02040 gene tyrS 23498 22263 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHS8 protein_id gnl|my_center|LOCUS_02040 23391 23636 gene locus_tag LOCUS_02050 23391 23636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 23819 24106 gene locus_tag LOCUS_02060 23819 24106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 24550 25161 gene locus_tag LOCUS_02070 gene cysC 24550 25161 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_02070 25822 26493 gene locus_tag LOCUS_02080 25822 26493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 28655 26640 gene locus_tag LOCUS_02090 28655 26640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 28980 29068 gene locus_tag LOCUS_t00030 28980 29068 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30370 29183 gene locus_tag LOCUS_02100 gene xylR 30370 29183 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_02100 30765 31853 gene locus_tag LOCUS_02110 30765 31853 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_02110 32626 31871 gene locus_tag LOCUS_02120 gene uppS 32626 31871 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF53 protein_id gnl|my_center|LOCUS_02120 32832 33794 gene locus_tag LOCUS_02130 32832 33794 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070921.1 protein_id gnl|my_center|LOCUS_02130 35192 33813 gene locus_tag LOCUS_02140 35192 33813 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119884.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence007 808 1992 gene locus_tag LOCUS_02150 808 1992 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_02150 2094 4376 gene locus_tag LOCUS_02160 2094 4376 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_02160 6942 4444 gene locus_tag LOCUS_02170 6942 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 7786 7133 gene locus_tag LOCUS_02180 7786 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 8443 7856 gene locus_tag LOCUS_02190 8443 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 9185 8508 gene locus_tag LOCUS_02200 9185 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 10423 9182 gene locus_tag LOCUS_02210 10423 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 11034 10423 gene locus_tag LOCUS_02220 11034 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 11304 12806 gene locus_tag LOCUS_02230 gene pds 11304 12806 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_02230 12855 14408 gene locus_tag LOCUS_02240 12855 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 14494 16212 gene locus_tag LOCUS_02250 14494 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 16712 18115 gene locus_tag LOCUS_02260 16712 18115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 19553 18186 gene locus_tag LOCUS_02270 gene mgtE 19553 18186 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN8 protein_id gnl|my_center|LOCUS_02270 19964 19683 gene locus_tag LOCUS_02280 gene rpsT 19964 19683 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M74 protein_id gnl|my_center|LOCUS_02280 21549 20182 gene locus_tag LOCUS_02290 21549 20182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 21797 22366 gene locus_tag LOCUS_02300 21797 22366 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118402.1 protein_id gnl|my_center|LOCUS_02300 23075 22479 gene locus_tag LOCUS_02310 gene fur 23075 22479 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121869.1 protein_id gnl|my_center|LOCUS_02310 23750 23274 gene locus_tag LOCUS_02320 23750 23274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 24666 25535 gene locus_tag LOCUS_02330 24666 25535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 25642 26865 gene locus_tag LOCUS_02340 gene gspE 25642 26865 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_02340 27039 28370 gene locus_tag LOCUS_02350 27039 28370 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119140.1 protein_id gnl|my_center|LOCUS_02350 28745 28425 gene locus_tag LOCUS_02360 28745 28425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 29891 28806 gene locus_tag LOCUS_02370 29891 28806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 30121 30618 gene locus_tag LOCUS_02380 gene fae 30121 30618 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122706.1 protein_id gnl|my_center|LOCUS_02380 30978 31490 gene locus_tag LOCUS_02390 30978 31490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120910.1 protein_id gnl|my_center|LOCUS_02390 32348 31581 gene locus_tag LOCUS_02400 gene cysH 32348 31581 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADG3 protein_id gnl|my_center|LOCUS_02400 32639 33070 gene locus_tag LOCUS_02410 gene arsC 32639 33070 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_02410 33109 34518 gene locus_tag LOCUS_02420 33109 34518 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence008 303 1145 gene locus_tag LOCUS_02430 303 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 1142 1933 gene locus_tag LOCUS_02440 1142 1933 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118565.1 protein_id gnl|my_center|LOCUS_02440 4852 1946 gene locus_tag LOCUS_02450 gene tolB 4852 1946 CDS product TolB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120765.1 protein_id gnl|my_center|LOCUS_02450 4998 5429 gene locus_tag LOCUS_02460 4998 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5687 6187 gene locus_tag LOCUS_02470 5687 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7099 6251 gene locus_tag LOCUS_02480 gene pyrK 7099 6251 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_02480 7827 7204 gene locus_tag LOCUS_02490 7827 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008653063.1 protein_id gnl|my_center|LOCUS_02490 9329 8190 gene locus_tag LOCUS_02500 9329 8190 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329274.1 protein_id gnl|my_center|LOCUS_02500 9955 10329 gene locus_tag LOCUS_02510 9955 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 10723 10899 gene locus_tag LOCUS_02520 10723 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 11037 11429 gene locus_tag LOCUS_02530 11037 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 12202 11558 gene locus_tag LOCUS_02540 12202 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 13050 12238 gene locus_tag LOCUS_02550 gene djlA 13050 12238 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB99 protein_id gnl|my_center|LOCUS_02550 13819 13163 gene locus_tag LOCUS_02560 13819 13163 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123637.1 protein_id gnl|my_center|LOCUS_02560 17742 13948 gene locus_tag LOCUS_02570 gene metH 17742 13948 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122502.1 protein_id gnl|my_center|LOCUS_02570 22912 18242 gene locus_tag LOCUS_02580 22912 18242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 23315 23995 gene locus_tag LOCUS_02590 gene rplY 23315 23995 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQU8 protein_id gnl|my_center|LOCUS_02590 24051 24632 gene locus_tag LOCUS_02600 gene pth 24051 24632 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV0 protein_id gnl|my_center|LOCUS_02600 24895 25242 gene locus_tag LOCUS_02610 24895 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 25539 26117 gene locus_tag LOCUS_02620 25539 26117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 26190 26705 gene locus_tag LOCUS_02630 gene rplI 26190 26705 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV4 protein_id gnl|my_center|LOCUS_02630 26851 28323 gene locus_tag LOCUS_02640 gene dnaB 26851 28323 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWY4 protein_id gnl|my_center|LOCUS_02640 30257 28401 gene locus_tag LOCUS_02650 30257 28401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 >Feature sequence009 3 740 gene locus_tag LOCUS_02660 3 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2231 1173 gene locus_tag LOCUS_02670 gene pknB 2231 1173 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 protein_id gnl|my_center|LOCUS_02670 2822 4921 gene locus_tag LOCUS_02680 2822 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5770 5036 gene locus_tag LOCUS_02690 5770 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 6687 5767 gene locus_tag LOCUS_02700 6687 5767 CDS product formylmethanofuran--tetrahydromethanopterin formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869816.1 protein_id gnl|my_center|LOCUS_02700 7003 7809 gene locus_tag LOCUS_02710 gene hutG 7003 7809 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064863.1 protein_id gnl|my_center|LOCUS_02710 10858 8141 gene locus_tag LOCUS_02720 10858 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11452 11000 gene locus_tag LOCUS_02730 11452 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 12614 11619 gene locus_tag LOCUS_02740 gene prs 12614 11619 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4D0 protein_id gnl|my_center|LOCUS_02740 13115 12645 gene locus_tag LOCUS_02750 13115 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 13429 13205 gene locus_tag LOCUS_02760 13429 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 14811 13474 gene locus_tag LOCUS_02770 14811 13474 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120510.1 protein_id gnl|my_center|LOCUS_02770 15146 16231 gene locus_tag LOCUS_02780 15146 16231 CDS product 3-phosphoserine/phosphohydroxythreonine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_02780 17178 17495 gene locus_tag LOCUS_02790 17178 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 18370 17690 gene locus_tag LOCUS_02800 18370 17690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 19115 18441 gene locus_tag LOCUS_02810 19115 18441 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333247.1 protein_id gnl|my_center|LOCUS_02810 19824 19225 gene locus_tag LOCUS_02820 19824 19225 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841351.1 protein_id gnl|my_center|LOCUS_02820 21957 19963 gene locus_tag LOCUS_02830 21957 19963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_02830 22566 22060 gene locus_tag LOCUS_02840 22566 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 22986 22594 gene locus_tag LOCUS_02850 22986 22594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_02850 24296 23034 gene locus_tag LOCUS_02860 24296 23034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_02860 24747 24367 gene locus_tag LOCUS_02870 24747 24367 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_02870 26449 24794 gene locus_tag LOCUS_02880 26449 24794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_02880 27119 26787 gene locus_tag LOCUS_02890 27119 26787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 27575 27129 gene locus_tag LOCUS_02900 27575 27129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 27973 27647 gene locus_tag LOCUS_02910 27973 27647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 29878 28034 gene locus_tag LOCUS_02920 29878 28034 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122444.1 protein_id gnl|my_center|LOCUS_02920 30566 29904 gene locus_tag LOCUS_02930 30566 29904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence010 759 3920 gene locus_tag LOCUS_02940 759 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4972 4001 gene locus_tag LOCUS_02950 4972 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02950 5075 7243 gene locus_tag LOCUS_02960 gene uvrB 5075 7243 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR2 protein_id gnl|my_center|LOCUS_02960 7686 8015 gene locus_tag LOCUS_02970 7686 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 8316 8966 gene locus_tag LOCUS_02980 8316 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 9066 9404 gene locus_tag LOCUS_02990 9066 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 9845 13489 gene locus_tag LOCUS_03000 gene gspD 9845 13489 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118422.1 protein_id gnl|my_center|LOCUS_03000 13561 14349 gene locus_tag LOCUS_03010 13561 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 14387 15115 gene locus_tag LOCUS_03020 14387 15115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 15295 18807 gene locus_tag LOCUS_03030 15295 18807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 18804 24692 gene locus_tag LOCUS_03040 18804 24692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 25026 24745 gene locus_tag LOCUS_03050 gene yidD 25026 24745 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NF22 protein_id gnl|my_center|LOCUS_03050 25321 25019 gene locus_tag LOCUS_03060 25321 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 25808 25431 gene locus_tag LOCUS_03070 gene rnpA 25808 25431 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181T2 protein_id gnl|my_center|LOCUS_03070 26018 26794 gene locus_tag LOCUS_03080 26018 26794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 26880 27311 gene locus_tag LOCUS_03090 gene nusB 26880 27311 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USA9 protein_id gnl|my_center|LOCUS_03090 27429 28373 gene locus_tag LOCUS_03100 27429 28373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 28577 29329 gene locus_tag LOCUS_03110 28577 29329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 29397 29789 gene locus_tag LOCUS_03120 gene nasE 29397 29789 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_03120 30665 29883 gene locus_tag LOCUS_03130 30665 29883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence011 <1 1176 gene locus_tag LOCUS_03140 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035732.1:hybrid sensor histidine kinase/response regulator 1285 3444 gene locus_tag LOCUS_03150 1285 3444 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119257.1 protein_id gnl|my_center|LOCUS_03150 4560 3520 gene locus_tag LOCUS_03160 4560 3520 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_03160 6412 4673 gene locus_tag LOCUS_03170 6412 4673 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124008.1 protein_id gnl|my_center|LOCUS_03170 7074 6412 gene locus_tag LOCUS_03180 7074 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 8127 7126 gene locus_tag LOCUS_03190 8127 7126 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124010.1 protein_id gnl|my_center|LOCUS_03190 10574 8124 gene locus_tag LOCUS_03200 10574 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 11811 10591 gene locus_tag LOCUS_03210 11811 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 12451 12059 gene locus_tag LOCUS_03220 12451 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 14953 12755 gene locus_tag LOCUS_03230 14953 12755 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123683.1 protein_id gnl|my_center|LOCUS_03230 17442 15238 gene locus_tag LOCUS_03240 17442 15238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 19365 17671 gene locus_tag LOCUS_03250 gene kaiC 19365 17671 CDS product circadian clock protein kinase KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAN5 protein_id gnl|my_center|LOCUS_03250 20062 19487 gene locus_tag LOCUS_03260 20062 19487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 20568 23987 gene locus_tag LOCUS_03270 20568 23987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 24249 30437 gene locus_tag LOCUS_03280 24249 30437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence012 274 1338 gene locus_tag LOCUS_03290 274 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1418 2623 gene locus_tag LOCUS_03300 1418 2623 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_03300 3585 2683 gene locus_tag LOCUS_03310 gene suhB 3585 2683 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120572.1 protein_id gnl|my_center|LOCUS_03310 3789 7784 gene locus_tag LOCUS_03320 3789 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 8672 7977 gene locus_tag LOCUS_03330 8672 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 9333 8860 gene locus_tag LOCUS_03340 9333 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 9731 10990 gene locus_tag LOCUS_03350 9731 10990 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119285.1 protein_id gnl|my_center|LOCUS_03350 13029 11116 gene locus_tag LOCUS_03360 13029 11116 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122938.1 protein_id gnl|my_center|LOCUS_03360 13437 14708 gene locus_tag LOCUS_03370 13437 14708 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325333.1 protein_id gnl|my_center|LOCUS_03370 14859 15815 gene locus_tag LOCUS_03380 14859 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 18122 15891 gene locus_tag LOCUS_03390 18122 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 19391 18435 gene locus_tag LOCUS_03400 gene iunH 19391 18435 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324951.1 protein_id gnl|my_center|LOCUS_03400 20053 20355 gene locus_tag LOCUS_03410 20053 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 20455 21450 gene locus_tag LOCUS_03420 20455 21450 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_03420 27243 21478 gene locus_tag LOCUS_03430 27243 21478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 28429 27428 gene locus_tag LOCUS_03440 28429 27428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 29746 28622 gene locus_tag LOCUS_03450 29746 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence013 2284 362 gene locus_tag LOCUS_03460 2284 362 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259038.1 protein_id gnl|my_center|LOCUS_03460 3210 2281 gene locus_tag LOCUS_03470 3210 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 4270 3251 gene locus_tag LOCUS_03480 4270 3251 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_03480 7490 4371 gene locus_tag LOCUS_03490 7490 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123724.1 protein_id gnl|my_center|LOCUS_03490 9055 7487 gene locus_tag LOCUS_03500 9055 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 10548 9277 gene locus_tag LOCUS_03510 10548 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 11639 10545 gene locus_tag LOCUS_03520 11639 10545 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_03520 11863 13179 gene locus_tag LOCUS_03530 11863 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 14573 13221 gene locus_tag LOCUS_03540 14573 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_03540 17179 14636 gene locus_tag LOCUS_03550 17179 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 17413 17826 gene locus_tag LOCUS_03560 17413 17826 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF9 protein_id gnl|my_center|LOCUS_03560 18741 17920 gene locus_tag LOCUS_03570 18741 17920 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119944.1 protein_id gnl|my_center|LOCUS_03570 19907 18738 gene locus_tag LOCUS_03580 19907 18738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119943.1 protein_id gnl|my_center|LOCUS_03580 21100 20690 gene locus_tag LOCUS_03590 21100 20690 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_03590 21205 22788 gene locus_tag LOCUS_03600 gene trkH 21205 22788 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121515.1 protein_id gnl|my_center|LOCUS_03600 22902 23372 gene locus_tag LOCUS_03610 gene ribH 22902 23372 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXZ8 protein_id gnl|my_center|LOCUS_03610 23473 25062 gene locus_tag LOCUS_03620 gene gltX 23473 25062 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNF9 protein_id gnl|my_center|LOCUS_03620 25114 27447 gene locus_tag LOCUS_03630 gene priA 25114 27447 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFQ0 protein_id gnl|my_center|LOCUS_03630 27581 27654 gene locus_tag LOCUS_t00040 27581 27654 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 29136 27796 gene locus_tag LOCUS_03640 29136 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence014 1652 585 gene locus_tag LOCUS_03650 gene truD 1652 585 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSX8 protein_id gnl|my_center|LOCUS_03650 2980 1649 gene locus_tag LOCUS_03660 2980 1649 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118668.1 protein_id gnl|my_center|LOCUS_03660 3268 3900 gene locus_tag LOCUS_03670 3268 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_03670 6136 3920 gene locus_tag LOCUS_03680 gene recQ 6136 3920 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120701.1 protein_id gnl|my_center|LOCUS_03680 6238 7020 gene locus_tag LOCUS_03690 6238 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327171.1 protein_id gnl|my_center|LOCUS_03690 8300 7104 gene locus_tag LOCUS_03700 gene acrA1 8300 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122386.1 protein_id gnl|my_center|LOCUS_03700 8744 9820 gene locus_tag LOCUS_03710 8744 9820 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330020.1 protein_id gnl|my_center|LOCUS_03710 10213 9836 gene locus_tag LOCUS_03720 10213 9836 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656289.1 protein_id gnl|my_center|LOCUS_03720 12448 10283 gene locus_tag LOCUS_03730 12448 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 13026 12502 gene locus_tag LOCUS_03740 13026 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 13187 13816 gene locus_tag LOCUS_03750 13187 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 14009 15109 gene locus_tag LOCUS_03760 14009 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 15217 16635 gene locus_tag LOCUS_03770 15217 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 16812 17288 gene locus_tag LOCUS_03780 16812 17288 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942915.1 protein_id gnl|my_center|LOCUS_03780 17309 18367 gene locus_tag LOCUS_03790 17309 18367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_03790 19050 18343 gene locus_tag LOCUS_03800 19050 18343 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_03800 20305 19337 gene locus_tag LOCUS_03810 20305 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 20528 21553 gene locus_tag LOCUS_03820 gene prmC 20528 21553 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_03820 21637 22182 gene locus_tag LOCUS_03830 21637 22182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 22415 23428 gene locus_tag LOCUS_03840 22415 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 24061 23465 gene locus_tag LOCUS_03850 24061 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 24267 24695 gene locus_tag LOCUS_03860 gene queF 24267 24695 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG9 protein_id gnl|my_center|LOCUS_03860 26412 24715 gene locus_tag LOCUS_03870 26412 24715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118595.1 protein_id gnl|my_center|LOCUS_03870 26622 26455 gene locus_tag LOCUS_03880 26622 26455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 27983 26628 gene locus_tag LOCUS_03890 gene glyA 27983 26628 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN2 protein_id gnl|my_center|LOCUS_03890 >Feature sequence015 <1 1456 gene locus_tag LOCUS_03900 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123909.1:DNA polymerase I 1538 3427 gene locus_tag LOCUS_03910 1538 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4570 3458 gene locus_tag LOCUS_03920 4570 3458 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_03920 4712 5968 gene locus_tag LOCUS_03930 gene ykbA 4712 5968 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122348.1 protein_id gnl|my_center|LOCUS_03930 8315 5946 gene locus_tag LOCUS_03940 8315 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 9150 8410 gene locus_tag LOCUS_03950 9150 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 11701 9230 gene locus_tag LOCUS_03960 11701 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 12369 11800 gene locus_tag LOCUS_03970 12369 11800 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_03970 13293 12394 gene locus_tag LOCUS_03980 13293 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 14645 13323 gene locus_tag LOCUS_03990 14645 13323 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_03990 15929 14790 gene locus_tag LOCUS_04000 15929 14790 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_04000 15985 16896 gene locus_tag LOCUS_04010 15985 16896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 18075 16963 gene locus_tag LOCUS_04020 gene aspC 18075 16963 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG06 protein_id gnl|my_center|LOCUS_04020 18380 19924 gene locus_tag LOCUS_04030 18380 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 20165 24661 gene locus_tag LOCUS_04040 20165 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 24661 25263 gene locus_tag LOCUS_04050 24661 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 28000 25232 gene locus_tag LOCUS_04060 gene murE 28000 25232 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUP9 protein_id gnl|my_center|LOCUS_04060 >Feature sequence016 <1 1892 gene locus_tag LOCUS_04070 <1 1892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120560.1:glutamate synthase 1932 2798 gene locus_tag LOCUS_04080 1932 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 2964 4442 gene locus_tag LOCUS_04090 gene gltD 2964 4442 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_04090 4899 5081 gene locus_tag LOCUS_04100 4899 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 5525 6079 gene locus_tag LOCUS_04110 gene cpaA 5525 6079 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_04110 6296 7582 gene locus_tag LOCUS_04120 6296 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 7795 9810 gene locus_tag LOCUS_04130 gene cpaC 7795 9810 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120311.1 protein_id gnl|my_center|LOCUS_04130 9885 11099 gene locus_tag LOCUS_04140 gene cpaE 9885 11099 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_04140 13234 11186 gene locus_tag LOCUS_04150 13234 11186 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120518.1 protein_id gnl|my_center|LOCUS_04150 14355 13222 gene locus_tag LOCUS_04160 gene dxr 14355 13222 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_04160 14602 16713 gene locus_tag LOCUS_04170 14602 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 20958 16840 gene locus_tag LOCUS_04180 20958 16840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 23656 21554 gene locus_tag LOCUS_04190 gene metG 23656 21554 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URP3 protein_id gnl|my_center|LOCUS_04190 23826 24755 gene locus_tag LOCUS_04200 23826 24755 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_04200 24850 25749 gene locus_tag LOCUS_04210 gene dapA 24850 25749 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVB1 protein_id gnl|my_center|LOCUS_04210 26235 25825 gene locus_tag LOCUS_04220 26235 25825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 26687 26220 gene locus_tag LOCUS_04230 26687 26220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence017 3073 2141 gene locus_tag LOCUS_04240 3073 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4161 3460 gene locus_tag LOCUS_04250 4161 3460 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_04250 5295 4324 gene locus_tag LOCUS_04260 gene gnl 5295 4324 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 protein_id gnl|my_center|LOCUS_04260 6620 5610 gene locus_tag LOCUS_04270 6620 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 6761 7789 gene locus_tag LOCUS_04280 6761 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 8628 7840 gene locus_tag LOCUS_04290 8628 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 8934 8695 gene locus_tag LOCUS_04300 8934 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 9969 9019 gene locus_tag LOCUS_04310 gene dapA 9969 9019 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_04310 10399 11373 gene locus_tag LOCUS_04320 gene psd 10399 11373 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTK9 protein_id gnl|my_center|LOCUS_04320 11456 12373 gene locus_tag LOCUS_04330 gene pss 11456 12373 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119571.1 protein_id gnl|my_center|LOCUS_04330 12382 13074 gene locus_tag LOCUS_04340 gene ribE 12382 13074 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_870472.2 protein_id gnl|my_center|LOCUS_04340 14198 13338 gene locus_tag LOCUS_04350 14198 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 14431 15363 gene locus_tag LOCUS_04360 gene rsmA 14431 15363 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR4 protein_id gnl|my_center|LOCUS_04360 15559 17046 gene locus_tag LOCUS_04370 gene guaB 15559 17046 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJL3 protein_id gnl|my_center|LOCUS_04370 17099 18232 gene locus_tag LOCUS_04380 17099 18232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 18825 18370 gene locus_tag LOCUS_04390 18825 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 19552 18857 gene locus_tag LOCUS_04400 gene motB 19552 18857 CDS product MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_04400 19799 21457 gene locus_tag LOCUS_04410 gene polB 19799 21457 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118392.1 protein_id gnl|my_center|LOCUS_04410 21527 21853 gene locus_tag LOCUS_04420 21527 21853 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_04420 22476 23402 gene locus_tag LOCUS_04430 22476 23402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 24023 25333 gene locus_tag LOCUS_04440 gene aroB 24023 25333 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120777.1 protein_id gnl|my_center|LOCUS_04440 25529 26443 gene locus_tag LOCUS_04450 25529 26443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 26508 27815 gene locus_tag LOCUS_04460 26508 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence018 3657 157 gene locus_tag LOCUS_04470 3657 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3731 4354 gene locus_tag LOCUS_04480 3731 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5725 4433 gene locus_tag LOCUS_04490 5725 4433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968429.1 protein_id gnl|my_center|LOCUS_04490 5857 6324 gene locus_tag LOCUS_04500 5857 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227509.1 protein_id gnl|my_center|LOCUS_04500 8317 6830 gene locus_tag LOCUS_04510 8317 6830 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 protein_id gnl|my_center|LOCUS_04510 8465 8965 gene locus_tag LOCUS_04520 8465 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 9047 10366 gene locus_tag LOCUS_04530 9047 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227755.1 protein_id gnl|my_center|LOCUS_04530 10351 12030 gene locus_tag LOCUS_04540 10351 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 12050 13228 gene locus_tag LOCUS_04550 12050 13228 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_04550 13299 15728 gene locus_tag LOCUS_04560 13299 15728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_04560 15969 15766 gene locus_tag LOCUS_04570 15969 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 15905 16384 gene locus_tag LOCUS_04580 15905 16384 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109808.1 protein_id gnl|my_center|LOCUS_04580 18006 19163 gene locus_tag LOCUS_04590 18006 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 20274 19186 gene locus_tag LOCUS_04600 20274 19186 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_04600 21157 20315 gene locus_tag LOCUS_04610 gene lpxA 21157 20315 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ1 protein_id gnl|my_center|LOCUS_04610 22302 21352 gene locus_tag LOCUS_04620 gene envA 22302 21352 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L4 protein_id gnl|my_center|LOCUS_04620 23176 22526 gene locus_tag LOCUS_04630 23176 22526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 24896 23523 gene locus_tag LOCUS_04640 24896 23523 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_04640 26439 25030 gene locus_tag LOCUS_04650 26439 25030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence019 2478 4586 gene locus_tag LOCUS_04660 gene fliC 2478 4586 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTQ5 protein_id gnl|my_center|LOCUS_04660 4684 5922 gene locus_tag LOCUS_04670 4684 5922 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_04670 6501 5941 gene locus_tag LOCUS_04680 6501 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 6631 7596 gene locus_tag LOCUS_04690 6631 7596 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877489.1 protein_id gnl|my_center|LOCUS_04690 9182 7617 gene locus_tag LOCUS_04700 gene zwf 9182 7617 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_04700 10007 9264 gene locus_tag LOCUS_04710 gene hisA 10007 9264 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG70 protein_id gnl|my_center|LOCUS_04710 11362 10052 gene locus_tag LOCUS_04720 11362 10052 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123294.1 protein_id gnl|my_center|LOCUS_04720 11495 12733 gene locus_tag LOCUS_04730 11495 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 13491 12766 gene locus_tag LOCUS_04740 13491 12766 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_04740 14162 13488 gene locus_tag LOCUS_04750 14162 13488 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGM3 protein_id gnl|my_center|LOCUS_04750 15348 14155 gene locus_tag LOCUS_04760 15348 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 15451 16110 gene locus_tag LOCUS_04770 15451 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 16376 17617 gene locus_tag LOCUS_04780 16376 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 17602 20106 gene locus_tag LOCUS_04790 17602 20106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 20226 21782 gene locus_tag LOCUS_04800 20226 21782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 21779 22279 gene locus_tag LOCUS_04810 21779 22279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 23077 22283 gene locus_tag LOCUS_04820 23077 22283 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121773.1 protein_id gnl|my_center|LOCUS_04820 24391 23144 gene locus_tag LOCUS_04830 gene rnd 24391 23144 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120569.1 protein_id gnl|my_center|LOCUS_04830 25599 24547 gene locus_tag LOCUS_04840 25599 24547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence020 3042 2533 gene locus_tag LOCUS_04850 3042 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3145 3405 gene locus_tag LOCUS_04860 3145 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4747 3464 gene locus_tag LOCUS_04870 4747 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6182 4842 gene locus_tag LOCUS_04880 6182 4842 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727955.1 protein_id gnl|my_center|LOCUS_04880 6872 6219 gene locus_tag LOCUS_04890 6872 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 8304 6970 gene locus_tag LOCUS_04900 gene ahcY 8304 6970 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ5 protein_id gnl|my_center|LOCUS_04900 8633 9100 gene locus_tag LOCUS_04910 8633 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 9231 9614 gene locus_tag LOCUS_04920 9231 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 9736 10230 gene locus_tag LOCUS_04930 9736 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 11596 10283 gene locus_tag LOCUS_04940 11596 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 11695 12192 gene locus_tag LOCUS_04950 11695 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 12197 12679 gene locus_tag LOCUS_04960 12197 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 12823 13713 gene locus_tag LOCUS_04970 gene metF 12823 13713 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNJ7 protein_id gnl|my_center|LOCUS_04970 13730 14410 gene locus_tag LOCUS_04980 13730 14410 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262633.1 protein_id gnl|my_center|LOCUS_04980 16876 14438 gene locus_tag LOCUS_04990 16876 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 17556 16960 gene locus_tag LOCUS_05000 17556 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 18126 18590 gene locus_tag LOCUS_05010 18126 18590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 18677 19693 gene locus_tag LOCUS_05020 18677 19693 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259367.1 protein_id gnl|my_center|LOCUS_05020 19861 20730 gene locus_tag LOCUS_05030 19861 20730 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_05030 20837 22267 gene locus_tag LOCUS_05040 20837 22267 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118315.1 protein_id gnl|my_center|LOCUS_05040 22394 23119 gene locus_tag LOCUS_05050 22394 23119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 23539 23925 gene locus_tag LOCUS_05060 23539 23925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 24212 23973 gene locus_tag LOCUS_05070 24212 23973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 24694 24299 gene locus_tag LOCUS_05080 24694 24299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence021 84 683 gene locus_tag LOCUS_05090 84 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 801 1499 gene locus_tag LOCUS_05100 801 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1657 2601 gene locus_tag LOCUS_05110 gene pyrB 1657 2601 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNR3 protein_id gnl|my_center|LOCUS_05110 4539 2731 gene locus_tag LOCUS_05120 4539 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 6107 4629 gene locus_tag LOCUS_05130 6107 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 7496 6219 gene locus_tag LOCUS_05140 gene pyrC 7496 6219 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_05140 8369 7635 gene locus_tag LOCUS_05150 8369 7635 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122635.1 protein_id gnl|my_center|LOCUS_05150 8263 8478 gene locus_tag LOCUS_05160 8263 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 10173 8764 gene locus_tag LOCUS_05170 10173 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 11181 10429 gene locus_tag LOCUS_05180 gene pyrH 11181 10429 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH1 protein_id gnl|my_center|LOCUS_05180 11492 11725 gene locus_tag LOCUS_05190 11492 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 12127 12729 gene locus_tag LOCUS_05200 12127 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 15014 12807 gene locus_tag LOCUS_05210 15014 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 16478 15297 gene locus_tag LOCUS_05220 16478 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 16772 20185 gene locus_tag LOCUS_05230 gene carB 16772 20185 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ58 protein_id gnl|my_center|LOCUS_05230 18787 18878 gene locus_tag LOCUS_t00050 18787 18878 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21375 20299 gene locus_tag LOCUS_05240 gene flhB 21375 20299 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_05240 22272 21454 gene locus_tag LOCUS_05250 22272 21454 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKD3 protein_id gnl|my_center|LOCUS_05250 22663 22388 gene locus_tag LOCUS_05260 gene fliQ 22663 22388 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_05260 23599 22784 gene locus_tag LOCUS_05270 23599 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 24772 23684 gene locus_tag LOCUS_05280 24772 23684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence022 1502 2617 gene locus_tag LOCUS_05290 1502 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4165 2651 gene locus_tag LOCUS_05300 4165 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 6612 4162 gene locus_tag LOCUS_05310 6612 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 7534 6704 gene locus_tag LOCUS_05320 7534 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 10547 7728 gene locus_tag LOCUS_05330 10547 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 12393 10741 gene locus_tag LOCUS_05340 12393 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 13121 12561 gene locus_tag LOCUS_05350 13121 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120318.1 protein_id gnl|my_center|LOCUS_05350 13306 14166 gene locus_tag LOCUS_05360 gene hpaG 13306 14166 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_05360 14259 16892 gene locus_tag LOCUS_05370 14259 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 18244 16958 gene locus_tag LOCUS_05380 gene papS 18244 16958 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_05380 19038 18256 gene locus_tag LOCUS_05390 gene dapB 19038 18256 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJD7 protein_id gnl|my_center|LOCUS_05390 19163 20437 gene locus_tag LOCUS_05400 19163 20437 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_05400 20537 21283 gene locus_tag LOCUS_05410 20537 21283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 21323 21952 gene locus_tag LOCUS_05420 gene dfp 21323 21952 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_05420 21980 23089 gene locus_tag LOCUS_05430 gene aroB 21980 23089 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWN8 protein_id gnl|my_center|LOCUS_05430 23199 23126 gene locus_tag LOCUS_t00060 23199 23126 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24473 23304 gene locus_tag LOCUS_05440 24473 23304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence023 1682 2593 gene locus_tag LOCUS_05450 1682 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3740 2880 gene locus_tag LOCUS_05460 3740 2880 CDS product ATP-utilizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120585.1 protein_id gnl|my_center|LOCUS_05460 4233 3823 gene locus_tag LOCUS_05470 4233 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5392 4850 gene locus_tag LOCUS_05480 5392 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5888 7360 gene locus_tag LOCUS_05490 5888 7360 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGU7 protein_id gnl|my_center|LOCUS_05490 7863 7525 gene locus_tag LOCUS_05500 7863 7525 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326562.1 protein_id gnl|my_center|LOCUS_05500 8038 9117 gene locus_tag LOCUS_05510 gene manC 8038 9117 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_05510 9292 9762 gene locus_tag LOCUS_05520 9292 9762 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG74 protein_id gnl|my_center|LOCUS_05520 12505 9884 gene locus_tag LOCUS_05530 gene alaS 12505 9884 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFH9 protein_id gnl|my_center|LOCUS_05530 14246 12801 gene locus_tag LOCUS_05540 gene atoC 14246 12801 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_05540 17108 15177 gene locus_tag LOCUS_05550 17108 15177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 19427 17274 gene locus_tag LOCUS_05560 19427 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 21048 19738 gene locus_tag LOCUS_05570 21048 19738 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_05570 22771 21527 gene locus_tag LOCUS_05580 gene hemH 22771 21527 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFZ7 protein_id gnl|my_center|LOCUS_05580 24412 23396 gene locus_tag LOCUS_05590 24412 23396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence024 2801 4096 gene locus_tag LOCUS_05600 2801 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122571.1 protein_id gnl|my_center|LOCUS_05600 4096 6579 gene locus_tag LOCUS_05610 4096 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122570.1 protein_id gnl|my_center|LOCUS_05610 6841 7470 gene locus_tag LOCUS_05620 gene sigY 6841 7470 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_05620 8699 7530 gene locus_tag LOCUS_05630 8699 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 8911 8702 gene locus_tag LOCUS_05640 8911 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 13694 8985 gene locus_tag LOCUS_05650 13694 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 13579 13842 gene locus_tag LOCUS_05660 13579 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 18058 13889 gene locus_tag LOCUS_05670 18058 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 21618 18055 gene locus_tag LOCUS_05680 21618 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 24257 21798 gene locus_tag LOCUS_05690 24257 21798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence025 1012 3720 gene locus_tag LOCUS_05700 gene clpB 1012 3720 CDS product protease associated ATPase ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 protein_id gnl|my_center|LOCUS_05700 3881 9412 gene locus_tag LOCUS_05710 3881 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 9491 11272 gene locus_tag LOCUS_05720 9491 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 11265 16382 gene locus_tag LOCUS_05730 11265 16382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 16706 17197 gene locus_tag LOCUS_05740 16706 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190698.1 protein_id gnl|my_center|LOCUS_05740 17470 19380 gene locus_tag LOCUS_05750 17470 19380 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122432.1 protein_id gnl|my_center|LOCUS_05750 19619 20656 gene locus_tag LOCUS_05760 19619 20656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 20947 22032 gene locus_tag LOCUS_05770 20947 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 22097 22633 gene locus_tag LOCUS_05780 gene purE 22097 22633 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A1Y6 protein_id gnl|my_center|LOCUS_05780 22630 23808 gene locus_tag LOCUS_05790 gene purK 22630 23808 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQS2 protein_id gnl|my_center|LOCUS_05790 >Feature sequence026 1 1869 gene locus_tag LOCUS_05800 1 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2179 3162 gene locus_tag LOCUS_05810 2179 3162 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_05810 3201 4823 gene locus_tag LOCUS_05820 gene nadB 3201 4823 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTK8 protein_id gnl|my_center|LOCUS_05820 5047 4751 gene locus_tag LOCUS_05830 5047 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6207 5131 gene locus_tag LOCUS_05840 6207 5131 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122268.1 protein_id gnl|my_center|LOCUS_05840 8339 6486 gene locus_tag LOCUS_05850 8339 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 8514 9368 gene locus_tag LOCUS_05860 8514 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 12235 9599 gene locus_tag LOCUS_05870 12235 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 12352 13404 gene locus_tag LOCUS_05880 gene argC 12352 13404 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVL4 protein_id gnl|my_center|LOCUS_05880 13501 14871 gene locus_tag LOCUS_05890 13501 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 15861 14992 gene locus_tag LOCUS_05900 15861 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 16766 16155 gene locus_tag LOCUS_05910 16766 16155 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J086 protein_id gnl|my_center|LOCUS_05910 18293 16914 gene locus_tag LOCUS_05920 18293 16914 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_05920 18888 19364 gene locus_tag LOCUS_05930 gene ypeA 18888 19364 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_05930 19567 19842 gene locus_tag LOCUS_05940 19567 19842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 20844 19903 gene locus_tag LOCUS_05950 20844 19903 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119904.1 protein_id gnl|my_center|LOCUS_05950 20978 21211 gene locus_tag LOCUS_05960 20978 21211 CDS product UPF0434 protein bsr0601 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WS6 protein_id gnl|my_center|LOCUS_05960 21422 23425 gene locus_tag LOCUS_05970 21422 23425 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_05970 24083 23556 gene locus_tag LOCUS_05980 24083 23556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence027 <1 594 gene locus_tag LOCUS_05990 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121452.1:acyltransferase 774 2171 gene locus_tag LOCUS_06000 774 2171 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122056.1 protein_id gnl|my_center|LOCUS_06000 2740 2258 gene locus_tag LOCUS_06010 2740 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3378 3004 gene locus_tag LOCUS_06020 gene groS 3378 3004 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU13 protein_id gnl|my_center|LOCUS_06020 4882 3611 gene locus_tag LOCUS_06030 4882 3611 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_06030 5110 6798 gene locus_tag LOCUS_06040 5110 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6905 8773 gene locus_tag LOCUS_06050 6905 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 9169 8933 gene locus_tag LOCUS_06060 9169 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 9610 12030 gene locus_tag LOCUS_06070 9610 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 12090 12539 gene locus_tag LOCUS_06080 12090 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 13000 12599 gene locus_tag LOCUS_06090 13000 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 14462 13317 gene locus_tag LOCUS_06100 14462 13317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 17434 14741 gene locus_tag LOCUS_06110 17434 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 18236 17766 gene locus_tag LOCUS_06120 18236 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 18549 18388 gene locus_tag LOCUS_06130 18549 18388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 18754 19674 gene locus_tag LOCUS_06140 18754 19674 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_06140 20090 19755 gene locus_tag LOCUS_06150 20090 19755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 21118 20090 gene locus_tag LOCUS_06160 21118 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_06160 23642 21240 gene locus_tag LOCUS_06170 23642 21240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence028 <1 1615 gene locus_tag LOCUS_06180 <1 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URX8:phosphoribosylformylglycinamidine synthase subunit PurL 1757 3073 gene locus_tag LOCUS_06190 1757 3073 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_06190 3146 4462 gene locus_tag LOCUS_06200 3146 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4616 5083 gene locus_tag LOCUS_06210 4616 5083 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087296.1 protein_id gnl|my_center|LOCUS_06210 5128 5583 gene locus_tag LOCUS_06220 5128 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 5580 6002 gene locus_tag LOCUS_06230 5580 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 5999 6802 gene locus_tag LOCUS_06240 5999 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 6802 8445 gene locus_tag LOCUS_06250 6802 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 8546 9196 gene locus_tag LOCUS_06260 8546 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9915 9220 gene locus_tag LOCUS_06270 gene queE 9915 9220 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG8 protein_id gnl|my_center|LOCUS_06270 11479 10184 gene locus_tag LOCUS_06280 gene hom 11479 10184 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFK4 protein_id gnl|my_center|LOCUS_06280 11742 12656 gene locus_tag LOCUS_06290 gene mqnA 11742 12656 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_06290 12664 13410 gene locus_tag LOCUS_06300 12664 13410 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_06300 13843 13463 gene locus_tag LOCUS_06310 13843 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 14397 13840 gene locus_tag LOCUS_06320 14397 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 15043 14423 gene locus_tag LOCUS_06330 15043 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 15875 15162 gene locus_tag LOCUS_06340 gene motB 15875 15162 CDS product MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_06340 16762 15989 gene locus_tag LOCUS_06350 gene pomA 16762 15989 CDS product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326458.1 protein_id gnl|my_center|LOCUS_06350 17052 16855 gene locus_tag LOCUS_06360 17052 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 18869 17169 gene locus_tag LOCUS_06370 18869 17169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 20161 19094 gene locus_tag LOCUS_06380 20161 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 21100 21600 gene locus_tag LOCUS_06390 21100 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 21910 22386 gene locus_tag LOCUS_06400 21910 22386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence029 2031 280 gene locus_tag LOCUS_06410 gene ask 2031 280 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_06410 2270 3427 gene locus_tag LOCUS_06420 gene rfe 2270 3427 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 protein_id gnl|my_center|LOCUS_06420 3424 5562 gene locus_tag LOCUS_06430 3424 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5677 7080 gene locus_tag LOCUS_06440 5677 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 7201 8046 gene locus_tag LOCUS_06450 7201 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 8420 8130 gene locus_tag LOCUS_06460 8420 8130 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_06460 9074 9661 gene locus_tag LOCUS_06470 9074 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 9733 10419 gene locus_tag LOCUS_06480 9733 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 10519 11709 gene locus_tag LOCUS_06490 10519 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 11740 12609 gene locus_tag LOCUS_06500 11740 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 14324 12576 gene locus_tag LOCUS_06510 14324 12576 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_06510 15574 14321 gene locus_tag LOCUS_06520 15574 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_06520 15683 16054 gene locus_tag LOCUS_06530 15683 16054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 16184 17692 gene locus_tag LOCUS_06540 16184 17692 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_06540 17737 19212 gene locus_tag LOCUS_06550 gene arsA 17737 19212 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_06550 19221 19493 gene locus_tag LOCUS_06560 19221 19493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 19493 20017 gene locus_tag LOCUS_06570 19493 20017 CDS product molybdopterin converting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_06570 20017 21051 gene locus_tag LOCUS_06580 gene moaA 20017 21051 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT69 protein_id gnl|my_center|LOCUS_06580 21053 22189 gene locus_tag LOCUS_06590 21053 22189 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_06590 22186 23211 gene locus_tag LOCUS_06600 22186 23211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence030 4271 1392 gene locus_tag LOCUS_06610 4271 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4822 6579 gene locus_tag LOCUS_06620 4822 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 6889 9786 gene locus_tag LOCUS_06630 6889 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9873 12032 gene locus_tag LOCUS_06640 9873 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 12276 12758 gene locus_tag LOCUS_06650 gene cheW 12276 12758 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083224.1 protein_id gnl|my_center|LOCUS_06650 14205 12931 gene locus_tag LOCUS_06660 14205 12931 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118373.1 protein_id gnl|my_center|LOCUS_06660 14393 15643 gene locus_tag LOCUS_06670 14393 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 16728 15700 gene locus_tag LOCUS_06680 16728 15700 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_06680 16842 17918 gene locus_tag LOCUS_06690 16842 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 17984 19147 gene locus_tag LOCUS_06700 17984 19147 CDS product dehydrogenase MviM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706516.1 protein_id gnl|my_center|LOCUS_06700 19316 20266 gene locus_tag LOCUS_06710 gene nadK 19316 20266 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB8 protein_id gnl|my_center|LOCUS_06710 21448 20552 gene locus_tag LOCUS_06720 21448 20552 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URI8 protein_id gnl|my_center|LOCUS_06720 21764 22018 gene locus_tag LOCUS_06730 21764 22018 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_06730 23387 22200 gene locus_tag LOCUS_06740 23387 22200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence031 1899 256 gene locus_tag LOCUS_06750 1899 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2351 2001 gene locus_tag LOCUS_06760 2351 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 2895 2485 gene locus_tag LOCUS_06770 gene flgC 2895 2485 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNQ3 protein_id gnl|my_center|LOCUS_06770 3415 2990 gene locus_tag LOCUS_06780 gene flgB 3415 2990 CDS product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121392.1 protein_id gnl|my_center|LOCUS_06780 5057 3669 gene locus_tag LOCUS_06790 5057 3669 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086512.1 protein_id gnl|my_center|LOCUS_06790 5727 5296 gene locus_tag LOCUS_06800 5727 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 8463 5989 gene locus_tag LOCUS_06810 8463 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 9433 9059 gene locus_tag LOCUS_06820 9433 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 11000 9576 gene locus_tag LOCUS_06830 11000 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 11202 11966 gene locus_tag LOCUS_06840 11202 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 12311 16291 gene locus_tag LOCUS_06850 12311 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 18374 16488 gene locus_tag LOCUS_06860 18374 16488 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_06860 18933 18562 gene locus_tag LOCUS_06870 18933 18562 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704194.1 protein_id gnl|my_center|LOCUS_06870 20096 18930 gene locus_tag LOCUS_06880 20096 18930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 21856 20285 gene locus_tag LOCUS_06890 gene proS 21856 20285 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_06890 23015 21951 gene locus_tag LOCUS_06900 gene uxaB 23015 21951 CDS product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972586.1 protein_id gnl|my_center|LOCUS_06900 22944 23159 gene locus_tag LOCUS_06910 22944 23159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence032 797 390 gene locus_tag LOCUS_06920 797 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1034 1687 gene locus_tag LOCUS_06930 gene hpt 1034 1687 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_06930 1757 2638 gene locus_tag LOCUS_06940 1757 2638 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_06940 3799 2906 gene locus_tag LOCUS_06950 3799 2906 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 protein_id gnl|my_center|LOCUS_06950 4100 4831 gene locus_tag LOCUS_06960 4100 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6701 4938 gene locus_tag LOCUS_06970 gene recJ 6701 4938 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_06970 7936 6806 gene locus_tag LOCUS_06980 7936 6806 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_06980 8405 9946 gene locus_tag LOCUS_06990 gene xylB 8405 9946 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123533.1 protein_id gnl|my_center|LOCUS_06990 10386 10607 gene locus_tag LOCUS_07000 10386 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 11145 11516 gene locus_tag LOCUS_07010 gene rpsL 11145 11516 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN32 protein_id gnl|my_center|LOCUS_07010 11617 12093 gene locus_tag LOCUS_07020 gene rpsG 11617 12093 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN31 protein_id gnl|my_center|LOCUS_07020 12132 14384 gene locus_tag LOCUS_07030 gene fusA 12132 14384 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_07030 14488 15072 gene locus_tag LOCUS_07040 14488 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 15162 16214 gene locus_tag LOCUS_07050 15162 16214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119080.1 protein_id gnl|my_center|LOCUS_07050 16332 18170 gene locus_tag LOCUS_07060 16332 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 18211 18582 gene locus_tag LOCUS_07070 18211 18582 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPZ1 protein_id gnl|my_center|LOCUS_07070 18759 19400 gene locus_tag LOCUS_07080 gene recR 18759 19400 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ68 protein_id gnl|my_center|LOCUS_07080 19470 20114 gene locus_tag LOCUS_07090 19470 20114 CDS product glycerol-3-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972881.1 protein_id gnl|my_center|LOCUS_07090 20270 22828 gene locus_tag LOCUS_07100 gene phr 20270 22828 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122223.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence033 1577 3094 gene locus_tag LOCUS_07110 1577 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 3145 4476 gene locus_tag LOCUS_07120 3145 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_07120 4531 6387 gene locus_tag LOCUS_07130 gene atsA 4531 6387 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_07130 9970 6407 gene locus_tag LOCUS_07140 9970 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11225 9975 gene locus_tag LOCUS_07150 11225 9975 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_07150 14580 11308 gene locus_tag LOCUS_07160 14580 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 17435 14577 gene locus_tag LOCUS_07170 17435 14577 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_07170 19030 17762 gene locus_tag LOCUS_07180 19030 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 20299 19277 gene locus_tag LOCUS_07190 20299 19277 CDS product hemolysin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324277.1 protein_id gnl|my_center|LOCUS_07190 21591 20296 gene locus_tag LOCUS_07200 21591 20296 CDS product hemolysin activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120735.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence034 470 135 gene locus_tag LOCUS_07210 470 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2425 536 gene locus_tag LOCUS_07220 2425 536 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 protein_id gnl|my_center|LOCUS_07220 2965 2486 gene locus_tag LOCUS_07230 2965 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3851 2958 gene locus_tag LOCUS_07240 3851 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 5618 3939 gene locus_tag LOCUS_07250 5618 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521953.1 protein_id gnl|my_center|LOCUS_07250 7328 5814 gene locus_tag LOCUS_07260 gene impC 7328 5814 CDS product type VI secretion protein EvpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315895.1 protein_id gnl|my_center|LOCUS_07260 7981 7463 gene locus_tag LOCUS_07270 7981 7463 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318241.1 protein_id gnl|my_center|LOCUS_07270 9199 8078 gene locus_tag LOCUS_07280 9199 8078 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 protein_id gnl|my_center|LOCUS_07280 10087 9353 gene locus_tag LOCUS_07290 gene fliA 10087 9353 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720175.1 protein_id gnl|my_center|LOCUS_07290 10999 10607 gene locus_tag LOCUS_07300 10999 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 16506 11065 gene locus_tag LOCUS_07310 16506 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 17287 19155 gene locus_tag LOCUS_07320 17287 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 19334 21676 gene locus_tag LOCUS_07330 19334 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 22358 21858 gene locus_tag LOCUS_07340 22358 21858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence035 280 1050 gene locus_tag LOCUS_07350 280 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1445 2182 gene locus_tag LOCUS_07360 1445 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122952.1 protein_id gnl|my_center|LOCUS_07360 3520 2273 gene locus_tag LOCUS_07370 3520 2273 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_07370 3615 3812 gene locus_tag LOCUS_07380 3615 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3809 4669 gene locus_tag LOCUS_07390 3809 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4893 5216 gene locus_tag LOCUS_07400 4893 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_07400 5318 6919 gene locus_tag LOCUS_07410 5318 6919 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_07410 7248 7012 gene locus_tag LOCUS_07420 7248 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 7979 9433 gene locus_tag LOCUS_07430 7979 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 9591 10022 gene locus_tag LOCUS_07440 9591 10022 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525347.1 protein_id gnl|my_center|LOCUS_07440 10085 10417 gene locus_tag LOCUS_07450 10085 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 10534 12273 gene locus_tag LOCUS_07460 10534 12273 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_07460 12360 13562 gene locus_tag LOCUS_07470 12360 13562 CDS product phytochrome sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_07470 14469 13597 gene locus_tag LOCUS_07480 gene suhB 14469 13597 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117902.1 protein_id gnl|my_center|LOCUS_07480 14880 16172 gene locus_tag LOCUS_07490 14880 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 16764 16228 gene locus_tag LOCUS_07500 16764 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 17061 17630 gene locus_tag LOCUS_07510 17061 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 19885 17723 gene locus_tag LOCUS_07520 19885 17723 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119758.1 protein_id gnl|my_center|LOCUS_07520 20188 20610 gene locus_tag LOCUS_07530 20188 20610 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence036 55 1266 gene locus_tag LOCUS_07540 gene murC 55 1266 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG70 protein_id gnl|my_center|LOCUS_07540 2135 1320 gene locus_tag LOCUS_07550 2135 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3437 2328 gene locus_tag LOCUS_07560 3437 2328 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 protein_id gnl|my_center|LOCUS_07560 4044 3580 gene locus_tag LOCUS_07570 4044 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 4272 4898 gene locus_tag LOCUS_07580 4272 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5258 6031 gene locus_tag LOCUS_07590 gene natA 5258 6031 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_07590 6118 8589 gene locus_tag LOCUS_07600 6118 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 10578 8719 gene locus_tag LOCUS_07610 10578 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 10864 11319 gene locus_tag LOCUS_07620 10864 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 12731 11376 gene locus_tag LOCUS_07630 12731 11376 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_07630 12831 13490 gene locus_tag LOCUS_07640 12831 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 13556 14179 gene locus_tag LOCUS_07650 gene mthfs 13556 14179 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URX2 protein_id gnl|my_center|LOCUS_07650 14284 15216 gene locus_tag LOCUS_07660 14284 15216 CDS product formylmethanofuran--tetrahydromethanopterin formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869816.1 protein_id gnl|my_center|LOCUS_07660 16671 15280 gene locus_tag LOCUS_07670 16671 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 16928 17650 gene locus_tag LOCUS_07680 16928 17650 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_07680 17810 19558 gene locus_tag LOCUS_07690 gene lolC 17810 19558 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_07690 19657 20409 gene locus_tag LOCUS_07700 gene lolD2 19657 20409 CDS product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPK3 protein_id gnl|my_center|LOCUS_07700 >Feature sequence037 3610 1937 gene locus_tag LOCUS_07710 3610 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4599 5654 gene locus_tag LOCUS_07720 4599 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6085 5759 gene locus_tag LOCUS_07730 6085 5759 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_07730 7876 6410 gene locus_tag LOCUS_07740 7876 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 8805 7960 gene locus_tag LOCUS_07750 8805 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 9022 10113 gene locus_tag LOCUS_07760 gene ychF 9022 10113 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ1 protein_id gnl|my_center|LOCUS_07760 10436 12298 gene locus_tag LOCUS_07770 gene typA 10436 12298 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120935.1 protein_id gnl|my_center|LOCUS_07770 12558 14975 gene locus_tag LOCUS_07780 12558 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07780 15316 16905 gene locus_tag LOCUS_07790 15316 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121998.1 protein_id gnl|my_center|LOCUS_07790 17026 18780 gene locus_tag LOCUS_07800 17026 18780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340030.1 protein_id gnl|my_center|LOCUS_07800 19857 18973 gene locus_tag LOCUS_07810 19857 18973 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_07810 20547 19906 gene locus_tag LOCUS_07820 20547 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence038 1498 398 gene locus_tag LOCUS_07830 1498 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2104 4095 gene locus_tag LOCUS_07840 2104 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4205 5152 gene locus_tag LOCUS_07850 4205 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_07850 5182 5817 gene locus_tag LOCUS_07860 5182 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 7393 5942 gene locus_tag LOCUS_07870 7393 5942 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_07870 8159 7428 gene locus_tag LOCUS_07880 8159 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122585.1 protein_id gnl|my_center|LOCUS_07880 8661 10250 gene locus_tag LOCUS_07890 8661 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 10399 11091 gene locus_tag LOCUS_07900 10399 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 11674 11276 gene locus_tag LOCUS_07910 11674 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 12243 11791 gene locus_tag LOCUS_07920 gene folX 12243 11791 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_07920 13107 12328 gene locus_tag LOCUS_07930 13107 12328 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_07930 13759 15786 gene locus_tag LOCUS_07940 13759 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 15898 16752 gene locus_tag LOCUS_07950 gene ispE 15898 16752 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839U9 protein_id gnl|my_center|LOCUS_07950 16995 17438 gene locus_tag LOCUS_07960 16995 17438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 18694 17522 gene locus_tag LOCUS_07970 gene trx 18694 17522 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_07970 19361 20155 gene locus_tag LOCUS_07980 gene panB 19361 20155 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM39 protein_id gnl|my_center|LOCUS_07980 20944 20417 gene locus_tag LOCUS_07990 20944 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence039 1341 184 gene locus_tag LOCUS_08000 1341 184 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_08000 3387 1432 gene locus_tag LOCUS_08010 3387 1432 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119224.1 protein_id gnl|my_center|LOCUS_08010 3790 9579 gene locus_tag LOCUS_08020 3790 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 9833 10720 gene locus_tag LOCUS_08030 9833 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 10711 10806 gene locus_tag LOCUS_t00070 10711 10806 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10974 13277 gene locus_tag LOCUS_08040 10974 13277 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_08040 13543 15045 gene locus_tag LOCUS_08050 13543 15045 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_08050 16738 15293 gene locus_tag LOCUS_08060 16738 15293 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_08060 17129 19276 gene locus_tag LOCUS_08070 17129 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 19847 19344 gene locus_tag LOCUS_08080 19847 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence040 2317 452 gene locus_tag LOCUS_08090 2317 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6431 2766 gene locus_tag LOCUS_08100 6431 2766 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117905.1 protein_id gnl|my_center|LOCUS_08100 7390 6764 gene locus_tag LOCUS_08110 7390 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 8715 7651 gene locus_tag LOCUS_08120 8715 7651 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_08120 8998 9207 gene locus_tag LOCUS_08130 8998 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 9635 11395 gene locus_tag LOCUS_08140 9635 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_08140 11478 12377 gene locus_tag LOCUS_08150 11478 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 12869 12504 gene locus_tag LOCUS_08160 12869 12504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 13855 13211 gene locus_tag LOCUS_08170 13855 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 14373 17312 gene locus_tag LOCUS_08180 14373 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 17790 17395 gene locus_tag LOCUS_08190 gene acpS 17790 17395 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8M5 protein_id gnl|my_center|LOCUS_08190 18598 18005 gene locus_tag LOCUS_08200 18598 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 19998 18670 gene locus_tag LOCUS_08210 gene GALNS 19998 18670 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121931.1 protein_id gnl|my_center|LOCUS_08210 19991 20566 gene locus_tag LOCUS_08220 19991 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 20679 20476 gene locus_tag LOCUS_08230 20679 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 20817 20680 gene locus_tag LOCUS_08240 20817 20680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence041 889 53 gene locus_tag LOCUS_08250 gene fabI 889 53 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_08250 1068 2042 gene locus_tag LOCUS_08260 1068 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_08260 3404 2064 gene locus_tag LOCUS_08270 3404 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3671 4126 gene locus_tag LOCUS_08280 3671 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 5068 4166 gene locus_tag LOCUS_08290 5068 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123679.1 protein_id gnl|my_center|LOCUS_08290 5243 5821 gene locus_tag LOCUS_08300 5243 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 5862 6407 gene locus_tag LOCUS_08310 5862 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6407 7060 gene locus_tag LOCUS_08320 6407 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7195 9882 gene locus_tag LOCUS_08330 7195 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120757.1 protein_id gnl|my_center|LOCUS_08330 9955 11271 gene locus_tag LOCUS_08340 9955 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_08340 12685 11294 gene locus_tag LOCUS_08350 12685 11294 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_08350 13683 12793 gene locus_tag LOCUS_08360 13683 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 13889 13815 gene locus_tag LOCUS_t00080 13889 13815 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14630 14073 gene locus_tag LOCUS_08370 14630 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 15561 14710 gene locus_tag LOCUS_08380 gene punA 15561 14710 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ11 protein_id gnl|my_center|LOCUS_08380 16785 15619 gene locus_tag LOCUS_08390 gene proB 16785 15619 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJA8 protein_id gnl|my_center|LOCUS_08390 17042 18637 gene locus_tag LOCUS_08400 gene purF 17042 18637 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGS5 protein_id gnl|my_center|LOCUS_08400 19018 18650 gene locus_tag LOCUS_08410 19018 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence042 1638 412 gene locus_tag LOCUS_08420 1638 412 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337145.1 protein_id gnl|my_center|LOCUS_08420 1845 2237 gene locus_tag LOCUS_08430 1845 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2801 3628 gene locus_tag LOCUS_08440 2801 3628 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706250.1 protein_id gnl|my_center|LOCUS_08440 3664 4815 gene locus_tag LOCUS_08450 gene gcd 3664 4815 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329800.1 protein_id gnl|my_center|LOCUS_08450 5016 6638 gene locus_tag LOCUS_08460 5016 6638 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120634.1 protein_id gnl|my_center|LOCUS_08460 7914 7024 gene locus_tag LOCUS_08470 7914 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8727 8038 gene locus_tag LOCUS_08480 8727 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 10376 9156 gene locus_tag LOCUS_08490 10376 9156 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_08490 10552 11682 gene locus_tag LOCUS_08500 10552 11682 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_08500 12252 11848 gene locus_tag LOCUS_08510 12252 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 12502 13215 gene locus_tag LOCUS_08520 12502 13215 CDS product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_08520 13367 14464 gene locus_tag LOCUS_08530 13367 14464 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119925.1 protein_id gnl|my_center|LOCUS_08530 14731 15582 gene locus_tag LOCUS_08540 14731 15582 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_08540 16596 15658 gene locus_tag LOCUS_08550 16596 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 16867 18978 gene locus_tag LOCUS_08560 16867 18978 CDS product protein-xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123507.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence043 1419 181 gene locus_tag LOCUS_08570 1419 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123740.1 protein_id gnl|my_center|LOCUS_08570 1729 2355 gene locus_tag LOCUS_08580 1729 2355 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073380.1 protein_id gnl|my_center|LOCUS_08580 2538 3053 gene locus_tag LOCUS_08590 2538 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4220 3099 gene locus_tag LOCUS_08600 4220 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 5922 4357 gene locus_tag LOCUS_08610 5922 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 6755 7891 gene locus_tag LOCUS_08620 6755 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 8578 7961 gene locus_tag LOCUS_08630 8578 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 10565 8748 gene locus_tag LOCUS_08640 gene dnaK 10565 8748 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120597.1 protein_id gnl|my_center|LOCUS_08640 10851 13883 gene locus_tag LOCUS_08650 gene putA 10851 13883 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 protein_id gnl|my_center|LOCUS_08650 13982 14296 gene locus_tag LOCUS_08660 13982 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 14463 15245 gene locus_tag LOCUS_08670 14463 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 15436 16770 gene locus_tag LOCUS_08680 gene glgC 15436 16770 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337168.1 protein_id gnl|my_center|LOCUS_08680 18498 16840 gene locus_tag LOCUS_08690 18498 16840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118499.1 protein_id gnl|my_center|LOCUS_08690 19126 18689 gene locus_tag LOCUS_08700 19126 18689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 <20071 19128 gene locus_tag LOCUS_08710 <20071 19128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120598.1:molecular chaperone DnaK >Feature sequence044 721 1890 gene locus_tag LOCUS_08720 721 1890 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_08720 1982 3106 gene locus_tag LOCUS_08730 1982 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 3103 4149 gene locus_tag LOCUS_08740 gene hpnA 3103 4149 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_08740 4352 5467 gene locus_tag LOCUS_08750 4352 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 5518 6816 gene locus_tag LOCUS_08760 5518 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403758.1 protein_id gnl|my_center|LOCUS_08760 8580 6880 gene locus_tag LOCUS_08770 8580 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 11372 8667 gene locus_tag LOCUS_08780 11372 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 12220 11474 gene locus_tag LOCUS_08790 12220 11474 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_08790 13683 12802 gene locus_tag LOCUS_08800 13683 12802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120864.1 protein_id gnl|my_center|LOCUS_08800 14089 13961 gene locus_tag LOCUS_08810 14089 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 14942 14070 gene locus_tag LOCUS_08820 14942 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118614.1 protein_id gnl|my_center|LOCUS_08820 15907 15161 gene locus_tag LOCUS_08830 15907 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 16517 17668 gene locus_tag LOCUS_08840 16517 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 <19879 18201 gene locus_tag LOCUS_08850 <19879 18201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007331356.1:two-component system response regulator >Feature sequence045 1171 143 gene locus_tag LOCUS_08860 1171 143 CDS product serum resistance protein brkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119949.1 protein_id gnl|my_center|LOCUS_08860 1365 2321 gene locus_tag LOCUS_08870 1365 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2984 2340 gene locus_tag LOCUS_08880 gene cynT 2984 2340 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UP1 protein_id gnl|my_center|LOCUS_08880 3299 3212 gene locus_tag LOCUS_t00090 3299 3212 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3664 3425 gene locus_tag LOCUS_08890 3664 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3821 6022 gene locus_tag LOCUS_08900 3821 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6065 6994 gene locus_tag LOCUS_08910 gene ubiA 6065 6994 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_08910 9944 6984 gene locus_tag LOCUS_08920 9944 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 11236 10076 gene locus_tag LOCUS_08930 11236 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_08930 11645 12238 gene locus_tag LOCUS_08940 11645 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 13559 12327 gene locus_tag LOCUS_08950 gene trpB 13559 12327 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG9 protein_id gnl|my_center|LOCUS_08950 13698 15695 gene locus_tag LOCUS_08960 gene htpG 13698 15695 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61185 protein_id gnl|my_center|LOCUS_08960 15737 16240 gene locus_tag LOCUS_08970 15737 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 16641 17468 gene locus_tag LOCUS_08980 16641 17468 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_08980 17476 18102 gene locus_tag LOCUS_08990 17476 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 18255 19094 gene locus_tag LOCUS_09000 18255 19094 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence046 <1 598 gene locus_tag LOCUS_09010 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120603.1:potassium transporter 1465 665 gene locus_tag LOCUS_09020 1465 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1584 2579 gene locus_tag LOCUS_09030 gene lipA 1584 2579 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH37 protein_id gnl|my_center|LOCUS_09030 2663 2911 gene locus_tag LOCUS_09040 2663 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4111 2960 gene locus_tag LOCUS_09050 4111 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4249 5832 gene locus_tag LOCUS_09060 4249 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_09060 5956 7029 gene locus_tag LOCUS_09070 5956 7029 CDS product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 protein_id gnl|my_center|LOCUS_09070 7115 7741 gene locus_tag LOCUS_09080 7115 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 7957 9681 gene locus_tag LOCUS_09090 7957 9681 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143047.1 protein_id gnl|my_center|LOCUS_09090 9890 10159 gene locus_tag LOCUS_09100 9890 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10204 15354 gene locus_tag LOCUS_09110 10204 15354 CDS product vegetatible incompatibility protein HET-E-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118726.1 protein_id gnl|my_center|LOCUS_09110 15422 15637 gene locus_tag LOCUS_09120 15422 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 15637 16023 gene locus_tag LOCUS_09130 gene doc 15637 16023 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_09130 16075 17532 gene locus_tag LOCUS_09140 16075 17532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_09140 17551 18714 gene locus_tag LOCUS_09150 17551 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 19314 18874 gene locus_tag LOCUS_09160 19314 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence047 173 1099 gene locus_tag LOCUS_09170 173 1099 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118357.1 protein_id gnl|my_center|LOCUS_09170 1096 2058 gene locus_tag LOCUS_09180 1096 2058 CDS product 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P833 protein_id gnl|my_center|LOCUS_09180 2055 3302 gene locus_tag LOCUS_09190 gene dadA 2055 3302 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_09190 3764 3537 gene locus_tag LOCUS_09200 3764 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3852 4346 gene locus_tag LOCUS_09210 3852 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 4600 4433 gene locus_tag LOCUS_09220 4600 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6570 4687 gene locus_tag LOCUS_09230 6570 4687 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW9 protein_id gnl|my_center|LOCUS_09230 7486 6689 gene locus_tag LOCUS_09240 7486 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8619 7606 gene locus_tag LOCUS_09250 8619 7606 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118418.1 protein_id gnl|my_center|LOCUS_09250 9788 8745 gene locus_tag LOCUS_09260 9788 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 10547 13228 gene locus_tag LOCUS_09270 10547 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 13296 13958 gene locus_tag LOCUS_09280 13296 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_09280 14620 13964 gene locus_tag LOCUS_09290 14620 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402995.1 protein_id gnl|my_center|LOCUS_09290 15504 14821 gene locus_tag LOCUS_09300 gene rplQ 15504 14821 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC4 protein_id gnl|my_center|LOCUS_09300 16680 15673 gene locus_tag LOCUS_09310 gene rpoA 16680 15673 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC5 protein_id gnl|my_center|LOCUS_09310 17241 16858 gene locus_tag LOCUS_09320 gene rpsK 17241 16858 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC6 protein_id gnl|my_center|LOCUS_09320 17762 17376 gene locus_tag LOCUS_09330 gene rpsM 17762 17376 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC7 protein_id gnl|my_center|LOCUS_09330 18253 17915 gene locus_tag LOCUS_09340 18253 17915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence048 2235 322 gene locus_tag LOCUS_09350 2235 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3974 2388 gene locus_tag LOCUS_09360 3974 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140024.1 protein_id gnl|my_center|LOCUS_09360 5739 4048 gene locus_tag LOCUS_09370 5739 4048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118217.1 protein_id gnl|my_center|LOCUS_09370 6172 7473 gene locus_tag LOCUS_09380 gene fucA 6172 7473 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_09380 8747 7566 gene locus_tag LOCUS_09390 8747 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 9420 8875 gene locus_tag LOCUS_09400 9420 8875 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_09400 12207 9892 gene locus_tag LOCUS_09410 12207 9892 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_09410 13399 12548 gene locus_tag LOCUS_09420 13399 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 13787 14839 gene locus_tag LOCUS_09430 13787 14839 CDS product periplasmic sugar-binding protein of ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140809.1 protein_id gnl|my_center|LOCUS_09430 14836 15207 gene locus_tag LOCUS_09440 14836 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 15258 16547 gene locus_tag LOCUS_09450 15258 16547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 16891 16571 gene locus_tag LOCUS_09460 16891 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 protein_id gnl|my_center|LOCUS_09460 18770 17304 gene locus_tag LOCUS_09470 gene aslA 18770 17304 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120007.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence049 1368 115 gene locus_tag LOCUS_09480 1368 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 protein_id gnl|my_center|LOCUS_09480 1610 2083 gene locus_tag LOCUS_09490 1610 2083 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_09490 2143 3342 gene locus_tag LOCUS_09500 2143 3342 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257135.1 protein_id gnl|my_center|LOCUS_09500 3388 4080 gene locus_tag LOCUS_09510 3388 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5136 4114 gene locus_tag LOCUS_09520 5136 4114 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121274.1 protein_id gnl|my_center|LOCUS_09520 5790 5287 gene locus_tag LOCUS_09530 5790 5287 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214726.1 protein_id gnl|my_center|LOCUS_09530 5930 7279 gene locus_tag LOCUS_09540 5930 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 8718 7294 gene locus_tag LOCUS_09550 8718 7294 CDS product xanthosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513243.1 protein_id gnl|my_center|LOCUS_09550 9108 11159 gene locus_tag LOCUS_09560 9108 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 12310 11201 gene locus_tag LOCUS_09570 gene rlmN 12310 11201 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHU7 protein_id gnl|my_center|LOCUS_09570 12498 13334 gene locus_tag LOCUS_09580 12498 13334 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_09580 14365 13343 gene locus_tag LOCUS_09590 14365 13343 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_09590 16189 14504 gene locus_tag LOCUS_09600 16189 14504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 17495 16221 gene locus_tag LOCUS_09610 17495 16221 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335856.1 protein_id gnl|my_center|LOCUS_09610 <18739 17555 gene locus_tag LOCUS_09620 <18739 17555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118478.1:diguanylate cyclase >Feature sequence050 2557 1907 gene locus_tag LOCUS_09630 2557 1907 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_09630 4612 2870 gene locus_tag LOCUS_09640 4612 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5432 5076 gene locus_tag LOCUS_09650 5432 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 5416 6675 gene locus_tag LOCUS_09660 gene eno 5416 6675 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR2 protein_id gnl|my_center|LOCUS_09660 6805 8400 gene locus_tag LOCUS_09670 6805 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 7527 7604 gene locus_tag LOCUS_t00100 7527 7604 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8780 10408 gene locus_tag LOCUS_09680 8780 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 11260 10442 gene locus_tag LOCUS_09690 11260 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_09690 11545 12408 gene locus_tag LOCUS_09700 11545 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 12526 12942 gene locus_tag LOCUS_09710 12526 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_09710 13118 14635 gene locus_tag LOCUS_09720 13118 14635 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118678.1 protein_id gnl|my_center|LOCUS_09720 14677 16179 gene locus_tag LOCUS_09730 14677 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 16277 17893 gene locus_tag LOCUS_09740 16277 17893 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence051 781 110 gene locus_tag LOCUS_09750 781 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3116 810 gene locus_tag LOCUS_09760 3116 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3379 4641 gene locus_tag LOCUS_09770 gene sat 3379 4641 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR03 protein_id gnl|my_center|LOCUS_09770 6122 4707 gene locus_tag LOCUS_09780 6122 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7311 6217 gene locus_tag LOCUS_09790 7311 6217 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122231.1 protein_id gnl|my_center|LOCUS_09790 7675 7971 gene locus_tag LOCUS_09800 7675 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 8029 8970 gene locus_tag LOCUS_09810 gene ftsY 8029 8970 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT17 protein_id gnl|my_center|LOCUS_09810 9353 11389 gene locus_tag LOCUS_09820 9353 11389 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_09820 11503 13233 gene locus_tag LOCUS_09830 11503 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 13343 15508 gene locus_tag LOCUS_09840 13343 15508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 15997 15644 gene locus_tag LOCUS_09850 gene hinT 15997 15644 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261764.1 protein_id gnl|my_center|LOCUS_09850 16237 16752 gene locus_tag LOCUS_09860 16237 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 17325 16807 gene locus_tag LOCUS_09870 17325 16807 CDS product putative Nudix hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S266 protein_id gnl|my_center|LOCUS_09870 <18697 17439 gene locus_tag LOCUS_09880 <18697 17439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942647.1:3-octaprenyl-4-hydroxybenzoate carboxy-lyase >Feature sequence052 5238 6470 gene locus_tag LOCUS_09890 gene tolQ 5238 6470 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_09890 6629 8494 gene locus_tag LOCUS_09900 6629 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8491 9540 gene locus_tag LOCUS_09910 8491 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324693.1 protein_id gnl|my_center|LOCUS_09910 9584 10474 gene locus_tag LOCUS_09920 gene sqdC 9584 10474 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120934.1 protein_id gnl|my_center|LOCUS_09920 11950 10562 gene locus_tag LOCUS_09930 11950 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 13909 12335 gene locus_tag LOCUS_09940 13909 12335 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121705.1 protein_id gnl|my_center|LOCUS_09940 14963 14121 gene locus_tag LOCUS_09950 14963 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 15071 15565 gene locus_tag LOCUS_09960 15071 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 17389 15716 gene locus_tag LOCUS_09970 gene ctpA 17389 15716 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119232.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence053 <1 3990 gene locus_tag LOCUS_09980 <1 3990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119627.1:cytochrome c 4100 5674 gene locus_tag LOCUS_09990 4100 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 5729 6223 gene locus_tag LOCUS_10000 5729 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324288.1 protein_id gnl|my_center|LOCUS_10000 7978 6329 gene locus_tag LOCUS_10010 7978 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 10844 8109 gene locus_tag LOCUS_10020 10844 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_10020 11034 11759 gene locus_tag LOCUS_10030 11034 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 11964 13733 gene locus_tag LOCUS_10040 gene aspS 11964 13733 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFY6 protein_id gnl|my_center|LOCUS_10040 13941 15644 gene locus_tag LOCUS_10050 13941 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 15761 16480 gene locus_tag LOCUS_10060 15761 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 16565 17311 gene locus_tag LOCUS_10070 gene rnc 16565 17311 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ7 protein_id gnl|my_center|LOCUS_10070 18415 17402 gene locus_tag LOCUS_10080 gene trpD 18415 17402 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYS5 protein_id gnl|my_center|LOCUS_10080 >Feature sequence054 531 794 gene locus_tag LOCUS_10090 531 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 905 2413 gene locus_tag LOCUS_10100 gene crtI 905 2413 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_10100 2421 2873 gene locus_tag LOCUS_10110 2421 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037583.1 protein_id gnl|my_center|LOCUS_10110 2942 3082 gene locus_tag LOCUS_10120 2942 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3079 4032 gene locus_tag LOCUS_10130 3079 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4029 4373 gene locus_tag LOCUS_10140 4029 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 4419 5528 gene locus_tag LOCUS_10150 gene yrbG 4419 5528 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_10150 5636 6493 gene locus_tag LOCUS_10160 5636 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6636 7730 gene locus_tag LOCUS_10170 gene pknH 6636 7730 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122631.1 protein_id gnl|my_center|LOCUS_10170 7794 8792 gene locus_tag LOCUS_10180 7794 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 8937 10181 gene locus_tag LOCUS_10190 8937 10181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 11185 10241 gene locus_tag LOCUS_10200 11185 10241 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_10200 11728 13467 gene locus_tag LOCUS_10210 11728 13467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 14078 13551 gene locus_tag LOCUS_10220 14078 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_10220 14369 15751 gene locus_tag LOCUS_10230 14369 15751 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226938.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence055 2558 1203 gene locus_tag LOCUS_10240 2558 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_10240 5043 2623 gene locus_tag LOCUS_10250 5043 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 5825 5232 gene locus_tag LOCUS_10260 5825 5232 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121675.1 protein_id gnl|my_center|LOCUS_10260 9259 5822 gene locus_tag LOCUS_10270 9259 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9412 10833 gene locus_tag LOCUS_10280 9412 10833 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_10280 12823 10919 gene locus_tag LOCUS_10290 12823 10919 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118947.1 protein_id gnl|my_center|LOCUS_10290 13889 12921 gene locus_tag LOCUS_10300 13889 12921 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029017.1 protein_id gnl|my_center|LOCUS_10300 14182 14910 gene locus_tag LOCUS_10310 14182 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 15195 17894 gene locus_tag LOCUS_10320 15195 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence056 2884 284 gene locus_tag LOCUS_10330 gene gyrB 2884 284 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM28 protein_id gnl|my_center|LOCUS_10330 3999 3094 gene locus_tag LOCUS_10340 gene nadC 3999 3094 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121013.1 protein_id gnl|my_center|LOCUS_10340 5727 4045 gene locus_tag LOCUS_10350 5727 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 5937 6440 gene locus_tag LOCUS_10360 5937 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 6691 8073 gene locus_tag LOCUS_10370 6691 8073 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122491.1 protein_id gnl|my_center|LOCUS_10370 8215 12363 gene locus_tag LOCUS_10380 8215 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121833.1 protein_id gnl|my_center|LOCUS_10380 13268 12498 gene locus_tag LOCUS_10390 13268 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 13592 14515 gene locus_tag LOCUS_10400 13592 14515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 14613 15062 gene locus_tag LOCUS_10410 14613 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 15249 16445 gene locus_tag LOCUS_10420 15249 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 16744 17295 gene locus_tag LOCUS_10430 16744 17295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 17536 17793 gene locus_tag LOCUS_10440 17536 17793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence057 997 164 gene locus_tag LOCUS_10450 997 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_10450 1800 1102 gene locus_tag LOCUS_10460 1800 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2202 2978 gene locus_tag LOCUS_10470 2202 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 3149 3805 gene locus_tag LOCUS_10480 3149 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4546 3833 gene locus_tag LOCUS_10490 4546 3833 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 protein_id gnl|my_center|LOCUS_10490 4983 4543 gene locus_tag LOCUS_10500 4983 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6473 5046 gene locus_tag LOCUS_10510 6473 5046 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123590.1 protein_id gnl|my_center|LOCUS_10510 6628 6699 gene locus_tag LOCUS_t00110 6628 6699 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7608 6754 gene locus_tag LOCUS_10520 7608 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7775 8272 gene locus_tag LOCUS_10530 gene ispF 7775 8272 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFM1 protein_id gnl|my_center|LOCUS_10530 8385 9932 gene locus_tag LOCUS_10540 gene cysS 8385 9932 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US70 protein_id gnl|my_center|LOCUS_10540 9974 10480 gene locus_tag LOCUS_10550 gene ruvC 9974 10480 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US71 protein_id gnl|my_center|LOCUS_10550 12827 10509 gene locus_tag LOCUS_10560 12827 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 13318 14223 gene locus_tag LOCUS_10570 13318 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 14333 15721 gene locus_tag LOCUS_10580 14333 15721 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_10580 16073 15768 gene locus_tag LOCUS_10590 16073 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 17340 16303 gene locus_tag LOCUS_10600 17340 16303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence058 103 1092 gene locus_tag LOCUS_10610 103 1092 CDS product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709779.1 protein_id gnl|my_center|LOCUS_10610 1150 2010 gene locus_tag LOCUS_10620 1150 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2070 3638 gene locus_tag LOCUS_10630 2070 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976340.1 protein_id gnl|my_center|LOCUS_10630 3711 4982 gene locus_tag LOCUS_10640 3711 4982 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_10640 5020 5415 gene locus_tag LOCUS_10650 5020 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5433 6194 gene locus_tag LOCUS_10660 5433 6194 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_10660 7182 6262 gene locus_tag LOCUS_10670 gene rmlD 7182 6262 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_10670 7496 7179 gene locus_tag LOCUS_10680 7496 7179 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121768.1 protein_id gnl|my_center|LOCUS_10680 8142 7519 gene locus_tag LOCUS_10690 8142 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8362 9840 gene locus_tag LOCUS_10700 gene ffh 8362 9840 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_10700 10118 11317 gene locus_tag LOCUS_10710 10118 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 11479 12636 gene locus_tag LOCUS_10720 gene bamB 11479 12636 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTW8 protein_id gnl|my_center|LOCUS_10720 12738 13556 gene locus_tag LOCUS_10730 12738 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 13917 13651 gene locus_tag LOCUS_10740 gene rpsR 13917 13651 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_10740 15136 14201 gene locus_tag LOCUS_10750 15136 14201 CDS product beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_10750 16256 15180 gene locus_tag LOCUS_10760 16256 15180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 16978 16328 gene locus_tag LOCUS_10770 16978 16328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 17439 16975 gene locus_tag LOCUS_10780 17439 16975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence059 244 1587 gene locus_tag LOCUS_10790 244 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1979 1713 gene locus_tag LOCUS_10800 1979 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1879 2118 gene locus_tag LOCUS_10810 1879 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2115 2537 gene locus_tag LOCUS_10820 2115 2537 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613956.1 protein_id gnl|my_center|LOCUS_10820 2805 5138 gene locus_tag LOCUS_10830 2805 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5554 6864 gene locus_tag LOCUS_10840 5554 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 7765 7370 gene locus_tag LOCUS_10850 7765 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 8068 10242 gene locus_tag LOCUS_10860 8068 10242 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_10860 11301 10309 gene locus_tag LOCUS_10870 11301 10309 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_10870 11470 12444 gene locus_tag LOCUS_10880 11470 12444 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117796.1 protein_id gnl|my_center|LOCUS_10880 12529 13563 gene locus_tag LOCUS_10890 gene yjjN 12529 13563 CDS product zinc-type alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_10890 13594 14007 gene locus_tag LOCUS_10900 13594 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 14299 13964 gene locus_tag LOCUS_10910 14299 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 14817 14434 gene locus_tag LOCUS_10920 gene hisI 14817 14434 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62386 protein_id gnl|my_center|LOCUS_10920 15022 16002 gene locus_tag LOCUS_10930 15022 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 16272 17228 gene locus_tag LOCUS_10940 gene rluD 16272 17228 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX8 protein_id gnl|my_center|LOCUS_10940 >Feature sequence060 361 1041 gene locus_tag LOCUS_10950 361 1041 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_10950 2500 1070 gene locus_tag LOCUS_10960 2500 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119021.1 protein_id gnl|my_center|LOCUS_10960 4913 2562 gene locus_tag LOCUS_10970 4913 2562 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 protein_id gnl|my_center|LOCUS_10970 5647 5072 gene locus_tag LOCUS_10980 gene lspA 5647 5072 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CMS8 protein_id gnl|my_center|LOCUS_10980 6783 5767 gene locus_tag LOCUS_10990 6783 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 7030 8139 gene locus_tag LOCUS_11000 gene nemA 7030 8139 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337792.1 protein_id gnl|my_center|LOCUS_11000 8466 8143 gene locus_tag LOCUS_11010 8466 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 8545 9399 gene locus_tag LOCUS_11020 8545 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 10989 9418 gene locus_tag LOCUS_11030 gene rne 10989 9418 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_11030 13458 11686 gene locus_tag LOCUS_11040 gene ptsI 13458 11686 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMU0 protein_id gnl|my_center|LOCUS_11040 14432 13650 gene locus_tag LOCUS_11050 14432 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 15114 15848 gene locus_tag LOCUS_11060 15114 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 16069 16257 gene locus_tag LOCUS_11070 16069 16257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 16335 17273 gene locus_tag LOCUS_11080 16335 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence061 470 2287 gene locus_tag LOCUS_11090 gene cya 470 2287 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_11090 2640 3098 gene locus_tag LOCUS_11100 2640 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3332 5347 gene locus_tag LOCUS_11110 3332 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 6098 5379 gene locus_tag LOCUS_11120 6098 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 protein_id gnl|my_center|LOCUS_11120 7857 6367 gene locus_tag LOCUS_11130 7857 6367 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118737.1 protein_id gnl|my_center|LOCUS_11130 7957 9039 gene locus_tag LOCUS_11140 gene ybhE 7957 9039 CDS product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_11140 9227 10348 gene locus_tag LOCUS_11150 gene corA 9227 10348 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_11150 10986 10561 gene locus_tag LOCUS_11160 10986 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 13719 11308 gene locus_tag LOCUS_11170 13719 11308 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_11170 13870 17334 gene locus_tag LOCUS_11180 13870 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence062 3775 1613 gene locus_tag LOCUS_11190 gene fusA 3775 1613 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URV2 protein_id gnl|my_center|LOCUS_11190 4623 4309 gene locus_tag LOCUS_11200 4623 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 4792 5925 gene locus_tag LOCUS_11210 4792 5925 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119030.1 protein_id gnl|my_center|LOCUS_11210 6032 6916 gene locus_tag LOCUS_11220 6032 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7569 8588 gene locus_tag LOCUS_11230 gene glnII 7569 8588 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_11230 8680 10704 gene locus_tag LOCUS_11240 8680 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 11707 10760 gene locus_tag LOCUS_11250 11707 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 12064 11876 gene locus_tag LOCUS_11260 12064 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 13483 12116 gene locus_tag LOCUS_11270 13483 12116 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_11270 14064 15242 gene locus_tag LOCUS_11280 14064 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123767.1 protein_id gnl|my_center|LOCUS_11280 15269 16399 gene locus_tag LOCUS_11290 15269 16399 CDS product N-acylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_11290 16544 17293 gene locus_tag LOCUS_11300 16544 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence063 183 1559 gene locus_tag LOCUS_11310 183 1559 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122733.1 protein_id gnl|my_center|LOCUS_11310 1712 4882 gene locus_tag LOCUS_11320 1712 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5253 5621 gene locus_tag LOCUS_11330 5253 5621 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USG1 protein_id gnl|my_center|LOCUS_11330 5677 6789 gene locus_tag LOCUS_11340 gene mreB 5677 6789 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919417.1 protein_id gnl|my_center|LOCUS_11340 6964 7704 gene locus_tag LOCUS_11350 6964 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7701 9683 gene locus_tag LOCUS_11360 7701 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 10772 9723 gene locus_tag LOCUS_11370 10772 9723 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123593.1 protein_id gnl|my_center|LOCUS_11370 10817 12046 gene locus_tag LOCUS_11380 10817 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 14219 12228 gene locus_tag LOCUS_11390 gene flgI 14219 12228 CDS product flagellar P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 protein_id gnl|my_center|LOCUS_11390 15405 14398 gene locus_tag LOCUS_11400 gene ilvC 15405 14398 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKY0 protein_id gnl|my_center|LOCUS_11400 16068 15517 gene locus_tag LOCUS_11410 gene ilvN 16068 15517 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122509.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence064 722 333 gene locus_tag LOCUS_11420 722 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 700 2076 gene locus_tag LOCUS_11430 700 2076 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030574.1 protein_id gnl|my_center|LOCUS_11430 2381 4951 gene locus_tag LOCUS_11440 2381 4951 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_11440 5165 6046 gene locus_tag LOCUS_11450 5165 6046 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122378.1 protein_id gnl|my_center|LOCUS_11450 6175 6939 gene locus_tag LOCUS_11460 6175 6939 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_11460 7024 8439 gene locus_tag LOCUS_11470 gene sthA 7024 8439 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325276.1 protein_id gnl|my_center|LOCUS_11470 9490 8576 gene locus_tag LOCUS_11480 9490 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767322.1 protein_id gnl|my_center|LOCUS_11480 11555 9612 gene locus_tag LOCUS_11490 gene pcrA 11555 9612 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR6 protein_id gnl|my_center|LOCUS_11490 12410 11634 gene locus_tag LOCUS_11500 gene accD 12410 11634 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX0 protein_id gnl|my_center|LOCUS_11500 13172 12606 gene locus_tag LOCUS_11510 gene pgaM 13172 12606 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332332.1 protein_id gnl|my_center|LOCUS_11510 14058 13354 gene locus_tag LOCUS_11520 gene rpe 14058 13354 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CCP9 protein_id gnl|my_center|LOCUS_11520 15183 14161 gene locus_tag LOCUS_11530 15183 14161 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH8 protein_id gnl|my_center|LOCUS_11530 16705 15671 gene locus_tag LOCUS_11540 16705 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence065 2411 468 gene locus_tag LOCUS_11550 gene acsA 2411 468 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIW6 protein_id gnl|my_center|LOCUS_11550 3455 2514 gene locus_tag LOCUS_11560 3455 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 4509 3487 gene locus_tag LOCUS_11570 4509 3487 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_11570 5669 4509 gene locus_tag LOCUS_11580 5669 4509 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122038.1 protein_id gnl|my_center|LOCUS_11580 6532 5666 gene locus_tag LOCUS_11590 6532 5666 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_11590 6632 7258 gene locus_tag LOCUS_11600 6632 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120574.1 protein_id gnl|my_center|LOCUS_11600 7968 7324 gene locus_tag LOCUS_11610 7968 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 8924 8148 gene locus_tag LOCUS_11620 gene menG 8924 8148 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59912 protein_id gnl|my_center|LOCUS_11620 15821 9165 gene locus_tag LOCUS_11630 15821 9165 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_11630 16211 15906 gene locus_tag LOCUS_11640 16211 15906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 16594 16217 gene locus_tag LOCUS_11650 16594 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 16862 16644 gene locus_tag LOCUS_11660 16862 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 17188 16826 gene locus_tag LOCUS_11670 17188 16826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence066 91 402 gene locus_tag LOCUS_11680 91 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 530 1162 gene locus_tag LOCUS_11690 gene folE 530 1162 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJJ7 protein_id gnl|my_center|LOCUS_11690 1279 4296 gene locus_tag LOCUS_11700 1279 4296 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_11700 5276 4350 gene locus_tag LOCUS_11710 5276 4350 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119789.1 protein_id gnl|my_center|LOCUS_11710 5896 5654 gene locus_tag LOCUS_11720 5896 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 6096 7682 gene locus_tag LOCUS_11730 gene purH 6096 7682 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ8 protein_id gnl|my_center|LOCUS_11730 7957 8631 gene locus_tag LOCUS_11740 7957 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 8687 9466 gene locus_tag LOCUS_11750 8687 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 9540 11261 gene locus_tag LOCUS_11760 9540 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 11403 12473 gene locus_tag LOCUS_11770 11403 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 12664 12987 gene locus_tag LOCUS_11780 12664 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 14683 13025 gene locus_tag LOCUS_11790 14683 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 14990 16378 gene locus_tag LOCUS_11800 gene rimO 14990 16378 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK39 protein_id gnl|my_center|LOCUS_11800 16582 16328 gene locus_tag LOCUS_11810 16582 16328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence067 <1 564 gene locus_tag LOCUS_11820 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WDL2:hydroxypyruvate isomerase 645 1805 gene locus_tag LOCUS_11830 gene aroC 645 1805 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_11830 1891 1961 gene locus_tag LOCUS_t00120 1891 1961 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2029 2418 gene locus_tag LOCUS_11840 2029 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_11840 2515 3360 gene locus_tag LOCUS_11850 2515 3360 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_11850 3401 4882 gene locus_tag LOCUS_11860 3401 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 5013 5771 gene locus_tag LOCUS_11870 5013 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7223 5814 gene locus_tag LOCUS_11880 7223 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 7757 7380 gene locus_tag LOCUS_11890 7757 7380 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_11890 8797 7901 gene locus_tag LOCUS_11900 8797 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 protein_id gnl|my_center|LOCUS_11900 9050 10231 gene locus_tag LOCUS_11910 9050 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 13635 10261 gene locus_tag LOCUS_11920 13635 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 13756 13929 gene locus_tag LOCUS_11930 13756 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 14026 14697 gene locus_tag LOCUS_11940 14026 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 14846 16048 gene locus_tag LOCUS_11950 14846 16048 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIN0 protein_id gnl|my_center|LOCUS_11950 >Feature sequence068 <1 820 gene locus_tag LOCUS_11960 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123487.1:protease 935 2479 gene locus_tag LOCUS_11970 935 2479 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_11970 2764 3795 gene locus_tag LOCUS_11980 gene fba 2764 3795 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69600 protein_id gnl|my_center|LOCUS_11980 3891 4226 gene locus_tag LOCUS_11990 3891 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 4274 4903 gene locus_tag LOCUS_12000 4274 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 5338 4919 gene locus_tag LOCUS_12010 5338 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7022 5418 gene locus_tag LOCUS_12020 7022 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 7744 7331 gene locus_tag LOCUS_12030 7744 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 8298 9116 gene locus_tag LOCUS_12040 gene rpsB 8298 9116 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH4 protein_id gnl|my_center|LOCUS_12040 9924 9478 gene locus_tag LOCUS_12050 9924 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 10328 11161 gene locus_tag LOCUS_12060 gene tsf 10328 11161 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66930 protein_id gnl|my_center|LOCUS_12060 12094 11240 gene locus_tag LOCUS_12070 12094 11240 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_12070 14229 12880 gene locus_tag LOCUS_12080 gene mntB 14229 12880 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_12080 15178 14270 gene locus_tag LOCUS_12090 15178 14270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence069 924 244 gene locus_tag LOCUS_12100 924 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2044 1058 gene locus_tag LOCUS_12110 2044 1058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123496.1 protein_id gnl|my_center|LOCUS_12110 2607 2041 gene locus_tag LOCUS_12120 2607 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3796 2924 gene locus_tag LOCUS_12130 3796 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 5344 3971 gene locus_tag LOCUS_12140 5344 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 5471 6664 gene locus_tag LOCUS_12150 5471 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 7006 8115 gene locus_tag LOCUS_12160 7006 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 8266 8658 gene locus_tag LOCUS_12170 8266 8658 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_12170 8707 11028 gene locus_tag LOCUS_12180 gene epsB 8707 11028 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118858.1 protein_id gnl|my_center|LOCUS_12180 11963 11094 gene locus_tag LOCUS_12190 gene comB 11963 11094 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS5 protein_id gnl|my_center|LOCUS_12190 13065 12088 gene locus_tag LOCUS_12200 gene degP 13065 12088 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121356.1 protein_id gnl|my_center|LOCUS_12200 14929 13187 gene locus_tag LOCUS_12210 gene degP 14929 13187 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121355.1 protein_id gnl|my_center|LOCUS_12210 15018 15938 gene locus_tag LOCUS_12220 15018 15938 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_12220 16187 16537 gene locus_tag LOCUS_12230 16187 16537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence070 1385 90 gene locus_tag LOCUS_12240 1385 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 9421 2099 gene locus_tag LOCUS_12250 9421 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 12055 9566 gene locus_tag LOCUS_12260 12055 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 13848 12061 gene locus_tag LOCUS_12270 13848 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 15257 13884 gene locus_tag LOCUS_12280 15257 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence071 1890 310 gene locus_tag LOCUS_12290 gene trpE 1890 310 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_12290 2664 1936 gene locus_tag LOCUS_12300 2664 1936 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119440.1 protein_id gnl|my_center|LOCUS_12300 2866 3414 gene locus_tag LOCUS_12310 gene yacH 2866 3414 CDS product UvrB/UvrC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_12310 3535 4584 gene locus_tag LOCUS_12320 gene yacI 3535 4584 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV3 protein_id gnl|my_center|LOCUS_12320 4641 5546 gene locus_tag LOCUS_12330 4641 5546 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460378.1 protein_id gnl|my_center|LOCUS_12330 6599 5760 gene locus_tag LOCUS_12340 6599 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402995.1 protein_id gnl|my_center|LOCUS_12340 8363 6705 gene locus_tag LOCUS_12350 8363 6705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119516.1 protein_id gnl|my_center|LOCUS_12350 7149 7051 gene locus_tag LOCUS_t00130 7149 7051 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9644 8601 gene locus_tag LOCUS_12360 9644 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 10218 11759 gene locus_tag LOCUS_12370 gene rny 10218 11759 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE3 protein_id gnl|my_center|LOCUS_12370 12671 11958 gene locus_tag LOCUS_12380 gene pdxJ 12671 11958 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8C9 protein_id gnl|my_center|LOCUS_12380 12948 12766 gene locus_tag LOCUS_12390 12948 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 16191 13357 gene locus_tag LOCUS_12400 16191 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence072 332 247 gene locus_tag LOCUS_t00140 332 247 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 508 1353 gene locus_tag LOCUS_12410 508 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2492 1383 gene locus_tag LOCUS_12420 gene galM 2492 1383 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882J1 protein_id gnl|my_center|LOCUS_12420 3697 2543 gene locus_tag LOCUS_12430 3697 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 5137 3782 gene locus_tag LOCUS_12440 5137 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 7020 5482 gene locus_tag LOCUS_12450 7020 5482 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_12450 8123 7098 gene locus_tag LOCUS_12460 8123 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 8273 9640 gene locus_tag LOCUS_12470 8273 9640 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122935.1 protein_id gnl|my_center|LOCUS_12470 10152 12146 gene locus_tag LOCUS_12480 10152 12146 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_12480 12306 13628 gene locus_tag LOCUS_12490 12306 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 13727 14740 gene locus_tag LOCUS_12500 gene nifR 13727 14740 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ25 protein_id gnl|my_center|LOCUS_12500 15731 14808 gene locus_tag LOCUS_12510 15731 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence073 378 770 gene locus_tag LOCUS_12520 378 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 767 1993 gene locus_tag LOCUS_12530 767 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2086 2961 gene locus_tag LOCUS_12540 gene ggpP 2086 2961 CDS product geranylgeranyl pyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_12540 3138 3386 gene locus_tag LOCUS_12550 3138 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3383 5311 gene locus_tag LOCUS_12560 gene dxs 3383 5311 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB7 protein_id gnl|my_center|LOCUS_12560 6255 5560 gene locus_tag LOCUS_12570 6255 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8159 6300 gene locus_tag LOCUS_12580 8159 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 10433 8523 gene locus_tag LOCUS_12590 10433 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11251 10649 gene locus_tag LOCUS_12600 11251 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 11789 12013 gene locus_tag LOCUS_12610 gene acpP 11789 12013 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67611 protein_id gnl|my_center|LOCUS_12610 12129 13391 gene locus_tag LOCUS_12620 gene fabF 12129 13391 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY0 protein_id gnl|my_center|LOCUS_12620 13493 14770 gene locus_tag LOCUS_12630 13493 14770 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_12630 14866 15231 gene locus_tag LOCUS_12640 14866 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 15361 15984 gene locus_tag LOCUS_12650 15361 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence074 <1 1255 gene locus_tag LOCUS_12660 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932456.1:NADH-quinone oxidoreductase subunit L 1384 2979 gene locus_tag LOCUS_12670 gene ndhD 1384 2979 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_12670 2976 4556 gene locus_tag LOCUS_12680 2976 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 4597 5376 gene locus_tag LOCUS_12690 4597 5376 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259435.1 protein_id gnl|my_center|LOCUS_12690 5698 5949 gene locus_tag LOCUS_12700 5698 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 6092 6955 gene locus_tag LOCUS_12710 gene whiG 6092 6955 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFV6 protein_id gnl|my_center|LOCUS_12710 7098 7595 gene locus_tag LOCUS_12720 gene fabZ 7098 7595 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121271.1 protein_id gnl|my_center|LOCUS_12720 7722 8471 gene locus_tag LOCUS_12730 7722 8471 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_12730 8759 9148 gene locus_tag LOCUS_12740 gene acpP 8759 9148 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP48 protein_id gnl|my_center|LOCUS_12740 9261 9752 gene locus_tag LOCUS_12750 9261 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 9890 11197 gene locus_tag LOCUS_12760 gene fabF 9890 11197 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ1 protein_id gnl|my_center|LOCUS_12760 11255 12250 gene locus_tag LOCUS_12770 11255 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 12309 12782 gene locus_tag LOCUS_12780 12309 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 12849 14357 gene locus_tag LOCUS_12790 12849 14357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120502.1 protein_id gnl|my_center|LOCUS_12790 15427 14384 gene locus_tag LOCUS_12800 15427 14384 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence075 649 56 gene locus_tag LOCUS_12810 gene def 649 56 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ5 protein_id gnl|my_center|LOCUS_12810 2070 904 gene locus_tag LOCUS_12820 2070 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3178 2198 gene locus_tag LOCUS_12830 3178 2198 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939731.1 protein_id gnl|my_center|LOCUS_12830 5331 3346 gene locus_tag LOCUS_12840 5331 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 6954 5554 gene locus_tag LOCUS_12850 6954 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_12850 8603 7002 gene locus_tag LOCUS_12860 8603 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 9622 8753 gene locus_tag LOCUS_12870 9622 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 10418 9825 gene locus_tag LOCUS_12880 10418 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10467 11378 gene locus_tag LOCUS_12890 10467 11378 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_12890 11459 12067 gene locus_tag LOCUS_12900 11459 12067 CDS product fructose 2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812049.1 protein_id gnl|my_center|LOCUS_12900 13492 12170 gene locus_tag LOCUS_12910 13492 12170 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_12910 14503 13583 gene locus_tag LOCUS_12920 14503 13583 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_12920 14762 15010 gene locus_tag LOCUS_12930 14762 15010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12930 >Feature sequence076 670 2418 gene locus_tag LOCUS_12940 670 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3406 2390 gene locus_tag LOCUS_12950 3406 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 3750 3496 gene locus_tag LOCUS_12960 3750 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 6056 3900 gene locus_tag LOCUS_12970 6056 3900 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119431.1 protein_id gnl|my_center|LOCUS_12970 6386 6814 gene locus_tag LOCUS_12980 6386 6814 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_12980 7373 8164 gene locus_tag LOCUS_12990 7373 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 8238 8534 gene locus_tag LOCUS_13000 8238 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 8534 8941 gene locus_tag LOCUS_13010 8534 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 9402 10328 gene locus_tag LOCUS_13020 9402 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 10426 10899 gene locus_tag LOCUS_13030 10426 10899 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_13030 10998 11483 gene locus_tag LOCUS_13040 10998 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 11714 12715 gene locus_tag LOCUS_13050 11714 12715 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMF2 protein_id gnl|my_center|LOCUS_13050 12817 13593 gene locus_tag LOCUS_13060 gene proC 12817 13593 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK62 protein_id gnl|my_center|LOCUS_13060 >Feature sequence077 1484 2386 gene locus_tag LOCUS_13070 gene mtsA 1484 2386 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123738.1 protein_id gnl|my_center|LOCUS_13070 3937 2450 gene locus_tag LOCUS_13080 gene rho 3937 2450 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGV0 protein_id gnl|my_center|LOCUS_13080 4900 4205 gene locus_tag LOCUS_13090 gene coaE 4900 4205 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58897 protein_id gnl|my_center|LOCUS_13090 6019 5144 gene locus_tag LOCUS_13100 gene sgaU 6019 5144 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_13100 6153 6317 gene locus_tag LOCUS_13110 6153 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6417 7184 gene locus_tag LOCUS_13120 6417 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_13120 8067 7240 gene locus_tag LOCUS_13130 8067 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8351 8839 gene locus_tag LOCUS_13140 8351 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9823 8921 gene locus_tag LOCUS_13150 9823 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 protein_id gnl|my_center|LOCUS_13150 11723 10149 gene locus_tag LOCUS_13160 11723 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 13476 12142 gene locus_tag LOCUS_13170 13476 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 14475 13663 gene locus_tag LOCUS_13180 14475 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_13180 14587 15357 gene locus_tag LOCUS_13190 gene mntA 14587 15357 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence078 3080 3379 gene locus_tag LOCUS_13200 3080 3379 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_13200 3855 3430 gene locus_tag LOCUS_13210 3855 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 5117 3879 gene locus_tag LOCUS_13220 5117 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 5605 5114 gene locus_tag LOCUS_13230 5605 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6330 5668 gene locus_tag LOCUS_13240 6330 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7308 6421 gene locus_tag LOCUS_13250 7308 6421 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_13250 7546 8739 gene locus_tag LOCUS_13260 7546 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 8950 9735 gene locus_tag LOCUS_13270 8950 9735 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence079 1189 320 gene locus_tag LOCUS_13280 gene folD 1189 320 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNN9 protein_id gnl|my_center|LOCUS_13280 1355 2977 gene locus_tag LOCUS_13290 1355 2977 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_13290 4434 3016 gene locus_tag LOCUS_13300 4434 3016 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG53 protein_id gnl|my_center|LOCUS_13300 4512 6110 gene locus_tag LOCUS_13310 4512 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 9326 6129 gene locus_tag LOCUS_13320 9326 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10401 9391 gene locus_tag LOCUS_13330 10401 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 10615 12021 gene locus_tag LOCUS_13340 10615 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 12188 13171 gene locus_tag LOCUS_13350 12188 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 13269 13574 gene locus_tag LOCUS_13360 13269 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 <15444 13655 gene locus_tag LOCUS_13370 <15444 13655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIA9:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence080 1116 430 gene locus_tag LOCUS_13380 1116 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13380 1467 8492 gene locus_tag LOCUS_13390 gene uvrA 1467 8492 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV4 protein_id gnl|my_center|LOCUS_13390 8634 9839 gene locus_tag LOCUS_13400 8634 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 10526 10221 gene locus_tag LOCUS_13410 10526 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence081 626 4327 gene locus_tag LOCUS_13420 626 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5017 8265 gene locus_tag LOCUS_13430 5017 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8713 9585 gene locus_tag LOCUS_13440 8713 9585 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967177.1 protein_id gnl|my_center|LOCUS_13440 9854 10960 gene locus_tag LOCUS_13450 9854 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 11453 11103 gene locus_tag LOCUS_13460 11453 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 11566 11913 gene locus_tag LOCUS_13470 11566 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 12303 11956 gene locus_tag LOCUS_13480 12303 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 12713 14875 gene locus_tag LOCUS_13490 12713 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence082 371 1258 gene locus_tag LOCUS_13500 371 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1413 2489 gene locus_tag LOCUS_13510 1413 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3960 2551 gene locus_tag LOCUS_13520 3960 2551 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119875.1 protein_id gnl|my_center|LOCUS_13520 6050 4362 gene locus_tag LOCUS_13530 6050 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119876.1 protein_id gnl|my_center|LOCUS_13530 7237 6080 gene locus_tag LOCUS_13540 7237 6080 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119877.1 protein_id gnl|my_center|LOCUS_13540 8675 7407 gene locus_tag LOCUS_13550 8675 7407 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921026.1 protein_id gnl|my_center|LOCUS_13550 8718 9851 gene locus_tag LOCUS_13560 gene purM 8718 9851 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI59 protein_id gnl|my_center|LOCUS_13560 10895 10185 gene locus_tag LOCUS_13570 10895 10185 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I730 protein_id gnl|my_center|LOCUS_13570 11984 11103 gene locus_tag LOCUS_13580 11984 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 13487 12081 gene locus_tag LOCUS_13590 gene sun 13487 12081 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES9 protein_id gnl|my_center|LOCUS_13590 <15094 13847 gene locus_tag LOCUS_13600 <15094 13847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UW43:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence083 <1 4250 gene locus_tag LOCUS_13610 <1 4250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105890.1:RTX toxin 5747 4299 gene locus_tag LOCUS_13620 5747 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 6028 8892 gene locus_tag LOCUS_13630 6028 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 9577 12129 gene locus_tag LOCUS_13640 gene epsB 9577 12129 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118858.1 protein_id gnl|my_center|LOCUS_13640 13144 12203 gene locus_tag LOCUS_13650 13144 12203 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_13650 13806 13141 gene locus_tag LOCUS_13660 13806 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 <15032 13806 gene locus_tag LOCUS_13670 <15032 13806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544567.1:glycosyl transferase >Feature sequence084 1763 750 gene locus_tag LOCUS_13680 1763 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2974 1820 gene locus_tag LOCUS_13690 2974 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3284 6412 gene locus_tag LOCUS_13700 3284 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6618 6418 gene locus_tag LOCUS_13710 6618 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 6556 7245 gene locus_tag LOCUS_13720 6556 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 7524 7598 gene locus_tag LOCUS_t00150 7524 7598 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8354 7665 gene locus_tag LOCUS_13730 8354 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9492 8656 gene locus_tag LOCUS_13740 9492 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_13740 10200 9619 gene locus_tag LOCUS_13750 gene trpG 10200 9619 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120844.1 protein_id gnl|my_center|LOCUS_13750 10350 12518 gene locus_tag LOCUS_13760 gene recG 10350 12518 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118187.1 protein_id gnl|my_center|LOCUS_13760 12849 12592 gene locus_tag LOCUS_13770 12849 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13990 12920 gene locus_tag LOCUS_13780 gene flgI 13990 12920 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67608 protein_id gnl|my_center|LOCUS_13780 14925 14089 gene locus_tag LOCUS_13790 14925 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence085 3039 643 gene locus_tag LOCUS_13800 3039 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120740.1 protein_id gnl|my_center|LOCUS_13800 3492 3411 gene locus_tag LOCUS_t00160 3492 3411 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3634 4455 gene locus_tag LOCUS_13810 3634 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5392 4709 gene locus_tag LOCUS_13820 gene plsY 5392 4709 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60926 protein_id gnl|my_center|LOCUS_13820 6723 5593 gene locus_tag LOCUS_13830 gene dnaN 6723 5593 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKK1 protein_id gnl|my_center|LOCUS_13830 6877 7788 gene locus_tag LOCUS_13840 6877 7788 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_13840 7975 10749 gene locus_tag LOCUS_13850 7975 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 10755 11378 gene locus_tag LOCUS_13860 10755 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 11651 13267 gene locus_tag LOCUS_13870 11651 13267 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_13870 13353 13919 gene locus_tag LOCUS_13880 13353 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence086 1600 170 gene locus_tag LOCUS_13890 gene purB 1600 170 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFU0 protein_id gnl|my_center|LOCUS_13890 1743 2798 gene locus_tag LOCUS_13900 gene tal 1743 2798 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUN2 protein_id gnl|my_center|LOCUS_13900 2826 3227 gene locus_tag LOCUS_13910 2826 3227 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_13910 3620 5497 gene locus_tag LOCUS_13920 gene rpsA 3620 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 protein_id gnl|my_center|LOCUS_13920 5596 7023 gene locus_tag LOCUS_13930 5596 7023 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_13930 7231 7157 gene locus_tag LOCUS_t00170 7231 7157 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7340 9748 gene locus_tag LOCUS_13940 7340 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10738 9833 gene locus_tag LOCUS_13950 10738 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_13950 11880 10789 gene locus_tag LOCUS_13960 gene moxR 11880 10789 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_13960 12162 14483 gene locus_tag LOCUS_13970 12162 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence087 <1 4941 gene locus_tag LOCUS_13980 <1 4941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001001535.1:membrane protein 6452 5028 gene locus_tag LOCUS_13990 gene miaB 6452 5028 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULM9 protein_id gnl|my_center|LOCUS_13990 6674 6474 gene locus_tag LOCUS_14000 6674 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7712 6723 gene locus_tag LOCUS_14010 7712 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 8480 7911 gene locus_tag LOCUS_14020 gene efp 8480 7911 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN7 protein_id gnl|my_center|LOCUS_14020 8623 9627 gene locus_tag LOCUS_14030 8623 9627 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 protein_id gnl|my_center|LOCUS_14030 10616 9684 gene locus_tag LOCUS_14040 10616 9684 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_14040 11931 10882 gene locus_tag LOCUS_14050 gene aguA 11931 10882 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J9 protein_id gnl|my_center|LOCUS_14050 12201 11989 gene locus_tag LOCUS_14060 12201 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 12463 12233 gene locus_tag LOCUS_14070 12463 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 13543 12587 gene locus_tag LOCUS_14080 13543 12587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence088 430 128 gene locus_tag LOCUS_14090 430 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 514 1986 gene locus_tag LOCUS_14100 514 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 5317 1997 gene locus_tag LOCUS_14110 5317 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 7112 5565 gene locus_tag LOCUS_14120 7112 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7358 7687 gene locus_tag LOCUS_14130 7358 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 8557 7724 gene locus_tag LOCUS_14140 8557 7724 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_14140 9823 8708 gene locus_tag LOCUS_14150 9823 8708 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_14150 10423 9875 gene locus_tag LOCUS_14160 gene bcp 10423 9875 CDS product putative peroxiredoxin bcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CY8 protein_id gnl|my_center|LOCUS_14160 11426 10566 gene locus_tag LOCUS_14170 11426 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 13224 11509 gene locus_tag LOCUS_14180 gene sigA 13224 11509 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQG1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence089 1171 452 gene locus_tag LOCUS_14190 gene queC 1171 452 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_14190 1769 1161 gene locus_tag LOCUS_14200 1769 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2860 1766 gene locus_tag LOCUS_14210 gene pucA 2860 1766 CDS product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 protein_id gnl|my_center|LOCUS_14210 5196 2887 gene locus_tag LOCUS_14220 5196 2887 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975269.1 protein_id gnl|my_center|LOCUS_14220 6278 5238 gene locus_tag LOCUS_14230 6278 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706538.1 protein_id gnl|my_center|LOCUS_14230 7015 6275 gene locus_tag LOCUS_14240 7015 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 7263 7568 gene locus_tag LOCUS_14250 7263 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 7741 10302 gene locus_tag LOCUS_14260 7741 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 10340 11092 gene locus_tag LOCUS_14270 gene recO 10340 11092 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USC2 protein_id gnl|my_center|LOCUS_14270 11203 12816 gene locus_tag LOCUS_14280 11203 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 12923 13426 gene locus_tag LOCUS_14290 12923 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119987.1 protein_id gnl|my_center|LOCUS_14290 13682 14080 gene locus_tag LOCUS_14300 13682 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence090 5788 4625 gene locus_tag LOCUS_14310 5788 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 6651 5887 gene locus_tag LOCUS_14320 6651 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 7718 6750 gene locus_tag LOCUS_14330 7718 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 8752 7895 gene locus_tag LOCUS_14340 8752 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 10722 8749 gene locus_tag LOCUS_14350 10722 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 11629 10799 gene locus_tag LOCUS_14360 11629 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 11991 11713 gene locus_tag LOCUS_14370 11991 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 12765 12139 gene locus_tag LOCUS_14380 12765 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 14399 12855 gene locus_tag LOCUS_14390 14399 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence091 1786 362 gene locus_tag LOCUS_14400 gene argH 1786 362 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK64 protein_id gnl|my_center|LOCUS_14400 2236 3018 gene locus_tag LOCUS_14410 2236 3018 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023583.1 protein_id gnl|my_center|LOCUS_14410 3327 4289 gene locus_tag LOCUS_14420 3327 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4730 6433 gene locus_tag LOCUS_14430 4730 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6612 7862 gene locus_tag LOCUS_14440 6612 7862 CDS product spore coat protein CotZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123821.1 protein_id gnl|my_center|LOCUS_14440 8179 10431 gene locus_tag LOCUS_14450 8179 10431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 10428 11753 gene locus_tag LOCUS_14460 10428 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 11825 13159 gene locus_tag LOCUS_14470 11825 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence092 1607 741 gene locus_tag LOCUS_14480 1607 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1874 4042 gene locus_tag LOCUS_14490 1874 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 5814 4207 gene locus_tag LOCUS_14500 5814 4207 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_14500 6403 6726 gene locus_tag LOCUS_14510 6403 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6947 7213 gene locus_tag LOCUS_14520 6947 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 8637 7306 gene locus_tag LOCUS_14530 gene rpoA 8637 7306 CDS product RNA polymerase subunit alpha domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328259.1 protein_id gnl|my_center|LOCUS_14530 8879 8808 gene locus_tag LOCUS_t00180 8879 8808 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9407 9192 gene locus_tag LOCUS_14540 gene csrA 9407 9192 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_14540 10895 9996 gene locus_tag LOCUS_14550 10895 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_14550 11147 12469 gene locus_tag LOCUS_14560 11147 12469 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_14560 13240 12737 gene locus_tag LOCUS_14570 13240 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence093 <1 908 gene locus_tag LOCUS_14580 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122968.1:oxidoreductase 889 1179 gene locus_tag LOCUS_14590 889 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1960 1208 gene locus_tag LOCUS_14600 1960 1208 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256385.1 protein_id gnl|my_center|LOCUS_14600 2963 1953 gene locus_tag LOCUS_14610 2963 1953 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118940.1 protein_id gnl|my_center|LOCUS_14610 4369 3038 gene locus_tag LOCUS_14620 4369 3038 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355117.1 protein_id gnl|my_center|LOCUS_14620 4540 5025 gene locus_tag LOCUS_14630 4540 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5299 5754 gene locus_tag LOCUS_14640 5299 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 5993 7783 gene locus_tag LOCUS_14650 5993 7783 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118918.1 protein_id gnl|my_center|LOCUS_14650 7991 8329 gene locus_tag LOCUS_14660 7991 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 8815 9624 gene locus_tag LOCUS_14670 gene rpoS 8815 9624 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTR4 protein_id gnl|my_center|LOCUS_14670 9731 10087 gene locus_tag LOCUS_14680 9731 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10210 10719 gene locus_tag LOCUS_14690 10210 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 10795 10868 gene locus_tag LOCUS_t00190 10795 10868 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10920 11828 gene locus_tag LOCUS_14700 10920 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 11871 12827 gene locus_tag LOCUS_14710 11871 12827 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_14710 13884 12934 gene locus_tag LOCUS_14720 13884 12934 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118295.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence094 1744 1274 gene locus_tag LOCUS_14730 1744 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2329 1757 gene locus_tag LOCUS_14740 2329 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2895 2374 gene locus_tag LOCUS_14750 2895 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3070 2912 gene locus_tag LOCUS_14760 3070 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3367 3125 gene locus_tag LOCUS_14770 3367 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3814 3509 gene locus_tag LOCUS_14780 3814 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4080 5273 gene locus_tag LOCUS_14790 4080 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6405 5317 gene locus_tag LOCUS_14800 6405 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6499 7824 gene locus_tag LOCUS_14810 6499 7824 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119074.1 protein_id gnl|my_center|LOCUS_14810 8361 7996 gene locus_tag LOCUS_14820 gene speD 8361 7996 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBG3 protein_id gnl|my_center|LOCUS_14820 10010 8712 gene locus_tag LOCUS_14830 10010 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 10608 11270 gene locus_tag LOCUS_14840 10608 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence095 1898 945 gene locus_tag LOCUS_14850 1898 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3274 3200 gene locus_tag LOCUS_t00200 3274 3200 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4451 3462 gene locus_tag LOCUS_14860 4451 3462 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119033.1 protein_id gnl|my_center|LOCUS_14860 5540 4479 gene locus_tag LOCUS_14870 5540 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 protein_id gnl|my_center|LOCUS_14870 6139 5600 gene locus_tag LOCUS_14880 gene pgpA 6139 5600 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y504 protein_id gnl|my_center|LOCUS_14880 6505 6173 gene locus_tag LOCUS_14890 6505 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 7593 6505 gene locus_tag LOCUS_14900 7593 6505 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_14900 7813 8196 gene locus_tag LOCUS_14910 7813 8196 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 protein_id gnl|my_center|LOCUS_14910 8416 10419 gene locus_tag LOCUS_14920 gene sir 8416 10419 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121401.1 protein_id gnl|my_center|LOCUS_14920 11103 10519 gene locus_tag LOCUS_14930 11103 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 12722 11271 gene locus_tag LOCUS_14940 12722 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 12953 13864 gene locus_tag LOCUS_14950 12953 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence096 1220 567 gene locus_tag LOCUS_14960 gene sigW 1220 567 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118528.1 protein_id gnl|my_center|LOCUS_14960 1497 1261 gene locus_tag LOCUS_14970 1497 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2785 1667 gene locus_tag LOCUS_14980 gene queA 2785 1667 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGI9 protein_id gnl|my_center|LOCUS_14980 2860 4023 gene locus_tag LOCUS_14990 2860 4023 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122846.1 protein_id gnl|my_center|LOCUS_14990 4486 5391 gene locus_tag LOCUS_15000 gene rsmH 4486 5391 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFX8 protein_id gnl|my_center|LOCUS_15000 5451 7145 gene locus_tag LOCUS_15010 5451 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8121 7090 gene locus_tag LOCUS_15020 8121 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 8349 9059 gene locus_tag LOCUS_15030 gene surE 8349 9059 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT6 protein_id gnl|my_center|LOCUS_15030 9166 9600 gene locus_tag LOCUS_15040 9166 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 9628 11019 gene locus_tag LOCUS_15050 gene purD 9628 11019 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPZ8 protein_id gnl|my_center|LOCUS_15050 11090 13384 gene locus_tag LOCUS_15060 11090 13384 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118596.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence097 1240 2967 gene locus_tag LOCUS_15070 gene ilvD 1240 2967 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ69 protein_id gnl|my_center|LOCUS_15070 3397 3008 gene locus_tag LOCUS_15080 3397 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3813 3418 gene locus_tag LOCUS_15090 3813 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5029 3875 gene locus_tag LOCUS_15100 5029 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 5337 6353 gene locus_tag LOCUS_15110 5337 6353 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_15110 6772 6587 gene locus_tag LOCUS_15120 6772 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 7272 7799 gene locus_tag LOCUS_15130 7272 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 7832 8338 gene locus_tag LOCUS_15140 7832 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 9136 8342 gene locus_tag LOCUS_15150 9136 8342 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070499.1 protein_id gnl|my_center|LOCUS_15150 9760 9191 gene locus_tag LOCUS_15160 gene ilvH 9760 9191 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_15160 9853 10491 gene locus_tag LOCUS_15170 9853 10491 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368969.1 protein_id gnl|my_center|LOCUS_15170 10693 12090 gene locus_tag LOCUS_15180 10693 12090 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119007.1 protein_id gnl|my_center|LOCUS_15180 12347 12970 gene locus_tag LOCUS_15190 gene lexA 12347 12970 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2R7 protein_id gnl|my_center|LOCUS_15190 <13966 13385 gene locus_tag LOCUS_15200 <13966 13385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228823.1:peptidase M24 >Feature sequence098 736 2553 gene locus_tag LOCUS_15210 736 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3911 2955 gene locus_tag LOCUS_15220 3911 2955 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8G2 protein_id gnl|my_center|LOCUS_15220 4985 3996 gene locus_tag LOCUS_15230 4985 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 6283 5063 gene locus_tag LOCUS_15240 6283 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15240 7318 6347 gene locus_tag LOCUS_15250 7318 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 7621 8394 gene locus_tag LOCUS_15260 7621 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 10052 8478 gene locus_tag LOCUS_15270 10052 8478 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637764.2 protein_id gnl|my_center|LOCUS_15270 11027 10398 gene locus_tag LOCUS_15280 11027 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 11589 11191 gene locus_tag LOCUS_15290 11589 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 11991 12839 gene locus_tag LOCUS_15300 11991 12839 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence099 2671 4077 gene locus_tag LOCUS_15310 2671 4077 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_15310 5258 4269 gene locus_tag LOCUS_15320 5258 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 7555 6140 gene locus_tag LOCUS_15330 7555 6140 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118348.1 protein_id gnl|my_center|LOCUS_15330 7927 7631 gene locus_tag LOCUS_15340 7927 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 8347 9165 gene locus_tag LOCUS_15350 8347 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 9309 9722 gene locus_tag LOCUS_15360 gene exbD 9309 9722 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 protein_id gnl|my_center|LOCUS_15360 10851 9907 gene locus_tag LOCUS_15370 10851 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 11991 10927 gene locus_tag LOCUS_15380 11991 10927 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_15380 12212 12844 gene locus_tag LOCUS_15390 12212 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence100 617 2479 gene locus_tag LOCUS_15400 gene secA 617 2479 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117764.1 protein_id gnl|my_center|LOCUS_15400 2485 3294 gene locus_tag LOCUS_15410 2485 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3330 4784 gene locus_tag LOCUS_15420 3330 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4905 7052 gene locus_tag LOCUS_15430 4905 7052 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 protein_id gnl|my_center|LOCUS_15430 7261 8799 gene locus_tag LOCUS_15440 7261 8799 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120439.1 protein_id gnl|my_center|LOCUS_15440 12000 8821 gene locus_tag LOCUS_15450 gene czcA 12000 8821 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_15450 13277 11997 gene locus_tag LOCUS_15460 13277 11997 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence101 1596 3149 gene locus_tag LOCUS_15470 gene nusA 1596 3149 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URQ7 protein_id gnl|my_center|LOCUS_15470 3364 6423 gene locus_tag LOCUS_15480 3364 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 6473 7084 gene locus_tag LOCUS_15490 6473 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7395 8312 gene locus_tag LOCUS_15500 7395 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15500 8596 10950 gene locus_tag LOCUS_15510 8596 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 11071 11820 gene locus_tag LOCUS_15520 11071 11820 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA54 protein_id gnl|my_center|LOCUS_15520 11900 12964 gene locus_tag LOCUS_15530 11900 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121463.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence102 1925 1215 gene locus_tag LOCUS_15540 1925 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3458 2010 gene locus_tag LOCUS_15550 gene asnS 3458 2010 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG51 protein_id gnl|my_center|LOCUS_15550 6440 3762 gene locus_tag LOCUS_15560 6440 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 6870 10283 gene locus_tag LOCUS_15570 6870 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 12440 10371 gene locus_tag LOCUS_15580 12440 10371 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887490.1 protein_id gnl|my_center|LOCUS_15580 12587 13312 gene locus_tag LOCUS_15590 12587 13312 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence103 2228 624 gene locus_tag LOCUS_15600 2228 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2597 2268 gene locus_tag LOCUS_15610 2597 2268 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP7 protein_id gnl|my_center|LOCUS_15610 2899 2582 gene locus_tag LOCUS_15620 2899 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3169 2960 gene locus_tag LOCUS_15630 3169 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3634 6819 gene locus_tag LOCUS_15640 3634 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 6944 8122 gene locus_tag LOCUS_15650 6944 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 8441 8181 gene locus_tag LOCUS_15660 8441 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 9581 8583 gene locus_tag LOCUS_15670 gene yeaC 9581 8583 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_15670 9814 9578 gene locus_tag LOCUS_15680 9814 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 11486 9843 gene locus_tag LOCUS_15690 11486 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 12545 12141 gene locus_tag LOCUS_15700 12545 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 <13638 13043 gene locus_tag LOCUS_15710 <13638 13043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056158.1:isocitrate dehydrogenase >Feature sequence104 <1 1767 gene locus_tag LOCUS_15720 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121080.1:ATP-dependent Clp protease ATP-binding protein 2017 3237 gene locus_tag LOCUS_15730 2017 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3491 5833 gene locus_tag LOCUS_15740 3491 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6042 6257 gene locus_tag LOCUS_15750 6042 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 6866 6321 gene locus_tag LOCUS_15760 6866 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8305 6863 gene locus_tag LOCUS_15770 8305 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8630 10120 gene locus_tag LOCUS_15780 8630 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 10215 11981 gene locus_tag LOCUS_15790 10215 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 12055 13329 gene locus_tag LOCUS_15800 gene cinA 12055 13329 CDS product damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117966.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence105 1738 284 gene locus_tag LOCUS_15810 gene leuC 1738 284 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF0 protein_id gnl|my_center|LOCUS_15810 1916 2674 gene locus_tag LOCUS_15820 1916 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4180 2741 gene locus_tag LOCUS_15830 4180 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5282 4311 gene locus_tag LOCUS_15840 gene pstS 5282 4311 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_15840 5621 6256 gene locus_tag LOCUS_15850 gene pduO 5621 6256 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_15850 6342 8216 gene locus_tag LOCUS_15860 6342 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 9959 8301 gene locus_tag LOCUS_15870 9959 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 10330 11328 gene locus_tag LOCUS_15880 10330 11328 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123324.1 protein_id gnl|my_center|LOCUS_15880 11338 12510 gene locus_tag LOCUS_15890 11338 12510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123325.1 protein_id gnl|my_center|LOCUS_15890 12548 12955 gene locus_tag LOCUS_15900 12548 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence106 113 433 gene locus_tag LOCUS_15910 113 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1494 613 gene locus_tag LOCUS_15920 1494 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1769 3589 gene locus_tag LOCUS_15930 1769 3589 CDS product oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 protein_id gnl|my_center|LOCUS_15930 4389 3751 gene locus_tag LOCUS_15940 4389 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 4680 5030 gene locus_tag LOCUS_15950 4680 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 5407 6552 gene locus_tag LOCUS_15960 5407 6552 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_15960 7707 6631 gene locus_tag LOCUS_15970 gene recA 7707 6631 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJJ0 protein_id gnl|my_center|LOCUS_15970 9037 8144 gene locus_tag LOCUS_15980 9037 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 9585 9034 gene locus_tag LOCUS_15990 9585 9034 CDS product adenylyl cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120856.1 protein_id gnl|my_center|LOCUS_15990 11146 9665 gene locus_tag LOCUS_16000 11146 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 12856 11396 gene locus_tag LOCUS_16010 12856 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence107 <1 3488 gene locus_tag LOCUS_16020 <1 3488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105494.1:ATP-dependent helicase 4130 5401 gene locus_tag LOCUS_16030 4130 5401 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_16030 6273 5467 gene locus_tag LOCUS_16040 gene mutM 6273 5467 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123886.1 protein_id gnl|my_center|LOCUS_16040 6860 6318 gene locus_tag LOCUS_16050 6860 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7410 6946 gene locus_tag LOCUS_16060 7410 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_16060 8366 7407 gene locus_tag LOCUS_16070 8366 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 9025 9381 gene locus_tag LOCUS_16080 9025 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 9498 9944 gene locus_tag LOCUS_16090 9498 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 10142 10215 gene locus_tag LOCUS_t00210 10142 10215 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10303 11199 gene locus_tag LOCUS_16100 gene yfbL 10303 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76482 protein_id gnl|my_center|LOCUS_16100 11220 12683 gene locus_tag LOCUS_16110 11220 12683 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence108 1986 3284 gene locus_tag LOCUS_16120 1986 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3603 6077 gene locus_tag LOCUS_16130 gene uvrA 3603 6077 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK42 protein_id gnl|my_center|LOCUS_16130 6800 6228 gene locus_tag LOCUS_16140 6800 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946524.1 protein_id gnl|my_center|LOCUS_16140 8156 7008 gene locus_tag LOCUS_16150 8156 7008 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899005.1 protein_id gnl|my_center|LOCUS_16150 9738 8284 gene locus_tag LOCUS_16160 9738 8284 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529019.1 protein_id gnl|my_center|LOCUS_16160 12702 10306 gene locus_tag LOCUS_16170 12702 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence109 <1 641 gene locus_tag LOCUS_16180 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UK67:ATP-dependent Clp protease proteolytic subunit 1 753 1352 gene locus_tag LOCUS_16190 gene clpP2 753 1352 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK66 protein_id gnl|my_center|LOCUS_16190 1501 2358 gene locus_tag LOCUS_16200 1501 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2706 2383 gene locus_tag LOCUS_16210 2706 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3621 2788 gene locus_tag LOCUS_16220 3621 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3749 5269 gene locus_tag LOCUS_16230 3749 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5778 7052 gene locus_tag LOCUS_16240 gene rhlE 5778 7052 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948368.1 protein_id gnl|my_center|LOCUS_16240 7049 7702 gene locus_tag LOCUS_16250 7049 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 9502 7814 gene locus_tag LOCUS_16260 9502 7814 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_16260 10322 9951 gene locus_tag LOCUS_16270 10322 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 10279 12000 gene locus_tag LOCUS_16280 gene pilB 10279 12000 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123899.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence110 <1 1266 gene locus_tag LOCUS_16290 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118996.1:iduronate-2-sulfatase 1420 2559 gene locus_tag LOCUS_16300 1420 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3237 2599 gene locus_tag LOCUS_16310 3237 2599 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118390.1 protein_id gnl|my_center|LOCUS_16310 3347 4372 gene locus_tag LOCUS_16320 gene pdxA 3347 4372 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8D3 protein_id gnl|my_center|LOCUS_16320 5943 4465 gene locus_tag LOCUS_16330 5943 4465 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_16330 6560 6072 gene locus_tag LOCUS_16340 6560 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 6850 6569 gene locus_tag LOCUS_16350 6850 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 7432 6875 gene locus_tag LOCUS_16360 7432 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 8073 7435 gene locus_tag LOCUS_16370 8073 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 9320 8070 gene locus_tag LOCUS_16380 9320 8070 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121595.1 protein_id gnl|my_center|LOCUS_16380 9563 10873 gene locus_tag LOCUS_16390 gene phoD 9563 10873 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence111 326 589 gene locus_tag LOCUS_16400 326 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1233 550 gene locus_tag LOCUS_16410 1233 550 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123490.1 protein_id gnl|my_center|LOCUS_16410 1808 1467 gene locus_tag LOCUS_16420 1808 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1927 2502 gene locus_tag LOCUS_16430 gene ppa 1927 2502 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S122 protein_id gnl|my_center|LOCUS_16430 3530 2568 gene locus_tag LOCUS_16440 3530 2568 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943043.1 protein_id gnl|my_center|LOCUS_16440 4963 3716 gene locus_tag LOCUS_16450 4963 3716 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119341.1 protein_id gnl|my_center|LOCUS_16450 6649 5420 gene locus_tag LOCUS_16460 6649 5420 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121130.1 protein_id gnl|my_center|LOCUS_16460 7301 7107 gene locus_tag LOCUS_16470 7301 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 7880 11056 gene locus_tag LOCUS_16480 7880 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 11139 11960 gene locus_tag LOCUS_16490 gene mtdA 11139 11960 CDS product MtdA bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_16490 12041 12925 gene locus_tag LOCUS_16500 12041 12925 CDS product iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence112 297 1334 gene locus_tag LOCUS_16510 297 1334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_16510 1500 1823 gene locus_tag LOCUS_16520 1500 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1823 3511 gene locus_tag LOCUS_16530 1823 3511 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_16530 3739 4215 gene locus_tag LOCUS_16540 3739 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4738 6012 gene locus_tag LOCUS_16550 gene clpX 4738 6012 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU7 protein_id gnl|my_center|LOCUS_16550 6339 6758 gene locus_tag LOCUS_16560 6339 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 8903 6798 gene locus_tag LOCUS_16570 8903 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 10281 8896 gene locus_tag LOCUS_16580 10281 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545573.1 protein_id gnl|my_center|LOCUS_16580 11627 10338 gene locus_tag LOCUS_16590 11627 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122879.1 protein_id gnl|my_center|LOCUS_16590 11912 12532 gene locus_tag LOCUS_16600 11912 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence113 656 2014 gene locus_tag LOCUS_16610 656 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2385 2095 gene locus_tag LOCUS_16620 2385 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2718 5480 gene locus_tag LOCUS_16630 gene gyrA 2718 5480 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMG7 protein_id gnl|my_center|LOCUS_16630 6027 7115 gene locus_tag LOCUS_16640 6027 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 7871 7365 gene locus_tag LOCUS_16650 7871 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 8426 9478 gene locus_tag LOCUS_16660 gene rfbB 8426 9478 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CB9 protein_id gnl|my_center|LOCUS_16660 9660 11003 gene locus_tag LOCUS_16670 gene ugd 9660 11003 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence114 <1 2960 gene locus_tag LOCUS_16680 <1 2960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URW4:DNA-directed RNA polymerase subunit beta' 3529 6693 gene locus_tag LOCUS_16690 3529 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 6878 8551 gene locus_tag LOCUS_16700 6878 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 8843 10135 gene locus_tag LOCUS_16710 8843 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 11330 10149 gene locus_tag LOCUS_16720 11330 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119379.1 protein_id gnl|my_center|LOCUS_16720 11481 12431 gene locus_tag LOCUS_16730 gene uxs 11481 12431 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence115 102 1229 gene locus_tag LOCUS_16740 102 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1264 2247 gene locus_tag LOCUS_16750 1264 2247 CDS product lipolytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120391.1 protein_id gnl|my_center|LOCUS_16750 2302 2375 gene locus_tag LOCUS_t00220 2302 2375 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3966 2401 gene locus_tag LOCUS_16760 3966 2401 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970696.1 protein_id gnl|my_center|LOCUS_16760 5216 4101 gene locus_tag LOCUS_16770 5216 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 7552 5213 gene locus_tag LOCUS_16780 7552 5213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_16780 11379 7549 gene locus_tag LOCUS_16790 11379 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 protein_id gnl|my_center|LOCUS_16790 <12784 11453 gene locus_tag LOCUS_16800 <12784 11453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121743.1:inter-alpha-trypsin inhibitor heavy chain H2 [precursor] >Feature sequence116 153 2021 gene locus_tag LOCUS_16810 153 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_16810 2142 3611 gene locus_tag LOCUS_16820 2142 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_16820 3855 3703 gene locus_tag LOCUS_16830 3855 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 4301 6838 gene locus_tag LOCUS_16840 4301 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6929 8464 gene locus_tag LOCUS_16850 gene gspE 6929 8464 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533498.1 protein_id gnl|my_center|LOCUS_16850 8725 9933 gene locus_tag LOCUS_16860 gene etpF 8725 9933 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173152.1 protein_id gnl|my_center|LOCUS_16860 9920 10372 gene locus_tag LOCUS_16870 9920 10372 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_16870 10369 10821 gene locus_tag LOCUS_16880 10369 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 10850 11248 gene locus_tag LOCUS_16890 10850 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 11245 11799 gene locus_tag LOCUS_16900 11245 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence117 <1 1089 gene locus_tag LOCUS_16910 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073162.1:acriflavin resistance protein 1348 2472 gene locus_tag LOCUS_16920 gene tatC 1348 2472 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFI8 protein_id gnl|my_center|LOCUS_16920 2631 3770 gene locus_tag LOCUS_16930 2631 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_16930 3859 4092 gene locus_tag LOCUS_16940 3859 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4356 5795 gene locus_tag LOCUS_16950 4356 5795 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_16950 5913 6596 gene locus_tag LOCUS_16960 5913 6596 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_16960 8480 6651 gene locus_tag LOCUS_16970 gene glgB 8480 6651 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH1 protein_id gnl|my_center|LOCUS_16970 10892 8922 gene locus_tag LOCUS_16980 10892 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 11503 12468 gene locus_tag LOCUS_16990 11503 12468 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence118 462 1913 gene locus_tag LOCUS_17000 gene atsA 462 1913 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118387.1 protein_id gnl|my_center|LOCUS_17000 2074 3651 gene locus_tag LOCUS_17010 gene arsB 2074 3651 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122841.1 protein_id gnl|my_center|LOCUS_17010 4611 3727 gene locus_tag LOCUS_17020 gene deoD 4611 3727 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_17020 5515 4739 gene locus_tag LOCUS_17030 5515 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 8088 5560 gene locus_tag LOCUS_17040 8088 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 8975 8292 gene locus_tag LOCUS_17050 8975 8292 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_17050 11491 9128 gene locus_tag LOCUS_17060 11491 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 <12554 11811 gene locus_tag LOCUS_17070 <12554 11811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704393.1:hybrid sensor histidine kinase/response regulator >Feature sequence119 3400 311 gene locus_tag LOCUS_17080 3400 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5964 4285 gene locus_tag LOCUS_17090 5964 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 6783 10427 gene locus_tag LOCUS_17100 6783 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 10619 11686 gene locus_tag LOCUS_17110 gene cas1 10619 11686 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_17110 11830 12270 gene locus_tag LOCUS_17120 gene cas2 11830 12270 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence120 2419 1442 gene locus_tag LOCUS_17130 2419 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2469 3620 gene locus_tag LOCUS_17140 gene pheS 2469 3620 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP75 protein_id gnl|my_center|LOCUS_17140 3960 5009 gene locus_tag LOCUS_17150 3960 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 5108 6220 gene locus_tag LOCUS_17160 5108 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6319 7860 gene locus_tag LOCUS_17170 gene uvrC 6319 7860 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD6 protein_id gnl|my_center|LOCUS_17170 7999 8865 gene locus_tag LOCUS_17180 7999 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259458.1 protein_id gnl|my_center|LOCUS_17180 8875 10326 gene locus_tag LOCUS_17190 8875 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_17190 10919 10323 gene locus_tag LOCUS_17200 10919 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence121 5504 4407 gene locus_tag LOCUS_17210 gene ppiD 5504 4407 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPZ6 protein_id gnl|my_center|LOCUS_17210 7062 5866 gene locus_tag LOCUS_17220 7062 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 7521 7591 gene locus_tag LOCUS_t00230 7521 7591 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7711 9195 gene locus_tag LOCUS_17230 7711 9195 CDS product arylsulfatase A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_17230 10785 9211 gene locus_tag LOCUS_17240 10785 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence122 351 1457 gene locus_tag LOCUS_17250 351 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2422 1670 gene locus_tag LOCUS_17260 2422 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3590 2634 gene locus_tag LOCUS_17270 3590 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5174 3642 gene locus_tag LOCUS_17280 gene ggt 5174 3642 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_17280 5559 6182 gene locus_tag LOCUS_17290 5559 6182 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_17290 7279 8820 gene locus_tag LOCUS_17300 7279 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_17300 8925 9977 gene locus_tag LOCUS_17310 8925 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_17310 10016 10369 gene locus_tag LOCUS_17320 10016 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 10366 10935 gene locus_tag LOCUS_17330 gene maa 10366 10935 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123673.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence123 191 1432 gene locus_tag LOCUS_17340 191 1432 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_17340 1514 2737 gene locus_tag LOCUS_17350 1514 2737 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_17350 4639 2792 gene locus_tag LOCUS_17360 4639 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 5554 4778 gene locus_tag LOCUS_17370 5554 4778 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_17370 7015 5651 gene locus_tag LOCUS_17380 7015 5651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_17380 8686 7058 gene locus_tag LOCUS_17390 8686 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 10097 8907 gene locus_tag LOCUS_17400 10097 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 <12069 10424 gene locus_tag LOCUS_17410 <12069 10424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028513.1:ATP-binding protein >Feature sequence124 2513 1743 gene locus_tag LOCUS_17420 2513 1743 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCR8 protein_id gnl|my_center|LOCUS_17420 4810 2606 gene locus_tag LOCUS_17430 4810 2606 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118533.1 protein_id gnl|my_center|LOCUS_17430 5128 4883 gene locus_tag LOCUS_17440 5128 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 5301 5921 gene locus_tag LOCUS_17450 5301 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 5890 7146 gene locus_tag LOCUS_17460 5890 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 7221 7934 gene locus_tag LOCUS_17470 7221 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 7979 8215 gene locus_tag LOCUS_17480 7979 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 9167 8295 gene locus_tag LOCUS_17490 gene wecG 9167 8295 CDS product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123818.1 protein_id gnl|my_center|LOCUS_17490 10261 9179 gene locus_tag LOCUS_17500 10261 9179 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_17500 10625 11230 gene locus_tag LOCUS_17510 10625 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 11648 11334 gene locus_tag LOCUS_17520 11648 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence125 325 2028 gene locus_tag LOCUS_17530 gene groL1 325 2028 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM99 protein_id gnl|my_center|LOCUS_17530 2128 2478 gene locus_tag LOCUS_17540 2128 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2565 2855 gene locus_tag LOCUS_17550 gene groS1 2565 2855 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM98 protein_id gnl|my_center|LOCUS_17550 2960 4573 gene locus_tag LOCUS_17560 gene groL2 2960 4573 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM97 protein_id gnl|my_center|LOCUS_17560 4698 5804 gene locus_tag LOCUS_17570 gene dnaJ 4698 5804 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM96 protein_id gnl|my_center|LOCUS_17570 5930 6532 gene locus_tag LOCUS_17580 gene grpE 5930 6532 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI4 protein_id gnl|my_center|LOCUS_17580 6585 6926 gene locus_tag LOCUS_17590 6585 6926 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_17590 6950 7201 gene locus_tag LOCUS_17600 6950 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 7433 7645 gene locus_tag LOCUS_17610 7433 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 9072 7717 gene locus_tag LOCUS_17620 9072 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120254.1 protein_id gnl|my_center|LOCUS_17620 11367 9178 gene locus_tag LOCUS_17630 11367 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120253.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence126 396 1628 gene locus_tag LOCUS_17640 396 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2643 1717 gene locus_tag LOCUS_17650 2643 1717 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_17650 3646 2711 gene locus_tag LOCUS_17660 gene parA 3646 2711 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_17660 3905 5338 gene locus_tag LOCUS_17670 gene pepA 3905 5338 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ62 protein_id gnl|my_center|LOCUS_17670 5629 6792 gene locus_tag LOCUS_17680 5629 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 6918 8393 gene locus_tag LOCUS_17690 6918 8393 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_17690 8721 9848 gene locus_tag LOCUS_17700 8721 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120538.1 protein_id gnl|my_center|LOCUS_17700 11648 9900 gene locus_tag LOCUS_17710 11648 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence127 1200 61 gene locus_tag LOCUS_17720 gene metK 1200 61 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URU7 protein_id gnl|my_center|LOCUS_17720 2602 1322 gene locus_tag LOCUS_17730 gene waaA 2602 1322 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_17730 6277 2651 gene locus_tag LOCUS_17740 6277 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 6384 7823 gene locus_tag LOCUS_17750 6384 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 9096 7825 gene locus_tag LOCUS_17760 9096 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_17760 10088 9402 gene locus_tag LOCUS_17770 10088 9402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 10142 10393 gene locus_tag LOCUS_17780 10142 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 10390 11649 gene locus_tag LOCUS_17790 10390 11649 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59806 protein_id gnl|my_center|LOCUS_17790 >Feature sequence128 1458 115 gene locus_tag LOCUS_17800 1458 115 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_17800 2249 1560 gene locus_tag LOCUS_17810 2249 1560 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_17810 4678 2390 gene locus_tag LOCUS_17820 4678 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 5404 5892 gene locus_tag LOCUS_17830 5404 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 7184 5973 gene locus_tag LOCUS_17840 7184 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 11576 7440 gene locus_tag LOCUS_17850 11576 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence129 1867 1235 gene locus_tag LOCUS_17860 1867 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2441 4585 gene locus_tag LOCUS_17870 2441 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4845 6518 gene locus_tag LOCUS_17880 gene sigA 4845 6518 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQG1 protein_id gnl|my_center|LOCUS_17880 6808 10248 gene locus_tag LOCUS_17890 6808 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 10262 10717 gene locus_tag LOCUS_17900 10262 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 10730 11617 gene locus_tag LOCUS_17910 10730 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence130 628 1656 gene locus_tag LOCUS_17920 628 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2632 1673 gene locus_tag LOCUS_17930 2632 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3172 4980 gene locus_tag LOCUS_17940 3172 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5599 5015 gene locus_tag LOCUS_17950 5599 5015 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_17950 5730 6548 gene locus_tag LOCUS_17960 gene coaX 5730 6548 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y1 protein_id gnl|my_center|LOCUS_17960 7258 6554 gene locus_tag LOCUS_17970 7258 6554 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ43 protein_id gnl|my_center|LOCUS_17970 7839 7327 gene locus_tag LOCUS_17980 7839 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8063 8152 gene locus_tag LOCUS_t00240 8063 8152 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8349 8615 gene locus_tag LOCUS_17990 8349 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 8672 9496 gene locus_tag LOCUS_18000 8672 9496 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_18000 9584 10222 gene locus_tag LOCUS_18010 9584 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 10278 11213 gene locus_tag LOCUS_18020 10278 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence131 338 3685 gene locus_tag LOCUS_18030 338 3685 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_18030 4871 3738 gene locus_tag LOCUS_18040 gene mqnE 4871 3738 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_18040 5911 5279 gene locus_tag LOCUS_18050 5911 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 9712 6089 gene locus_tag LOCUS_18060 gene gdhP 9712 6089 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_18060 9862 11331 gene locus_tag LOCUS_18070 9862 11331 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence132 1922 4312 gene locus_tag LOCUS_18080 1922 4312 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120925.1 protein_id gnl|my_center|LOCUS_18080 4434 10157 gene locus_tag LOCUS_18090 4434 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 10154 11266 gene locus_tag LOCUS_18100 10154 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120927.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence133 1813 992 gene locus_tag LOCUS_18110 1813 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1883 2080 gene locus_tag LOCUS_18120 1883 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2807 4255 gene locus_tag LOCUS_18130 2807 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 4584 6044 gene locus_tag LOCUS_18140 4584 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 6261 8789 gene locus_tag LOCUS_18150 6261 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 9232 11481 gene locus_tag LOCUS_18160 gene epsB 9232 11481 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118858.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence134 530 4063 gene locus_tag LOCUS_18170 gene dnaE 530 4063 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUS6 protein_id gnl|my_center|LOCUS_18170 4555 5127 gene locus_tag LOCUS_18180 4555 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 5933 5349 gene locus_tag LOCUS_18190 5933 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 6845 5964 gene locus_tag LOCUS_18200 6845 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 9395 6951 gene locus_tag LOCUS_18210 9395 6951 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_18210 10195 9455 gene locus_tag LOCUS_18220 10195 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 11167 10328 gene locus_tag LOCUS_18230 11167 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence135 81 1757 gene locus_tag LOCUS_18240 gene nosR 81 1757 CDS product NosR regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121575.1 protein_id gnl|my_center|LOCUS_18240 3586 1811 gene locus_tag LOCUS_18250 3586 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4443 3904 gene locus_tag LOCUS_18260 4443 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5363 4758 gene locus_tag LOCUS_18270 5363 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5992 5414 gene locus_tag LOCUS_18280 5992 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 6399 5992 gene locus_tag LOCUS_18290 6399 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 7755 6967 gene locus_tag LOCUS_18300 7755 6967 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_18300 8065 9645 gene locus_tag LOCUS_18310 gene lysS 8065 9645 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK37 protein_id gnl|my_center|LOCUS_18310 10266 9718 gene locus_tag LOCUS_18320 10266 9718 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118745.1 protein_id gnl|my_center|LOCUS_18320 10446 10922 gene locus_tag LOCUS_18330 10446 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975293.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence136 <1 1582 gene locus_tag LOCUS_18340 <1 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117876.1:molybdopterin oxidoreductase 1579 3906 gene locus_tag LOCUS_18350 gene narB 1579 3906 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_18350 3983 5833 gene locus_tag LOCUS_18360 gene nirA 3983 5833 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117878.1 protein_id gnl|my_center|LOCUS_18360 5913 7553 gene locus_tag LOCUS_18370 gene cysJ 5913 7553 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117879.1 protein_id gnl|my_center|LOCUS_18370 8000 9904 gene locus_tag LOCUS_18380 8000 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence137 5659 6987 gene locus_tag LOCUS_18390 5659 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119155.1 protein_id gnl|my_center|LOCUS_18390 7317 9683 gene locus_tag LOCUS_18400 7317 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119154.1 protein_id gnl|my_center|LOCUS_18400 11026 9716 gene locus_tag LOCUS_18410 gene arsA 11026 9716 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence138 957 211 gene locus_tag LOCUS_18420 957 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1139 957 gene locus_tag LOCUS_18430 1139 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2011 1214 gene locus_tag LOCUS_18440 2011 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2097 2185 gene locus_tag LOCUS_t00250 2097 2185 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2643 2365 gene locus_tag LOCUS_18450 2643 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3363 5804 gene locus_tag LOCUS_18460 3363 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 6219 8294 gene locus_tag LOCUS_18470 6219 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 8563 9972 gene locus_tag LOCUS_18480 gene strI 8563 9972 CDS product streptomycin biosynthesis protein StrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence139 33 959 gene locus_tag LOCUS_18490 gene purC 33 959 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ19 protein_id gnl|my_center|LOCUS_18490 1020 1559 gene locus_tag LOCUS_18500 gene fabZ 1020 1559 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_18500 1559 2215 gene locus_tag LOCUS_18510 1559 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2467 3597 gene locus_tag LOCUS_18520 2467 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3816 4460 gene locus_tag LOCUS_18530 3816 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 6666 4873 gene locus_tag LOCUS_18540 6666 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 7455 6814 gene locus_tag LOCUS_18550 7455 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 8942 7545 gene locus_tag LOCUS_18560 8942 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 <11163 9861 gene locus_tag LOCUS_18570 <11163 9861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878813.1:threonine synthase >Feature sequence140 678 1391 gene locus_tag LOCUS_18580 678 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1877 1509 gene locus_tag LOCUS_18590 1877 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2120 4492 gene locus_tag LOCUS_18600 2120 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6146 4626 gene locus_tag LOCUS_18610 gene ndh 6146 4626 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_18610 9228 6310 gene locus_tag LOCUS_18620 9228 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 10498 9476 gene locus_tag LOCUS_18630 gene pstS 10498 9476 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405017.1 protein_id gnl|my_center|LOCUS_18630 <11098 10595 gene locus_tag LOCUS_18640 <11098 10595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941762.1:PAS domain-containing sensor histidine kinase >Feature sequence141 <1 981 gene locus_tag LOCUS_18650 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118814.1:arylsulfatase 1876 1061 gene locus_tag LOCUS_18660 1876 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2207 3940 gene locus_tag LOCUS_18670 2207 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4093 5031 gene locus_tag LOCUS_18680 4093 5031 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_18680 5028 6404 gene locus_tag LOCUS_18690 gene mnmE 5028 6404 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJI3 protein_id gnl|my_center|LOCUS_18690 7739 6783 gene locus_tag LOCUS_18700 7739 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 8501 8079 gene locus_tag LOCUS_18710 8501 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 8977 8582 gene locus_tag LOCUS_18720 8977 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 10614 9307 gene locus_tag LOCUS_18730 10614 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence142 308 1387 gene locus_tag LOCUS_18740 gene htrB 308 1387 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_18740 1421 1759 gene locus_tag LOCUS_18750 1421 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1759 2097 gene locus_tag LOCUS_18760 1759 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2238 3761 gene locus_tag LOCUS_18770 2238 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3805 4362 gene locus_tag LOCUS_18780 3805 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 5773 4547 gene locus_tag LOCUS_18790 5773 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 7774 6161 gene locus_tag LOCUS_18800 7774 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 9005 7803 gene locus_tag LOCUS_18810 9005 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 9453 10763 gene locus_tag LOCUS_18820 9453 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence143 1902 322 gene locus_tag LOCUS_18830 1902 322 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_18830 3052 2126 gene locus_tag LOCUS_18840 gene dapF 3052 2126 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FS5 protein_id gnl|my_center|LOCUS_18840 3634 3338 gene locus_tag LOCUS_18850 3634 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4069 6621 gene locus_tag LOCUS_18860 4069 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 7887 6811 gene locus_tag LOCUS_18870 gene holB 7887 6811 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18870 9219 7954 gene locus_tag LOCUS_18880 9219 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 9954 9349 gene locus_tag LOCUS_18890 gene dcd 9954 9349 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_18890 10159 10920 gene locus_tag LOCUS_18900 10159 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence144 2667 1540 gene locus_tag LOCUS_18910 2667 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2778 6476 gene locus_tag LOCUS_18920 2778 6476 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_18920 7870 6848 gene locus_tag LOCUS_18930 7870 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 8862 9713 gene locus_tag LOCUS_18940 8862 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 10508 9744 gene locus_tag LOCUS_18950 10508 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence145 <1 1328 gene locus_tag LOCUS_18960 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119791.1:cytochrome c 1359 1739 gene locus_tag LOCUS_18970 1359 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1743 3164 gene locus_tag LOCUS_18980 1743 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119690.1 protein_id gnl|my_center|LOCUS_18980 4439 3291 gene locus_tag LOCUS_18990 4439 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 6033 4531 gene locus_tag LOCUS_19000 6033 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 6580 8196 gene locus_tag LOCUS_19010 6580 8196 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_19010 8444 8938 gene locus_tag LOCUS_19020 8444 8938 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW63 protein_id gnl|my_center|LOCUS_19020 9095 9400 gene locus_tag LOCUS_19030 9095 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 9434 9829 gene locus_tag LOCUS_19040 9434 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 9853 10575 gene locus_tag LOCUS_19050 9853 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence146 1328 2299 gene locus_tag LOCUS_19060 1328 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 2594 2436 gene locus_tag LOCUS_19070 2594 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4313 2796 gene locus_tag LOCUS_19080 4313 2796 CDS product stage V sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_19080 5541 4456 gene locus_tag LOCUS_19090 5541 4456 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_19090 6715 5951 gene locus_tag LOCUS_19100 6715 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 8375 6816 gene locus_tag LOCUS_19110 8375 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 8741 9454 gene locus_tag LOCUS_19120 8741 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_19120 9695 10315 gene locus_tag LOCUS_19130 9695 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence147 <1 859 gene locus_tag LOCUS_19140 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NG93:adenylosuccinate synthetase 923 1450 gene locus_tag LOCUS_19150 923 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2350 1496 gene locus_tag LOCUS_19160 2350 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122952.1 protein_id gnl|my_center|LOCUS_19160 4295 2418 gene locus_tag LOCUS_19170 4295 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 5066 7804 gene locus_tag LOCUS_19180 5066 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140732.1 protein_id gnl|my_center|LOCUS_19180 9033 7882 gene locus_tag LOCUS_19190 gene hemN 9033 7882 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence148 4884 3742 gene locus_tag LOCUS_19200 4884 3742 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_19200 5467 5066 gene locus_tag LOCUS_19210 5467 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 5845 6408 gene locus_tag LOCUS_19220 5845 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 6488 7915 gene locus_tag LOCUS_19230 6488 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 9113 8295 gene locus_tag LOCUS_19240 gene map 9113 8295 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU68 protein_id gnl|my_center|LOCUS_19240 9467 10231 gene locus_tag LOCUS_19250 9467 10231 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262998.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence149 2114 603 gene locus_tag LOCUS_19260 2114 603 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_19260 2728 2225 gene locus_tag LOCUS_19270 2728 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 4004 2784 gene locus_tag LOCUS_19280 4004 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 5953 4451 gene locus_tag LOCUS_19290 gene arsA 5953 4451 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_19290 6248 6805 gene locus_tag LOCUS_19300 6248 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 7079 9316 gene locus_tag LOCUS_19310 7079 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 10213 9401 gene locus_tag LOCUS_19320 10213 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence150 321 1019 gene locus_tag LOCUS_19330 321 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2216 1059 gene locus_tag LOCUS_19340 2216 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2650 3999 gene locus_tag LOCUS_19350 2650 3999 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_19350 4153 5484 gene locus_tag LOCUS_19360 4153 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 5545 6849 gene locus_tag LOCUS_19370 5545 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 6949 7908 gene locus_tag LOCUS_19380 6949 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 8003 9274 gene locus_tag LOCUS_19390 8003 9274 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462479.1 protein_id gnl|my_center|LOCUS_19390 9338 10465 gene locus_tag LOCUS_19400 gene pglB 9338 10465 CDS product pilin glycosylation protein PglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225656.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence151 925 2082 gene locus_tag LOCUS_19410 925 2082 CDS product Rossman fold protein, TIGR00730 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122653.1 protein_id gnl|my_center|LOCUS_19410 3306 2224 gene locus_tag LOCUS_19420 gene chsA 3306 2224 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 protein_id gnl|my_center|LOCUS_19420 4299 6443 gene locus_tag LOCUS_19430 4299 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 6513 8612 gene locus_tag LOCUS_19440 6513 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 8809 10278 gene locus_tag LOCUS_19450 8809 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence152 1560 37 gene locus_tag LOCUS_19460 1560 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 1976 1626 gene locus_tag LOCUS_19470 1976 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2383 2919 gene locus_tag LOCUS_19480 2383 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2962 3435 gene locus_tag LOCUS_19490 2962 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3871 3461 gene locus_tag LOCUS_19500 3871 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4594 3941 gene locus_tag LOCUS_19510 gene tolQ 4594 3941 CDS product MotA/TolQ/ExbB proton channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324221.1 protein_id gnl|my_center|LOCUS_19510 4947 5357 gene locus_tag LOCUS_19520 4947 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 6328 5399 gene locus_tag LOCUS_19530 6328 5399 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_19530 6518 7900 gene locus_tag LOCUS_19540 gene hisD 6518 7900 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX39 protein_id gnl|my_center|LOCUS_19540 8843 7905 gene locus_tag LOCUS_19550 8843 7905 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_19550 9406 8840 gene locus_tag LOCUS_19560 9406 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence153 781 3516 gene locus_tag LOCUS_19570 781 3516 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120440.1 protein_id gnl|my_center|LOCUS_19570 3648 5156 gene locus_tag LOCUS_19580 3648 5156 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333818.1 protein_id gnl|my_center|LOCUS_19580 6365 5223 gene locus_tag LOCUS_19590 6365 5223 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_19590 8444 6486 gene locus_tag LOCUS_19600 8444 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 <10416 8787 gene locus_tag LOCUS_19610 <10416 8787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119871.1:catalase >Feature sequence154 1830 805 gene locus_tag LOCUS_19620 1830 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3395 1917 gene locus_tag LOCUS_19630 3395 1917 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403007.1 protein_id gnl|my_center|LOCUS_19630 5807 3546 gene locus_tag LOCUS_19640 5807 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 7337 8611 gene locus_tag LOCUS_19650 7337 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 9019 10071 gene locus_tag LOCUS_19660 9019 10071 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 protein_id gnl|my_center|LOCUS_19660 >Feature sequence155 556 1419 gene locus_tag LOCUS_19670 556 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1603 2325 gene locus_tag LOCUS_19680 gene ptsN 1603 2325 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_19680 3706 2486 gene locus_tag LOCUS_19690 3706 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4680 3703 gene locus_tag LOCUS_19700 4680 3703 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_19700 7401 4792 gene locus_tag LOCUS_19710 7401 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_19710 7719 9452 gene locus_tag LOCUS_19720 7719 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 9539 10072 gene locus_tag LOCUS_19730 9539 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence156 358 1050 gene locus_tag LOCUS_19740 358 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3379 1325 gene locus_tag LOCUS_19750 3379 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3763 3527 gene locus_tag LOCUS_19760 3763 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4403 5773 gene locus_tag LOCUS_19770 4403 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118694.1 protein_id gnl|my_center|LOCUS_19770 7587 6034 gene locus_tag LOCUS_19780 7587 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 8781 7756 gene locus_tag LOCUS_19790 8781 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence157 1928 66 gene locus_tag LOCUS_19800 1928 66 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119344.1 protein_id gnl|my_center|LOCUS_19800 2047 3429 gene locus_tag LOCUS_19810 gene xylE 2047 3429 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_19810 4395 3472 gene locus_tag LOCUS_19820 gene uppP 4395 3472 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXA0 protein_id gnl|my_center|LOCUS_19820 5508 4474 gene locus_tag LOCUS_19830 5508 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 5791 6927 gene locus_tag LOCUS_19840 5791 6927 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_19840 7820 7608 gene locus_tag LOCUS_19850 7820 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence158 2336 165 gene locus_tag LOCUS_19860 2336 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2768 2995 gene locus_tag LOCUS_19870 2768 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 4921 3017 gene locus_tag LOCUS_19880 4921 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 6095 5175 gene locus_tag LOCUS_19890 6095 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 7797 6331 gene locus_tag LOCUS_19900 7797 6331 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086147.1 protein_id gnl|my_center|LOCUS_19900 9295 7775 gene locus_tag LOCUS_19910 gene murG 9295 7775 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120938.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence159 1463 999 gene locus_tag LOCUS_19920 1463 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1916 1491 gene locus_tag LOCUS_19930 1916 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1908 2114 gene locus_tag LOCUS_19940 1908 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2111 3031 gene locus_tag LOCUS_19950 2111 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3515 3045 gene locus_tag LOCUS_19960 3515 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4110 3562 gene locus_tag LOCUS_19970 gene tadA 4110 3562 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIP0 protein_id gnl|my_center|LOCUS_19970 4288 4214 gene locus_tag LOCUS_t00260 4288 4214 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5993 4524 gene locus_tag LOCUS_19980 5993 4524 CDS product UDP-N-acetylhexosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_19980 6170 6098 gene locus_tag LOCUS_t00270 6170 6098 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6457 8079 gene locus_tag LOCUS_19990 6457 8079 CDS product Mn(2+) transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122489.1 protein_id gnl|my_center|LOCUS_19990 8938 8312 gene locus_tag LOCUS_20000 8938 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 9547 9176 gene locus_tag LOCUS_20010 9547 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence160 883 4410 gene locus_tag LOCUS_20020 883 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 4746 5783 gene locus_tag LOCUS_20030 4746 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 6479 5862 gene locus_tag LOCUS_20040 gene ubiX 6479 5862 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN84 protein_id gnl|my_center|LOCUS_20040 7470 6601 gene locus_tag LOCUS_20050 7470 6601 CDS product hyalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119128.1 protein_id gnl|my_center|LOCUS_20050 7723 10209 gene locus_tag LOCUS_20060 gene katG 7723 10209 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUW9 protein_id gnl|my_center|LOCUS_20060 >Feature sequence161 3209 189 gene locus_tag LOCUS_20070 3209 189 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_20070 3351 4559 gene locus_tag LOCUS_20080 3351 4559 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056098.1 protein_id gnl|my_center|LOCUS_20080 9170 4704 gene locus_tag LOCUS_20090 9170 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence162 <1 1085 gene locus_tag LOCUS_20100 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123732.1:sulfatase 1082 1807 gene locus_tag LOCUS_20110 1082 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2079 2945 gene locus_tag LOCUS_20120 2079 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 4329 3061 gene locus_tag LOCUS_20130 4329 3061 CDS product merozoite surface protein 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120335.1 protein_id gnl|my_center|LOCUS_20130 4579 4926 gene locus_tag LOCUS_20140 4579 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 4987 6399 gene locus_tag LOCUS_20150 4987 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333737.1 protein_id gnl|my_center|LOCUS_20150 6471 6710 gene locus_tag LOCUS_20160 6471 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 6707 8389 gene locus_tag LOCUS_20170 gene ftsI 6707 8389 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_20170 8612 8391 gene locus_tag LOCUS_20180 8612 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_20180 <10036 8675 gene locus_tag LOCUS_20190 <10036 8675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701100.1:cell division control protein 48 CDC48 >Feature sequence163 913 11 gene locus_tag LOCUS_20200 gene fabD 913 11 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY3 protein_id gnl|my_center|LOCUS_20200 2010 1006 gene locus_tag LOCUS_20210 2010 1006 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_20210 2471 2295 gene locus_tag LOCUS_20220 gene rpmF 2471 2295 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_20220 2829 4703 gene locus_tag LOCUS_20230 2829 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 8260 4787 gene locus_tag LOCUS_20240 8260 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 9484 8603 gene locus_tag LOCUS_20250 9484 8603 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence164 1179 382 gene locus_tag LOCUS_20260 1179 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3117 1270 gene locus_tag LOCUS_20270 3117 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 3824 3150 gene locus_tag LOCUS_20280 gene ispD 3824 3150 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFM0 protein_id gnl|my_center|LOCUS_20280 4941 3943 gene locus_tag LOCUS_20290 4941 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 4907 5134 gene locus_tag LOCUS_20300 4907 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 6442 5504 gene locus_tag LOCUS_20310 gene truB 6442 5504 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ0 protein_id gnl|my_center|LOCUS_20310 6568 6495 gene locus_tag LOCUS_t00280 6568 6495 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6942 7403 gene locus_tag LOCUS_20320 6942 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 7703 8059 gene locus_tag LOCUS_20330 gene panD 7703 8059 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P5 protein_id gnl|my_center|LOCUS_20330 <9986 8096 gene locus_tag LOCUS_20340 <9986 8096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118941.1:ADP-ribosylation factor-directed GTPase activating protein isoform b >Feature sequence165 2236 1181 gene locus_tag LOCUS_20350 2236 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4326 2260 gene locus_tag LOCUS_20360 4326 2260 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_20360 4876 4802 gene locus_tag LOCUS_t00290 4876 4802 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5339 7120 gene locus_tag LOCUS_20370 5339 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 7790 8536 gene locus_tag LOCUS_20380 7790 8536 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_20380 9135 9746 gene locus_tag LOCUS_20390 9135 9746 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence166 313 1185 gene locus_tag LOCUS_20400 313 1185 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_20400 1457 1182 gene locus_tag LOCUS_20410 1457 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1479 2282 gene locus_tag LOCUS_20420 gene fabG 1479 2282 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122369.1 protein_id gnl|my_center|LOCUS_20420 2306 2983 gene locus_tag LOCUS_20430 2306 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4426 2993 gene locus_tag LOCUS_20440 4426 2993 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_20440 7655 4587 gene locus_tag LOCUS_20450 7655 4587 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence167 2 1216 gene locus_tag LOCUS_20460 2 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 1592 1278 gene locus_tag LOCUS_20470 1592 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2063 2947 gene locus_tag LOCUS_20480 2063 2947 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118351.1 protein_id gnl|my_center|LOCUS_20480 2983 4110 gene locus_tag LOCUS_20490 2983 4110 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 protein_id gnl|my_center|LOCUS_20490 4145 5773 gene locus_tag LOCUS_20500 gene dnlI 4145 5773 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118433.1 protein_id gnl|my_center|LOCUS_20500 9891 6058 gene locus_tag LOCUS_20510 9891 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence168 1684 2178 gene locus_tag LOCUS_20520 1684 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2634 4331 gene locus_tag LOCUS_20530 2634 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 5932 4517 gene locus_tag LOCUS_20540 5932 4517 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_20540 7259 6063 gene locus_tag LOCUS_20550 7259 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 8593 7331 gene locus_tag LOCUS_20560 8593 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 9432 8590 gene locus_tag LOCUS_20570 9432 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423245.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence169 515 1408 gene locus_tag LOCUS_20580 515 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1405 2751 gene locus_tag LOCUS_20590 gene hemA 1405 2751 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKZ2 protein_id gnl|my_center|LOCUS_20590 3136 2783 gene locus_tag LOCUS_20600 3136 2783 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_20600 4519 3272 gene locus_tag LOCUS_20610 4519 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_20610 4676 4915 gene locus_tag LOCUS_20620 4676 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 5037 6152 gene locus_tag LOCUS_20630 5037 6152 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878837.1 protein_id gnl|my_center|LOCUS_20630 7522 6185 gene locus_tag LOCUS_20640 7522 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 8073 7519 gene locus_tag LOCUS_20650 gene aroK 8073 7519 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHJ7 protein_id gnl|my_center|LOCUS_20650 9626 8130 gene locus_tag LOCUS_20660 9626 8130 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ72 protein_id gnl|my_center|LOCUS_20660 >Feature sequence170 3820 5385 gene locus_tag LOCUS_20670 3820 5385 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108630.1 protein_id gnl|my_center|LOCUS_20670 6024 8150 gene locus_tag LOCUS_20680 gene nirB 6024 8150 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118575.1 protein_id gnl|my_center|LOCUS_20680 8186 9592 gene locus_tag LOCUS_20690 8186 9592 CDS product NrfA- nitrite reduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118576.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence171 592 1941 gene locus_tag LOCUS_20700 592 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_20700 3326 1950 gene locus_tag LOCUS_20710 3326 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3965 3501 gene locus_tag LOCUS_20720 3965 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123285.1 protein_id gnl|my_center|LOCUS_20720 6425 4752 gene locus_tag LOCUS_20730 6425 4752 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_20730 7437 6640 gene locus_tag LOCUS_20740 7437 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 8816 7563 gene locus_tag LOCUS_20750 gene pepT 8816 7563 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNU2 protein_id gnl|my_center|LOCUS_20750 <9820 8885 gene locus_tag LOCUS_20760 <9820 8885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335393.1:secretion protein >Feature sequence172 <1 1206 gene locus_tag LOCUS_20770 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118487.1:dihydropteroate synthase 1219 1311 gene locus_tag LOCUS_t00300 1219 1311 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1757 1350 gene locus_tag LOCUS_20780 1757 1350 CDS product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJY4 protein_id gnl|my_center|LOCUS_20780 1864 3279 gene locus_tag LOCUS_20790 gene pabB 1864 3279 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121081.1 protein_id gnl|my_center|LOCUS_20790 3742 6273 gene locus_tag LOCUS_20800 3742 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_20800 6270 7574 gene locus_tag LOCUS_20810 6270 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_20810 8637 7651 gene locus_tag LOCUS_20820 8637 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 9078 9404 gene locus_tag LOCUS_20830 9078 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence173 321 785 gene locus_tag LOCUS_20840 321 785 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324679.1 protein_id gnl|my_center|LOCUS_20840 1129 2598 gene locus_tag LOCUS_20850 gene ntrC 1129 2598 CDS product nitrogen assimilation regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119936.1 protein_id gnl|my_center|LOCUS_20850 2686 2901 gene locus_tag LOCUS_20860 2686 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3155 2898 gene locus_tag LOCUS_20870 3155 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3066 3326 gene locus_tag LOCUS_20880 3066 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3660 3577 gene locus_tag LOCUS_t00310 3660 3577 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5302 3776 gene locus_tag LOCUS_20890 5302 3776 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 protein_id gnl|my_center|LOCUS_20890 5623 5345 gene locus_tag LOCUS_20900 5623 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 5838 5620 gene locus_tag LOCUS_20910 5838 5620 CDS product DUF3072 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227672.1 protein_id gnl|my_center|LOCUS_20910 8625 5992 gene locus_tag LOCUS_20920 gene clpB 8625 5992 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence174 1333 173 gene locus_tag LOCUS_20930 1333 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2768 1515 gene locus_tag LOCUS_20940 gene mqnC 2768 1515 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT24 protein_id gnl|my_center|LOCUS_20940 2864 3325 gene locus_tag LOCUS_20950 2864 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5432 3381 gene locus_tag LOCUS_20960 gene msaB 5432 3381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_20960 5651 5917 gene locus_tag LOCUS_20970 5651 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336793.1 protein_id gnl|my_center|LOCUS_20970 6918 6085 gene locus_tag LOCUS_20980 6918 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence175 1011 364 gene locus_tag LOCUS_20990 gene pur3 1011 364 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_20990 1809 1042 gene locus_tag LOCUS_21000 1809 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1979 2827 gene locus_tag LOCUS_21010 1979 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2942 3235 gene locus_tag LOCUS_21020 2942 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3267 4163 gene locus_tag LOCUS_21030 gene xerC 3267 4163 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_21030 4656 4261 gene locus_tag LOCUS_21040 4656 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 5983 4679 gene locus_tag LOCUS_21050 5983 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 6249 7265 gene locus_tag LOCUS_21060 6249 7265 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_21060 7848 7342 gene locus_tag LOCUS_21070 7848 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 9458 7845 gene locus_tag LOCUS_21080 9458 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence176 6293 5340 gene locus_tag LOCUS_21090 gene pyrD 6293 5340 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UML7 protein_id gnl|my_center|LOCUS_21090 6845 6426 gene locus_tag LOCUS_21100 6845 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 7697 7167 gene locus_tag LOCUS_21110 gene hup 7697 7167 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328824.1 protein_id gnl|my_center|LOCUS_21110 8365 7859 gene locus_tag LOCUS_21120 8365 7859 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869889.1 protein_id gnl|my_center|LOCUS_21120 9276 9467 gene locus_tag LOCUS_21130 9276 9467 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460793.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence177 1186 1737 gene locus_tag LOCUS_21140 1186 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3788 1833 gene locus_tag LOCUS_21150 3788 1833 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121956.1 protein_id gnl|my_center|LOCUS_21150 4201 5838 gene locus_tag LOCUS_21160 gene yljF 4201 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_21160 6083 6619 gene locus_tag LOCUS_21170 6083 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 6790 7362 gene locus_tag LOCUS_21180 6790 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 7663 8142 gene locus_tag LOCUS_21190 7663 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 8911 8222 gene locus_tag LOCUS_21200 8911 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence178 472 400 gene locus_tag LOCUS_t00320 472 400 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 692 2386 gene locus_tag LOCUS_21210 692 2386 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121082.1 protein_id gnl|my_center|LOCUS_21210 4529 2589 gene locus_tag LOCUS_21220 4529 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 4795 5382 gene locus_tag LOCUS_21230 4795 5382 CDS product RNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_21230 6307 5441 gene locus_tag LOCUS_21240 6307 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 6677 6838 gene locus_tag LOCUS_21250 6677 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 8133 6922 gene locus_tag LOCUS_21260 8133 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_21260 9073 8276 gene locus_tag LOCUS_21270 9073 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence179 62 361 gene locus_tag LOCUS_21280 62 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 487 1143 gene locus_tag LOCUS_21290 487 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1794 1564 gene locus_tag LOCUS_21300 1794 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1918 2577 gene locus_tag LOCUS_21310 1918 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122826.1 protein_id gnl|my_center|LOCUS_21310 3239 2538 gene locus_tag LOCUS_21320 3239 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122318.1 protein_id gnl|my_center|LOCUS_21320 3350 3790 gene locus_tag LOCUS_21330 3350 3790 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 protein_id gnl|my_center|LOCUS_21330 3879 4400 gene locus_tag LOCUS_21340 3879 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 5305 4493 gene locus_tag LOCUS_21350 gene xynE 5305 4493 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122022.1 protein_id gnl|my_center|LOCUS_21350 5565 6524 gene locus_tag LOCUS_21360 5565 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 7541 6765 gene locus_tag LOCUS_21370 7541 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 7993 8220 gene locus_tag LOCUS_21380 7993 8220 CDS product ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325922.1 protein_id gnl|my_center|LOCUS_21380 9271 8378 gene locus_tag LOCUS_21390 gene cheR1 9271 8378 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_21390 >Feature sequence180 1380 757 gene locus_tag LOCUS_21400 1380 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1583 2551 gene locus_tag LOCUS_21410 1583 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2551 3687 gene locus_tag LOCUS_21420 2551 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3687 4835 gene locus_tag LOCUS_21430 3687 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 6028 4895 gene locus_tag LOCUS_21440 gene flhF 6028 4895 CDS product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073097.1 protein_id gnl|my_center|LOCUS_21440 8122 6059 gene locus_tag LOCUS_21450 gene flhA 8122 6059 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence181 2128 842 gene locus_tag LOCUS_21460 2128 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2729 2220 gene locus_tag LOCUS_21470 2729 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3441 6311 gene locus_tag LOCUS_21480 3441 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_21480 6409 7002 gene locus_tag LOCUS_21490 6409 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence182 171 1184 gene locus_tag LOCUS_21500 gene mch 171 1184 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPS1 protein_id gnl|my_center|LOCUS_21500 1260 2192 gene locus_tag LOCUS_21510 1260 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 3049 2255 gene locus_tag LOCUS_21520 3049 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3452 4522 gene locus_tag LOCUS_21530 3452 4522 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_21530 4938 5525 gene locus_tag LOCUS_21540 4938 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 5605 7071 gene locus_tag LOCUS_21550 5605 7071 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 protein_id gnl|my_center|LOCUS_21550 8133 7216 gene locus_tag LOCUS_21560 gene argF 8133 7216 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ6 protein_id gnl|my_center|LOCUS_21560 <9475 8288 gene locus_tag LOCUS_21570 <9475 8288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GU3:acetylornithine aminotransferase >Feature sequence183 3304 1154 gene locus_tag LOCUS_21580 3304 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 4237 3344 gene locus_tag LOCUS_21590 4237 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_21590 5384 4275 gene locus_tag LOCUS_21600 gene moxR 5384 4275 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_21600 6503 5463 gene locus_tag LOCUS_21610 6503 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_21610 7318 6545 gene locus_tag LOCUS_21620 7318 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence184 <1 1419 gene locus_tag LOCUS_21630 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UM31:chaperone protein DnaK 1591 2670 gene locus_tag LOCUS_21640 1591 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 3590 2979 gene locus_tag LOCUS_21650 3590 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3835 4761 gene locus_tag LOCUS_21660 3835 4761 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_21660 6794 5001 gene locus_tag LOCUS_21670 6794 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_21670 8163 7039 gene locus_tag LOCUS_21680 8163 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence185 1122 2945 gene locus_tag LOCUS_21690 1122 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3162 4220 gene locus_tag LOCUS_21700 gene pstC 3162 4220 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S083 protein_id gnl|my_center|LOCUS_21700 4217 5383 gene locus_tag LOCUS_21710 gene pstA 4217 5383 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S082 protein_id gnl|my_center|LOCUS_21710 5478 6299 gene locus_tag LOCUS_21720 gene pstB 5478 6299 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK4 protein_id gnl|my_center|LOCUS_21720 6459 7142 gene locus_tag LOCUS_21730 gene phoU 6459 7142 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_21730 7294 7980 gene locus_tag LOCUS_21740 7294 7980 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118951.1 protein_id gnl|my_center|LOCUS_21740 8101 9195 gene locus_tag LOCUS_21750 8101 9195 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence186 47 571 gene locus_tag LOCUS_21760 gene smpB 47 571 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH38 protein_id gnl|my_center|LOCUS_21760 1333 626 gene locus_tag LOCUS_21770 1333 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2497 1520 gene locus_tag LOCUS_21780 2497 1520 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176584.1 protein_id gnl|my_center|LOCUS_21780 3362 2589 gene locus_tag LOCUS_21790 3362 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_21790 4676 3537 gene locus_tag LOCUS_21800 4676 3537 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_21800 5547 4894 gene locus_tag LOCUS_21810 5547 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 6123 5716 gene locus_tag LOCUS_21820 6123 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 6443 6120 gene locus_tag LOCUS_21830 6443 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 8671 7004 gene locus_tag LOCUS_21840 8671 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence187 899 30 gene locus_tag LOCUS_21850 899 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1206 949 gene locus_tag LOCUS_21860 1206 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 1430 1209 gene locus_tag LOCUS_21870 1430 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902953.1 protein_id gnl|my_center|LOCUS_21870 1696 3237 gene locus_tag LOCUS_21880 1696 3237 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403783.1 protein_id gnl|my_center|LOCUS_21880 3895 3269 gene locus_tag LOCUS_21890 gene cnrH 3895 3269 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122499.1 protein_id gnl|my_center|LOCUS_21890 4126 4416 gene locus_tag LOCUS_21900 4126 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4560 5132 gene locus_tag LOCUS_21910 4560 5132 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_21910 5129 5569 gene locus_tag LOCUS_21920 5129 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 7102 5636 gene locus_tag LOCUS_21930 7102 5636 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_21930 7370 8050 gene locus_tag LOCUS_21940 7370 8050 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence188 266 2428 gene locus_tag LOCUS_21950 266 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3134 2607 gene locus_tag LOCUS_21960 3134 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3292 4524 gene locus_tag LOCUS_21970 3292 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_21970 5196 4645 gene locus_tag LOCUS_21980 5196 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 6150 5503 gene locus_tag LOCUS_21990 6150 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 6265 6543 gene locus_tag LOCUS_22000 6265 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 6602 7123 gene locus_tag LOCUS_22010 6602 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 7542 7451 gene locus_tag LOCUS_t00330 7542 7451 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9078 7759 gene locus_tag LOCUS_22020 gene hemL 9078 7759 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPM9 protein_id gnl|my_center|LOCUS_22020 >Feature sequence189 1522 950 gene locus_tag LOCUS_22030 1522 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_22030 2338 3381 gene locus_tag LOCUS_22040 2338 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4227 3484 gene locus_tag LOCUS_22050 4227 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_22050 4678 5340 gene locus_tag LOCUS_22060 4678 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 7003 5423 gene locus_tag LOCUS_22070 7003 5423 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_22070 7829 7125 gene locus_tag LOCUS_22080 gene nnrE 7829 7125 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX4 protein_id gnl|my_center|LOCUS_22080 8723 7833 gene locus_tag LOCUS_22090 gene ubiG 8723 7833 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence190 1286 1732 gene locus_tag LOCUS_22100 1286 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 1749 2180 gene locus_tag LOCUS_22110 1749 2180 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120292.1 protein_id gnl|my_center|LOCUS_22110 2279 3589 gene locus_tag LOCUS_22120 gene metY-1 2279 3589 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_22120 3644 4834 gene locus_tag LOCUS_22130 gene pepP 3644 4834 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101469.1 protein_id gnl|my_center|LOCUS_22130 4845 5972 gene locus_tag LOCUS_22140 gene bioF 4845 5972 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE2 protein_id gnl|my_center|LOCUS_22140 7199 5973 gene locus_tag LOCUS_22150 7199 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 8212 7253 gene locus_tag LOCUS_22160 8212 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence191 3 686 gene locus_tag LOCUS_22170 3 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1829 924 gene locus_tag LOCUS_22180 1829 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3586 2234 gene locus_tag LOCUS_22190 3586 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 protein_id gnl|my_center|LOCUS_22190 3726 8768 gene locus_tag LOCUS_22200 3726 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence192 848 420 gene locus_tag LOCUS_22210 848 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1135 845 gene locus_tag LOCUS_22220 1135 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2646 1183 gene locus_tag LOCUS_22230 2646 1183 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530553.1 protein_id gnl|my_center|LOCUS_22230 5202 2725 gene locus_tag LOCUS_22240 5202 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 5811 5614 gene locus_tag LOCUS_22250 5811 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 5777 7408 gene locus_tag LOCUS_22260 gene 6pgD 5777 7408 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UV82 protein_id gnl|my_center|LOCUS_22260 7542 8168 gene locus_tag LOCUS_22270 7542 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 <9197 8211 gene locus_tag LOCUS_22280 <9197 8211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085984871.1:alpha/beta hydrolase >Feature sequence193 158 1090 gene locus_tag LOCUS_22290 158 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2358 1492 gene locus_tag LOCUS_22300 2358 1492 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJF6 protein_id gnl|my_center|LOCUS_22300 3789 2485 gene locus_tag LOCUS_22310 3789 2485 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118010.1 protein_id gnl|my_center|LOCUS_22310 4191 4000 gene locus_tag LOCUS_22320 4191 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 4840 4262 gene locus_tag LOCUS_22330 4840 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5001 4819 gene locus_tag LOCUS_22340 5001 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 5500 5027 gene locus_tag LOCUS_22350 5500 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 5932 5567 gene locus_tag LOCUS_22360 5932 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 6450 5986 gene locus_tag LOCUS_22370 6450 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6802 7638 gene locus_tag LOCUS_22380 6802 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 8943 7774 gene locus_tag LOCUS_22390 8943 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence194 1047 481 gene locus_tag LOCUS_22400 1047 481 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120437.1 protein_id gnl|my_center|LOCUS_22400 2098 1307 gene locus_tag LOCUS_22410 2098 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3255 2152 gene locus_tag LOCUS_22420 3255 2152 CDS product calcium sensor EFh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119349.1 protein_id gnl|my_center|LOCUS_22420 3692 6874 gene locus_tag LOCUS_22430 3692 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence195 5471 4980 gene locus_tag LOCUS_22440 5471 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5892 5581 gene locus_tag LOCUS_22450 5892 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 7511 6033 gene locus_tag LOCUS_22460 7511 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 7762 8178 gene locus_tag LOCUS_22470 7762 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence196 240 1478 gene locus_tag LOCUS_22480 240 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1475 1978 gene locus_tag LOCUS_22490 1475 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1975 2493 gene locus_tag LOCUS_22500 1975 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 3857 2577 gene locus_tag LOCUS_22510 gene murA 3857 2577 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B3 protein_id gnl|my_center|LOCUS_22510 4592 3936 gene locus_tag LOCUS_22520 4592 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 4827 6560 gene locus_tag LOCUS_22530 4827 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122313.1 protein_id gnl|my_center|LOCUS_22530 7801 6542 gene locus_tag LOCUS_22540 7801 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 8363 7854 gene locus_tag LOCUS_22550 8363 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 <8987 8413 gene locus_tag LOCUS_22560 <8987 8413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AJ6:malto-oligosyltrehalose trehalohydrolase >Feature sequence197 2049 235 gene locus_tag LOCUS_22570 2049 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2484 2810 gene locus_tag LOCUS_22580 2484 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2876 3910 gene locus_tag LOCUS_22590 2876 3910 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_22590 7726 3935 gene locus_tag LOCUS_22600 gene kefA 7726 3935 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120603.1 protein_id gnl|my_center|LOCUS_22600 8609 7998 gene locus_tag LOCUS_22610 8609 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence198 536 39 gene locus_tag LOCUS_22620 536 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1381 878 gene locus_tag LOCUS_22630 1381 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2569 1475 gene locus_tag LOCUS_22640 2569 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3632 2589 gene locus_tag LOCUS_22650 3632 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 4351 3692 gene locus_tag LOCUS_22660 gene trmH 4351 3692 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_22660 5611 4601 gene locus_tag LOCUS_22670 gene obg 5611 4601 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH6 protein_id gnl|my_center|LOCUS_22670 8598 5803 gene locus_tag LOCUS_22680 8598 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence199 587 108 gene locus_tag LOCUS_22690 587 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1090 608 gene locus_tag LOCUS_22700 1090 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 1837 1304 gene locus_tag LOCUS_22710 1837 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1916 2596 gene locus_tag LOCUS_22720 1916 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 5662 2609 gene locus_tag LOCUS_22730 5662 2609 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117697.1 protein_id gnl|my_center|LOCUS_22730 6561 5857 gene locus_tag LOCUS_22740 6561 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 7650 6586 gene locus_tag LOCUS_22750 gene trpS 7650 6586 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA4 protein_id gnl|my_center|LOCUS_22750 7706 8500 gene locus_tag LOCUS_22760 7706 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence200 1257 286 gene locus_tag LOCUS_22770 1257 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1927 1346 gene locus_tag LOCUS_22780 1927 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2767 4182 gene locus_tag LOCUS_22790 2767 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 4744 6018 gene locus_tag LOCUS_22800 4744 6018 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_22800 6066 7196 gene locus_tag LOCUS_22810 6066 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119847.1 protein_id gnl|my_center|LOCUS_22810 7258 8121 gene locus_tag LOCUS_22820 7258 8121 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119848.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence201 499 2781 gene locus_tag LOCUS_22830 499 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 744 647 gene locus_tag LOCUS_t00340 744 647 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2852 4258 gene locus_tag LOCUS_22840 2852 4258 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_22840 5235 4357 gene locus_tag LOCUS_22850 5235 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 6610 5660 gene locus_tag LOCUS_22860 gene ddlB 6610 5660 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_22860 7536 6937 gene locus_tag LOCUS_22870 7536 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence202 946 128 gene locus_tag LOCUS_22880 946 128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_22880 1868 1029 gene locus_tag LOCUS_22890 1868 1029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121261.1 protein_id gnl|my_center|LOCUS_22890 2183 2578 gene locus_tag LOCUS_22900 2183 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2565 3014 gene locus_tag LOCUS_22910 2565 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 3918 3025 gene locus_tag LOCUS_22920 3918 3025 CDS product LmbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_22920 7476 3961 gene locus_tag LOCUS_22930 7476 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 8465 7518 gene locus_tag LOCUS_22940 8465 7518 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence203 332 607 gene locus_tag LOCUS_22950 332 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22950 915 1592 gene locus_tag LOCUS_22960 915 1592 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_22960 1589 2398 gene locus_tag LOCUS_22970 1589 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2410 2985 gene locus_tag LOCUS_22980 2410 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3056 3871 gene locus_tag LOCUS_22990 3056 3871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122565.1 protein_id gnl|my_center|LOCUS_22990 3959 4705 gene locus_tag LOCUS_23000 3959 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 4915 6381 gene locus_tag LOCUS_23010 4915 6381 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_23010 6615 6902 gene locus_tag LOCUS_23020 6615 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 7023 7319 gene locus_tag LOCUS_23030 7023 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence204 885 487 gene locus_tag LOCUS_23040 885 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1112 2461 gene locus_tag LOCUS_23050 1112 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2555 3796 gene locus_tag LOCUS_23060 2555 3796 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_23060 6152 3933 gene locus_tag LOCUS_23070 6152 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 7243 6467 gene locus_tag LOCUS_23080 gene macB 7243 6467 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJF1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence205 54 1079 gene locus_tag LOCUS_23090 54 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2055 1378 gene locus_tag LOCUS_23100 2055 1378 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_23100 3432 2194 gene locus_tag LOCUS_23110 gene glgC 3432 2194 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXF5 protein_id gnl|my_center|LOCUS_23110 3948 6674 gene locus_tag LOCUS_23120 3948 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence206 851 264 gene locus_tag LOCUS_23130 gene coaD 851 264 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG6 protein_id gnl|my_center|LOCUS_23130 1103 1630 gene locus_tag LOCUS_23140 gene hsp20 1103 1630 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122700.1 protein_id gnl|my_center|LOCUS_23140 1627 2001 gene locus_tag LOCUS_23150 1627 2001 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526549.1 protein_id gnl|my_center|LOCUS_23150 2114 2722 gene locus_tag LOCUS_23160 2114 2722 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194486.1 protein_id gnl|my_center|LOCUS_23160 2799 3086 gene locus_tag LOCUS_23170 2799 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 3225 4475 gene locus_tag LOCUS_23180 3225 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 4666 6357 gene locus_tag LOCUS_23190 4666 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 6354 7181 gene locus_tag LOCUS_23200 6354 7181 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_23200 7191 8468 gene locus_tag LOCUS_23210 7191 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence207 1167 511 gene locus_tag LOCUS_23220 1167 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2209 1256 gene locus_tag LOCUS_23230 2209 1256 CDS product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120147.1 protein_id gnl|my_center|LOCUS_23230 2222 2947 gene locus_tag LOCUS_23240 2222 2947 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_23240 4287 3064 gene locus_tag LOCUS_23250 4287 3064 CDS product type IV pilus biogenesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_23250 4444 5622 gene locus_tag LOCUS_23260 4444 5622 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120945.1 protein_id gnl|my_center|LOCUS_23260 6955 5768 gene locus_tag LOCUS_23270 6955 5768 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_23270 8053 7178 gene locus_tag LOCUS_23280 8053 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence208 985 656 gene locus_tag LOCUS_23290 985 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1836 982 gene locus_tag LOCUS_23300 gene nfo 1836 982 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WII8 protein_id gnl|my_center|LOCUS_23300 2414 1890 gene locus_tag LOCUS_23310 gene apt 2414 1890 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR74 protein_id gnl|my_center|LOCUS_23310 4153 2444 gene locus_tag LOCUS_23320 4153 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 4514 4900 gene locus_tag LOCUS_23330 gene cbiX 4514 4900 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_23330 6371 5016 gene locus_tag LOCUS_23340 6371 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 7522 6560 gene locus_tag LOCUS_23350 gene miaA 7522 6560 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_23350 7571 8032 gene locus_tag LOCUS_23360 7571 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 8648 8058 gene locus_tag LOCUS_23370 8648 8058 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence209 2202 3302 gene locus_tag LOCUS_23380 gene leuB 2202 3302 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119542.1 protein_id gnl|my_center|LOCUS_23380 3343 4293 gene locus_tag LOCUS_23390 3343 4293 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705212.1 protein_id gnl|my_center|LOCUS_23390 4373 5659 gene locus_tag LOCUS_23400 4373 5659 CDS product glucarate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334635.1 protein_id gnl|my_center|LOCUS_23400 5664 6704 gene locus_tag LOCUS_23410 5664 6704 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_23410 7163 6735 gene locus_tag LOCUS_23420 7163 6735 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119547.1 protein_id gnl|my_center|LOCUS_23420 7254 7937 gene locus_tag LOCUS_23430 7254 7937 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119544.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence210 409 1875 gene locus_tag LOCUS_23440 409 1875 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122540.1 protein_id gnl|my_center|LOCUS_23440 2365 1931 gene locus_tag LOCUS_23450 2365 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 3911 2358 gene locus_tag LOCUS_23460 3911 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 4750 4010 gene locus_tag LOCUS_23470 gene bioD 4750 4010 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MN32 protein_id gnl|my_center|LOCUS_23470 4846 6438 gene locus_tag LOCUS_23480 gene guaA 4846 6438 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFS3 protein_id gnl|my_center|LOCUS_23480 7209 6454 gene locus_tag LOCUS_23490 7209 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 7726 7319 gene locus_tag LOCUS_23500 gene atpC 7726 7319 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB4 protein_id gnl|my_center|LOCUS_23500 <8657 7775 gene locus_tag LOCUS_23510 <8657 7775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFB5:ATP synthase subunit beta >Feature sequence211 427 2178 gene locus_tag LOCUS_23520 427 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 3032 2313 gene locus_tag LOCUS_23530 gene araC 3032 2313 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_23530 3152 3763 gene locus_tag LOCUS_23540 3152 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 3829 5223 gene locus_tag LOCUS_23550 3829 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_23550 5416 5766 gene locus_tag LOCUS_23560 5416 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_23560 5906 8359 gene locus_tag LOCUS_23570 5906 8359 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence212 689 2248 gene locus_tag LOCUS_23580 689 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 3063 2314 gene locus_tag LOCUS_23590 3063 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 3312 3629 gene locus_tag LOCUS_23600 gene gatC 3312 3629 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYQ1 protein_id gnl|my_center|LOCUS_23600 3629 5191 gene locus_tag LOCUS_23610 gene gatA 3629 5191 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT33 protein_id gnl|my_center|LOCUS_23610 5277 6779 gene locus_tag LOCUS_23620 gene gatB 5277 6779 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK56 protein_id gnl|my_center|LOCUS_23620 6863 7672 gene locus_tag LOCUS_23630 6863 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence213 530 2020 gene locus_tag LOCUS_23640 530 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2020 3042 gene locus_tag LOCUS_23650 gene tsaD 2020 3042 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM42 protein_id gnl|my_center|LOCUS_23650 3096 3614 gene locus_tag LOCUS_23660 3096 3614 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971492.1 protein_id gnl|my_center|LOCUS_23660 4187 3624 gene locus_tag LOCUS_23670 4187 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_23670 4532 4260 gene locus_tag LOCUS_23680 4532 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 4902 5873 gene locus_tag LOCUS_23690 gene gpsA2 4902 5873 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H6 protein_id gnl|my_center|LOCUS_23690 6866 5901 gene locus_tag LOCUS_23700 6866 5901 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_23700 7107 7865 gene locus_tag LOCUS_23710 7107 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence214 522 1574 gene locus_tag LOCUS_23720 522 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_23720 1994 3547 gene locus_tag LOCUS_23730 1994 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 4517 3618 gene locus_tag LOCUS_23740 4517 3618 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118012.1 protein_id gnl|my_center|LOCUS_23740 4769 4578 gene locus_tag LOCUS_23750 4769 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 5437 4835 gene locus_tag LOCUS_23760 5437 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 8244 5806 gene locus_tag LOCUS_23770 8244 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence215 372 1829 gene locus_tag LOCUS_23780 gene acrA 372 1829 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123072.1 protein_id gnl|my_center|LOCUS_23780 1882 5049 gene locus_tag LOCUS_23790 gene acrB 1882 5049 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123071.1 protein_id gnl|my_center|LOCUS_23790 6481 5216 gene locus_tag LOCUS_23800 6481 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 7098 7394 gene locus_tag LOCUS_23810 7098 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence216 370 3867 gene locus_tag LOCUS_23820 370 3867 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_23820 4304 3876 gene locus_tag LOCUS_23830 gene fabZ 4304 3876 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61452 protein_id gnl|my_center|LOCUS_23830 5805 4420 gene locus_tag LOCUS_23840 5805 4420 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV29 protein_id gnl|my_center|LOCUS_23840 7169 5925 gene locus_tag LOCUS_23850 gene sucB 7169 5925 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX6 protein_id gnl|my_center|LOCUS_23850 7391 8392 gene locus_tag LOCUS_23860 7391 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence217 1229 315 gene locus_tag LOCUS_23870 gene rbsK 1229 315 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKN5 protein_id gnl|my_center|LOCUS_23870 1374 1820 gene locus_tag LOCUS_23880 1374 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1955 2941 gene locus_tag LOCUS_23890 1955 2941 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120424.1 protein_id gnl|my_center|LOCUS_23890 4462 3047 gene locus_tag LOCUS_23900 4462 3047 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120382.1 protein_id gnl|my_center|LOCUS_23900 4933 6306 gene locus_tag LOCUS_23910 4933 6306 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327030.1 protein_id gnl|my_center|LOCUS_23910 6654 7721 gene locus_tag LOCUS_23920 6654 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence218 1302 370 gene locus_tag LOCUS_23930 gene cysK 1302 370 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y99 protein_id gnl|my_center|LOCUS_23930 1474 2217 gene locus_tag LOCUS_23940 gene prh 1474 2217 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EBI0 protein_id gnl|my_center|LOCUS_23940 2269 3093 gene locus_tag LOCUS_23950 2269 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174163.1 protein_id gnl|my_center|LOCUS_23950 3090 3500 gene locus_tag LOCUS_23960 3090 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6794 3525 gene locus_tag LOCUS_23970 6794 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6950 7219 gene locus_tag LOCUS_23980 gene rpsO 6950 7219 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_23980 >Feature sequence219 1838 861 gene locus_tag LOCUS_23990 1838 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 1969 3384 gene locus_tag LOCUS_24000 1969 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3391 3987 gene locus_tag LOCUS_24010 3391 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 4114 5487 gene locus_tag LOCUS_24020 4114 5487 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_24020 5580 6524 gene locus_tag LOCUS_24030 5580 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 7949 6582 gene locus_tag LOCUS_24040 gene fixW 7949 6582 CDS product redoxin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327198.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence220 1203 106 gene locus_tag LOCUS_24050 1203 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2406 1342 gene locus_tag LOCUS_24060 2406 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2630 4612 gene locus_tag LOCUS_24070 2630 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5884 4721 gene locus_tag LOCUS_24080 gene argJ 5884 4721 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN4 protein_id gnl|my_center|LOCUS_24080 8074 6044 gene locus_tag LOCUS_24090 gene pheT 8074 6044 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP77 protein_id gnl|my_center|LOCUS_24090 >Feature sequence221 2907 1426 gene locus_tag LOCUS_24100 2907 1426 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_24100 4132 2939 gene locus_tag LOCUS_24110 gene bcpC 4132 2939 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_868623.2 protein_id gnl|my_center|LOCUS_24110 4568 4179 gene locus_tag LOCUS_24120 4568 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4727 4654 gene locus_tag LOCUS_t00350 4727 4654 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6919 4808 gene locus_tag LOCUS_24130 6919 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 7282 7049 gene locus_tag LOCUS_24140 gene ycf40 7282 7049 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140405.1 protein_id gnl|my_center|LOCUS_24140 7321 8157 gene locus_tag LOCUS_24150 7321 8157 CDS product N,N-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence222 38 1330 gene locus_tag LOCUS_24160 gene xapH 38 1330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_24160 1659 2915 gene locus_tag LOCUS_24170 1659 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2912 3952 gene locus_tag LOCUS_24180 gene gmd 2912 3952 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_24180 4560 5342 gene locus_tag LOCUS_24190 4560 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 5427 6758 gene locus_tag LOCUS_24200 5427 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence223 1351 350 gene locus_tag LOCUS_24210 1351 350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_24210 2052 3098 gene locus_tag LOCUS_24220 gene gspF 2052 3098 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_24220 3234 4337 gene locus_tag LOCUS_24230 gene tgt 3234 4337 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWK9 protein_id gnl|my_center|LOCUS_24230 <8114 4420 gene locus_tag LOCUS_24240 <8114 4420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97ES0:isoleucine--tRNA ligase >Feature sequence224 240 518 gene locus_tag LOCUS_24250 240 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1372 1782 gene locus_tag LOCUS_24260 gene fur 1372 1782 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_24260 1764 2033 gene locus_tag LOCUS_24270 1764 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2701 3453 gene locus_tag LOCUS_24280 2701 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 4137 4622 gene locus_tag LOCUS_24290 4137 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 4782 5135 gene locus_tag LOCUS_24300 4782 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 5244 5996 gene locus_tag LOCUS_24310 5244 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 7378 7049 gene locus_tag LOCUS_24320 7378 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 7910 8061 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acgcccccgtgagggggcgac >Feature sequence225 1945 800 gene locus_tag LOCUS_24330 1945 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2087 2707 gene locus_tag LOCUS_24340 2087 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_24340 2972 3796 gene locus_tag LOCUS_24350 2972 3796 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117794.1 protein_id gnl|my_center|LOCUS_24350 4208 5437 gene locus_tag LOCUS_24360 4208 5437 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118793.1 protein_id gnl|my_center|LOCUS_24360 5900 6433 gene locus_tag LOCUS_24370 5900 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 6586 7044 gene locus_tag LOCUS_24380 6586 7044 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence226 <1 523 gene locus_tag LOCUS_24390 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKI3:succinate--CoA ligase [ADP-forming] subunit beta 576 1325 gene locus_tag LOCUS_24400 576 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1389 2084 gene locus_tag LOCUS_24410 1389 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2783 2088 gene locus_tag LOCUS_24420 2783 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2890 3795 gene locus_tag LOCUS_24430 gene sucD 2890 3795 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_24430 3842 4072 gene locus_tag LOCUS_24440 3842 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4113 6842 gene locus_tag LOCUS_24450 4113 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 6901 7590 gene locus_tag LOCUS_24460 6901 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 <8061 7558 gene locus_tag LOCUS_24470 <8061 7558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQ38:aldose 1-epimerase >Feature sequence227 787 590 gene locus_tag LOCUS_24480 787 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1604 846 gene locus_tag LOCUS_24490 1604 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1835 3361 gene locus_tag LOCUS_24500 1835 3361 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_24500 3570 4166 gene locus_tag LOCUS_24510 3570 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 4248 4775 gene locus_tag LOCUS_24520 4248 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 4968 6173 gene locus_tag LOCUS_24530 gene rimK 4968 6173 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_24530 >Feature sequence228 4146 3352 gene locus_tag LOCUS_24540 4146 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 5006 4266 gene locus_tag LOCUS_24550 5006 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 5148 7751 gene locus_tag LOCUS_24560 gene mutS 5148 7751 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP05 protein_id gnl|my_center|LOCUS_24560 >Feature sequence229 1115 111 gene locus_tag LOCUS_24570 1115 111 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475776.1 protein_id gnl|my_center|LOCUS_24570 1235 2275 gene locus_tag LOCUS_24580 1235 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3615 2845 gene locus_tag LOCUS_24590 gene hisF 3615 2845 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ9 protein_id gnl|my_center|LOCUS_24590 3781 5475 gene locus_tag LOCUS_24600 3781 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5475 6791 gene locus_tag LOCUS_24610 5475 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 7029 7970 gene locus_tag LOCUS_24620 7029 7970 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence230 504 1949 gene locus_tag LOCUS_24630 504 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2994 2143 gene locus_tag LOCUS_24640 2994 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 3346 4347 gene locus_tag LOCUS_24650 gene rbsB 3346 4347 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120704.1 protein_id gnl|my_center|LOCUS_24650 4529 5497 gene locus_tag LOCUS_24660 gene rbsC 4529 5497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120702.1 protein_id gnl|my_center|LOCUS_24660 6353 5550 gene locus_tag LOCUS_24670 6353 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119280.1 protein_id gnl|my_center|LOCUS_24670 6671 7900 gene locus_tag LOCUS_24680 gene argG 6671 7900 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFW4 protein_id gnl|my_center|LOCUS_24680 >Feature sequence231 1898 891 gene locus_tag LOCUS_24690 1898 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118659.1 protein_id gnl|my_center|LOCUS_24690 4906 2042 gene locus_tag LOCUS_24700 4906 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 6715 4988 gene locus_tag LOCUS_24710 6715 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24710 >Feature sequence232 723 295 gene locus_tag LOCUS_24720 723 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1005 1526 gene locus_tag LOCUS_24730 1005 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117967.1 protein_id gnl|my_center|LOCUS_24730 1635 2720 gene locus_tag LOCUS_24740 1635 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2786 3955 gene locus_tag LOCUS_24750 2786 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120898.1 protein_id gnl|my_center|LOCUS_24750 3966 4364 gene locus_tag LOCUS_24760 gene crcB 3966 4364 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVS9 protein_id gnl|my_center|LOCUS_24760 4396 5304 gene locus_tag LOCUS_24770 4396 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 6968 5313 gene locus_tag LOCUS_24780 6968 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 7205 7441 gene locus_tag LOCUS_24790 7205 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence233 1841 690 gene locus_tag LOCUS_24800 gene fabH 1841 690 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59814 protein_id gnl|my_center|LOCUS_24800 3604 2276 gene locus_tag LOCUS_24810 3604 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 4153 3647 gene locus_tag LOCUS_24820 4153 3647 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_24820 6101 4308 gene locus_tag LOCUS_24830 6101 4308 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123340.1 protein_id gnl|my_center|LOCUS_24830 6333 7469 gene locus_tag LOCUS_24840 6333 7469 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence234 588 1544 gene locus_tag LOCUS_24850 588 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1635 2285 gene locus_tag LOCUS_24860 gene pcxB 1635 2285 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121516.1 protein_id gnl|my_center|LOCUS_24860 3955 2453 gene locus_tag LOCUS_24870 3955 2453 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_24870 4541 3972 gene locus_tag LOCUS_24880 4541 3972 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469143.1 protein_id gnl|my_center|LOCUS_24880 4689 4604 gene locus_tag LOCUS_t00360 4689 4604 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4943 7807 gene locus_tag LOCUS_24890 gene sucA 4943 7807 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326049.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence235 326 1852 gene locus_tag LOCUS_24900 gene merA 326 1852 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_24900 2129 3517 gene locus_tag LOCUS_24910 2129 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3881 3582 gene locus_tag LOCUS_24920 3881 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 4059 4442 gene locus_tag LOCUS_24930 gene rplU 4059 4442 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGJ5 protein_id gnl|my_center|LOCUS_24930 5810 4533 gene locus_tag LOCUS_24940 5810 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 6123 6539 gene locus_tag LOCUS_24950 6123 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 6636 7514 gene locus_tag LOCUS_24960 gene thiL 6636 7514 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG5 protein_id gnl|my_center|LOCUS_24960 >Feature sequence236 2950 119 gene locus_tag LOCUS_24970 gene acnA 2950 119 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020308.1 protein_id gnl|my_center|LOCUS_24970 4633 3128 gene locus_tag LOCUS_24980 4633 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 5032 5439 gene locus_tag LOCUS_24990 gene hsp 5032 5439 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245063.1 protein_id gnl|my_center|LOCUS_24990 5547 5966 gene locus_tag LOCUS_25000 5547 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 6110 6856 gene locus_tag LOCUS_25010 6110 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 7627 6914 gene locus_tag LOCUS_25020 7627 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence237 1560 163 gene locus_tag LOCUS_25030 1560 163 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879527.1 protein_id gnl|my_center|LOCUS_25030 2458 1646 gene locus_tag LOCUS_25040 2458 1646 CDS product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335847.1 protein_id gnl|my_center|LOCUS_25040 2967 2455 gene locus_tag LOCUS_25050 2967 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 4532 3216 gene locus_tag LOCUS_25060 4532 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 5384 4626 gene locus_tag LOCUS_25070 5384 4626 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_25070 5724 5416 gene locus_tag LOCUS_25080 5724 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 5723 6898 gene locus_tag LOCUS_25090 5723 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence238 1977 631 gene locus_tag LOCUS_25100 gene trkA 1977 631 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_25100 2062 2775 gene locus_tag LOCUS_25110 gene trpF 2062 2775 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NML1 protein_id gnl|my_center|LOCUS_25110 2907 3347 gene locus_tag LOCUS_25120 2907 3347 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120691.1 protein_id gnl|my_center|LOCUS_25120 3615 3361 gene locus_tag LOCUS_25130 3615 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3814 4515 gene locus_tag LOCUS_25140 3814 4515 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122587.1 protein_id gnl|my_center|LOCUS_25140 6322 4913 gene locus_tag LOCUS_25150 6322 4913 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence239 2781 1327 gene locus_tag LOCUS_25160 2781 1327 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117762.1 protein_id gnl|my_center|LOCUS_25160 3731 2904 gene locus_tag LOCUS_25170 3731 2904 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117763.1 protein_id gnl|my_center|LOCUS_25170 5708 3900 gene locus_tag LOCUS_25180 gene secA 5708 3900 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117764.1 protein_id gnl|my_center|LOCUS_25180 7410 5743 gene locus_tag LOCUS_25190 7410 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence240 3867 88 gene locus_tag LOCUS_25200 gene smc 3867 88 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQV4 protein_id gnl|my_center|LOCUS_25200 4562 5545 gene locus_tag LOCUS_25210 4562 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence241 3789 1918 gene locus_tag LOCUS_25220 3789 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 3940 4560 gene locus_tag LOCUS_25230 3940 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121484.1 protein_id gnl|my_center|LOCUS_25230 5780 4620 gene locus_tag LOCUS_25240 gene lpxB 5780 4620 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119004.1 protein_id gnl|my_center|LOCUS_25240 5988 6539 gene locus_tag LOCUS_25250 5988 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence242 1481 2209 gene locus_tag LOCUS_25260 gene rpsH 1481 2209 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_25260 2350 2883 gene locus_tag LOCUS_25270 2350 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 2880 4115 gene locus_tag LOCUS_25280 2880 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 5456 4146 gene locus_tag LOCUS_25290 5456 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 6919 5453 gene locus_tag LOCUS_25300 6919 5453 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence243 2516 1182 gene locus_tag LOCUS_25310 gene pyrC 2516 1182 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFD0 protein_id gnl|my_center|LOCUS_25310 2880 2539 gene locus_tag LOCUS_25320 2880 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 4350 2914 gene locus_tag LOCUS_25330 gene gntP 4350 2914 CDS product gluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_25330 4436 6220 gene locus_tag LOCUS_25340 4436 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 6284 7579 gene locus_tag LOCUS_25350 6284 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence244 728 186 gene locus_tag LOCUS_25360 728 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 1012 2004 gene locus_tag LOCUS_25370 1012 2004 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_25370 2001 3884 gene locus_tag LOCUS_25380 2001 3884 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_25380 4912 3923 gene locus_tag LOCUS_25390 4912 3923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120248.1 protein_id gnl|my_center|LOCUS_25390 6978 5008 gene locus_tag LOCUS_25400 gene prc 6978 5008 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence245 5515 6636 gene locus_tag LOCUS_25410 5515 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 6633 7028 gene locus_tag LOCUS_25420 6633 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence246 922 548 gene locus_tag LOCUS_25430 922 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1520 1125 gene locus_tag LOCUS_25440 1520 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2260 1517 gene locus_tag LOCUS_25450 2260 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_25450 2259 2585 gene locus_tag LOCUS_25460 2259 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2670 3221 gene locus_tag LOCUS_25470 2670 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 6826 3248 gene locus_tag LOCUS_25480 6826 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence247 356 2833 gene locus_tag LOCUS_25490 356 2833 CDS product 7TM receptor with intracellular metal dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330940.1 protein_id gnl|my_center|LOCUS_25490 2890 4734 gene locus_tag LOCUS_25500 2890 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 4766 6904 gene locus_tag LOCUS_25510 gene ppk 4766 6904 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZS6 protein_id gnl|my_center|LOCUS_25510 >Feature sequence248 1036 59 gene locus_tag LOCUS_25520 1036 59 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222572.1 protein_id gnl|my_center|LOCUS_25520 2183 1143 gene locus_tag LOCUS_25530 2183 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 4249 2336 gene locus_tag LOCUS_25540 gene mutL 4249 2336 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_25540 5091 4306 gene locus_tag LOCUS_25550 5091 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 5688 5344 gene locus_tag LOCUS_25560 5688 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 6682 5900 gene locus_tag LOCUS_25570 6682 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 6599 6973 gene locus_tag LOCUS_25580 6599 6973 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120601.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence249 2679 1624 gene locus_tag LOCUS_25590 2679 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3191 3532 gene locus_tag LOCUS_25600 3191 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 5929 3548 gene locus_tag LOCUS_25610 5929 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 7031 6138 gene locus_tag LOCUS_25620 7031 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 7199 7271 gene locus_tag LOCUS_t00370 7199 7271 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence250 <1 800 gene locus_tag LOCUS_25630 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q727A5:glutamine--tRNA ligase 1652 807 gene locus_tag LOCUS_25640 1652 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2370 1645 gene locus_tag LOCUS_25650 gene cmk 2370 1645 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQQ0 protein_id gnl|my_center|LOCUS_25650 2734 3933 gene locus_tag LOCUS_25660 2734 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 4143 6155 gene locus_tag LOCUS_25670 4143 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 <7321 6213 gene locus_tag LOCUS_25680 <7321 6213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028387.1:tRNA dihydrouridine synthase DusB >Feature sequence251 1975 1409 gene locus_tag LOCUS_25690 1975 1409 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_25690 5054 2193 gene locus_tag LOCUS_25700 5054 2193 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120680.1 protein_id gnl|my_center|LOCUS_25700 6571 5246 gene locus_tag LOCUS_25710 6571 5246 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence252 379 1638 gene locus_tag LOCUS_25720 379 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2166 1699 gene locus_tag LOCUS_25730 2166 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2260 3438 gene locus_tag LOCUS_25740 gene metX 2260 3438 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7P4 protein_id gnl|my_center|LOCUS_25740 5081 3510 gene locus_tag LOCUS_25750 5081 3510 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_25750 <7254 5353 gene locus_tag LOCUS_25760 <7254 5353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DHH0:endoglucanase >Feature sequence253 314 4159 gene locus_tag LOCUS_25770 314 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 4255 5958 gene locus_tag LOCUS_25780 4255 5958 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330716.1 protein_id gnl|my_center|LOCUS_25780 6012 6869 gene locus_tag LOCUS_25790 6012 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259458.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence254 <1 1326 gene locus_tag LOCUS_25800 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121470.1:peptidase M16 2409 1402 gene locus_tag LOCUS_25810 2409 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121285.1 protein_id gnl|my_center|LOCUS_25810 2827 3255 gene locus_tag LOCUS_25820 2827 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 4519 3695 gene locus_tag LOCUS_25830 gene gdh 4519 3695 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_25830 6234 5197 gene locus_tag LOCUS_25840 gene adh 6234 5197 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence255 2535 1450 gene locus_tag LOCUS_25850 2535 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 3383 2535 gene locus_tag LOCUS_25860 3383 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 5368 3392 gene locus_tag LOCUS_25870 5368 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 6347 5430 gene locus_tag LOCUS_25880 6347 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence256 1775 2278 gene locus_tag LOCUS_25890 1775 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 2397 3593 gene locus_tag LOCUS_25900 gene carA 2397 3593 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_25900 3680 4141 gene locus_tag LOCUS_25910 gene ndk 3680 4141 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK7 protein_id gnl|my_center|LOCUS_25910 4231 5802 gene locus_tag LOCUS_25920 4231 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 <7174 6089 gene locus_tag LOCUS_25930 <7174 6089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119535.1:iduronate-2-sulfatase >Feature sequence257 227 1513 gene locus_tag LOCUS_25940 gene gltA 227 1513 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF3 protein_id gnl|my_center|LOCUS_25940 2974 1586 gene locus_tag LOCUS_25950 2974 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_25950 3040 3393 gene locus_tag LOCUS_25960 3040 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 5150 3528 gene locus_tag LOCUS_25970 gene pckA2 5150 3528 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S008 protein_id gnl|my_center|LOCUS_25970 5302 6732 gene locus_tag LOCUS_25980 5302 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence258 <1 1425 gene locus_tag LOCUS_25990 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121346.1:DEAD/DEAH box helicase 1704 2522 gene locus_tag LOCUS_26000 1704 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2596 3804 gene locus_tag LOCUS_26010 2596 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 3978 5126 gene locus_tag LOCUS_26020 3978 5126 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_26020 6212 5208 gene locus_tag LOCUS_26030 6212 5208 CDS product stearoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120146.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence259 526 2811 gene locus_tag LOCUS_26040 526 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 4470 2914 gene locus_tag LOCUS_26050 gene comM 4470 2914 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_26050 5745 4567 gene locus_tag LOCUS_26060 5745 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 6495 5992 gene locus_tag LOCUS_26070 6495 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 6658 6574 gene locus_tag LOCUS_t00380 6658 6574 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence260 117 359 gene locus_tag LOCUS_26080 117 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 763 413 gene locus_tag LOCUS_26090 763 413 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_26090 1680 955 gene locus_tag LOCUS_26100 1680 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1646 2107 gene locus_tag LOCUS_26110 1646 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3345 2125 gene locus_tag LOCUS_26120 gene fabH 3345 2125 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123917.1 protein_id gnl|my_center|LOCUS_26120 3666 3469 gene locus_tag LOCUS_26130 3666 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 4075 4857 gene locus_tag LOCUS_26140 4075 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 6119 5121 gene locus_tag LOCUS_26150 6119 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 <7083 6305 gene locus_tag LOCUS_26160 <7083 6305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263951.1:RTX toxin >Feature sequence261 1447 4437 gene locus_tag LOCUS_26170 1447 4437 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117769.1 protein_id gnl|my_center|LOCUS_26170 4629 5864 gene locus_tag LOCUS_26180 4629 5864 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence262 2885 3733 gene locus_tag LOCUS_26190 2885 3733 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_26190 3816 4103 gene locus_tag LOCUS_26200 3816 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 4430 5365 gene locus_tag LOCUS_26210 gene xerC 4430 5365 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQK2 protein_id gnl|my_center|LOCUS_26210 5607 5912 gene locus_tag LOCUS_26220 5607 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 6101 6174 gene locus_tag LOCUS_t00390 6101 6174 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence263 <1 1342 gene locus_tag LOCUS_26230 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGK9:signal peptidase I 1533 3422 gene locus_tag LOCUS_26240 gene lepB 1533 3422 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGK9 protein_id gnl|my_center|LOCUS_26240 4209 3499 gene locus_tag LOCUS_26250 4209 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 4454 5683 gene locus_tag LOCUS_26260 4454 5683 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence264 264 2177 gene locus_tag LOCUS_26270 264 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2354 4024 gene locus_tag LOCUS_26280 2354 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 4021 5322 gene locus_tag LOCUS_26290 4021 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_26290 6385 5348 gene locus_tag LOCUS_26300 6385 5348 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121388.1 protein_id gnl|my_center|LOCUS_26300 6442 6645 gene locus_tag LOCUS_26310 6442 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence265 1792 845 gene locus_tag LOCUS_26320 1792 845 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070486.1 protein_id gnl|my_center|LOCUS_26320 2312 1857 gene locus_tag LOCUS_26330 2312 1857 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 protein_id gnl|my_center|LOCUS_26330 2632 3717 gene locus_tag LOCUS_26340 gene ald 2632 3717 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXF1 protein_id gnl|my_center|LOCUS_26340 5100 3787 gene locus_tag LOCUS_26350 5100 3787 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118912.1 protein_id gnl|my_center|LOCUS_26350 5263 6243 gene locus_tag LOCUS_26360 5263 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 6655 6308 gene locus_tag LOCUS_26370 gene yisB 6655 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06715 protein_id gnl|my_center|LOCUS_26370 >Feature sequence266 2394 1084 gene locus_tag LOCUS_26380 gene tadA 2394 1084 CDS product secretion system protein TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120689.1 protein_id gnl|my_center|LOCUS_26380 2751 3425 gene locus_tag LOCUS_26390 2751 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3448 4059 gene locus_tag LOCUS_26400 3448 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142658.1 protein_id gnl|my_center|LOCUS_26400 4220 5713 gene locus_tag LOCUS_26410 gene uxaA 4220 5713 CDS product altronate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919362.1 protein_id gnl|my_center|LOCUS_26410 6709 5873 gene locus_tag LOCUS_26420 6709 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence267 45 5180 gene locus_tag LOCUS_26430 45 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120000.1 protein_id gnl|my_center|LOCUS_26430 5507 5244 gene locus_tag LOCUS_26440 5507 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 5573 6277 gene locus_tag LOCUS_26450 5573 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence268 395 5503 gene locus_tag LOCUS_26460 395 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 6281 5535 gene locus_tag LOCUS_26470 6281 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence269 769 1440 gene locus_tag LOCUS_26480 769 1440 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705141.1 protein_id gnl|my_center|LOCUS_26480 2359 1538 gene locus_tag LOCUS_26490 gene trpA 2359 1538 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URN0 protein_id gnl|my_center|LOCUS_26490 3258 2881 gene locus_tag LOCUS_26500 3258 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 3332 4666 gene locus_tag LOCUS_26510 3332 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_26510 5321 4719 gene locus_tag LOCUS_26520 5321 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 5999 5334 gene locus_tag LOCUS_26530 5999 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence270 <1 1086 gene locus_tag LOCUS_26540 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120940.1:sugar ABC transporter substrate-binding protein 1207 2349 gene locus_tag LOCUS_26550 1207 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_26550 3000 2365 gene locus_tag LOCUS_26560 3000 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 4076 3078 gene locus_tag LOCUS_26570 4076 3078 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120402.1 protein_id gnl|my_center|LOCUS_26570 4851 4396 gene locus_tag LOCUS_26580 4851 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence271 169 1956 gene locus_tag LOCUS_26590 169 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2906 1971 gene locus_tag LOCUS_26600 2906 1971 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337243.1 protein_id gnl|my_center|LOCUS_26600 4644 2947 gene locus_tag LOCUS_26610 gene ilvD 4644 2947 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118389.1 protein_id gnl|my_center|LOCUS_26610 4746 5744 gene locus_tag LOCUS_26620 4746 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 <6784 5683 gene locus_tag LOCUS_26630 <6784 5683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122824.1:gluconate permease >Feature sequence272 3651 115 gene locus_tag LOCUS_26640 3651 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 4022 4930 gene locus_tag LOCUS_26650 4022 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 5064 5909 gene locus_tag LOCUS_26660 5064 5909 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123406.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence273 2531 960 gene locus_tag LOCUS_26670 2531 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3172 2594 gene locus_tag LOCUS_26680 3172 2594 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258966.1 protein_id gnl|my_center|LOCUS_26680 5205 3352 gene locus_tag LOCUS_26690 gene xlnC 5205 3352 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122162.1 protein_id gnl|my_center|LOCUS_26690 6249 5305 gene locus_tag LOCUS_26700 6249 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence274 <1 688 gene locus_tag LOCUS_26710 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZX9:diaminopimelate decarboxylase 792 1235 gene locus_tag LOCUS_26720 792 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1503 2519 gene locus_tag LOCUS_26730 gene aroG-2 1503 2519 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_26730 2652 3302 gene locus_tag LOCUS_26740 2652 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3370 4452 gene locus_tag LOCUS_26750 gene mnmA 3370 4452 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ4 protein_id gnl|my_center|LOCUS_26750 6174 4456 gene locus_tag LOCUS_26760 6174 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence275 559 47 gene locus_tag LOCUS_26770 559 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121594.1 protein_id gnl|my_center|LOCUS_26770 1204 2148 gene locus_tag LOCUS_26780 1204 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 3062 2217 gene locus_tag LOCUS_26790 gene guaA 3062 2217 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_26790 3611 4123 gene locus_tag LOCUS_26800 3611 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 4460 4098 gene locus_tag LOCUS_26810 4460 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 4567 5343 gene locus_tag LOCUS_26820 gene ypuG 4567 5343 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327962.1 protein_id gnl|my_center|LOCUS_26820 5458 5386 gene locus_tag LOCUS_t00400 5458 5386 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5558 6598 gene locus_tag LOCUS_26830 gene bioB 5558 6598 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF84 protein_id gnl|my_center|LOCUS_26830 >Feature sequence276 395 2419 gene locus_tag LOCUS_26840 gene yoaA 395 2419 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_26840 2531 4000 gene locus_tag LOCUS_26850 2531 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 4560 4144 gene locus_tag LOCUS_26860 4560 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4671 5711 gene locus_tag LOCUS_26870 gene adhP 4671 5711 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence277 1300 686 gene locus_tag LOCUS_26880 1300 686 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328411.1 protein_id gnl|my_center|LOCUS_26880 1823 1293 gene locus_tag LOCUS_26890 1823 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3470 2133 gene locus_tag LOCUS_26900 3470 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_26900 6030 3574 gene locus_tag LOCUS_26910 6030 3574 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121151.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence278 283 2016 gene locus_tag LOCUS_26920 283 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_26920 2444 2644 gene locus_tag LOCUS_26930 2444 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2960 3391 gene locus_tag LOCUS_26940 2960 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3832 5118 gene locus_tag LOCUS_26950 3832 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 5700 5158 gene locus_tag LOCUS_26960 gene pfpI 5700 5158 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121904.1 protein_id gnl|my_center|LOCUS_26960 6131 5787 gene locus_tag LOCUS_26970 6131 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence279 540 1433 gene locus_tag LOCUS_26980 gene hisG 540 1433 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_26980 2512 1565 gene locus_tag LOCUS_26990 gene hemC 2512 1565 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I1 protein_id gnl|my_center|LOCUS_26990 3819 2722 gene locus_tag LOCUS_27000 3819 2722 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122013.1 protein_id gnl|my_center|LOCUS_27000 4089 5267 gene locus_tag LOCUS_27010 4089 5267 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQD2 protein_id gnl|my_center|LOCUS_27010 5325 6101 gene locus_tag LOCUS_27020 5325 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence280 462 1097 gene locus_tag LOCUS_27030 462 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 1321 2040 gene locus_tag LOCUS_27040 1321 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2898 2131 gene locus_tag LOCUS_27050 2898 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 3239 5671 gene locus_tag LOCUS_27060 3239 5671 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_27060 6395 5655 gene locus_tag LOCUS_27070 6395 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence281 <1 1434 gene locus_tag LOCUS_27080 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123565.1:exopolyphosphatase 2915 1659 gene locus_tag LOCUS_27090 2915 1659 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120143.1 protein_id gnl|my_center|LOCUS_27090 3953 3144 gene locus_tag LOCUS_27100 3953 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 4316 5026 gene locus_tag LOCUS_27110 4316 5026 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328113.1 protein_id gnl|my_center|LOCUS_27110 5102 5980 gene locus_tag LOCUS_27120 5102 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence282 352 80 gene locus_tag LOCUS_27130 352 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1974 673 gene locus_tag LOCUS_27140 gene ftsA 1974 673 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_27140 2428 2165 gene locus_tag LOCUS_27150 2428 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2639 3160 gene locus_tag LOCUS_27160 2639 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123400.1 protein_id gnl|my_center|LOCUS_27160 3274 5070 gene locus_tag LOCUS_27170 3274 5070 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence283 365 1723 gene locus_tag LOCUS_27180 365 1723 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_27180 3025 1979 gene locus_tag LOCUS_27190 3025 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118962.1 protein_id gnl|my_center|LOCUS_27190 3960 3076 gene locus_tag LOCUS_27200 3960 3076 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122511.1 protein_id gnl|my_center|LOCUS_27200 4143 5543 gene locus_tag LOCUS_27210 gene atsG 4143 5543 CDS product sulfatase atsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122623.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence284 1790 1134 gene locus_tag LOCUS_27220 gene adk 1790 1134 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_27220 2514 1906 gene locus_tag LOCUS_27230 gene rpsD 2514 1906 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM6 protein_id gnl|my_center|LOCUS_27230 2640 3422 gene locus_tag LOCUS_27240 gene purE 2640 3422 CDS product phosphoribosyl carboxyaminoimidazole mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 protein_id gnl|my_center|LOCUS_27240 3689 4534 gene locus_tag LOCUS_27250 3689 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334335.1 protein_id gnl|my_center|LOCUS_27250 4703 5251 gene locus_tag LOCUS_27260 4703 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence285 42 2045 gene locus_tag LOCUS_27270 gene argS 42 2045 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URC7 protein_id gnl|my_center|LOCUS_27270 2129 2827 gene locus_tag LOCUS_27280 2129 2827 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKI6 protein_id gnl|my_center|LOCUS_27280 4420 2858 gene locus_tag LOCUS_27290 gene rbsA 4420 2858 CDS product ribose import ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDI2 protein_id gnl|my_center|LOCUS_27290 5732 4527 gene locus_tag LOCUS_27300 5732 4527 CDS product inner-membrane translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370536.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence286 287 1258 gene locus_tag LOCUS_27310 287 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1430 2836 gene locus_tag LOCUS_27320 1430 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 4120 2882 gene locus_tag LOCUS_27330 4120 2882 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338163.1 protein_id gnl|my_center|LOCUS_27330 4572 5714 gene locus_tag LOCUS_27340 4572 5714 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence287 1822 656 gene locus_tag LOCUS_27350 1822 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 3294 2140 gene locus_tag LOCUS_27360 3294 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3809 3375 gene locus_tag LOCUS_27370 3809 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence288 779 1321 gene locus_tag LOCUS_27380 gene rplM 779 1321 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1G5 protein_id gnl|my_center|LOCUS_27380 1390 2229 gene locus_tag LOCUS_27390 1390 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2735 2295 gene locus_tag LOCUS_27400 2735 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3322 2798 gene locus_tag LOCUS_27410 3322 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 3388 5679 gene locus_tag LOCUS_27420 gene sps 3388 5679 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence289 2513 3916 gene locus_tag LOCUS_27430 2513 3916 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328770.1 protein_id gnl|my_center|LOCUS_27430 4167 4883 gene locus_tag LOCUS_27440 4167 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 5141 5980 gene locus_tag LOCUS_27450 5141 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence290 4324 911 gene locus_tag LOCUS_27460 4324 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 4768 5913 gene locus_tag LOCUS_27470 4768 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence291 <1 1091 gene locus_tag LOCUS_27480 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122678.1:twitching motility protein PilT 1157 2524 gene locus_tag LOCUS_27490 1157 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 3300 2584 gene locus_tag LOCUS_27500 3300 2584 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_27500 3917 3447 gene locus_tag LOCUS_27510 3917 3447 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118745.1 protein_id gnl|my_center|LOCUS_27510 5218 4256 gene locus_tag LOCUS_27520 5218 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 <6118 5338 gene locus_tag LOCUS_27530 <6118 5338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UEX1:phosphoglycerate kinase >Feature sequence292 <1 633 gene locus_tag LOCUS_27540 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UF90:methylthioribose-1-phosphate isomerase 849 1154 gene locus_tag LOCUS_27550 849 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1411 4017 gene locus_tag LOCUS_27560 1411 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 4082 5896 gene locus_tag LOCUS_27570 4082 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence293 347 2656 gene locus_tag LOCUS_27580 gene agrA 347 2656 CDS product beta-agarase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119353.1 protein_id gnl|my_center|LOCUS_27580 2956 3861 gene locus_tag LOCUS_27590 2956 3861 CDS product large multifunctional protein- glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120043.1 protein_id gnl|my_center|LOCUS_27590 5740 4670 gene locus_tag LOCUS_27600 5740 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence294 1642 917 gene locus_tag LOCUS_27610 1642 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4024 2330 gene locus_tag LOCUS_27620 4024 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 5689 4352 gene locus_tag LOCUS_27630 5689 4352 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118005.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence295 740 1681 gene locus_tag LOCUS_27640 740 1681 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119904.1 protein_id gnl|my_center|LOCUS_27640 3004 1898 gene locus_tag LOCUS_27650 3004 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256855.1 protein_id gnl|my_center|LOCUS_27650 3819 3148 gene locus_tag LOCUS_27660 3819 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_27660 4472 3903 gene locus_tag LOCUS_27670 4472 3903 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_27670 5011 4607 gene locus_tag LOCUS_27680 5011 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence296 639 3371 gene locus_tag LOCUS_27690 639 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 4468 3446 gene locus_tag LOCUS_27700 4468 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 5435 5334 gene locus_tag LOCUS_r00010 5435 5334 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence297 466 1854 gene locus_tag LOCUS_27710 466 1854 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_27710 2119 1883 gene locus_tag LOCUS_27720 2119 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 2012 2830 gene locus_tag LOCUS_27730 2012 2830 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530346.1 protein_id gnl|my_center|LOCUS_27730 4877 3000 gene locus_tag LOCUS_27740 gene cstA 4877 3000 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_27740 5256 5528 gene locus_tag LOCUS_27750 5256 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence298 2678 1983 gene locus_tag LOCUS_27760 2678 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2974 3609 gene locus_tag LOCUS_27770 2974 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 3788 4636 gene locus_tag LOCUS_27780 3788 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 4704 5294 gene locus_tag LOCUS_27790 4704 5294 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267101.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence299 1756 785 gene locus_tag LOCUS_27800 1756 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2804 1848 gene locus_tag LOCUS_27810 2804 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 3634 2918 gene locus_tag LOCUS_27820 3634 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123690.1 protein_id gnl|my_center|LOCUS_27820 4317 3670 gene locus_tag LOCUS_27830 4317 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123691.1 protein_id gnl|my_center|LOCUS_27830 5278 4397 gene locus_tag LOCUS_27840 gene rmlA 5278 4397 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 protein_id gnl|my_center|LOCUS_27840 >Feature sequence300 937 260 gene locus_tag LOCUS_27850 937 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1812 1021 gene locus_tag LOCUS_27860 1812 1021 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_27860 2245 1847 gene locus_tag LOCUS_27870 2245 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4268 2268 gene locus_tag LOCUS_27880 gene sdhA 4268 2268 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_27880 5228 4383 gene locus_tag LOCUS_27890 5228 4383 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence301 921 1637 gene locus_tag LOCUS_27900 921 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 2074 1730 gene locus_tag LOCUS_27910 2074 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 2208 4475 gene locus_tag LOCUS_27920 2208 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 4563 5132 gene locus_tag LOCUS_27930 4563 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence302 4185 2986 gene locus_tag LOCUS_27940 4185 2986 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_27940 4977 4258 gene locus_tag LOCUS_27950 4977 4258 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_27950 5481 5191 gene locus_tag LOCUS_27960 5481 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27960 >Feature sequence303 468 148 gene locus_tag LOCUS_27970 468 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1129 2106 gene locus_tag LOCUS_27980 gene pmi 1129 2106 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_27980 3570 2143 gene locus_tag LOCUS_27990 gene dpoL 3570 2143 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119624.1 protein_id gnl|my_center|LOCUS_27990 3649 4857 gene locus_tag LOCUS_28000 gene degP 3649 4857 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence304 <1 589 gene locus_tag LOCUS_28010 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122505.1:amidohydrolase 671 3475 gene locus_tag LOCUS_28020 gene ppc 671 3475 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHN1 protein_id gnl|my_center|LOCUS_28020 3714 3920 gene locus_tag LOCUS_28030 3714 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 4082 5044 gene locus_tag LOCUS_28040 4082 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence305 34 119 gene locus_tag LOCUS_t00410 34 119 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 489 157 gene locus_tag LOCUS_28050 489 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2635 692 gene locus_tag LOCUS_28060 gene secA2 2635 692 CDS product protein translocase subunit SecA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWI5 protein_id gnl|my_center|LOCUS_28060 2634 3563 gene locus_tag LOCUS_28070 2634 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 4615 3692 gene locus_tag LOCUS_28080 4615 3692 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence306 3564 1726 gene locus_tag LOCUS_28090 3564 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence307 1297 2316 gene locus_tag LOCUS_28100 1297 2316 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence308 2074 1439 gene locus_tag LOCUS_28110 2074 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 2150 2971 gene locus_tag LOCUS_28120 2150 2971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120863.1 protein_id gnl|my_center|LOCUS_28120 3085 3783 gene locus_tag LOCUS_28130 3085 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 3817 4290 gene locus_tag LOCUS_28140 gene gcvH 3817 4290 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121110.1 protein_id gnl|my_center|LOCUS_28140 4338 5300 gene locus_tag LOCUS_28150 4338 5300 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121488.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence309 >Feature sequence310 1833 2648 gene locus_tag LOCUS_28160 1833 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2719 3735 gene locus_tag LOCUS_28170 gene moxR 2719 3735 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121741.1 protein_id gnl|my_center|LOCUS_28170 3798 4727 gene locus_tag LOCUS_28180 3798 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence311 >Feature sequence312 343 861 gene locus_tag LOCUS_28190 343 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 1125 2012 gene locus_tag LOCUS_28200 gene uspA 1125 2012 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123122.1 protein_id gnl|my_center|LOCUS_28200 2105 3307 gene locus_tag LOCUS_28210 2105 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3361 4356 gene locus_tag LOCUS_28220 gene ldhA 3361 4356 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence313 3722 3297 gene locus_tag LOCUS_28230 3722 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3954 4991 gene locus_tag LOCUS_28240 3954 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence314 2821 1598 gene locus_tag LOCUS_28250 2821 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_28250 3927 2920 gene locus_tag LOCUS_28260 3927 2920 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence315 1401 340 gene locus_tag LOCUS_28270 1401 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence316 2618 336 gene locus_tag LOCUS_28280 2618 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3454 2741 gene locus_tag LOCUS_28290 3454 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 <5432 3562 gene locus_tag LOCUS_28300 <5432 3562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UR95:polyribonucleotide nucleotidyltransferase >Feature sequence317 641 45 gene locus_tag LOCUS_28310 641 45 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121754.1 protein_id gnl|my_center|LOCUS_28310 1625 792 gene locus_tag LOCUS_28320 gene trpC 1625 792 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ7 protein_id gnl|my_center|LOCUS_28320 1694 2572 gene locus_tag LOCUS_28330 1694 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2565 2957 gene locus_tag LOCUS_28340 2565 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 4685 3129 gene locus_tag LOCUS_28350 gene leuA 4685 3129 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI51 protein_id gnl|my_center|LOCUS_28350 >Feature sequence318 32 1627 gene locus_tag LOCUS_28360 32 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2003 3808 gene locus_tag LOCUS_28370 2003 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 4985 3894 gene locus_tag LOCUS_28380 4985 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence319 137 913 gene locus_tag LOCUS_28390 gene kdsB 137 913 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI86 protein_id gnl|my_center|LOCUS_28390 1126 2757 gene locus_tag LOCUS_28400 gene pyrG 1126 2757 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_28400 3207 2764 gene locus_tag LOCUS_28410 3207 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193935.1 protein_id gnl|my_center|LOCUS_28410 3674 3204 gene locus_tag LOCUS_28420 3674 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 4855 3854 gene locus_tag LOCUS_28430 4855 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence320 2317 281 gene locus_tag LOCUS_28440 2317 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122005.1 protein_id gnl|my_center|LOCUS_28440 3874 2429 gene locus_tag LOCUS_28450 3874 2429 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117864.1 protein_id gnl|my_center|LOCUS_28450 5156 3882 gene locus_tag LOCUS_28460 5156 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence321 3546 439 gene locus_tag LOCUS_28470 gene valS 3546 439 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXH9 protein_id gnl|my_center|LOCUS_28470 5266 3638 gene locus_tag LOCUS_28480 gene leuA 5266 3638 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_28480 >Feature sequence322 744 962 gene locus_tag LOCUS_28490 744 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1135 1668 gene locus_tag LOCUS_28500 1135 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1716 3449 gene locus_tag LOCUS_28510 gene flgK 1716 3449 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence323 1 1416 gene locus_tag LOCUS_28520 1 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 1453 2796 gene locus_tag LOCUS_28530 1453 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_28530 2877 3827 gene locus_tag LOCUS_28540 2877 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 5264 3867 gene locus_tag LOCUS_28550 5264 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence324 5044 974 gene locus_tag LOCUS_28560 5044 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence325 >Feature sequence326 1032 40 gene locus_tag LOCUS_28570 1032 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 1913 1113 gene locus_tag LOCUS_28580 gene flgG 1913 1113 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329888.1 protein_id gnl|my_center|LOCUS_28580 2733 1978 gene locus_tag LOCUS_28590 gene flgF 2733 1978 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ26 protein_id gnl|my_center|LOCUS_28590 >Feature sequence327 1846 2556 gene locus_tag LOCUS_28600 1846 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3780 2632 gene locus_tag LOCUS_28610 3780 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120614.1 protein_id gnl|my_center|LOCUS_28610 4849 3908 gene locus_tag LOCUS_28620 gene prs 4849 3908 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPM4 protein_id gnl|my_center|LOCUS_28620 >Feature sequence328 <1 1888 gene locus_tag LOCUS_28630 <1 1888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIR9:DNA helicase 4659 1903 gene locus_tag LOCUS_28640 4659 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence329 1561 1262 gene locus_tag LOCUS_28650 1561 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2145 1558 gene locus_tag LOCUS_28660 gene ndhG 2145 1558 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124337.1 protein_id gnl|my_center|LOCUS_28660 3319 2192 gene locus_tag LOCUS_28670 gene nuoH 3319 2192 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 protein_id gnl|my_center|LOCUS_28670 4774 3353 gene locus_tag LOCUS_28680 gene hemY 4774 3353 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence330 1035 175 gene locus_tag LOCUS_28690 1035 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1152 2471 gene locus_tag LOCUS_28700 1152 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 4808 2706 gene locus_tag LOCUS_28710 4808 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence331 2655 862 gene locus_tag LOCUS_28720 2655 862 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_28720 3320 2652 gene locus_tag LOCUS_28730 3320 2652 CDS product type I-C CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_28730 <5249 3347 gene locus_tag LOCUS_28740 <5249 3347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176706.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence332 1855 668 gene locus_tag LOCUS_28750 1855 668 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405425.1 protein_id gnl|my_center|LOCUS_28750 4744 2075 gene locus_tag LOCUS_28760 4744 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence333 <1 1687 gene locus_tag LOCUS_28770 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118999.1:cytochrome c 3720 1663 gene locus_tag LOCUS_28780 3720 1663 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHD9 protein_id gnl|my_center|LOCUS_28780 4104 5018 gene locus_tag LOCUS_28790 4104 5018 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404431.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence334 1606 749 gene locus_tag LOCUS_28800 1606 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 2534 2127 gene locus_tag LOCUS_28810 2534 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 2937 2572 gene locus_tag LOCUS_28820 gene cadC 2937 2572 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678450.1 protein_id gnl|my_center|LOCUS_28820 3324 3250 gene locus_tag LOCUS_t00420 3324 3250 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3534 4541 gene locus_tag LOCUS_28830 3534 4541 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence335 448 2958 gene locus_tag LOCUS_28840 448 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 4307 3075 gene locus_tag LOCUS_28850 4307 3075 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706251.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence336 350 3148 gene locus_tag LOCUS_28860 gene topA 350 3148 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EC95 protein_id gnl|my_center|LOCUS_28860 3875 3288 gene locus_tag LOCUS_28870 3875 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 4882 3932 gene locus_tag LOCUS_28880 gene fmt 4882 3932 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T0 protein_id gnl|my_center|LOCUS_28880 >Feature sequence337 2805 1666 gene locus_tag LOCUS_28890 2805 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122487.1 protein_id gnl|my_center|LOCUS_28890 3577 3326 gene locus_tag LOCUS_28900 3577 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3459 4181 gene locus_tag LOCUS_28910 3459 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 <5018 4377 gene locus_tag LOCUS_28920 <5018 4377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122696.1:phytoene desaturase >Feature sequence338 354 1520 gene locus_tag LOCUS_28930 354 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2572 1544 gene locus_tag LOCUS_28940 gene accA 2572 1544 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY7 protein_id gnl|my_center|LOCUS_28940 4259 2772 gene locus_tag LOCUS_28950 4259 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 4442 4726 gene locus_tag LOCUS_28960 4442 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence339 1140 2519 gene locus_tag LOCUS_28970 1140 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 2726 4264 gene locus_tag LOCUS_28980 2726 4264 CDS product teichoic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence340 1013 174 gene locus_tag LOCUS_28990 gene mutM 1013 174 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_28990 1383 3077 gene locus_tag LOCUS_29000 1383 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119040.1 protein_id gnl|my_center|LOCUS_29000 4071 3148 gene locus_tag LOCUS_29010 gene purU 4071 3148 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117816.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence341 4235 681 gene locus_tag LOCUS_29020 4235 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence342 228 1337 gene locus_tag LOCUS_29030 228 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1536 2885 gene locus_tag LOCUS_29040 1536 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3004 4836 gene locus_tag LOCUS_29050 3004 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence343 97 1245 gene locus_tag LOCUS_29060 97 1245 CDS product X-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_29060 1429 1965 gene locus_tag LOCUS_29070 gene accB 1429 1965 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121914.1 protein_id gnl|my_center|LOCUS_29070 2097 3443 gene locus_tag LOCUS_29080 gene accC 2097 3443 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence344 879 1115 gene locus_tag LOCUS_29090 879 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 2611 1298 gene locus_tag LOCUS_29100 gene xylA 2611 1298 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG2 protein_id gnl|my_center|LOCUS_29100 2907 4595 gene locus_tag LOCUS_29110 2907 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence345 2119 698 gene locus_tag LOCUS_29120 2119 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3323 2112 gene locus_tag LOCUS_29130 3323 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 4492 3491 gene locus_tag LOCUS_29140 4492 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence346 <1 604 gene locus_tag LOCUS_29150 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNW7:tetraacyldisaccharide 4'-kinase 682 1161 gene locus_tag LOCUS_29160 682 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121836.1 protein_id gnl|my_center|LOCUS_29160 1228 1977 gene locus_tag LOCUS_29170 1228 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3189 2044 gene locus_tag LOCUS_29180 3189 2044 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_29180 3394 4506 gene locus_tag LOCUS_29190 3394 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence347 >Feature sequence348 660 3968 gene locus_tag LOCUS_29200 660 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence349 207 133 gene locus_tag LOCUS_t00430 207 133 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 450 704 gene locus_tag LOCUS_29210 450 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 1514 981 gene locus_tag LOCUS_29220 1514 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335171.1 protein_id gnl|my_center|LOCUS_29220 1840 3168 gene locus_tag LOCUS_29230 1840 3168 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence350 1509 94 gene locus_tag LOCUS_29240 1509 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_29240 4170 1654 gene locus_tag LOCUS_29250 4170 1654 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120392.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence351 209 1300 gene locus_tag LOCUS_29260 209 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118009.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence352 504 1838 gene locus_tag LOCUS_29270 504 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence353 194 1594 gene locus_tag LOCUS_29280 gene GALNS 194 1594 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_29280 1819 2235 gene locus_tag LOCUS_29290 1819 2235 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272503.1 protein_id gnl|my_center|LOCUS_29290 4504 2297 gene locus_tag LOCUS_29300 4504 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence354 2039 384 gene locus_tag LOCUS_29310 2039 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence355 >Feature sequence356 2834 1641 gene locus_tag LOCUS_29320 2834 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3952 2978 gene locus_tag LOCUS_29330 3952 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_29330 4450 3992 gene locus_tag LOCUS_29340 4450 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence357 2012 492 gene locus_tag LOCUS_29350 2012 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2787 4490 gene locus_tag LOCUS_29360 2787 4490 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence358 1219 314 gene locus_tag LOCUS_29370 gene dapA 1219 314 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122009.1 protein_id gnl|my_center|LOCUS_29370 2920 1295 gene locus_tag LOCUS_29380 2920 1295 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122008.1 protein_id gnl|my_center|LOCUS_29380 <4722 3211 gene locus_tag LOCUS_29390 <4722 3211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ECL7:alpha-N-acetylgalactosaminidase >Feature sequence359 136 423 gene locus_tag LOCUS_29400 136 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1239 856 gene locus_tag LOCUS_29410 1239 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1417 3984 gene locus_tag LOCUS_29420 1417 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29420 4484 4635 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agacgccgttcagatacaac >Feature sequence360 929 1897 gene locus_tag LOCUS_29430 929 1897 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121519.1 protein_id gnl|my_center|LOCUS_29430 2004 4529 gene locus_tag LOCUS_29440 2004 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence361 4590 1327 gene locus_tag LOCUS_29450 4590 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence362 1075 92 gene locus_tag LOCUS_29460 1075 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 1360 2769 gene locus_tag LOCUS_29470 1360 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2905 4413 gene locus_tag LOCUS_29480 2905 4413 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence363 261 1061 gene locus_tag LOCUS_29490 261 1061 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2I9 protein_id gnl|my_center|LOCUS_29490 1728 1099 gene locus_tag LOCUS_29500 1728 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 1959 2438 gene locus_tag LOCUS_29510 1959 2438 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_29510 2629 4608 gene locus_tag LOCUS_29520 2629 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence364 <1 3037 gene locus_tag LOCUS_29530 <1 3037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122272.1:cadherin 4590 3106 gene locus_tag LOCUS_29540 4590 3106 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence365 3697 2720 gene locus_tag LOCUS_29550 3697 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence366 1892 1038 gene locus_tag LOCUS_29560 gene lolI 1892 1038 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_29560 3496 2006 gene locus_tag LOCUS_29570 3496 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324153.1 protein_id gnl|my_center|LOCUS_29570 <4610 3666 gene locus_tag LOCUS_29580 <4610 3666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119978.1:asparagine synthetase B >Feature sequence367 989 723 gene locus_tag LOCUS_29590 989 723 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123140.1 protein_id gnl|my_center|LOCUS_29590 1140 2369 gene locus_tag LOCUS_29600 1140 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 <4568 2471 gene locus_tag LOCUS_29610 <4568 2471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJ52:threonine--tRNA ligase >Feature sequence368 251 1240 gene locus_tag LOCUS_29620 251 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 1556 2536 gene locus_tag LOCUS_29630 1556 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 3127 2567 gene locus_tag LOCUS_29640 gene frr 3127 2567 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH0 protein_id gnl|my_center|LOCUS_29640 >Feature sequence369 <1 1305 gene locus_tag LOCUS_29650 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057980.1:sodium-independent anion transporter 1375 3033 gene locus_tag LOCUS_29660 1375 3033 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120974.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence370 1419 121 gene locus_tag LOCUS_29670 1419 121 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173407.1 protein_id gnl|my_center|LOCUS_29670 2459 1416 gene locus_tag LOCUS_29680 2459 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence371 57 2096 gene locus_tag LOCUS_29690 57 2096 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P642 protein_id gnl|my_center|LOCUS_29690 <4416 2126 gene locus_tag LOCUS_29700 <4416 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121935.1:cytochrome c biogenesis protein >Feature sequence372 1833 298 gene locus_tag LOCUS_29710 1833 298 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_29710 2075 2425 gene locus_tag LOCUS_29720 2075 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 2971 2501 gene locus_tag LOCUS_29730 2971 2501 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325393.1 protein_id gnl|my_center|LOCUS_29730 <4412 3161 gene locus_tag LOCUS_29740 <4412 3161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WG75:UDP-N-acetylmuramoylalanine--D-glutamate ligase >Feature sequence373 897 1481 gene locus_tag LOCUS_29750 897 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 2443 1751 gene locus_tag LOCUS_29760 2443 1751 CDS product phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876307.1 protein_id gnl|my_center|LOCUS_29760 3548 2640 gene locus_tag LOCUS_29770 3548 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence374 >Feature sequence375 788 3025 gene locus_tag LOCUS_29780 788 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3063 4001 gene locus_tag LOCUS_29790 3063 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence376 2204 1035 gene locus_tag LOCUS_29800 2204 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 <4342 2514 gene locus_tag LOCUS_29810 <4342 2514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMK2:transcription termination factor Rho >Feature sequence377 3233 1776 gene locus_tag LOCUS_29820 3233 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528777.1 protein_id gnl|my_center|LOCUS_29820 3993 3268 gene locus_tag LOCUS_29830 3993 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence378 960 811 gene locus_tag LOCUS_29840 960 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3073 1037 gene locus_tag LOCUS_29850 3073 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence379 <1 584 gene locus_tag LOCUS_29860 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123902.1:type IV fimbrial assembly protein PilB 749 1993 gene locus_tag LOCUS_29870 749 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2581 3729 gene locus_tag LOCUS_29880 2581 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence380 1193 246 gene locus_tag LOCUS_29890 gene ctaB 1193 246 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_29890 2206 1190 gene locus_tag LOCUS_29900 2206 1190 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123498.1 protein_id gnl|my_center|LOCUS_29900 2470 3093 gene locus_tag LOCUS_29910 2470 3093 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_29910 4044 3448 gene locus_tag LOCUS_29920 4044 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228758.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence381 1 375 gene locus_tag LOCUS_29930 1 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1430 501 gene locus_tag LOCUS_29940 1430 501 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120776.1 protein_id gnl|my_center|LOCUS_29940 1888 2238 gene locus_tag LOCUS_29950 1888 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334037.1 protein_id gnl|my_center|LOCUS_29950 3637 2510 gene locus_tag LOCUS_29960 3637 2510 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925739.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence382 1162 149 gene locus_tag LOCUS_29970 1162 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1366 2697 gene locus_tag LOCUS_29980 gene fabF 1366 2697 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118441.1 protein_id gnl|my_center|LOCUS_29980 3597 2809 gene locus_tag LOCUS_29990 3597 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence383 977 192 gene locus_tag LOCUS_30000 977 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 1029 1346 gene locus_tag LOCUS_30010 1029 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence384 1054 1671 gene locus_tag LOCUS_30020 1054 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028407.1 protein_id gnl|my_center|LOCUS_30020 3233 1848 gene locus_tag LOCUS_30030 3233 1848 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence385 2547 256 gene locus_tag LOCUS_30040 2547 256 CDS product NADH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121573.1 protein_id gnl|my_center|LOCUS_30040 3768 2677 gene locus_tag LOCUS_30050 gene gmd 3768 2677 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVN3 protein_id gnl|my_center|LOCUS_30050 >Feature sequence386 1483 716 gene locus_tag LOCUS_30060 1483 716 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_30060 2713 1724 gene locus_tag LOCUS_30070 2713 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 <4198 2836 gene locus_tag LOCUS_30080 <4198 2836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851183.1:MFS transporter >Feature sequence387 2238 697 gene locus_tag LOCUS_30090 2238 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 4141 2639 gene locus_tag LOCUS_30100 4141 2639 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120948.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence388 846 2900 gene locus_tag LOCUS_30110 846 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence389 1900 365 gene locus_tag LOCUS_30120 1900 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3871 2141 gene locus_tag LOCUS_30130 3871 2141 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence390 1480 3093 gene locus_tag LOCUS_30140 1480 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 4051 3209 gene locus_tag LOCUS_30150 gene yjfH 4051 3209 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence391 2222 1701 gene locus_tag LOCUS_30160 2222 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 3600 2485 gene locus_tag LOCUS_30170 gene nifS 3600 2485 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122862.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence392 382 17 gene locus_tag LOCUS_30180 382 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 2527 446 gene locus_tag LOCUS_30190 2527 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3620 2730 gene locus_tag LOCUS_30200 3620 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence393 2853 139 gene locus_tag LOCUS_30210 2853 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 3707 2850 gene locus_tag LOCUS_30220 3707 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence394 <1 1431 gene locus_tag LOCUS_30230 <1 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:surface protein 1797 2030 gene locus_tag LOCUS_30240 1797 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2030 2260 gene locus_tag LOCUS_30250 2030 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence395 >Feature sequence396 3199 2213 gene locus_tag LOCUS_30260 3199 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence397 <1 1345 gene locus_tag LOCUS_30270 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256937.1:ABC transporter 1483 2211 gene locus_tag LOCUS_30280 1483 2211 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_30280 3558 2314 gene locus_tag LOCUS_30290 3558 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence398 426 1163 gene locus_tag LOCUS_30300 426 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 1652 3103 gene locus_tag LOCUS_30310 1652 3103 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120382.1 protein_id gnl|my_center|LOCUS_30310 >Feature sequence399 <1 823 gene locus_tag LOCUS_30320 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119438.1:ring canal kelch protein <3997 880 gene locus_tag LOCUS_30330 <3997 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205041.1:Ig-like domain repeat protein >Feature sequence400 47 2779 gene locus_tag LOCUS_30340 gene glnD 47 2779 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8U4 protein_id gnl|my_center|LOCUS_30340 <3985 2810 gene locus_tag LOCUS_30350 <3985 2810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405072.1:signal peptide peptidase SppA >Feature sequence401 117 1472 gene locus_tag LOCUS_30360 gene bioA 117 1472 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728P4 protein_id gnl|my_center|LOCUS_30360 1680 2222 gene locus_tag LOCUS_30370 1680 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 2470 3186 gene locus_tag LOCUS_30380 2470 3186 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence402 3287 492 gene locus_tag LOCUS_30390 3287 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 >Feature sequence403 1633 953 gene locus_tag LOCUS_30400 1633 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 1959 1863 gene locus_tag LOCUS_t00440 1959 1863 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2667 2284 gene locus_tag LOCUS_30410 2667 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence404 2073 1246 gene locus_tag LOCUS_30420 gene nth 2073 1246 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTL4 protein_id gnl|my_center|LOCUS_30420 2355 3077 gene locus_tag LOCUS_30430 2355 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 >Feature sequence405 930 1004 gene locus_tag LOCUS_t00450 930 1004 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2393 1110 gene locus_tag LOCUS_30440 2393 1110 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_30440 <3910 2442 gene locus_tag LOCUS_30450 <3910 2442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQN7:transcription-repair-coupling factor >Feature sequence406 328 1221 gene locus_tag LOCUS_30460 328 1221 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_30460 1416 2453 gene locus_tag LOCUS_30470 gene prfB 1416 2453 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL5 protein_id gnl|my_center|LOCUS_30470 2450 3691 gene locus_tag LOCUS_30480 2450 3691 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121268.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence407 1065 13 gene locus_tag LOCUS_30490 1065 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 2063 1242 gene locus_tag LOCUS_30500 2063 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence408 683 1639 gene locus_tag LOCUS_30510 683 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 2519 2052 gene locus_tag LOCUS_30520 gene rpiB 2519 2052 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120716.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence409 505 1488 gene locus_tag LOCUS_30530 gene mdh 505 1488 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C87 protein_id gnl|my_center|LOCUS_30530 >Feature sequence410 1295 2128 gene locus_tag LOCUS_30540 gene hydH 1295 2128 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121413.1 protein_id gnl|my_center|LOCUS_30540 3718 2249 gene locus_tag LOCUS_30550 3718 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence411 148 1044 gene locus_tag LOCUS_30560 148 1044 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815269.1 protein_id gnl|my_center|LOCUS_30560 1241 1945 gene locus_tag LOCUS_30570 1241 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 1974 2219 gene locus_tag LOCUS_30580 1974 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 2398 3162 gene locus_tag LOCUS_30590 2398 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence412 >Feature sequence413 2131 1562 gene locus_tag LOCUS_30600 2131 1562 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118125.1 protein_id gnl|my_center|LOCUS_30600 2397 2759 gene locus_tag LOCUS_30610 2397 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence414 544 1905 gene locus_tag LOCUS_30620 544 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121567.1 protein_id gnl|my_center|LOCUS_30620 2441 1920 gene locus_tag LOCUS_30630 2441 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 3114 2578 gene locus_tag LOCUS_30640 3114 2578 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_30640 >Feature sequence415 160 1608 gene locus_tag LOCUS_30650 gene glyQS 160 1608 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_30650 2160 1750 gene locus_tag LOCUS_30660 2160 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2587 2336 gene locus_tag LOCUS_30670 2587 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3369 2623 gene locus_tag LOCUS_30680 3369 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393576.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence416 309 1262 gene locus_tag LOCUS_30690 gene ctrB 309 1262 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122225.1 protein_id gnl|my_center|LOCUS_30690 1325 2182 gene locus_tag LOCUS_30700 1325 2182 CDS product squalene synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031162.1 protein_id gnl|my_center|LOCUS_30700 3447 2227 gene locus_tag LOCUS_30710 gene dinB 3447 2227 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_30710 >Feature sequence417 1865 216 gene locus_tag LOCUS_30720 1865 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140390.1 protein_id gnl|my_center|LOCUS_30720 2625 2071 gene locus_tag LOCUS_30730 2625 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 <3750 2789 gene locus_tag LOCUS_30740 <3750 2789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DH57:LL-diaminopimelate aminotransferase >Feature sequence418 2367 1699 gene locus_tag LOCUS_30750 2367 1699 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087572.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence419 3013 2045 gene locus_tag LOCUS_30760 3013 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 <3684 3125 gene locus_tag LOCUS_30770 <3684 3125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224990.1:dehydrogenase >Feature sequence420 >Feature sequence421 717 2561 gene locus_tag LOCUS_30780 717 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence422 175 513 gene locus_tag LOCUS_30790 175 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 537 971 gene locus_tag LOCUS_30800 537 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 2242 983 gene locus_tag LOCUS_30810 gene proA 2242 983 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNV2 protein_id gnl|my_center|LOCUS_30810 2415 3233 gene locus_tag LOCUS_30820 gene fabI-2 2415 3233 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3U2 protein_id gnl|my_center|LOCUS_30820 >Feature sequence423 2290 551 gene locus_tag LOCUS_30830 gene trxB 2290 551 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636459.2 protein_id gnl|my_center|LOCUS_30830 >Feature sequence424 297 2618 gene locus_tag LOCUS_30840 gene fdhF 297 2618 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_30840 2750 3238 gene locus_tag LOCUS_30850 2750 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120706.1 protein_id gnl|my_center|LOCUS_30850 >Feature sequence425 <1 767 gene locus_tag LOCUS_30860 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SME0:pyruvate kinase 1622 798 gene locus_tag LOCUS_30870 1622 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 2017 3291 gene locus_tag LOCUS_30880 2017 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 >Feature sequence426 2309 1593 gene locus_tag LOCUS_30890 2309 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3490 2441 gene locus_tag LOCUS_30900 3490 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence427 344 3409 gene locus_tag LOCUS_30910 344 3409 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120738.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence428 2275 1367 gene locus_tag LOCUS_30920 gene ilvE 2275 1367 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_30920 3451 2384 gene locus_tag LOCUS_30930 gene moxR 3451 2384 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123485.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence429 1519 2718 gene locus_tag LOCUS_30940 1519 2718 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029877.1 protein_id gnl|my_center|LOCUS_30940 <3606 3052 gene locus_tag LOCUS_30950 <3606 3052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119574.1:porin >Feature sequence430 <1 2409 gene locus_tag LOCUS_30960 <1 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMC0:leucine--tRNA ligase 2646 3116 gene locus_tag LOCUS_30970 2646 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence431 6 1064 gene locus_tag LOCUS_30980 6 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 2063 1419 gene locus_tag LOCUS_30990 2063 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 2597 2121 gene locus_tag LOCUS_31000 2597 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 <3587 2677 gene locus_tag LOCUS_31010 <3587 2677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392295.1:EscN/YscN/HrcN family type III secretion system ATPase >Feature sequence432 1308 463 gene locus_tag LOCUS_31020 1308 463 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_31020 1456 2895 gene locus_tag LOCUS_31030 gene rtcB 1456 2895 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_31030 3577 2948 gene locus_tag LOCUS_31040 3577 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 >Feature sequence433 313 2220 gene locus_tag LOCUS_31050 313 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence434 3028 2582 gene locus_tag LOCUS_31060 3028 2582 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence435 1209 946 gene locus_tag LOCUS_31070 1209 946 CDS product microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324357.1 protein_id gnl|my_center|LOCUS_31070 1537 1280 gene locus_tag LOCUS_31080 gene eutM 1537 1280 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_31080 2395 1613 gene locus_tag LOCUS_31090 2395 1613 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVJ7 protein_id gnl|my_center|LOCUS_31090 3281 2508 gene locus_tag LOCUS_31100 3281 2508 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence436 3 254 gene locus_tag LOCUS_31110 3 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 371 2065 gene locus_tag LOCUS_31120 371 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 2441 3148 gene locus_tag LOCUS_31130 2441 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence437 >Feature sequence438 2195 1554 gene locus_tag LOCUS_31140 2195 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2646 3161 gene locus_tag LOCUS_31150 2646 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence439 3028 1565 gene locus_tag LOCUS_31160 3028 1565 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117906.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence440 2382 2843 gene locus_tag LOCUS_31170 2382 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence441 <1 1126 gene locus_tag LOCUS_31180 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222016.1:patatin >Feature sequence442 1074 2183 gene locus_tag LOCUS_31190 gene lpxD 1074 2183 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEV1 protein_id gnl|my_center|LOCUS_31190 2235 3152 gene locus_tag LOCUS_31200 2235 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122809.1 protein_id gnl|my_center|LOCUS_31200 >Feature sequence443 1271 465 gene locus_tag LOCUS_31210 1271 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 2659 1523 gene locus_tag LOCUS_31220 gene lpsB 2659 1523 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence444 1005 2330 gene locus_tag LOCUS_31230 gene gdhA 1005 2330 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPH7 protein_id gnl|my_center|LOCUS_31230 2664 3347 gene locus_tag LOCUS_31240 2664 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence445 750 31 gene locus_tag LOCUS_31250 750 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 2322 1021 gene locus_tag LOCUS_31260 2322 1021 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_31260 <3403 2381 gene locus_tag LOCUS_31270 <3403 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205249.1:thioredoxin >Feature sequence446 38 703 gene locus_tag LOCUS_31280 38 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 700 1854 gene locus_tag LOCUS_31290 700 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1979 3052 gene locus_tag LOCUS_31300 1979 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence447 <1 3170 gene locus_tag LOCUS_31310 <1 3170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120005.1:protein-export membrane protein SecD >Feature sequence448 820 218 gene locus_tag LOCUS_31320 820 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 2303 870 gene locus_tag LOCUS_31330 2303 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence449 <1 1688 gene locus_tag LOCUS_31340 <1 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119295.1:cytochrome c 3352 1736 gene locus_tag LOCUS_31350 3352 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence450 270 1643 gene locus_tag LOCUS_31360 gene hflX 270 1643 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD7 protein_id gnl|my_center|LOCUS_31360 1815 2576 gene locus_tag LOCUS_31370 1815 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence451 403 1593 gene locus_tag LOCUS_31380 403 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence452 >Feature sequence453 2611 854 gene locus_tag LOCUS_31390 2611 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 1216 1312 gene locus_tag LOCUS_t00460 1216 1312 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence454 213 965 gene locus_tag LOCUS_31400 213 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 1048 1506 gene locus_tag LOCUS_31410 1048 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence455 <1 594 gene locus_tag LOCUS_31420 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324928.1:nitrate ABC transporter ATP-binding protein 812 1753 gene locus_tag LOCUS_31430 gene nrtD 812 1753 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324929.1 protein_id gnl|my_center|LOCUS_31430 1873 2874 gene locus_tag LOCUS_31440 1873 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence456 1185 652 gene locus_tag LOCUS_31450 1185 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1745 1185 gene locus_tag LOCUS_31460 1745 1185 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_31460 1920 2489 gene locus_tag LOCUS_31470 1920 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119419.1 protein_id gnl|my_center|LOCUS_31470 3167 2616 gene locus_tag LOCUS_31480 3167 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence457 533 1144 gene locus_tag LOCUS_31490 gene pyrE 533 1144 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYX5 protein_id gnl|my_center|LOCUS_31490 1236 2639 gene locus_tag LOCUS_31500 gene pgi 1236 2639 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYT0 protein_id gnl|my_center|LOCUS_31500 >Feature sequence458 75 737 gene locus_tag LOCUS_31510 75 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_31510 1078 1503 gene locus_tag LOCUS_31520 1078 1503 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_31520 >Feature sequence459 <1 1710 gene locus_tag LOCUS_31530 <1 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121676.1:protein kinase <3175 1760 gene locus_tag LOCUS_31540 <3175 1760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976195.1:sulfatase >Feature sequence460 105 590 gene locus_tag LOCUS_31550 105 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1018 2307 gene locus_tag LOCUS_31560 1018 2307 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_31560 2406 3077 gene locus_tag LOCUS_31570 2406 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence461 731 528 gene locus_tag LOCUS_31580 731 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 1270 938 gene locus_tag LOCUS_31590 1270 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2937 1267 gene locus_tag LOCUS_31600 2937 1267 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_31600 >Feature sequence462 <1 1238 gene locus_tag LOCUS_31610 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120886.1:glucan biosynthesis protein G 1238 1753 gene locus_tag LOCUS_31620 1238 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence463 510 671 gene locus_tag LOCUS_31630 510 671 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLW2 protein_id gnl|my_center|LOCUS_31630 970 1362 gene locus_tag LOCUS_31640 970 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 1509 2933 gene locus_tag LOCUS_31650 1509 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 >Feature sequence464 <1 1655 gene locus_tag LOCUS_31660 <1 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WYV0:UvrABC system protein A <3134 1742 gene locus_tag LOCUS_31670 <3134 1742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118163.1:acetylglucosamine-6-sulfatase >Feature sequence465 498 1547 gene locus_tag LOCUS_31680 gene ambC 498 1547 CDS product protein AmbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115897.1 protein_id gnl|my_center|LOCUS_31680 1771 3081 gene locus_tag LOCUS_31690 1771 3081 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence466 132 1388 gene locus_tag LOCUS_31700 132 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 1385 1999 gene locus_tag LOCUS_31710 1385 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence467 <1 1776 gene locus_tag LOCUS_31720 <1 1776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQL2:D-3-phosphoglycerate dehydrogenase 1882 3033 gene locus_tag LOCUS_31730 1882 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence468 417 1295 gene locus_tag LOCUS_31740 417 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224981.1 protein_id gnl|my_center|LOCUS_31740 1370 1795 gene locus_tag LOCUS_31750 1370 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence469 291 1256 gene locus_tag LOCUS_31760 291 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 1632 2504 gene locus_tag LOCUS_31770 1632 2504 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_31770 >Feature sequence470 147 797 gene locus_tag LOCUS_31780 147 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_31780 855 2165 gene locus_tag LOCUS_31790 855 2165 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122564.1 protein_id gnl|my_center|LOCUS_31790 <3086 2253 gene locus_tag LOCUS_31800 <3086 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122637.1:sulfate permease >Feature sequence471 >Feature sequence472 1328 1978 gene locus_tag LOCUS_31810 1328 1978 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882959.1 protein_id gnl|my_center|LOCUS_31810 1978 2397 gene locus_tag LOCUS_31820 1978 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 2538 2861 gene locus_tag LOCUS_31830 2538 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence473 1538 192 gene locus_tag LOCUS_31840 1538 192 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_31840 1164 1084 gene locus_tag LOCUS_t00470 1164 1084 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2287 1595 gene locus_tag LOCUS_31850 2287 1595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_31850 >Feature sequence474 <1 1614 gene locus_tag LOCUS_31860 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121893.1:secretion protein 1660 2826 gene locus_tag LOCUS_31870 gene mutY 1660 2826 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence475 <1 607 gene locus_tag LOCUS_31880 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122745.1:membrane protein 1975 737 gene locus_tag LOCUS_31890 gene yuxH 1975 737 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_31890 <3020 2273 gene locus_tag LOCUS_31900 <3020 2273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881603.1:histidine kinase >Feature sequence476 <3007 1639 gene locus_tag LOCUS_31910 <3007 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120925.1:transposase >Feature sequence477 2554 761 gene locus_tag LOCUS_31920 gene uup 2554 761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120247.1 protein_id gnl|my_center|LOCUS_31920 >Feature sequence478 850 2670 gene locus_tag LOCUS_31930 gene lepA1 850 2670 CDS product elongation factor 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX15 protein_id gnl|my_center|LOCUS_31930 >Feature sequence479 261 503 gene locus_tag LOCUS_31940 261 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 503 2230 gene locus_tag LOCUS_31950 503 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 2983 2300 gene locus_tag LOCUS_31960 2983 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence480 2118 715 gene locus_tag LOCUS_31970 2118 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 <2963 2274 gene locus_tag LOCUS_31980 <2963 2274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121996.1:aerotolerance regulator BatA >Feature sequence481 <2959 1893 gene locus_tag LOCUS_31990 <2959 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339612.1:phage portal protein >Feature sequence482 1328 1840 gene locus_tag LOCUS_32000 1328 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2562 1987 gene locus_tag LOCUS_32010 2562 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence483 1 330 gene locus_tag LOCUS_32020 1 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 444 517 gene locus_tag LOCUS_t00480 444 517 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 932 2434 gene locus_tag LOCUS_32030 gene tig 932 2434 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URG5 protein_id gnl|my_center|LOCUS_32030 >Feature sequence484 >Feature sequence485 1639 2190 gene locus_tag LOCUS_32040 gene nrdR 1639 2190 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182X3 protein_id gnl|my_center|LOCUS_32040 2312 2797 gene locus_tag LOCUS_32050 2312 2797 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence486 6 962 gene locus_tag LOCUS_32060 gene fliG 6 962 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337481.1 protein_id gnl|my_center|LOCUS_32060 1075 1743 gene locus_tag LOCUS_32070 1075 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 >Feature sequence487 839 2446 gene locus_tag LOCUS_32080 839 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 >Feature sequence488 <1 2106 gene locus_tag LOCUS_32090 <1 2106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121514.1:peptidase >Feature sequence489 587 883 gene locus_tag LOCUS_32100 587 883 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118932.1 protein_id gnl|my_center|LOCUS_32100 985 1869 gene locus_tag LOCUS_32110 985 1869 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_32110 1914 2837 gene locus_tag LOCUS_32120 gene ldh 1914 2837 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence490 1319 396 gene locus_tag LOCUS_32130 1319 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 1548 2648 gene locus_tag LOCUS_32140 1548 2648 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence491 >Feature sequence492 26 190 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcgatccacgcccccgtgagggggcgac 1167 475 gene locus_tag LOCUS_32150 1167 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1487 2221 gene locus_tag LOCUS_32160 1487 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119681.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence493 1646 756 gene locus_tag LOCUS_32170 1646 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence494 1643 2215 gene locus_tag LOCUS_32180 1643 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_32180 >Feature sequence495 >Feature sequence496 <2806 1591 gene locus_tag LOCUS_32190 <2806 1591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121006.1:arylsulfatase >Feature sequence497 424 1239 gene locus_tag LOCUS_32200 424 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence498 685 80 gene locus_tag LOCUS_32210 685 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 2573 753 gene locus_tag LOCUS_32220 gene oprO 2573 753 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117790.1 protein_id gnl|my_center|LOCUS_32220 >Feature sequence499 2294 345 gene locus_tag LOCUS_32230 gene pmm 2294 345 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence500 2572 641 gene locus_tag LOCUS_32240 2572 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence501 515 1186 gene locus_tag LOCUS_32250 515 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 1968 1528 gene locus_tag LOCUS_32260 1968 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1855 2220 gene locus_tag LOCUS_32270 1855 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 2230 2736 gene locus_tag LOCUS_32280 2230 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence502 696 1919 gene locus_tag LOCUS_32290 696 1919 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123564.1 protein_id gnl|my_center|LOCUS_32290 2633 2094 gene locus_tag LOCUS_32300 2633 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence503 <1 729 gene locus_tag LOCUS_32310 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UXN4:aldose 1-epimerase 2160 754 gene locus_tag LOCUS_32320 gene trx 2160 754 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120612.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence504 1283 1056 gene locus_tag LOCUS_32330 1283 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1672 1454 gene locus_tag LOCUS_32340 1672 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence505 447 157 gene locus_tag LOCUS_32350 gene cas 447 157 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8P1 protein_id gnl|my_center|LOCUS_32350 1779 607 gene locus_tag LOCUS_32360 gene cas1-2 1779 607 CDS product CRISPR-associated endonuclease Cas1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RW61 protein_id gnl|my_center|LOCUS_32360 <2723 1921 gene locus_tag LOCUS_32370 <2723 1921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176710.1:CRISPR-associated protein Cas4 >Feature sequence506 360 626 gene locus_tag LOCUS_32380 360 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence507 769 68 gene locus_tag LOCUS_32390 769 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1472 816 gene locus_tag LOCUS_32400 1472 816 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_32400 1658 2632 gene locus_tag LOCUS_32410 1658 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_32410 >Feature sequence508 <2709 1471 gene locus_tag LOCUS_32420 <2709 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122004.1:ribulokinase >Feature sequence509 309 1007 gene locus_tag LOCUS_32430 309 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 1109 1999 gene locus_tag LOCUS_32440 1109 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 2677 2024 gene locus_tag LOCUS_32450 2677 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence510 <2663 1043 gene locus_tag LOCUS_32460 <2663 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388504.1:helix-turn-helix domain-containing protein >Feature sequence511 2304 202 gene locus_tag LOCUS_32470 2304 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence512 2265 1009 gene locus_tag LOCUS_32480 2265 1009 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122501.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence513 1407 436 gene locus_tag LOCUS_32490 1407 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 <2599 1564 gene locus_tag LOCUS_32500 <2599 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X295:putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence514 >Feature sequence515 238 1488 gene locus_tag LOCUS_32510 238 1488 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_32510 >Feature sequence516 <1 679 gene locus_tag LOCUS_32520 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121212.1:filamin 762 2144 gene locus_tag LOCUS_32530 762 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence517 <1 820 gene locus_tag LOCUS_32540 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFC2:ATP synthase subunit a 1051 1416 gene locus_tag LOCUS_32550 1051 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 1612 2379 gene locus_tag LOCUS_32560 1612 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence518 <2556 269 gene locus_tag LOCUS_32570 <2556 269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118591.1:thioredoxin >Feature sequence519 1170 2195 gene locus_tag LOCUS_32580 1170 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence520 1096 395 gene locus_tag LOCUS_32590 1096 395 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_32590 1503 2453 gene locus_tag LOCUS_32600 1503 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 >Feature sequence521 1828 902 gene locus_tag LOCUS_32610 1828 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence522 274 546 gene locus_tag LOCUS_32620 274 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 581 1237 gene locus_tag LOCUS_32630 581 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 1234 1488 gene locus_tag LOCUS_32640 1234 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence523 632 150 gene locus_tag LOCUS_32650 632 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 1148 735 gene locus_tag LOCUS_32660 1148 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 1544 1164 gene locus_tag LOCUS_32670 1544 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 1999 1607 gene locus_tag LOCUS_32680 1999 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 2474 2088 gene locus_tag LOCUS_32690 2474 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence524 455 1090 gene locus_tag LOCUS_32700 455 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 1594 1142 gene locus_tag LOCUS_32710 1594 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence525 538 2100 gene locus_tag LOCUS_32720 gene arsA 538 2100 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_32720 >Feature sequence526 >Feature sequence527 <1 723 gene locus_tag LOCUS_32730 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123857.1:cytochrome oxidase subunit III 783 1286 gene locus_tag LOCUS_32740 783 1286 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404825.1 protein_id gnl|my_center|LOCUS_32740 2282 1539 gene locus_tag LOCUS_32750 2282 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_32750 >Feature sequence528 1511 570 gene locus_tag LOCUS_32760 1511 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 2100 1504 gene locus_tag LOCUS_32770 2100 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 >Feature sequence529 >Feature sequence530 3 260 gene locus_tag LOCUS_32780 3 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 257 874 gene locus_tag LOCUS_32790 257 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence531 435 782 gene locus_tag LOCUS_32800 435 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence532 1032 4 gene locus_tag LOCUS_32810 1032 4 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_32810 <2423 1092 gene locus_tag LOCUS_32820 <2423 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120406.1:oxidoreductase >Feature sequence533 480 956 gene locus_tag LOCUS_32830 480 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence534 1063 320 gene locus_tag LOCUS_32840 1063 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 <2365 1290 gene locus_tag LOCUS_32850 <2365 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7TTY9:60 kDa chaperonin 3 >Feature sequence535 >Feature sequence536 1620 28 gene locus_tag LOCUS_32860 1620 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 >Feature sequence537 429 1085 gene locus_tag LOCUS_32870 gene leuD 429 1085 CDS product isopropylmalate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143407.1 protein_id gnl|my_center|LOCUS_32870 2013 1180 gene locus_tag LOCUS_32880 2013 1180 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325516.1 protein_id gnl|my_center|LOCUS_32880 >Feature sequence538 944 1753 gene locus_tag LOCUS_32890 gene gdh 944 1753 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_32890 >Feature sequence539 689 267 gene locus_tag LOCUS_32900 689 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 776 1972 gene locus_tag LOCUS_32910 gene xseA 776 1972 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTZ9 protein_id gnl|my_center|LOCUS_32910 2303 2058 gene locus_tag LOCUS_32920 2303 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 >Feature sequence540 335 1339 gene locus_tag LOCUS_32930 335 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 1553 2170 gene locus_tag LOCUS_32940 gene kdsC 1553 2170 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_32940 >Feature sequence541 193 1257 gene locus_tag LOCUS_32950 193 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 2288 1320 gene locus_tag LOCUS_32960 2288 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 >Feature sequence542 >Feature sequence543 1509 295 gene locus_tag LOCUS_32970 1509 295 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_32970 1874 1506 gene locus_tag LOCUS_32980 1874 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence544 <1 558 gene locus_tag LOCUS_32990 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121188.1:ABC transporter ATP-binding protein 633 1349 gene locus_tag LOCUS_33000 633 1349 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence545 >Feature sequence546 >Feature sequence547 426 94 gene locus_tag LOCUS_33010 426 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1602 577 gene locus_tag LOCUS_33020 1602 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496933.1 protein_id gnl|my_center|LOCUS_33020 >Feature sequence548 1755 238 gene locus_tag LOCUS_33030 1755 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 2141 1890 gene locus_tag LOCUS_33040 2141 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 >Feature sequence549 1718 468 gene locus_tag LOCUS_33050 1718 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122879.1 protein_id gnl|my_center|LOCUS_33050 2050 1763 gene locus_tag LOCUS_33060 2050 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence550 <1 687 gene locus_tag LOCUS_33070 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UVK1:acetate kinase 754 1107 gene locus_tag LOCUS_33080 gene eutN 754 1107 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118935.1 protein_id gnl|my_center|LOCUS_33080 1100 1645 gene locus_tag LOCUS_33090 1100 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 >Feature sequence551 163 1314 gene locus_tag LOCUS_33100 gene argE 163 1314 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122153.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence552 191 826 gene locus_tag LOCUS_33110 191 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 >Feature sequence553 >Feature sequence554 1185 1868 gene locus_tag LOCUS_33120 1185 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence555 41 592 gene locus_tag LOCUS_33130 41 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 711 1394 gene locus_tag LOCUS_33140 gene lolD1 711 1394 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_33140 1576 1794 gene locus_tag LOCUS_33150 gene infA1 1576 1794 CDS product translation initiation factor IF-1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61686 protein_id gnl|my_center|LOCUS_33150 >Feature sequence556 252 31 gene locus_tag LOCUS_33160 252 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 760 524 gene locus_tag LOCUS_33170 760 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 1166 897 gene locus_tag LOCUS_33180 1166 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence557 >Feature sequence558 >Feature sequence559 440 1702 gene locus_tag LOCUS_33190 440 1702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_33190 >Feature sequence560 >Feature sequence561 >Feature sequence562 1138 1899 gene locus_tag LOCUS_33200 1138 1899 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence563 638 1741 gene locus_tag LOCUS_33210 638 1741 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence564 2108 273 gene locus_tag LOCUS_33220 2108 273 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_33220 >Feature sequence565 760 230 gene locus_tag LOCUS_33230 760 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 >Feature sequence566 >Feature sequence567 577 2046 gene locus_tag LOCUS_33240 gene fumC 577 2046 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE6 protein_id gnl|my_center|LOCUS_33240 >Feature sequence568 207 1211 gene locus_tag LOCUS_33250 gene holA 207 1211 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_33250 >Feature sequence569 543 779 gene locus_tag LOCUS_33260 543 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 885 1301 gene locus_tag LOCUS_33270 885 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 >Feature sequence570 357 2060 gene locus_tag LOCUS_33280 357 2060 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123644.1 protein_id gnl|my_center|LOCUS_33280 >Feature sequence571 >Feature sequence572 1104 235 gene locus_tag LOCUS_33290 gene mqnD 1104 235 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_33290 >Feature sequence573 <1 1079 gene locus_tag LOCUS_33300 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120880.1:glucan biosynthesis glucosyltransferase H 1166 1951 gene locus_tag LOCUS_33310 1166 1951 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121331.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence574 156 602 gene locus_tag LOCUS_33320 156 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 726 1709 gene locus_tag LOCUS_33330 726 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence575 1223 1765 gene locus_tag LOCUS_33340 1223 1765 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_33340 >Feature sequence576 426 1538 gene locus_tag LOCUS_33350 426 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence577 1157 198 gene locus_tag LOCUS_33360 1157 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660854.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence578 351 1319 gene locus_tag LOCUS_33370 gene ispH 351 1319 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence579 611 357 gene locus_tag LOCUS_33380 611 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 <2009 657 gene locus_tag LOCUS_33390 <2009 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333579.1:aldehyde dehydrogenase >Feature sequence580 >Feature sequence581 >Feature sequence582 573 253 gene locus_tag LOCUS_33400 573 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 663 986 gene locus_tag LOCUS_33410 663 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_33410 1370 1762 gene locus_tag LOCUS_33420 1370 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 >Feature sequence583 1016 600 gene locus_tag LOCUS_33430 1016 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 1960 1013 gene locus_tag LOCUS_33440 1960 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 >Feature sequence584 907 1293 gene locus_tag LOCUS_33450 907 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 1943 1305 gene locus_tag LOCUS_33460 1943 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence585 345 1520 gene locus_tag LOCUS_33470 345 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence586 1520 762 gene locus_tag LOCUS_33480 1520 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence587 513 16 gene locus_tag LOCUS_33490 513 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 959 510 gene locus_tag LOCUS_33500 959 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 <1932 991 gene locus_tag LOCUS_33510 <1932 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329380.1:type II secretion system F domain protein >Feature sequence588 270 1649 gene locus_tag LOCUS_33520 270 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 >Feature sequence589 >Feature sequence590 >Feature sequence591 1437 658 gene locus_tag LOCUS_33530 1437 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence592 <1869 1351 gene locus_tag LOCUS_33540 <1869 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329383.1:twitching motility protein PilT >Feature sequence593 <1867 551 gene locus_tag LOCUS_33550 <1867 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256609.1:deoxyribodipyrimidine photo-lyase >Feature sequence594 1165 140 gene locus_tag LOCUS_33560 1165 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence595 315 1355 gene locus_tag LOCUS_33570 315 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence596 >Feature sequence597 464 1336 gene locus_tag LOCUS_33580 464 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1333 1509 gene locus_tag LOCUS_33590 1333 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence598 124 51 gene locus_tag LOCUS_t00490 124 51 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 629 246 gene locus_tag LOCUS_33600 629 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 1822 845 gene locus_tag LOCUS_33610 1822 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence599 <1 1626 gene locus_tag LOCUS_33620 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121337.1:helicase >Feature sequence600 1262 567 gene locus_tag LOCUS_33630 1262 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 >Feature sequence601 >Feature sequence602 538 350 gene locus_tag LOCUS_33640 538 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1525 695 gene locus_tag LOCUS_33650 1525 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142612.1 protein_id gnl|my_center|LOCUS_33650 >Feature sequence603 619 170 gene locus_tag LOCUS_33660 619 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 1278 640 gene locus_tag LOCUS_33670 gene ruvA 1278 640 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USB0 protein_id gnl|my_center|LOCUS_33670 >Feature sequence604 350 1612 gene locus_tag LOCUS_33680 350 1612 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_33680 >Feature sequence605 <1 714 gene locus_tag LOCUS_33690 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328372.1:cytochrome c oxidase subunit I >Feature sequence606 <1 1619 gene locus_tag LOCUS_33700 <1 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120685.1:squalene--hopene cyclase >Feature sequence607 <1769 552 gene locus_tag LOCUS_33710 <1769 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CEQ8:D-galactarolactone cycloisomerase >Feature sequence608 1088 216 gene locus_tag LOCUS_33720 gene phnP 1088 216 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_33720 >Feature sequence609 674 1285 gene locus_tag LOCUS_33730 gene sodA 674 1285 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_33730 >Feature sequence610 1367 894 gene locus_tag LOCUS_33740 1367 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_33740 >Feature sequence611 1670 780 gene locus_tag LOCUS_33750 gene panC 1670 780 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG7 protein_id gnl|my_center|LOCUS_33750 >Feature sequence612 >Feature sequence613 1382 621 gene locus_tag LOCUS_33760 1382 621 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968127.1 protein_id gnl|my_center|LOCUS_33760 >Feature sequence614 >Feature sequence615 >Feature sequence616 444 1289 gene locus_tag LOCUS_33770 444 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 >Feature sequence617 >Feature sequence618 1252 245 gene locus_tag LOCUS_33780 1252 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 1576 1367 gene locus_tag LOCUS_33790 1576 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence619 >Feature sequence620 >Feature sequence621 1537 1013 gene locus_tag LOCUS_33800 1537 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence622 >Feature sequence623 <1647 534 gene locus_tag LOCUS_33810 <1647 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNC3:histidinol-phosphate aminotransferase >Feature sequence624 >Feature sequence625 >Feature sequence626 >Feature sequence627 >Feature sequence628 >Feature sequence629 332 574 gene locus_tag LOCUS_33820 332 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 571 816 gene locus_tag LOCUS_33830 571 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence630 <1 616 gene locus_tag LOCUS_33840 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122148.1:ATPase AAA 613 1506 gene locus_tag LOCUS_33850 613 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120923.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence631 449 1531 gene locus_tag LOCUS_33860 gene leuB 449 1531 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIE1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence632 1035 76 gene locus_tag LOCUS_33870 1035 76 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_33870 <1591 1067 gene locus_tag LOCUS_33880 <1591 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393353.1:group 1 glycosyl transferase >Feature sequence633 421 1305 gene locus_tag LOCUS_33890 gene atpG 421 1305 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_33890 >Feature sequence634 962 102 gene locus_tag LOCUS_33900 962 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 >Feature sequence635 >Feature sequence636 2 1186 gene locus_tag LOCUS_33910 2 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 >Feature sequence637 >Feature sequence638 <1 1004 gene locus_tag LOCUS_33920 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120982.1:sulfatase >Feature sequence639 >Feature sequence640