>Feature sequence01 399 710 gene locus_tag LOCUS_00010 399 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1778 726 gene locus_tag LOCUS_00020 1778 726 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 protein_id gnl|my_center|LOCUS_00020 3681 1915 gene locus_tag LOCUS_00030 3681 1915 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_00030 4712 4269 gene locus_tag LOCUS_00040 4712 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5418 4873 gene locus_tag LOCUS_00050 5418 4873 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_00050 6424 5435 gene locus_tag LOCUS_00060 6424 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6787 6993 gene locus_tag LOCUS_00070 6787 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8167 7022 gene locus_tag LOCUS_00080 8167 7022 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_00080 8586 8257 gene locus_tag LOCUS_00090 gene moeB 8586 8257 CDS product rhodanese domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329766.1 protein_id gnl|my_center|LOCUS_00090 10077 8644 gene locus_tag LOCUS_00100 gene arsA 10077 8644 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_00100 10369 11688 gene locus_tag LOCUS_00110 10369 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11696 13132 gene locus_tag LOCUS_00120 gene GALNS 11696 13132 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121678.1 protein_id gnl|my_center|LOCUS_00120 13662 14222 gene locus_tag LOCUS_00130 13662 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15621 14335 gene locus_tag LOCUS_00140 15621 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15895 17343 gene locus_tag LOCUS_00150 15895 17343 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124070.1 protein_id gnl|my_center|LOCUS_00150 17825 18265 gene locus_tag LOCUS_00160 17825 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19249 18329 gene locus_tag LOCUS_00170 19249 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19656 20714 gene locus_tag LOCUS_00180 gene celM 19656 20714 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121909.1 protein_id gnl|my_center|LOCUS_00180 22047 20752 gene locus_tag LOCUS_00190 gene hemL 22047 20752 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPM9 protein_id gnl|my_center|LOCUS_00190 23334 22063 gene locus_tag LOCUS_00200 23334 22063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23526 25193 gene locus_tag LOCUS_00210 23526 25193 CDS product ubiquinone biosynthesis protein UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_00210 29034 25273 gene locus_tag LOCUS_00220 29034 25273 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118043.1 protein_id gnl|my_center|LOCUS_00220 30366 29302 gene locus_tag LOCUS_00230 gene yacI 30366 29302 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV3 protein_id gnl|my_center|LOCUS_00230 30815 32323 gene locus_tag LOCUS_00240 gene trpE 30815 32323 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_00240 32420 34102 gene locus_tag LOCUS_00250 32420 34102 CDS product Mn(2+) transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122489.1 protein_id gnl|my_center|LOCUS_00250 34333 34680 gene locus_tag LOCUS_00260 34333 34680 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_00260 34836 35495 gene locus_tag LOCUS_00270 34836 35495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 35793 35506 gene locus_tag LOCUS_00280 35793 35506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 39651 36199 gene locus_tag LOCUS_00290 gene pyc 39651 36199 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UES1 protein_id gnl|my_center|LOCUS_00290 40008 40988 gene locus_tag LOCUS_00300 40008 40988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 41311 41832 gene locus_tag LOCUS_00310 41311 41832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 43144 42236 gene locus_tag LOCUS_00320 43144 42236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 44402 43275 gene locus_tag LOCUS_00330 44402 43275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023739.1 protein_id gnl|my_center|LOCUS_00330 45345 45947 gene locus_tag LOCUS_00340 45345 45947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 46244 46050 gene locus_tag LOCUS_00350 46244 46050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46325 47359 gene locus_tag LOCUS_00360 46325 47359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 49188 47662 gene locus_tag LOCUS_00370 49188 47662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_00370 51068 49776 gene locus_tag LOCUS_00380 51068 49776 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_00380 52683 51268 gene locus_tag LOCUS_00390 52683 51268 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_00390 52942 53457 gene locus_tag LOCUS_00400 gene tadA 52942 53457 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIP0 protein_id gnl|my_center|LOCUS_00400 53790 53990 gene locus_tag LOCUS_00410 53790 53990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 54216 54968 gene locus_tag LOCUS_00420 gene uppS 54216 54968 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF53 protein_id gnl|my_center|LOCUS_00420 54975 55871 gene locus_tag LOCUS_00430 54975 55871 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141396.1 protein_id gnl|my_center|LOCUS_00430 56452 55808 gene locus_tag LOCUS_00440 56452 55808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120804.1 protein_id gnl|my_center|LOCUS_00440 57372 56494 gene locus_tag LOCUS_00450 gene hisG 57372 56494 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_00450 57751 58362 gene locus_tag LOCUS_00460 gene cysC 57751 58362 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_00460 60594 58744 gene locus_tag LOCUS_00470 60594 58744 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_00470 62540 60678 gene locus_tag LOCUS_00480 gene shc 62540 60678 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120685.1 protein_id gnl|my_center|LOCUS_00480 63629 62586 gene locus_tag LOCUS_00490 63629 62586 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121488.1 protein_id gnl|my_center|LOCUS_00490 64140 63682 gene locus_tag LOCUS_00500 gene gcvH 64140 63682 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121110.1 protein_id gnl|my_center|LOCUS_00500 64709 65914 gene locus_tag LOCUS_00510 64709 65914 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082979.1 protein_id gnl|my_center|LOCUS_00510 66048 67001 gene locus_tag LOCUS_00520 66048 67001 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_00520 67072 67491 gene locus_tag LOCUS_00530 67072 67491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119281.1 protein_id gnl|my_center|LOCUS_00530 68337 67510 gene locus_tag LOCUS_00540 68337 67510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 protein_id gnl|my_center|LOCUS_00540 69760 68477 gene locus_tag LOCUS_00550 69760 68477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 70053 70208 gene locus_tag LOCUS_00560 70053 70208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 72131 70695 gene locus_tag LOCUS_00570 72131 70695 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_00570 72278 73411 gene locus_tag LOCUS_00580 72278 73411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 75457 73922 gene locus_tag LOCUS_00590 gene arsA 75457 73922 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119648.1 protein_id gnl|my_center|LOCUS_00590 78657 76003 gene locus_tag LOCUS_00600 78657 76003 CDS product arsenite oxidase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_00600 79278 78721 gene locus_tag LOCUS_00610 79278 78721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 81910 79262 gene locus_tag LOCUS_00620 81910 79262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 82424 82657 gene locus_tag LOCUS_00630 82424 82657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 82797 82726 gene locus_tag LOCUS_t00010 82797 82726 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 83080 83817 gene locus_tag LOCUS_00640 83080 83817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 83890 85266 gene locus_tag LOCUS_00650 83890 85266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 85803 90638 gene locus_tag LOCUS_00660 85803 90638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 91939 90740 gene locus_tag LOCUS_00670 91939 90740 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DS3 protein_id gnl|my_center|LOCUS_00670 93060 92335 gene locus_tag LOCUS_00680 93060 92335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 93543 95285 gene locus_tag LOCUS_00690 93543 95285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 95378 97714 gene locus_tag LOCUS_00700 95378 97714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 98662 97730 gene locus_tag LOCUS_00710 98662 97730 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121388.1 protein_id gnl|my_center|LOCUS_00710 98924 99367 gene locus_tag LOCUS_00720 98924 99367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 99454 106422 gene locus_tag LOCUS_00730 gene uvrA 99454 106422 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV4 protein_id gnl|my_center|LOCUS_00730 107630 108295 gene locus_tag LOCUS_00740 gene spoVG 107630 108295 CDS product stage V sporulation protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122807.1 protein_id gnl|my_center|LOCUS_00740 108756 108475 gene locus_tag LOCUS_00750 108756 108475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 109115 109834 gene locus_tag LOCUS_00760 109115 109834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 109927 110784 gene locus_tag LOCUS_00770 109927 110784 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 protein_id gnl|my_center|LOCUS_00770 110816 111499 gene locus_tag LOCUS_00780 110816 111499 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_00780 111637 113082 gene locus_tag LOCUS_00790 111637 113082 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_00790 113907 113083 gene locus_tag LOCUS_00800 gene parA 113907 113083 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_00800 114972 114322 gene locus_tag LOCUS_00810 114972 114322 CDS product methionine biosynthesis MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_00810 116279 115077 gene locus_tag LOCUS_00820 gene metX 116279 115077 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP84 protein_id gnl|my_center|LOCUS_00820 118357 116543 gene locus_tag LOCUS_00830 118357 116543 CDS product oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 protein_id gnl|my_center|LOCUS_00830 118577 119404 gene locus_tag LOCUS_00840 118577 119404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 120553 119366 gene locus_tag LOCUS_00850 120553 119366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 121322 121678 gene locus_tag LOCUS_00860 121322 121678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 121787 122314 gene locus_tag LOCUS_00870 121787 122314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 122470 122543 gene locus_tag LOCUS_t00020 122470 122543 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 124048 122690 gene locus_tag LOCUS_00880 124048 122690 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 protein_id gnl|my_center|LOCUS_00880 124332 124778 gene locus_tag LOCUS_00890 124332 124778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 124897 125316 gene locus_tag LOCUS_00900 124897 125316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 125730 127208 gene locus_tag LOCUS_00910 gene aslA 125730 127208 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120007.1 protein_id gnl|my_center|LOCUS_00910 127295 129265 gene locus_tag LOCUS_00920 127295 129265 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_00920 129262 130485 gene locus_tag LOCUS_00930 129262 130485 CDS product 1,4-butanediol diacrylate esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083627.1 protein_id gnl|my_center|LOCUS_00930 130717 131190 gene locus_tag LOCUS_00940 130717 131190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 131565 132449 gene locus_tag LOCUS_00950 gene rffH 131565 132449 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI75 protein_id gnl|my_center|LOCUS_00950 132668 134140 gene locus_tag LOCUS_00960 132668 134140 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_00960 134184 136166 gene locus_tag LOCUS_00970 gene nadE 134184 136166 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_00970 136281 136970 gene locus_tag LOCUS_00980 136281 136970 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_00980 137009 137605 gene locus_tag LOCUS_00990 137009 137605 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_00990 137651 138196 gene locus_tag LOCUS_01000 gene kptA 137651 138196 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_01000 138662 138204 gene locus_tag LOCUS_01010 138662 138204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118447.1 protein_id gnl|my_center|LOCUS_01010 138937 139413 gene locus_tag LOCUS_01020 138937 139413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 140597 139491 gene locus_tag LOCUS_01030 140597 139491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112812.1 protein_id gnl|my_center|LOCUS_01030 141133 141063 gene locus_tag LOCUS_t00030 141133 141063 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 142283 141324 gene locus_tag LOCUS_01040 142283 141324 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706102.1 protein_id gnl|my_center|LOCUS_01040 143697 142408 gene locus_tag LOCUS_01050 gene dctM 143697 142408 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU16 protein_id gnl|my_center|LOCUS_01050 144257 143727 gene locus_tag LOCUS_01060 144257 143727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 144700 144305 gene locus_tag LOCUS_01070 gene ectC 144700 144305 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3U6 protein_id gnl|my_center|LOCUS_01070 146026 144731 gene locus_tag LOCUS_01080 gene ectB 146026 144731 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 protein_id gnl|my_center|LOCUS_01080 146558 146049 gene locus_tag LOCUS_01090 gene ectA 146558 146049 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930801.1 protein_id gnl|my_center|LOCUS_01090 147487 146966 gene locus_tag LOCUS_01100 147487 146966 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 protein_id gnl|my_center|LOCUS_01100 148595 147645 gene locus_tag LOCUS_01110 148595 147645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 149512 148688 gene locus_tag LOCUS_01120 149512 148688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 149962 152148 gene locus_tag LOCUS_01130 149962 152148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 152138 153622 gene locus_tag LOCUS_01140 152138 153622 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328443.1 protein_id gnl|my_center|LOCUS_01140 153833 155521 gene locus_tag LOCUS_01150 153833 155521 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118216.1 protein_id gnl|my_center|LOCUS_01150 156716 155709 gene locus_tag LOCUS_01160 156716 155709 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_01160 157537 156746 gene locus_tag LOCUS_01170 157537 156746 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJC9 protein_id gnl|my_center|LOCUS_01170 158760 157630 gene locus_tag LOCUS_01180 158760 157630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 159678 158791 gene locus_tag LOCUS_01190 159678 158791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120366.1 protein_id gnl|my_center|LOCUS_01190 162180 159703 gene locus_tag LOCUS_01200 162180 159703 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117697.1 protein_id gnl|my_center|LOCUS_01200 163094 162252 gene locus_tag LOCUS_01210 163094 162252 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119732.1 protein_id gnl|my_center|LOCUS_01210 163644 163402 gene locus_tag LOCUS_01220 163644 163402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 164068 165057 gene locus_tag LOCUS_01230 164068 165057 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121519.1 protein_id gnl|my_center|LOCUS_01230 165297 166892 gene locus_tag LOCUS_01240 165297 166892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 protein_id gnl|my_center|LOCUS_01240 167446 166982 gene locus_tag LOCUS_01250 167446 166982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 169983 167632 gene locus_tag LOCUS_01260 169983 167632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 170331 171680 gene locus_tag LOCUS_01270 170331 171680 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_01270 171782 172315 gene locus_tag LOCUS_01280 171782 172315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 172395 172619 gene locus_tag LOCUS_01290 172395 172619 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521369.1 protein_id gnl|my_center|LOCUS_01290 172635 173045 gene locus_tag LOCUS_01300 172635 173045 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269427.1 protein_id gnl|my_center|LOCUS_01300 173164 173568 gene locus_tag LOCUS_01310 173164 173568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 174950 174171 gene locus_tag LOCUS_01320 174950 174171 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_01320 176533 175049 gene locus_tag LOCUS_01330 gene phr 176533 175049 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_01330 177813 176530 gene locus_tag LOCUS_01340 177813 176530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120802.1 protein_id gnl|my_center|LOCUS_01340 178240 180516 gene locus_tag LOCUS_01350 gene sul1 178240 180516 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123067.1 protein_id gnl|my_center|LOCUS_01350 180891 180529 gene locus_tag LOCUS_01360 180891 180529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 181266 180964 gene locus_tag LOCUS_01370 181266 180964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 181588 182436 gene locus_tag LOCUS_01380 181588 182436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 183963 182698 gene locus_tag LOCUS_01390 183963 182698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 185038 184070 gene locus_tag LOCUS_01400 185038 184070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 186408 185035 gene locus_tag LOCUS_01410 186408 185035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 187218 186526 gene locus_tag LOCUS_01420 187218 186526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 189159 187420 gene locus_tag LOCUS_01430 189159 187420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 189987 191447 gene locus_tag LOCUS_01440 189987 191447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124058.1 protein_id gnl|my_center|LOCUS_01440 191444 193399 gene locus_tag LOCUS_01450 191444 193399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124057.1 protein_id gnl|my_center|LOCUS_01450 193524 195179 gene locus_tag LOCUS_01460 193524 195179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 196637 195309 gene locus_tag LOCUS_01470 196637 195309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 198247 196634 gene locus_tag LOCUS_01480 198247 196634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 199252 198347 gene locus_tag LOCUS_01490 199252 198347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_01490 200585 199689 gene locus_tag LOCUS_01500 200585 199689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_01500 201240 202772 gene locus_tag LOCUS_01510 201240 202772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 203226 205130 gene locus_tag LOCUS_01520 203226 205130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 205163 206854 gene locus_tag LOCUS_01530 gene rpdD 205163 206854 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF51 protein_id gnl|my_center|LOCUS_01530 207066 207776 gene locus_tag LOCUS_01540 207066 207776 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326094.1 protein_id gnl|my_center|LOCUS_01540 208728 207784 gene locus_tag LOCUS_01550 208728 207784 CDS product beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_01550 208900 208721 gene locus_tag LOCUS_01560 208900 208721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 209402 213388 gene locus_tag LOCUS_01570 209402 213388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 213462 214769 gene locus_tag LOCUS_01580 213462 214769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 215712 214783 gene locus_tag LOCUS_01590 215712 214783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 217213 215819 gene locus_tag LOCUS_01600 gene gntP 217213 215819 CDS product gluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_01600 217429 218886 gene locus_tag LOCUS_01610 217429 218886 CDS product polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122555.1 protein_id gnl|my_center|LOCUS_01610 219711 218896 gene locus_tag LOCUS_01620 219711 218896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 220064 221566 gene locus_tag LOCUS_01630 220064 221566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117961.1 protein_id gnl|my_center|LOCUS_01630 221660 222565 gene locus_tag LOCUS_01640 221660 222565 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_01640 222713 224014 gene locus_tag LOCUS_01650 222713 224014 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_01650 224153 225052 gene locus_tag LOCUS_01660 224153 225052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 226646 225198 gene locus_tag LOCUS_01670 226646 225198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 227107 228186 gene locus_tag LOCUS_01680 227107 228186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_01680 228189 229208 gene locus_tag LOCUS_01690 228189 229208 CDS product tetrahydromethanopterin-linked C1 transfer pathway inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120803.1 protein_id gnl|my_center|LOCUS_01690 229561 231423 gene locus_tag LOCUS_01700 gene glmS 229561 231423 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA9 protein_id gnl|my_center|LOCUS_01700 231752 232687 gene locus_tag LOCUS_01710 gene ispH 231752 232687 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_01710 232835 233677 gene locus_tag LOCUS_01720 232835 233677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 234217 233708 gene locus_tag LOCUS_01730 234217 233708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 235486 234383 gene locus_tag LOCUS_01740 235486 234383 CDS product dolichol monophosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_01740 235936 237243 gene locus_tag LOCUS_01750 gene tadA 235936 237243 CDS product secretion system protein TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120689.1 protein_id gnl|my_center|LOCUS_01750 237314 238285 gene locus_tag LOCUS_01760 gene tadB 237314 238285 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120690.1 protein_id gnl|my_center|LOCUS_01760 238374 239300 gene locus_tag LOCUS_01770 gene tadC 238374 239300 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_01770 239850 240272 gene locus_tag LOCUS_01780 239850 240272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 240488 241411 gene locus_tag LOCUS_01790 240488 241411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120245.1 protein_id gnl|my_center|LOCUS_01790 241417 242115 gene locus_tag LOCUS_01800 gene deoC 241417 242115 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPT7 protein_id gnl|my_center|LOCUS_01800 242300 242142 gene locus_tag LOCUS_01810 242300 242142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 243419 242457 gene locus_tag LOCUS_01820 243419 242457 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122231.1 protein_id gnl|my_center|LOCUS_01820 244351 244184 gene locus_tag LOCUS_01830 244351 244184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 245503 244538 gene locus_tag LOCUS_01840 245503 244538 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_01840 246267 246491 gene locus_tag LOCUS_01850 246267 246491 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_01850 246569 248869 gene locus_tag LOCUS_01860 gene feoB 246569 248869 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N2 protein_id gnl|my_center|LOCUS_01860 248944 249132 gene locus_tag LOCUS_01870 248944 249132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 249442 249663 gene locus_tag LOCUS_01880 249442 249663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 249871 250809 gene locus_tag LOCUS_01890 249871 250809 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_01890 253167 250831 gene locus_tag LOCUS_01900 253167 250831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 255466 253775 gene locus_tag LOCUS_01910 255466 253775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 256008 255463 gene locus_tag LOCUS_01920 256008 255463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 256421 257020 gene locus_tag LOCUS_01930 256421 257020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 257176 257517 gene locus_tag LOCUS_01940 257176 257517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 258265 257567 gene locus_tag LOCUS_01950 258265 257567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 261915 258262 gene locus_tag LOCUS_01960 261915 258262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 264462 262048 gene locus_tag LOCUS_01970 264462 262048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122099.1 protein_id gnl|my_center|LOCUS_01970 264994 264533 gene locus_tag LOCUS_01980 264994 264533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 265425 266885 gene locus_tag LOCUS_01990 265425 266885 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214193.1 protein_id gnl|my_center|LOCUS_01990 266842 267720 gene locus_tag LOCUS_02000 gene murB 266842 267720 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7A3 protein_id gnl|my_center|LOCUS_02000 269008 267734 gene locus_tag LOCUS_02010 269008 267734 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_02010 270465 269056 gene locus_tag LOCUS_02020 270465 269056 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_02020 273849 270496 gene locus_tag LOCUS_02030 273849 270496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 275420 274053 gene locus_tag LOCUS_02040 275420 274053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_02040 276289 275519 gene locus_tag LOCUS_02050 276289 275519 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 protein_id gnl|my_center|LOCUS_02050 277435 276425 gene locus_tag LOCUS_02060 277435 276425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120503.1 protein_id gnl|my_center|LOCUS_02060 277908 279506 gene locus_tag LOCUS_02070 gene guaA 277908 279506 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFS3 protein_id gnl|my_center|LOCUS_02070 279800 282862 gene locus_tag LOCUS_02080 279800 282862 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_02080 284188 282968 gene locus_tag LOCUS_02090 284188 282968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 285027 302201 gene locus_tag LOCUS_02100 285027 302201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 302446 303231 gene locus_tag LOCUS_02110 302446 303231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122300.1 protein_id gnl|my_center|LOCUS_02110 303245 303994 gene locus_tag LOCUS_02120 303245 303994 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_02120 304432 304061 gene locus_tag LOCUS_02130 304432 304061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 305002 306327 gene locus_tag LOCUS_02140 gene GALNS 305002 306327 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121931.1 protein_id gnl|my_center|LOCUS_02140 306659 306399 gene locus_tag LOCUS_02150 306659 306399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 310744 307046 gene locus_tag LOCUS_02160 310744 307046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 311222 312499 gene locus_tag LOCUS_02170 311222 312499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_02170 313978 312533 gene locus_tag LOCUS_02180 313978 312533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 314636 314827 gene locus_tag LOCUS_02190 314636 314827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 316182 315532 gene locus_tag LOCUS_02200 316182 315532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 318403 316322 gene locus_tag LOCUS_02210 318403 316322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_02210 318844 320292 gene locus_tag LOCUS_02220 318844 320292 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118668.1 protein_id gnl|my_center|LOCUS_02220 321049 320312 gene locus_tag LOCUS_02230 gene lplA 321049 320312 CDS product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_02230 322430 321051 gene locus_tag LOCUS_02240 gene dldH 322430 321051 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVC8 protein_id gnl|my_center|LOCUS_02240 323668 322493 gene locus_tag LOCUS_02250 323668 322493 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLK5 protein_id gnl|my_center|LOCUS_02250 324947 324003 gene locus_tag LOCUS_02260 324947 324003 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118181.1 protein_id gnl|my_center|LOCUS_02260 325164 326345 gene locus_tag LOCUS_02270 325164 326345 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_02270 328186 326699 gene locus_tag LOCUS_02280 328186 326699 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057713.1 protein_id gnl|my_center|LOCUS_02280 329978 328263 gene locus_tag LOCUS_02290 gene polB 329978 328263 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118392.1 protein_id gnl|my_center|LOCUS_02290 331316 330117 gene locus_tag LOCUS_02300 331316 330117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 332083 333039 gene locus_tag LOCUS_02310 332083 333039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 333453 334442 gene locus_tag LOCUS_02320 gene folE2 333453 334442 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT35 protein_id gnl|my_center|LOCUS_02320 336883 334484 gene locus_tag LOCUS_02330 336883 334484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 337693 336887 gene locus_tag LOCUS_02340 337693 336887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 338161 339003 gene locus_tag LOCUS_02350 338161 339003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 339347 339943 gene locus_tag LOCUS_02360 339347 339943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 339979 344253 gene locus_tag LOCUS_02370 339979 344253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 345637 344216 gene locus_tag LOCUS_02380 345637 344216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 347111 345672 gene locus_tag LOCUS_02390 347111 345672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 347430 347098 gene locus_tag LOCUS_02400 gene ywzG 347430 347098 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_02400 349703 348411 gene locus_tag LOCUS_02410 349703 348411 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_02410 350294 349758 gene locus_tag LOCUS_02420 350294 349758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120683.1 protein_id gnl|my_center|LOCUS_02420 351673 350363 gene locus_tag LOCUS_02430 gene hemN 351673 350363 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_02430 352983 351757 gene locus_tag LOCUS_02440 352983 351757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 354170 352971 gene locus_tag LOCUS_02450 354170 352971 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_02450 355149 354547 gene locus_tag LOCUS_02460 gene nadD 355149 354547 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FIX5 protein_id gnl|my_center|LOCUS_02460 355323 357656 gene locus_tag LOCUS_02470 gene priA 355323 357656 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFQ0 protein_id gnl|my_center|LOCUS_02470 357826 360813 gene locus_tag LOCUS_02480 357826 360813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119753.1 protein_id gnl|my_center|LOCUS_02480 361015 362043 gene locus_tag LOCUS_02490 361015 362043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 363186 362053 gene locus_tag LOCUS_02500 gene hemN 363186 362053 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_02500 364571 363225 gene locus_tag LOCUS_02510 364571 363225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 364851 365867 gene locus_tag LOCUS_02520 gene holA 364851 365867 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 protein_id gnl|my_center|LOCUS_02520 366100 366522 gene locus_tag LOCUS_02530 366100 366522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 366538 368223 gene locus_tag LOCUS_02540 gene mviN 366538 368223 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32ET1 protein_id gnl|my_center|LOCUS_02540 369330 368293 gene locus_tag LOCUS_02550 369330 368293 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123060.1 protein_id gnl|my_center|LOCUS_02550 369560 369895 gene locus_tag LOCUS_02560 369560 369895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 370402 369965 gene locus_tag LOCUS_02570 370402 369965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 370824 372134 gene locus_tag LOCUS_02580 gene xylA 370824 372134 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG2 protein_id gnl|my_center|LOCUS_02580 372413 372577 gene locus_tag LOCUS_02590 372413 372577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 373418 375529 gene locus_tag LOCUS_02600 373418 375529 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326746.1 protein_id gnl|my_center|LOCUS_02600 376885 375575 gene locus_tag LOCUS_02610 376885 375575 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_02610 377204 378370 gene locus_tag LOCUS_02620 gene nagA 377204 378370 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_02620 378731 380224 gene locus_tag LOCUS_02630 378731 380224 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_02630 381265 380249 gene locus_tag LOCUS_02640 gene moxR 381265 380249 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120739.1 protein_id gnl|my_center|LOCUS_02640 381628 384084 gene locus_tag LOCUS_02650 381628 384084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120740.1 protein_id gnl|my_center|LOCUS_02650 384134 384538 gene locus_tag LOCUS_02660 384134 384538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 384531 384896 gene locus_tag LOCUS_02670 384531 384896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 385790 384975 gene locus_tag LOCUS_02680 385790 384975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 387958 386048 gene locus_tag LOCUS_02690 387958 386048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 390195 387958 gene locus_tag LOCUS_02700 390195 387958 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123369.1 protein_id gnl|my_center|LOCUS_02700 390627 391469 gene locus_tag LOCUS_02710 gene hemB 390627 391469 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 protein_id gnl|my_center|LOCUS_02710 391721 392926 gene locus_tag LOCUS_02720 gene argD 391721 392926 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_02720 393043 393960 gene locus_tag LOCUS_02730 gene argF 393043 393960 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ6 protein_id gnl|my_center|LOCUS_02730 396132 394663 gene locus_tag LOCUS_02740 396132 394663 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULI3 protein_id gnl|my_center|LOCUS_02740 398733 396385 gene locus_tag LOCUS_02750 398733 396385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 399064 400362 gene locus_tag LOCUS_02760 399064 400362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_02760 400533 403874 gene locus_tag LOCUS_02770 400533 403874 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122155.1 protein_id gnl|my_center|LOCUS_02770 404036 404914 gene locus_tag LOCUS_02780 404036 404914 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH02 protein_id gnl|my_center|LOCUS_02780 405142 406092 gene locus_tag LOCUS_02790 405142 406092 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_02790 406274 406792 gene locus_tag LOCUS_02800 406274 406792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 406866 407987 gene locus_tag LOCUS_02810 406866 407987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 408017 409201 gene locus_tag LOCUS_02820 408017 409201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 409179 409424 gene locus_tag LOCUS_02830 409179 409424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 409681 409484 gene locus_tag LOCUS_02840 409681 409484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 410831 409842 gene locus_tag LOCUS_02850 410831 409842 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118191.1 protein_id gnl|my_center|LOCUS_02850 411267 411779 gene locus_tag LOCUS_02860 411267 411779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 411886 411959 gene locus_tag LOCUS_t00040 411886 411959 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 412019 412783 gene locus_tag LOCUS_02870 412019 412783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 413776 412784 gene locus_tag LOCUS_02880 gene add 413776 412784 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_02880 414040 414453 gene locus_tag LOCUS_02890 414040 414453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 414572 415909 gene locus_tag LOCUS_02900 414572 415909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102086.1 protein_id gnl|my_center|LOCUS_02900 416614 418674 gene locus_tag LOCUS_02910 416614 418674 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_02910 418782 419888 gene locus_tag LOCUS_02920 418782 419888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256855.1 protein_id gnl|my_center|LOCUS_02920 419971 421500 gene locus_tag LOCUS_02930 419971 421500 CDS product stage V sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_02930 421525 422019 gene locus_tag LOCUS_02940 421525 422019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 422182 422991 gene locus_tag LOCUS_02950 422182 422991 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061889.1 protein_id gnl|my_center|LOCUS_02950 423021 424172 gene locus_tag LOCUS_02960 gene sufS 423021 424172 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8D0M6 protein_id gnl|my_center|LOCUS_02960 424382 426883 gene locus_tag LOCUS_02970 424382 426883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_02970 426946 428364 gene locus_tag LOCUS_02980 426946 428364 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_02980 428675 429235 gene locus_tag LOCUS_02990 gene hslV 428675 429235 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Q4 protein_id gnl|my_center|LOCUS_02990 429223 430587 gene locus_tag LOCUS_03000 gene hslU 429223 430587 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG00 protein_id gnl|my_center|LOCUS_03000 431159 430680 gene locus_tag LOCUS_03010 431159 430680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 432162 431209 gene locus_tag LOCUS_03020 432162 431209 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_03020 433366 432458 gene locus_tag LOCUS_03030 433366 432458 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_03030 434138 433677 gene locus_tag LOCUS_03040 434138 433677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 435152 434196 gene locus_tag LOCUS_03050 435152 434196 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_03050 435459 435725 gene locus_tag LOCUS_03060 435459 435725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 435743 436369 gene locus_tag LOCUS_03070 435743 436369 CDS product septum formation inhibitor Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868834.1 protein_id gnl|my_center|LOCUS_03070 436406 437476 gene locus_tag LOCUS_03080 gene dusB 436406 437476 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_03080 442438 437564 gene locus_tag LOCUS_03090 442438 437564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 447635 442917 gene locus_tag LOCUS_03100 447635 442917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 448282 450222 gene locus_tag LOCUS_03110 gene secA2 448282 450222 CDS product protein translocase subunit SecA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWI5 protein_id gnl|my_center|LOCUS_03110 451011 450232 gene locus_tag LOCUS_03120 451011 450232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 451790 451008 gene locus_tag LOCUS_03130 451790 451008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 453080 451809 gene locus_tag LOCUS_03140 453080 451809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 455022 453280 gene locus_tag LOCUS_03150 455022 453280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 455288 456274 gene locus_tag LOCUS_03160 455288 456274 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119907.1 protein_id gnl|my_center|LOCUS_03160 457315 457602 gene locus_tag LOCUS_03170 457315 457602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 459358 457994 gene locus_tag LOCUS_03180 459358 457994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 460954 459476 gene locus_tag LOCUS_03190 460954 459476 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403781.1 protein_id gnl|my_center|LOCUS_03190 461669 461007 gene locus_tag LOCUS_03200 461669 461007 CDS product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022379.1 protein_id gnl|my_center|LOCUS_03200 461993 463228 gene locus_tag LOCUS_03210 gene glgC 461993 463228 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXF5 protein_id gnl|my_center|LOCUS_03210 463740 465158 gene locus_tag LOCUS_03220 463740 465158 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202061.1 protein_id gnl|my_center|LOCUS_03220 467202 465316 gene locus_tag LOCUS_03230 467202 465316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 467468 468313 gene locus_tag LOCUS_03240 gene mutM 467468 468313 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_03240 468520 470247 gene locus_tag LOCUS_03250 468520 470247 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123340.1 protein_id gnl|my_center|LOCUS_03250 470340 471101 gene locus_tag LOCUS_03260 gene rlmB 470340 471101 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM8 protein_id gnl|my_center|LOCUS_03260 471491 472465 gene locus_tag LOCUS_03270 471491 472465 CDS product UDP-glucose 4-epimerase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119533.1 protein_id gnl|my_center|LOCUS_03270 472556 474919 gene locus_tag LOCUS_03280 472556 474919 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 protein_id gnl|my_center|LOCUS_03280 476304 474949 gene locus_tag LOCUS_03290 476304 474949 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_03290 477777 476329 gene locus_tag LOCUS_03300 477777 476329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 478262 479773 gene locus_tag LOCUS_03310 gene glgA 478262 479773 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPY2 protein_id gnl|my_center|LOCUS_03310 479836 480831 gene locus_tag LOCUS_03320 479836 480831 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_03320 481188 483383 gene locus_tag LOCUS_03330 481188 483383 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_03330 484710 483430 gene locus_tag LOCUS_03340 484710 483430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_03340 486504 484798 gene locus_tag LOCUS_03350 486504 484798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03350 486839 488542 gene locus_tag LOCUS_03360 486839 488542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 488552 488932 gene locus_tag LOCUS_03370 488552 488932 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889218.1 protein_id gnl|my_center|LOCUS_03370 489604 488960 gene locus_tag LOCUS_03380 489604 488960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 490469 489831 gene locus_tag LOCUS_03390 490469 489831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 490742 491146 gene locus_tag LOCUS_03400 490742 491146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 491297 492229 gene locus_tag LOCUS_03410 491297 492229 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR2 protein_id gnl|my_center|LOCUS_03410 492233 492874 gene locus_tag LOCUS_03420 492233 492874 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 protein_id gnl|my_center|LOCUS_03420 493386 492979 gene locus_tag LOCUS_03430 493386 492979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 494472 493519 gene locus_tag LOCUS_03440 494472 493519 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_03440 496730 495162 gene locus_tag LOCUS_03450 496730 495162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 497851 496883 gene locus_tag LOCUS_03460 497851 496883 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029017.1 protein_id gnl|my_center|LOCUS_03460 498205 498651 gene locus_tag LOCUS_03470 498205 498651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 498801 500288 gene locus_tag LOCUS_03480 498801 500288 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119957.1 protein_id gnl|my_center|LOCUS_03480 500363 503599 gene locus_tag LOCUS_03490 500363 503599 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_03490 503670 504221 gene locus_tag LOCUS_03500 503670 504221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119955.1 protein_id gnl|my_center|LOCUS_03500 504597 505031 gene locus_tag LOCUS_03510 504597 505031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 505165 505914 gene locus_tag LOCUS_03520 505165 505914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 505911 507965 gene locus_tag LOCUS_03530 505911 507965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 508286 509512 gene locus_tag LOCUS_03540 508286 509512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 509587 511242 gene locus_tag LOCUS_03550 509587 511242 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_03550 511423 512421 gene locus_tag LOCUS_03560 511423 512421 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124145.1 protein_id gnl|my_center|LOCUS_03560 512940 513935 gene locus_tag LOCUS_03570 512940 513935 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_03570 514110 514430 gene locus_tag LOCUS_03580 514110 514430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 514623 516083 gene locus_tag LOCUS_03590 514623 516083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_03590 517464 516175 gene locus_tag LOCUS_03600 517464 516175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_03600 518596 517583 gene locus_tag LOCUS_03610 gene gpsA1 518596 517583 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2I4 protein_id gnl|my_center|LOCUS_03610 518965 519204 gene locus_tag LOCUS_03620 518965 519204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 519799 520881 gene locus_tag LOCUS_03630 519799 520881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 520981 521679 gene locus_tag LOCUS_03640 520981 521679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 521895 522842 gene locus_tag LOCUS_03650 gene prs 521895 522842 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPM4 protein_id gnl|my_center|LOCUS_03650 522906 523406 gene locus_tag LOCUS_03660 522906 523406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 523403 524362 gene locus_tag LOCUS_03670 523403 524362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 524494 525780 gene locus_tag LOCUS_03680 gene aroA 524494 525780 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW43 protein_id gnl|my_center|LOCUS_03680 525777 527207 gene locus_tag LOCUS_03690 gene rsmB 525777 527207 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z4 protein_id gnl|my_center|LOCUS_03690 527423 528748 gene locus_tag LOCUS_03700 gene rpoA 527423 528748 CDS product RNA polymerase subunit alpha domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328259.1 protein_id gnl|my_center|LOCUS_03700 528890 528962 gene locus_tag LOCUS_t00050 528890 528962 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 531000 529036 gene locus_tag LOCUS_03710 gene argS 531000 529036 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URC7 protein_id gnl|my_center|LOCUS_03710 531331 531125 gene locus_tag LOCUS_03720 531331 531125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 534189 531577 gene locus_tag LOCUS_03730 534189 531577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 534939 534523 gene locus_tag LOCUS_03740 534939 534523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_03740 536008 535157 gene locus_tag LOCUS_03750 536008 535157 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119081.1 protein_id gnl|my_center|LOCUS_03750 537256 536201 gene locus_tag LOCUS_03760 gene holB 537256 536201 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 protein_id gnl|my_center|LOCUS_03760 537550 537284 gene locus_tag LOCUS_03770 537550 537284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 538252 537551 gene locus_tag LOCUS_03780 538252 537551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 539183 538437 gene locus_tag LOCUS_03790 gene lipB 539183 538437 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF8 protein_id gnl|my_center|LOCUS_03790 539693 541861 gene locus_tag LOCUS_03800 539693 541861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 543587 542061 gene locus_tag LOCUS_03810 543587 542061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 544312 543860 gene locus_tag LOCUS_03820 gene dksA 544312 543860 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 protein_id gnl|my_center|LOCUS_03820 544755 545873 gene locus_tag LOCUS_03830 544755 545873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 547970 545895 gene locus_tag LOCUS_03840 gene recG 547970 545895 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118187.1 protein_id gnl|my_center|LOCUS_03840 548485 547991 gene locus_tag LOCUS_03850 gene rnhA 548485 547991 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU3 protein_id gnl|my_center|LOCUS_03850 548845 548627 gene locus_tag LOCUS_03860 gene infA 548845 548627 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY5 protein_id gnl|my_center|LOCUS_03860 549240 549410 gene locus_tag LOCUS_03870 549240 549410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 549660 550400 gene locus_tag LOCUS_03880 549660 550400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 550536 551879 gene locus_tag LOCUS_03890 550536 551879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_03890 552923 553591 gene locus_tag LOCUS_03900 552923 553591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 555273 553900 gene locus_tag LOCUS_03910 gene dapE 555273 553900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_03910 555397 556596 gene locus_tag LOCUS_03920 555397 556596 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_03920 556616 557791 gene locus_tag LOCUS_03930 556616 557791 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_03930 558592 558221 gene locus_tag LOCUS_03940 558592 558221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 558945 560048 gene locus_tag LOCUS_03950 558945 560048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 560615 560055 gene locus_tag LOCUS_03960 560615 560055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 561358 560816 gene locus_tag LOCUS_03970 561358 560816 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_03970 562758 561391 gene locus_tag LOCUS_03980 562758 561391 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_03980 565242 563062 gene locus_tag LOCUS_03990 gene thrS 565242 563062 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ52 protein_id gnl|my_center|LOCUS_03990 565518 565592 gene locus_tag LOCUS_t00060 565518 565592 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 565862 567433 gene locus_tag LOCUS_04000 565862 567433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 567619 567996 gene locus_tag LOCUS_04010 567619 567996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 568272 570386 gene locus_tag LOCUS_04020 568272 570386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 570390 573851 gene locus_tag LOCUS_04030 570390 573851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 575003 573858 gene locus_tag LOCUS_04040 575003 573858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 575686 575000 gene locus_tag LOCUS_04050 575686 575000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 576323 575802 gene locus_tag LOCUS_04060 576323 575802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 576506 576997 gene locus_tag LOCUS_04070 576506 576997 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122323.1 protein_id gnl|my_center|LOCUS_04070 577067 577765 gene locus_tag LOCUS_04080 577067 577765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522523.1 protein_id gnl|my_center|LOCUS_04080 577815 578261 gene locus_tag LOCUS_04090 577815 578261 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208113.1 protein_id gnl|my_center|LOCUS_04090 578671 580389 gene locus_tag LOCUS_04100 578671 580389 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893374.1 protein_id gnl|my_center|LOCUS_04100 580635 582254 gene locus_tag LOCUS_04110 580635 582254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209759.1 protein_id gnl|my_center|LOCUS_04110 582716 582357 gene locus_tag LOCUS_04120 582716 582357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 583170 582709 gene locus_tag LOCUS_04130 583170 582709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405170.1 protein_id gnl|my_center|LOCUS_04130 583455 583231 gene locus_tag LOCUS_04140 583455 583231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 584653 583646 gene locus_tag LOCUS_04150 584653 583646 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_04150 584882 585070 gene locus_tag LOCUS_04160 584882 585070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 585306 585097 gene locus_tag LOCUS_04170 585306 585097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 586372 585344 gene locus_tag LOCUS_04180 586372 585344 CDS product putative fructose-bisphosphate aldolase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z7 protein_id gnl|my_center|LOCUS_04180 587159 586470 gene locus_tag LOCUS_04190 587159 586470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121005.1 protein_id gnl|my_center|LOCUS_04190 587579 588541 gene locus_tag LOCUS_04200 587579 588541 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_04200 588755 589153 gene locus_tag LOCUS_04210 588755 589153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 589518 589832 gene locus_tag LOCUS_04220 589518 589832 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 protein_id gnl|my_center|LOCUS_04220 589856 590221 gene locus_tag LOCUS_04230 gene yeaO 589856 590221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207564.1 protein_id gnl|my_center|LOCUS_04230 592448 590223 gene locus_tag LOCUS_04240 592448 590223 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 protein_id gnl|my_center|LOCUS_04240 593050 592508 gene locus_tag LOCUS_04250 593050 592508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 593366 593692 gene locus_tag LOCUS_04260 593366 593692 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938934.1 protein_id gnl|my_center|LOCUS_04260 593825 595072 gene locus_tag LOCUS_04270 593825 595072 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_04270 595091 595510 gene locus_tag LOCUS_04280 gene arsC 595091 595510 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_04280 595541 596071 gene locus_tag LOCUS_04290 595541 596071 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271013.1 protein_id gnl|my_center|LOCUS_04290 596690 596052 gene locus_tag LOCUS_04300 596690 596052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 597447 596965 gene locus_tag LOCUS_04310 597447 596965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 598201 597440 gene locus_tag LOCUS_04320 598201 597440 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_04320 599148 598198 gene locus_tag LOCUS_04330 599148 598198 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122378.1 protein_id gnl|my_center|LOCUS_04330 600273 599161 gene locus_tag LOCUS_04340 600273 599161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202982.1 protein_id gnl|my_center|LOCUS_04340 601010 600270 gene locus_tag LOCUS_04350 601010 600270 CDS product DNA ligase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_04350 601736 603250 gene locus_tag LOCUS_04360 601736 603250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 603599 606019 gene locus_tag LOCUS_04370 603599 606019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 606675 606055 gene locus_tag LOCUS_04380 606675 606055 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_04380 607724 606768 gene locus_tag LOCUS_04390 607724 606768 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_04390 608405 607821 gene locus_tag LOCUS_04400 gene mip 608405 607821 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 protein_id gnl|my_center|LOCUS_04400 609074 608493 gene locus_tag LOCUS_04410 609074 608493 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731153.1 protein_id gnl|my_center|LOCUS_04410 609830 609420 gene locus_tag LOCUS_04420 609830 609420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 610957 610310 gene locus_tag LOCUS_04430 610957 610310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 611668 611279 gene locus_tag LOCUS_04440 611668 611279 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036362.1 protein_id gnl|my_center|LOCUS_04440 612153 611782 gene locus_tag LOCUS_04450 gene yhaH 612153 611782 CDS product inner membrane protein YhaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64590 protein_id gnl|my_center|LOCUS_04450 612752 612396 gene locus_tag LOCUS_04460 612752 612396 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705537.1 protein_id gnl|my_center|LOCUS_04460 613233 612799 gene locus_tag LOCUS_04470 613233 612799 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122325.1 protein_id gnl|my_center|LOCUS_04470 613902 613333 gene locus_tag LOCUS_04480 613902 613333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 614217 614930 gene locus_tag LOCUS_04490 614217 614930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_04490 616081 615062 gene locus_tag LOCUS_04500 616081 615062 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9T7 protein_id gnl|my_center|LOCUS_04500 616438 616097 gene locus_tag LOCUS_04510 616438 616097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 616534 616737 gene locus_tag LOCUS_04520 616534 616737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 619393 617243 gene locus_tag LOCUS_04530 619393 617243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 619916 619734 gene locus_tag LOCUS_04540 619916 619734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 620656 620123 gene locus_tag LOCUS_04550 620656 620123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 621365 620673 gene locus_tag LOCUS_04560 621365 620673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 623989 622871 gene locus_tag LOCUS_04570 623989 622871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 protein_id gnl|my_center|LOCUS_04570 624507 624932 gene locus_tag LOCUS_04580 624507 624932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 625058 625798 gene locus_tag LOCUS_04590 gene pcxB 625058 625798 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121516.1 protein_id gnl|my_center|LOCUS_04590 625940 626407 gene locus_tag LOCUS_04600 625940 626407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 626513 626719 gene locus_tag LOCUS_04610 626513 626719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 627190 626765 gene locus_tag LOCUS_04620 627190 626765 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122613.1 protein_id gnl|my_center|LOCUS_04620 628224 627325 gene locus_tag LOCUS_04630 628224 627325 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_04630 628678 629373 gene locus_tag LOCUS_04640 628678 629373 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888180.1 protein_id gnl|my_center|LOCUS_04640 629438 632083 gene locus_tag LOCUS_04650 629438 632083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_04650 632161 633483 gene locus_tag LOCUS_04660 632161 633483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_04660 634451 633543 gene locus_tag LOCUS_04670 634451 633543 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_04670 636985 634448 gene locus_tag LOCUS_04680 636985 634448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122580.1 protein_id gnl|my_center|LOCUS_04680 640489 637124 gene locus_tag LOCUS_04690 640489 637124 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 protein_id gnl|my_center|LOCUS_04690 641550 640549 gene locus_tag LOCUS_04700 641550 640549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_04700 643033 641543 gene locus_tag LOCUS_04710 643033 641543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_04710 644000 643467 gene locus_tag LOCUS_04720 644000 643467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 645019 644018 gene locus_tag LOCUS_04730 645019 644018 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_04730 646740 645400 gene locus_tag LOCUS_04740 646740 645400 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_04740 647696 646758 gene locus_tag LOCUS_04750 647696 646758 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS03 protein_id gnl|my_center|LOCUS_04750 650191 647714 gene locus_tag LOCUS_04760 650191 647714 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_04760 650636 650217 gene locus_tag LOCUS_04770 gene hspA 650636 650217 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_04770 650983 652800 gene locus_tag LOCUS_04780 gene atsA 650983 652800 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_04780 653027 653728 gene locus_tag LOCUS_04790 653027 653728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 655614 653989 gene locus_tag LOCUS_04800 655614 653989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340030.1 protein_id gnl|my_center|LOCUS_04800 657288 655660 gene locus_tag LOCUS_04810 657288 655660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121998.1 protein_id gnl|my_center|LOCUS_04810 658285 659664 gene locus_tag LOCUS_04820 658285 659664 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462056.1 protein_id gnl|my_center|LOCUS_04820 662419 659678 gene locus_tag LOCUS_04830 662419 659678 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141113.1 protein_id gnl|my_center|LOCUS_04830 664605 663034 gene locus_tag LOCUS_04840 664605 663034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 664810 665943 gene locus_tag LOCUS_04850 664810 665943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 666972 666103 gene locus_tag LOCUS_04860 666972 666103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 667203 667457 gene locus_tag LOCUS_04870 667203 667457 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071657.1 protein_id gnl|my_center|LOCUS_04870 668205 669692 gene locus_tag LOCUS_04880 668205 669692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRY1 protein_id gnl|my_center|LOCUS_04880 669685 670272 gene locus_tag LOCUS_04890 669685 670272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 670279 673683 gene locus_tag LOCUS_04900 670279 673683 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_04900 673700 674875 gene locus_tag LOCUS_04910 673700 674875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_04910 675173 674904 gene locus_tag LOCUS_04920 675173 674904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 675868 675413 gene locus_tag LOCUS_04930 675868 675413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105776.1 protein_id gnl|my_center|LOCUS_04930 677037 675865 gene locus_tag LOCUS_04940 677037 675865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_04940 677776 677012 gene locus_tag LOCUS_04950 677776 677012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459823.1 protein_id gnl|my_center|LOCUS_04950 681284 677871 gene locus_tag LOCUS_04960 681284 677871 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QR6 protein_id gnl|my_center|LOCUS_04960 681876 681274 gene locus_tag LOCUS_04970 681876 681274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459835.1 protein_id gnl|my_center|LOCUS_04970 682679 681873 gene locus_tag LOCUS_04980 682679 681873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459825.1 protein_id gnl|my_center|LOCUS_04980 684722 683826 gene locus_tag LOCUS_04990 684722 683826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 685593 686075 gene locus_tag LOCUS_05000 685593 686075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 687268 686402 gene locus_tag LOCUS_05010 687268 686402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 688465 687533 gene locus_tag LOCUS_05020 688465 687533 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118252.1 protein_id gnl|my_center|LOCUS_05020 690295 689723 gene locus_tag LOCUS_05030 690295 689723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 <692188 690270 gene locus_tag LOCUS_05040 <692188 690270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119956.1:cation transporter >Feature sequence02 296 490 gene locus_tag LOCUS_05050 296 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 701 1108 gene locus_tag LOCUS_05060 701 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2142 1381 gene locus_tag LOCUS_05070 2142 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3602 2745 gene locus_tag LOCUS_05080 gene ilvE 3602 2745 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_05080 4513 3785 gene locus_tag LOCUS_05090 gene lolD2 4513 3785 CDS product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPK3 protein_id gnl|my_center|LOCUS_05090 6204 4615 gene locus_tag LOCUS_05100 gene lolC 6204 4615 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_05100 7753 6272 gene locus_tag LOCUS_05110 gene lysS 7753 6272 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK37 protein_id gnl|my_center|LOCUS_05110 8780 7956 gene locus_tag LOCUS_05120 8780 7956 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDY5 protein_id gnl|my_center|LOCUS_05120 8956 9147 gene locus_tag LOCUS_05130 8956 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 9310 10242 gene locus_tag LOCUS_05140 9310 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 10242 10583 gene locus_tag LOCUS_05150 10242 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 10614 11723 gene locus_tag LOCUS_05160 10614 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_05160 11720 12940 gene locus_tag LOCUS_05170 11720 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 14142 12997 gene locus_tag LOCUS_05180 14142 12997 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_05180 15373 14267 gene locus_tag LOCUS_05190 15373 14267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119245.1 protein_id gnl|my_center|LOCUS_05190 16013 17113 gene locus_tag LOCUS_05200 16013 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 17365 18600 gene locus_tag LOCUS_05210 17365 18600 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121595.1 protein_id gnl|my_center|LOCUS_05210 19984 18638 gene locus_tag LOCUS_05220 19984 18638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 21344 20169 gene locus_tag LOCUS_05230 21344 20169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 22035 23108 gene locus_tag LOCUS_05240 22035 23108 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_05240 24888 23827 gene locus_tag LOCUS_05250 gene gspG 24888 23827 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118411.1 protein_id gnl|my_center|LOCUS_05250 25967 25569 gene locus_tag LOCUS_05260 25967 25569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 27155 26151 gene locus_tag LOCUS_05270 27155 26151 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_05270 27732 28526 gene locus_tag LOCUS_05280 gene hisF 27732 28526 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ9 protein_id gnl|my_center|LOCUS_05280 28765 29919 gene locus_tag LOCUS_05290 gene pilT 28765 29919 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_05290 30984 30055 gene locus_tag LOCUS_05300 30984 30055 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528925.1 protein_id gnl|my_center|LOCUS_05300 31326 34328 gene locus_tag LOCUS_05310 31326 34328 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120793.1 protein_id gnl|my_center|LOCUS_05310 34469 35893 gene locus_tag LOCUS_05320 gene fumC 34469 35893 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE6 protein_id gnl|my_center|LOCUS_05320 36607 35915 gene locus_tag LOCUS_05330 36607 35915 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_05330 36973 38043 gene locus_tag LOCUS_05340 36973 38043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 38202 38828 gene locus_tag LOCUS_05350 38202 38828 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGM3 protein_id gnl|my_center|LOCUS_05350 39487 38825 gene locus_tag LOCUS_05360 39487 38825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 41353 39578 gene locus_tag LOCUS_05370 41353 39578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 42755 42907 gene locus_tag LOCUS_05380 42755 42907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 43142 42879 gene locus_tag LOCUS_05390 43142 42879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 43423 44085 gene locus_tag LOCUS_05400 43423 44085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119826.1 protein_id gnl|my_center|LOCUS_05400 44308 44943 gene locus_tag LOCUS_05410 44308 44943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 45076 45558 gene locus_tag LOCUS_05420 45076 45558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 45900 45745 gene locus_tag LOCUS_05430 45900 45745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 48623 45897 gene locus_tag LOCUS_05440 48623 45897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 49117 48620 gene locus_tag LOCUS_05450 49117 48620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 50494 49253 gene locus_tag LOCUS_05460 50494 49253 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089992.1 protein_id gnl|my_center|LOCUS_05460 51585 50692 gene locus_tag LOCUS_05470 51585 50692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 55546 51839 gene locus_tag LOCUS_05480 55546 51839 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123694.1 protein_id gnl|my_center|LOCUS_05480 56050 57582 gene locus_tag LOCUS_05490 56050 57582 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122409.1 protein_id gnl|my_center|LOCUS_05490 58571 57936 gene locus_tag LOCUS_05500 58571 57936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 59091 58636 gene locus_tag LOCUS_05510 59091 58636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121102.1 protein_id gnl|my_center|LOCUS_05510 59742 59449 gene locus_tag LOCUS_05520 59742 59449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 61746 60136 gene locus_tag LOCUS_05530 gene rsr 61746 60136 CDS product ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_05530 62515 62444 gene locus_tag LOCUS_t00070 62515 62444 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 62595 62522 gene locus_tag LOCUS_t00080 62595 62522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62679 62608 gene locus_tag LOCUS_t00090 62679 62608 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65491 63110 gene locus_tag LOCUS_05540 gene katG 65491 63110 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUW9 protein_id gnl|my_center|LOCUS_05540 66164 66640 gene locus_tag LOCUS_05550 66164 66640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 66778 67023 gene locus_tag LOCUS_05560 66778 67023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 67559 67083 gene locus_tag LOCUS_05570 67559 67083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 67844 69508 gene locus_tag LOCUS_05580 67844 69508 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_05580 69892 69665 gene locus_tag LOCUS_05590 69892 69665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 69941 72580 gene locus_tag LOCUS_05600 69941 72580 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123585.1 protein_id gnl|my_center|LOCUS_05600 72583 74007 gene locus_tag LOCUS_05610 72583 74007 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121659.1 protein_id gnl|my_center|LOCUS_05610 74476 74021 gene locus_tag LOCUS_05620 gene nrdR 74476 74021 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI6 protein_id gnl|my_center|LOCUS_05620 74841 74659 gene locus_tag LOCUS_05630 74841 74659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 76389 74860 gene locus_tag LOCUS_05640 76389 74860 CDS product sodium:solute symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_05640 76688 76891 gene locus_tag LOCUS_05650 76688 76891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 76995 78683 gene locus_tag LOCUS_05660 76995 78683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_05660 79035 79628 gene locus_tag LOCUS_05670 79035 79628 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 protein_id gnl|my_center|LOCUS_05670 81059 79632 gene locus_tag LOCUS_05680 81059 79632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086332.1 protein_id gnl|my_center|LOCUS_05680 82293 81193 gene locus_tag LOCUS_05690 gene xylR 82293 81193 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_05690 82676 83833 gene locus_tag LOCUS_05700 82676 83833 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120646.1 protein_id gnl|my_center|LOCUS_05700 83848 85197 gene locus_tag LOCUS_05710 83848 85197 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_05710 85190 85771 gene locus_tag LOCUS_05720 85190 85771 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_05720 85772 86578 gene locus_tag LOCUS_05730 gene phnX 85772 86578 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81G82 protein_id gnl|my_center|LOCUS_05730 86580 87704 gene locus_tag LOCUS_05740 gene phnW 86580 87704 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLY7 protein_id gnl|my_center|LOCUS_05740 87880 88980 gene locus_tag LOCUS_05750 gene adh 87880 88980 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120643.1 protein_id gnl|my_center|LOCUS_05750 90211 88982 gene locus_tag LOCUS_05760 90211 88982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 90916 90653 gene locus_tag LOCUS_05770 90916 90653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 91920 90919 gene locus_tag LOCUS_05780 gene obg 91920 90919 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH6 protein_id gnl|my_center|LOCUS_05780 92475 93515 gene locus_tag LOCUS_05790 92475 93515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122487.1 protein_id gnl|my_center|LOCUS_05790 93598 96876 gene locus_tag LOCUS_05800 93598 96876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 97006 98634 gene locus_tag LOCUS_05810 97006 98634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 98740 99009 gene locus_tag LOCUS_05820 98740 99009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 99033 99197 gene locus_tag LOCUS_05830 99033 99197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 99617 100432 gene locus_tag LOCUS_05840 99617 100432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 100702 100956 gene locus_tag LOCUS_05850 100702 100956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 100953 101462 gene locus_tag LOCUS_05860 100953 101462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 101777 104197 gene locus_tag LOCUS_05870 101777 104197 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119647.1 protein_id gnl|my_center|LOCUS_05870 104191 105762 gene locus_tag LOCUS_05880 104191 105762 CDS product large multi-functional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119646.1 protein_id gnl|my_center|LOCUS_05880 106316 105783 gene locus_tag LOCUS_05890 106316 105783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 107459 106380 gene locus_tag LOCUS_05900 107459 106380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 107782 108684 gene locus_tag LOCUS_05910 107782 108684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 108719 110932 gene locus_tag LOCUS_05920 108719 110932 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_05920 111103 112065 gene locus_tag LOCUS_05930 gene ddl 111103 112065 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW1 protein_id gnl|my_center|LOCUS_05930 112284 113264 gene locus_tag LOCUS_05940 112284 113264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 113450 114181 gene locus_tag LOCUS_05950 113450 114181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 114603 114334 gene locus_tag LOCUS_05960 114603 114334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 114562 116517 gene locus_tag LOCUS_05970 gene acsA 114562 116517 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP98 protein_id gnl|my_center|LOCUS_05970 116635 117417 gene locus_tag LOCUS_05980 gene purE 116635 117417 CDS product phosphoribosyl carboxyaminoimidazole mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 protein_id gnl|my_center|LOCUS_05980 117452 118954 gene locus_tag LOCUS_05990 117452 118954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 119120 120979 gene locus_tag LOCUS_06000 119120 120979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 122236 121283 gene locus_tag LOCUS_06010 122236 121283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 123181 122351 gene locus_tag LOCUS_06020 gene ugpQ 123181 122351 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_06020 123518 123721 gene locus_tag LOCUS_06030 123518 123721 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_06030 123727 124560 gene locus_tag LOCUS_06040 gene thiG 123727 124560 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US84 protein_id gnl|my_center|LOCUS_06040 125218 124565 gene locus_tag LOCUS_06050 125218 124565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 126064 125441 gene locus_tag LOCUS_06060 126064 125441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 126212 127399 gene locus_tag LOCUS_06070 126212 127399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 127619 129514 gene locus_tag LOCUS_06080 gene aspS 127619 129514 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFY6 protein_id gnl|my_center|LOCUS_06080 129560 130900 gene locus_tag LOCUS_06090 129560 130900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_06090 131540 130965 gene locus_tag LOCUS_06100 131540 130965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 131679 132152 gene locus_tag LOCUS_06110 131679 132152 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889501.1 protein_id gnl|my_center|LOCUS_06110 133307 132174 gene locus_tag LOCUS_06120 133307 132174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 133874 133317 gene locus_tag LOCUS_06130 133874 133317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 134707 133919 gene locus_tag LOCUS_06140 134707 133919 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_06140 134978 135859 gene locus_tag LOCUS_06150 134978 135859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 135886 136068 gene locus_tag LOCUS_06160 135886 136068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 136374 139340 gene locus_tag LOCUS_06170 136374 139340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 139571 142114 gene locus_tag LOCUS_06180 139571 142114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 142819 142127 gene locus_tag LOCUS_06190 142819 142127 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120671.1 protein_id gnl|my_center|LOCUS_06190 143950 142820 gene locus_tag LOCUS_06200 143950 142820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 145084 143975 gene locus_tag LOCUS_06210 145084 143975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 145766 145074 gene locus_tag LOCUS_06220 145766 145074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 146341 145955 gene locus_tag LOCUS_06230 146341 145955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 150002 146982 gene locus_tag LOCUS_06240 150002 146982 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118591.1 protein_id gnl|my_center|LOCUS_06240 151664 150681 gene locus_tag LOCUS_06250 151664 150681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 152946 151969 gene locus_tag LOCUS_06260 152946 151969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 153716 153234 gene locus_tag LOCUS_06270 153716 153234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 154252 154079 gene locus_tag LOCUS_06280 154252 154079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 155171 154491 gene locus_tag LOCUS_06290 155171 154491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 155771 155211 gene locus_tag LOCUS_06300 155771 155211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 156631 155861 gene locus_tag LOCUS_06310 156631 155861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 157178 159592 gene locus_tag LOCUS_06320 157178 159592 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H4 protein_id gnl|my_center|LOCUS_06320 159686 161617 gene locus_tag LOCUS_06330 gene gyrB 159686 161617 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU72 protein_id gnl|my_center|LOCUS_06330 162513 161626 gene locus_tag LOCUS_06340 162513 161626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 162494 162706 gene locus_tag LOCUS_06350 162494 162706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 165063 162787 gene locus_tag LOCUS_06360 165063 162787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 165728 167992 gene locus_tag LOCUS_06370 gene pcrA 165728 167992 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR9 protein_id gnl|my_center|LOCUS_06370 168159 169109 gene locus_tag LOCUS_06380 gene xerC 168159 169109 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQK2 protein_id gnl|my_center|LOCUS_06380 170080 169130 gene locus_tag LOCUS_06390 170080 169130 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121978.1 protein_id gnl|my_center|LOCUS_06390 170585 170151 gene locus_tag LOCUS_06400 170585 170151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 171141 170608 gene locus_tag LOCUS_06410 171141 170608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 171581 171213 gene locus_tag LOCUS_06420 171581 171213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 172800 171694 gene locus_tag LOCUS_06430 172800 171694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 174099 172867 gene locus_tag LOCUS_06440 gene pilC 174099 172867 CDS product type IV pilin assembly protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4G9 protein_id gnl|my_center|LOCUS_06440 175272 174184 gene locus_tag LOCUS_06450 gene xcpS 175272 174184 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_06450 176569 175352 gene locus_tag LOCUS_06460 gene gspE 176569 175352 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_06460 177018 176569 gene locus_tag LOCUS_06470 177018 176569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 177580 177011 gene locus_tag LOCUS_06480 gene sigH 177580 177011 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121971.1 protein_id gnl|my_center|LOCUS_06480 177980 178501 gene locus_tag LOCUS_06490 gene aroK-2 177980 178501 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728T1 protein_id gnl|my_center|LOCUS_06490 178542 179594 gene locus_tag LOCUS_06500 gene aroF-1 178542 179594 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883S5 protein_id gnl|my_center|LOCUS_06500 181838 179685 gene locus_tag LOCUS_06510 181838 179685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 182746 181835 gene locus_tag LOCUS_06520 182746 181835 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070486.1 protein_id gnl|my_center|LOCUS_06520 183138 182743 gene locus_tag LOCUS_06530 gene gntR 183138 182743 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_06530 184383 183586 gene locus_tag LOCUS_06540 184383 183586 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339107.1 protein_id gnl|my_center|LOCUS_06540 186228 184777 gene locus_tag LOCUS_06550 186228 184777 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_06550 187852 186338 gene locus_tag LOCUS_06560 187852 186338 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_06560 188360 187908 gene locus_tag LOCUS_06570 188360 187908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 189474 188596 gene locus_tag LOCUS_06580 189474 188596 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_06580 189791 190762 gene locus_tag LOCUS_06590 189791 190762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 191295 192137 gene locus_tag LOCUS_06600 191295 192137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 192291 192473 gene locus_tag LOCUS_06610 192291 192473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 193995 192412 gene locus_tag LOCUS_06620 193995 192412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 194872 194243 gene locus_tag LOCUS_06630 194872 194243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 195022 195186 gene locus_tag LOCUS_06640 195022 195186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 195624 196349 gene locus_tag LOCUS_06650 195624 196349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 196504 196668 gene locus_tag LOCUS_06660 196504 196668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 198545 197499 gene locus_tag LOCUS_06670 198545 197499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 199483 198542 gene locus_tag LOCUS_06680 199483 198542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 201332 199467 gene locus_tag LOCUS_06690 201332 199467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 202251 201337 gene locus_tag LOCUS_06700 202251 201337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 202817 203074 gene locus_tag LOCUS_06710 202817 203074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 203241 203408 gene locus_tag LOCUS_06720 203241 203408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 203412 204005 gene locus_tag LOCUS_06730 203412 204005 CDS product DNA invertase Pin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776577.1 protein_id gnl|my_center|LOCUS_06730 204761 204063 gene locus_tag LOCUS_06740 204761 204063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 205197 206549 gene locus_tag LOCUS_06750 205197 206549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 207200 206691 gene locus_tag LOCUS_06760 207200 206691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 207664 208098 gene locus_tag LOCUS_06770 207664 208098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120443.1 protein_id gnl|my_center|LOCUS_06770 208105 208515 gene locus_tag LOCUS_06780 208105 208515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 208592 208885 gene locus_tag LOCUS_06790 208592 208885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 208889 209317 gene locus_tag LOCUS_06800 208889 209317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 209464 209844 gene locus_tag LOCUS_06810 209464 209844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 209942 212923 gene locus_tag LOCUS_06820 209942 212923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 213008 213355 gene locus_tag LOCUS_06830 213008 213355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 213357 214331 gene locus_tag LOCUS_06840 213357 214331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 214422 215684 gene locus_tag LOCUS_06850 214422 215684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 216032 217768 gene locus_tag LOCUS_06860 gene dnaK 216032 217768 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336666.1 protein_id gnl|my_center|LOCUS_06860 217975 218652 gene locus_tag LOCUS_06870 217975 218652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 218680 220353 gene locus_tag LOCUS_06880 218680 220353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 220411 221256 gene locus_tag LOCUS_06890 220411 221256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 221297 221998 gene locus_tag LOCUS_06900 221297 221998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 221998 223668 gene locus_tag LOCUS_06910 221998 223668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 224051 224449 gene locus_tag LOCUS_06920 224051 224449 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331759.1 protein_id gnl|my_center|LOCUS_06920 224446 228096 gene locus_tag LOCUS_06930 224446 228096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 228275 229414 gene locus_tag LOCUS_06940 228275 229414 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968431.1 protein_id gnl|my_center|LOCUS_06940 229432 229917 gene locus_tag LOCUS_06950 229432 229917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 230810 229971 gene locus_tag LOCUS_06960 230810 229971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 232077 230992 gene locus_tag LOCUS_06970 232077 230992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 232356 233825 gene locus_tag LOCUS_06980 232356 233825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 233815 235014 gene locus_tag LOCUS_06990 233815 235014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 235092 237314 gene locus_tag LOCUS_07000 235092 237314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 237623 237339 gene locus_tag LOCUS_07010 237623 237339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 238733 237726 gene locus_tag LOCUS_07020 238733 237726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 239207 241123 gene locus_tag LOCUS_07030 239207 241123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 243398 241170 gene locus_tag LOCUS_07040 243398 241170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 243757 243395 gene locus_tag LOCUS_07050 gene ywzG 243757 243395 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_07050 245327 243933 gene locus_tag LOCUS_07060 245327 243933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_07060 245626 249312 gene locus_tag LOCUS_07070 245626 249312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 249691 250815 gene locus_tag LOCUS_07080 249691 250815 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120402.1 protein_id gnl|my_center|LOCUS_07080 250914 251330 gene locus_tag LOCUS_07090 250914 251330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 252885 251368 gene locus_tag LOCUS_07100 252885 251368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 253128 254588 gene locus_tag LOCUS_07110 253128 254588 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_07110 255231 255031 gene locus_tag LOCUS_07120 255231 255031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 255545 255279 gene locus_tag LOCUS_07130 255545 255279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 255798 256538 gene locus_tag LOCUS_07140 255798 256538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118617.1 protein_id gnl|my_center|LOCUS_07140 256631 257116 gene locus_tag LOCUS_07150 256631 257116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 257181 257945 gene locus_tag LOCUS_07160 257181 257945 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_07160 258097 259677 gene locus_tag LOCUS_07170 258097 259677 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_07170 259674 259904 gene locus_tag LOCUS_07180 259674 259904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 260073 260282 gene locus_tag LOCUS_07190 260073 260282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 262036 260672 gene locus_tag LOCUS_07200 262036 260672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_07200 262397 263179 gene locus_tag LOCUS_07210 262397 263179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 265297 263654 gene locus_tag LOCUS_07220 265297 263654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_07220 266749 265703 gene locus_tag LOCUS_07230 gene oleA 266749 265703 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_07230 267100 266891 gene locus_tag LOCUS_07240 267100 266891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 268298 267363 gene locus_tag LOCUS_07250 268298 267363 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQJ2 protein_id gnl|my_center|LOCUS_07250 268673 269134 gene locus_tag LOCUS_07260 268673 269134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_07260 269323 270570 gene locus_tag LOCUS_07270 269323 270570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_07270 270592 271368 gene locus_tag LOCUS_07280 270592 271368 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_07280 271573 272319 gene locus_tag LOCUS_07290 271573 272319 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121486.1 protein_id gnl|my_center|LOCUS_07290 272321 273691 gene locus_tag LOCUS_07300 272321 273691 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_07300 273678 274295 gene locus_tag LOCUS_07310 273678 274295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121484.1 protein_id gnl|my_center|LOCUS_07310 274677 275369 gene locus_tag LOCUS_07320 274677 275369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 276654 275347 gene locus_tag LOCUS_07330 276654 275347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 277397 276666 gene locus_tag LOCUS_07340 277397 276666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 277863 279293 gene locus_tag LOCUS_07350 gene arsA 277863 279293 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_07350 279330 280808 gene locus_tag LOCUS_07360 gene atsG 279330 280808 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119682.1 protein_id gnl|my_center|LOCUS_07360 280854 281900 gene locus_tag LOCUS_07370 gene pam 280854 281900 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_07370 281937 284078 gene locus_tag LOCUS_07380 281937 284078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 284110 285294 gene locus_tag LOCUS_07390 284110 285294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 286226 285405 gene locus_tag LOCUS_07400 286226 285405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 288966 286276 gene locus_tag LOCUS_07410 288966 286276 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_07410 289949 289017 gene locus_tag LOCUS_07420 gene acuC2 289949 289017 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_07420 290294 289986 gene locus_tag LOCUS_07430 290294 289986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 291010 290471 gene locus_tag LOCUS_07440 291010 290471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 291900 291184 gene locus_tag LOCUS_07450 291900 291184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 292290 293042 gene locus_tag LOCUS_07460 292290 293042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 295260 293050 gene locus_tag LOCUS_07470 295260 293050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 295774 295250 gene locus_tag LOCUS_07480 295774 295250 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121023.1 protein_id gnl|my_center|LOCUS_07480 297233 295830 gene locus_tag LOCUS_07490 297233 295830 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921318.1 protein_id gnl|my_center|LOCUS_07490 298835 297735 gene locus_tag LOCUS_07500 298835 297735 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119877.1 protein_id gnl|my_center|LOCUS_07500 299322 300062 gene locus_tag LOCUS_07510 299322 300062 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223802.1 protein_id gnl|my_center|LOCUS_07510 300623 300165 gene locus_tag LOCUS_07520 300623 300165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 301703 300723 gene locus_tag LOCUS_07530 301703 300723 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_07530 302349 302074 gene locus_tag LOCUS_07540 302349 302074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 303180 302581 gene locus_tag LOCUS_07550 303180 302581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 303693 303280 gene locus_tag LOCUS_07560 303693 303280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 304384 303833 gene locus_tag LOCUS_07570 304384 303833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 305031 304420 gene locus_tag LOCUS_07580 305031 304420 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG81 protein_id gnl|my_center|LOCUS_07580 306201 307883 gene locus_tag LOCUS_07590 306201 307883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 307899 308972 gene locus_tag LOCUS_07600 gene truD 307899 308972 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI49 protein_id gnl|my_center|LOCUS_07600 308985 309506 gene locus_tag LOCUS_07610 gene hpt 308985 309506 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_07610 312031 309527 gene locus_tag LOCUS_07620 gene gyrB 312031 309527 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM28 protein_id gnl|my_center|LOCUS_07620 312488 312144 gene locus_tag LOCUS_07630 312488 312144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 313535 312492 gene locus_tag LOCUS_07640 gene dnaN 313535 312492 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKK1 protein_id gnl|my_center|LOCUS_07640 315194 314157 gene locus_tag LOCUS_07650 315194 314157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 315811 315236 gene locus_tag LOCUS_07660 315811 315236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 316087 317391 gene locus_tag LOCUS_07670 316087 317391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 318593 317388 gene locus_tag LOCUS_07680 gene pilC 318593 317388 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_07680 319689 318619 gene locus_tag LOCUS_07690 319689 318619 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_07690 321493 319745 gene locus_tag LOCUS_07700 321493 319745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07700 321846 321511 gene locus_tag LOCUS_07710 321846 321511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 323363 321858 gene locus_tag LOCUS_07720 323363 321858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 323792 323403 gene locus_tag LOCUS_07730 323792 323403 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_07730 325316 323850 gene locus_tag LOCUS_07740 325316 323850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 326609 325548 gene locus_tag LOCUS_07750 326609 325548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 328984 326612 gene locus_tag LOCUS_07760 328984 326612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 329701 329045 gene locus_tag LOCUS_07770 329701 329045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 330433 329825 gene locus_tag LOCUS_07780 330433 329825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 331163 330426 gene locus_tag LOCUS_07790 331163 330426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 332247 331174 gene locus_tag LOCUS_07800 332247 331174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 332929 332279 gene locus_tag LOCUS_07810 332929 332279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 334914 332947 gene locus_tag LOCUS_07820 334914 332947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 335785 334898 gene locus_tag LOCUS_07830 335785 334898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 336413 335808 gene locus_tag LOCUS_07840 336413 335808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 337660 336857 gene locus_tag LOCUS_07850 337660 336857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 337893 339119 gene locus_tag LOCUS_07860 337893 339119 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123564.1 protein_id gnl|my_center|LOCUS_07860 339368 340444 gene locus_tag LOCUS_07870 339368 340444 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_07870 340491 340688 gene locus_tag LOCUS_07880 340491 340688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 341382 341119 gene locus_tag LOCUS_07890 341382 341119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 341407 341910 gene locus_tag LOCUS_07900 341407 341910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 342058 343290 gene locus_tag LOCUS_07910 gene dapL 342058 343290 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 protein_id gnl|my_center|LOCUS_07910 343551 344267 gene locus_tag LOCUS_07920 gene mip 343551 344267 CDS product peptidyl-prolyl cis-trans isomerase Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51752 protein_id gnl|my_center|LOCUS_07920 344543 345628 gene locus_tag LOCUS_07930 344543 345628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 345831 346871 gene locus_tag LOCUS_07940 gene moeB 345831 346871 CDS product thiamine/molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158137.1 protein_id gnl|my_center|LOCUS_07940 348427 346901 gene locus_tag LOCUS_07950 348427 346901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 348635 348868 gene locus_tag LOCUS_07960 348635 348868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 349056 350540 gene locus_tag LOCUS_07970 349056 350540 CDS product arylsulfatase A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_07970 350868 351914 gene locus_tag LOCUS_07980 350868 351914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 353028 352009 gene locus_tag LOCUS_07990 353028 352009 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_07990 354553 353222 gene locus_tag LOCUS_08000 gene ahcY 354553 353222 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ5 protein_id gnl|my_center|LOCUS_08000 355043 355918 gene locus_tag LOCUS_08010 gene metF 355043 355918 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67422 protein_id gnl|my_center|LOCUS_08010 355967 356824 gene locus_tag LOCUS_08020 gene aroE 355967 356824 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CUJ9 protein_id gnl|my_center|LOCUS_08020 356864 357652 gene locus_tag LOCUS_08030 356864 357652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 protein_id gnl|my_center|LOCUS_08030 357658 358116 gene locus_tag LOCUS_08040 357658 358116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 358113 358547 gene locus_tag LOCUS_08050 358113 358547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 358751 359536 gene locus_tag LOCUS_08060 358751 359536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 359632 360063 gene locus_tag LOCUS_08070 359632 360063 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267849.1 protein_id gnl|my_center|LOCUS_08070 360139 360447 gene locus_tag LOCUS_08080 360139 360447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 360508 360993 gene locus_tag LOCUS_08090 360508 360993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119866.1 protein_id gnl|my_center|LOCUS_08090 361173 361427 gene locus_tag LOCUS_08100 361173 361427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 362244 361477 gene locus_tag LOCUS_08110 362244 361477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 362796 362323 gene locus_tag LOCUS_08120 362796 362323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 363711 362956 gene locus_tag LOCUS_08130 363711 362956 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_08130 364584 363895 gene locus_tag LOCUS_08140 gene nnrE 364584 363895 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX4 protein_id gnl|my_center|LOCUS_08140 364886 365605 gene locus_tag LOCUS_08150 364886 365605 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_08150 365767 366036 gene locus_tag LOCUS_08160 gene rpsN 365767 366036 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085655.1 protein_id gnl|my_center|LOCUS_08160 366158 366439 gene locus_tag LOCUS_08170 366158 366439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 367032 366523 gene locus_tag LOCUS_08180 367032 366523 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120292.1 protein_id gnl|my_center|LOCUS_08180 368476 367073 gene locus_tag LOCUS_08190 368476 367073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_08190 368987 368502 gene locus_tag LOCUS_08200 gene hisI 368987 368502 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IW3 protein_id gnl|my_center|LOCUS_08200 370470 369478 gene locus_tag LOCUS_08210 370470 369478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 373145 370845 gene locus_tag LOCUS_08220 373145 370845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 373655 373338 gene locus_tag LOCUS_08230 373655 373338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 373873 375045 gene locus_tag LOCUS_08240 373873 375045 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_08240 375928 376938 gene locus_tag LOCUS_08250 375928 376938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119429.1 protein_id gnl|my_center|LOCUS_08250 377949 377248 gene locus_tag LOCUS_08260 377949 377248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 380090 378663 gene locus_tag LOCUS_08270 380090 378663 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067535.1 protein_id gnl|my_center|LOCUS_08270 380271 381080 gene locus_tag LOCUS_08280 380271 381080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 381296 382663 gene locus_tag LOCUS_08290 gene yopA 381296 382663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31937 protein_id gnl|my_center|LOCUS_08290 382845 384209 gene locus_tag LOCUS_08300 382845 384209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 384377 385591 gene locus_tag LOCUS_08310 gene bcpC 384377 385591 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_868623.2 protein_id gnl|my_center|LOCUS_08310 386563 386138 gene locus_tag LOCUS_08320 386563 386138 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228709.1 protein_id gnl|my_center|LOCUS_08320 386954 387313 gene locus_tag LOCUS_08330 gene groS 386954 387313 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU13 protein_id gnl|my_center|LOCUS_08330 388439 387339 gene locus_tag LOCUS_08340 388439 387339 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_08340 389629 388463 gene locus_tag LOCUS_08350 389629 388463 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031018.1 protein_id gnl|my_center|LOCUS_08350 389956 390573 gene locus_tag LOCUS_08360 gene rpsH 389956 390573 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_08360 390606 391127 gene locus_tag LOCUS_08370 390606 391127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 391108 392415 gene locus_tag LOCUS_08380 391108 392415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 392552 393286 gene locus_tag LOCUS_08390 392552 393286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118676.1 protein_id gnl|my_center|LOCUS_08390 393360 395726 gene locus_tag LOCUS_08400 393360 395726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 395962 396891 gene locus_tag LOCUS_08410 395962 396891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 397713 396946 gene locus_tag LOCUS_08420 397713 396946 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706370.1 protein_id gnl|my_center|LOCUS_08420 399095 397755 gene locus_tag LOCUS_08430 399095 397755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 399995 399159 gene locus_tag LOCUS_08440 399995 399159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 400121 400672 gene locus_tag LOCUS_08450 400121 400672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 400998 403457 gene locus_tag LOCUS_08460 gene butB 400998 403457 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122380.1 protein_id gnl|my_center|LOCUS_08460 403562 404851 gene locus_tag LOCUS_08470 403562 404851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_08470 404886 406577 gene locus_tag LOCUS_08480 404886 406577 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122383.1 protein_id gnl|my_center|LOCUS_08480 408568 407087 gene locus_tag LOCUS_08490 408568 407087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 409236 408808 gene locus_tag LOCUS_08500 409236 408808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 410296 409316 gene locus_tag LOCUS_08510 410296 409316 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_08510 410904 411860 gene locus_tag LOCUS_08520 410904 411860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 412797 411868 gene locus_tag LOCUS_08530 412797 411868 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_08530 413055 413789 gene locus_tag LOCUS_08540 413055 413789 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_08540 414615 413995 gene locus_tag LOCUS_08550 414615 413995 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120280.1 protein_id gnl|my_center|LOCUS_08550 414718 416427 gene locus_tag LOCUS_08560 414718 416427 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120282.1 protein_id gnl|my_center|LOCUS_08560 416424 419786 gene locus_tag LOCUS_08570 416424 419786 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120283.1 protein_id gnl|my_center|LOCUS_08570 420197 420889 gene locus_tag LOCUS_08580 420197 420889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 421966 420914 gene locus_tag LOCUS_08590 421966 420914 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974655.1 protein_id gnl|my_center|LOCUS_08590 422601 422179 gene locus_tag LOCUS_08600 422601 422179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 423996 422614 gene locus_tag LOCUS_08610 423996 422614 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947459.1 protein_id gnl|my_center|LOCUS_08610 424521 424048 gene locus_tag LOCUS_08620 424521 424048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 424860 424570 gene locus_tag LOCUS_08630 424860 424570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 425481 425002 gene locus_tag LOCUS_08640 425481 425002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117855.1 protein_id gnl|my_center|LOCUS_08640 426384 425617 gene locus_tag LOCUS_08650 426384 425617 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527984.1 protein_id gnl|my_center|LOCUS_08650 427113 426493 gene locus_tag LOCUS_08660 427113 426493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 427535 429340 gene locus_tag LOCUS_08670 427535 429340 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_08670 430301 429378 gene locus_tag LOCUS_08680 gene draG 430301 429378 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_08680 431188 430376 gene locus_tag LOCUS_08690 431188 430376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123256.1 protein_id gnl|my_center|LOCUS_08690 431445 431927 gene locus_tag LOCUS_08700 431445 431927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 432727 431924 gene locus_tag LOCUS_08710 432727 431924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 433770 432823 gene locus_tag LOCUS_08720 433770 432823 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324315.1 protein_id gnl|my_center|LOCUS_08720 434217 435518 gene locus_tag LOCUS_08730 434217 435518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 435540 435806 gene locus_tag LOCUS_08740 435540 435806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 436076 437440 gene locus_tag LOCUS_08750 436076 437440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 437560 438819 gene locus_tag LOCUS_08760 437560 438819 CDS product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 protein_id gnl|my_center|LOCUS_08760 440205 438916 gene locus_tag LOCUS_08770 440205 438916 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335856.1 protein_id gnl|my_center|LOCUS_08770 440901 440296 gene locus_tag LOCUS_08780 440901 440296 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_08780 441270 445106 gene locus_tag LOCUS_08790 441270 445106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 445163 446167 gene locus_tag LOCUS_08800 445163 446167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 446352 447596 gene locus_tag LOCUS_08810 446352 447596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 448957 447659 gene locus_tag LOCUS_08820 448957 447659 CDS product polysaccharide pyruvyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_08820 452765 449688 gene locus_tag LOCUS_08830 452765 449688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 454150 453389 gene locus_tag LOCUS_08840 454150 453389 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036962.1 protein_id gnl|my_center|LOCUS_08840 455357 454233 gene locus_tag LOCUS_08850 455357 454233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 456369 455563 gene locus_tag LOCUS_08860 456369 455563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 456580 457368 gene locus_tag LOCUS_08870 gene trpC 456580 457368 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ7 protein_id gnl|my_center|LOCUS_08870 457427 458038 gene locus_tag LOCUS_08880 457427 458038 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121754.1 protein_id gnl|my_center|LOCUS_08880 458219 458884 gene locus_tag LOCUS_08890 458219 458884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 459084 460097 gene locus_tag LOCUS_08900 459084 460097 CDS product trans-2-enoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_08900 460219 461367 gene locus_tag LOCUS_08910 460219 461367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 461588 461394 gene locus_tag LOCUS_08920 461588 461394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 462193 463284 gene locus_tag LOCUS_08930 462193 463284 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_08930 463376 464782 gene locus_tag LOCUS_08940 463376 464782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 465152 465643 gene locus_tag LOCUS_08950 465152 465643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 465803 467413 gene locus_tag LOCUS_08960 gene yljF 465803 467413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_08960 467727 467428 gene locus_tag LOCUS_08970 467727 467428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 468557 467889 gene locus_tag LOCUS_08980 gene tmk 468557 467889 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MF63 protein_id gnl|my_center|LOCUS_08980 469956 468646 gene locus_tag LOCUS_08990 469956 468646 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123590.1 protein_id gnl|my_center|LOCUS_08990 470237 472012 gene locus_tag LOCUS_09000 gene ggtA 470237 472012 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_09000 473254 472067 gene locus_tag LOCUS_09010 473254 472067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 474616 473735 gene locus_tag LOCUS_09020 474616 473735 CDS product myo-inositol catabolism protein IolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_09020 475742 474702 gene locus_tag LOCUS_09030 475742 474702 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_09030 476512 475739 gene locus_tag LOCUS_09040 476512 475739 CDS product D-arabino 3-hexulose 6-phosphate aldehyde lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_09040 476855 478018 gene locus_tag LOCUS_09050 476855 478018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 478357 478536 gene locus_tag LOCUS_09060 478357 478536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 479750 478560 gene locus_tag LOCUS_09070 479750 478560 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_09070 480171 481430 gene locus_tag LOCUS_09080 480171 481430 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_09080 481553 482047 gene locus_tag LOCUS_09090 481553 482047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 483135 482044 gene locus_tag LOCUS_09100 483135 482044 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_09100 485459 483267 gene locus_tag LOCUS_09110 485459 483267 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328585.1 protein_id gnl|my_center|LOCUS_09110 486876 485731 gene locus_tag LOCUS_09120 486876 485731 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403915.1 protein_id gnl|my_center|LOCUS_09120 488061 487132 gene locus_tag LOCUS_09130 gene cysK 488061 487132 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y99 protein_id gnl|my_center|LOCUS_09130 489817 488345 gene locus_tag LOCUS_09140 489817 488345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 491458 489827 gene locus_tag LOCUS_09150 491458 489827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 492339 492593 gene locus_tag LOCUS_09160 492339 492593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 493128 493706 gene locus_tag LOCUS_09170 493128 493706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 493820 494167 gene locus_tag LOCUS_09180 493820 494167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 protein_id gnl|my_center|LOCUS_09180 494357 494602 gene locus_tag LOCUS_09190 494357 494602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 494602 494976 gene locus_tag LOCUS_09200 494602 494976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 494970 495821 gene locus_tag LOCUS_09210 494970 495821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 495821 496090 gene locus_tag LOCUS_09220 495821 496090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 496090 496341 gene locus_tag LOCUS_09230 496090 496341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 496226 496660 gene locus_tag LOCUS_09240 496226 496660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 496793 497053 gene locus_tag LOCUS_09250 496793 497053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 497073 497630 gene locus_tag LOCUS_09260 497073 497630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 497609 498727 gene locus_tag LOCUS_09270 497609 498727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 499465 498755 gene locus_tag LOCUS_09280 499465 498755 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_09280 500353 499505 gene locus_tag LOCUS_09290 500353 499505 CDS product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921804.1 protein_id gnl|my_center|LOCUS_09290 500580 501242 gene locus_tag LOCUS_09300 gene mipB 500580 501242 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WQU7 protein_id gnl|my_center|LOCUS_09300 501387 502694 gene locus_tag LOCUS_09310 gene arsA 501387 502694 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_09310 502721 503512 gene locus_tag LOCUS_09320 502721 503512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121552.1 protein_id gnl|my_center|LOCUS_09320 503538 503813 gene locus_tag LOCUS_09330 503538 503813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 504832 503834 gene locus_tag LOCUS_09340 504832 503834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 506321 505080 gene locus_tag LOCUS_09350 506321 505080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 507053 506403 gene locus_tag LOCUS_09360 507053 506403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 507345 507545 gene locus_tag LOCUS_09370 507345 507545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 507854 508543 gene locus_tag LOCUS_09380 507854 508543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 508622 509494 gene locus_tag LOCUS_09390 508622 509494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 509475 509639 gene locus_tag LOCUS_09400 509475 509639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 510133 509753 gene locus_tag LOCUS_09410 510133 509753 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_09410 511050 510235 gene locus_tag LOCUS_09420 511050 510235 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_09420 511710 511144 gene locus_tag LOCUS_09430 511710 511144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 513272 511758 gene locus_tag LOCUS_09440 513272 511758 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118438.1 protein_id gnl|my_center|LOCUS_09440 515674 513431 gene locus_tag LOCUS_09450 515674 513431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 516093 515680 gene locus_tag LOCUS_09460 516093 515680 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123550.1 protein_id gnl|my_center|LOCUS_09460 517287 517952 gene locus_tag LOCUS_09470 517287 517952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 518818 517976 gene locus_tag LOCUS_09480 518818 517976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 520626 518977 gene locus_tag LOCUS_09490 520626 518977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 521348 521572 gene locus_tag LOCUS_09500 gene csrA 521348 521572 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIW4 protein_id gnl|my_center|LOCUS_09500 521705 523669 gene locus_tag LOCUS_09510 521705 523669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 523899 524876 gene locus_tag LOCUS_09520 523899 524876 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_09520 527237 524877 gene locus_tag LOCUS_09530 527237 524877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 529141 528002 gene locus_tag LOCUS_09540 gene cheB1 529141 528002 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 protein_id gnl|my_center|LOCUS_09540 529389 530330 gene locus_tag LOCUS_09550 529389 530330 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_09550 531575 530349 gene locus_tag LOCUS_09560 531575 530349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 533814 531955 gene locus_tag LOCUS_09570 533814 531955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 534780 533824 gene locus_tag LOCUS_09580 534780 533824 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121978.1 protein_id gnl|my_center|LOCUS_09580 535768 534845 gene locus_tag LOCUS_09590 535768 534845 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121978.1 protein_id gnl|my_center|LOCUS_09590 536137 535826 gene locus_tag LOCUS_09600 536137 535826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 536889 536281 gene locus_tag LOCUS_09610 536889 536281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 537247 536882 gene locus_tag LOCUS_09620 537247 536882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 538657 537347 gene locus_tag LOCUS_09630 538657 537347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 540187 538925 gene locus_tag LOCUS_09640 gene pilG 540187 538925 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 protein_id gnl|my_center|LOCUS_09640 541293 540187 gene locus_tag LOCUS_09650 gene gspF 541293 540187 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_09650 541807 543138 gene locus_tag LOCUS_09660 gene asnS 541807 543138 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG51 protein_id gnl|my_center|LOCUS_09660 544026 543169 gene locus_tag LOCUS_09670 544026 543169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 544308 545984 gene locus_tag LOCUS_09680 544308 545984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 546045 547502 gene locus_tag LOCUS_09690 546045 547502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 549202 547511 gene locus_tag LOCUS_09700 549202 547511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 549432 550661 gene locus_tag LOCUS_09710 549432 550661 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_09710 550878 551555 gene locus_tag LOCUS_09720 550878 551555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 552077 553330 gene locus_tag LOCUS_09730 552077 553330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 553436 554707 gene locus_tag LOCUS_09740 553436 554707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 554797 555309 gene locus_tag LOCUS_09750 554797 555309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 555363 555596 gene locus_tag LOCUS_09760 555363 555596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 555661 556323 gene locus_tag LOCUS_09770 555661 556323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 556362 556664 gene locus_tag LOCUS_09780 556362 556664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 556661 557113 gene locus_tag LOCUS_09790 556661 557113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 557110 557379 gene locus_tag LOCUS_09800 557110 557379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 557316 557774 gene locus_tag LOCUS_09810 557316 557774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 557791 558684 gene locus_tag LOCUS_09820 557791 558684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 558726 559172 gene locus_tag LOCUS_09830 558726 559172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 559235 559549 gene locus_tag LOCUS_09840 559235 559549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 559553 561955 gene locus_tag LOCUS_09850 559553 561955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 561952 562683 gene locus_tag LOCUS_09860 561952 562683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 562696 565593 gene locus_tag LOCUS_09870 562696 565593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 565593 567728 gene locus_tag LOCUS_09880 565593 567728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 567728 569554 gene locus_tag LOCUS_09890 567728 569554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 569978 572164 gene locus_tag LOCUS_09900 569978 572164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 572151 572936 gene locus_tag LOCUS_09910 572151 572936 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123308.1 protein_id gnl|my_center|LOCUS_09910 574066 573521 gene locus_tag LOCUS_09920 574066 573521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 575855 574482 gene locus_tag LOCUS_09930 575855 574482 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_09930 577134 575989 gene locus_tag LOCUS_09940 577134 575989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 577891 577199 gene locus_tag LOCUS_09950 577891 577199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 578369 577986 gene locus_tag LOCUS_09960 578369 577986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 578821 581955 gene locus_tag LOCUS_09970 gene gdhP 578821 581955 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_09970 582008 583525 gene locus_tag LOCUS_09980 582008 583525 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_09980 583832 584296 gene locus_tag LOCUS_09990 583832 584296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 584580 584365 gene locus_tag LOCUS_10000 584580 584365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 585650 584946 gene locus_tag LOCUS_10010 585650 584946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 586505 585669 gene locus_tag LOCUS_10020 586505 585669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 587190 586513 gene locus_tag LOCUS_10030 587190 586513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_402716.2 protein_id gnl|my_center|LOCUS_10030 588362 587232 gene locus_tag LOCUS_10040 gene dprA 588362 587232 CDS product DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122801.1 protein_id gnl|my_center|LOCUS_10040 588704 589582 gene locus_tag LOCUS_10050 588704 589582 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C3 protein_id gnl|my_center|LOCUS_10050 589610 590191 gene locus_tag LOCUS_10060 589610 590191 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056410.1 protein_id gnl|my_center|LOCUS_10060 590243 590728 gene locus_tag LOCUS_10070 590243 590728 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_10070 590807 591895 gene locus_tag LOCUS_10080 590807 591895 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence03 3720 295 gene locus_tag LOCUS_10090 3720 295 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_10090 5169 3730 gene locus_tag LOCUS_10100 5169 3730 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119957.1 protein_id gnl|my_center|LOCUS_10100 6462 6722 gene locus_tag LOCUS_10110 6462 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7200 9644 gene locus_tag LOCUS_10120 7200 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 10020 16553 gene locus_tag LOCUS_10130 10020 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 16621 17301 gene locus_tag LOCUS_10140 16621 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 17358 18140 gene locus_tag LOCUS_10150 17358 18140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 18939 18865 gene locus_tag LOCUS_t00100 18939 18865 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20062 19127 gene locus_tag LOCUS_10160 20062 19127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 22826 20454 gene locus_tag LOCUS_10170 22826 20454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 23810 23001 gene locus_tag LOCUS_10180 23810 23001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 25213 23927 gene locus_tag LOCUS_10190 25213 23927 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_10190 26878 25331 gene locus_tag LOCUS_10200 26878 25331 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_10200 28243 27011 gene locus_tag LOCUS_10210 28243 27011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 29695 28589 gene locus_tag LOCUS_10220 gene apbE 29695 28589 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTS4 protein_id gnl|my_center|LOCUS_10220 30385 29795 gene locus_tag LOCUS_10230 gene leuD 30385 29795 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_10230 31864 30443 gene locus_tag LOCUS_10240 gene leuC 31864 30443 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF0 protein_id gnl|my_center|LOCUS_10240 32495 33973 gene locus_tag LOCUS_10250 gene ffh 32495 33973 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_10250 34065 34451 gene locus_tag LOCUS_10260 34065 34451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 34497 35198 gene locus_tag LOCUS_10270 gene trmD 34497 35198 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY8 protein_id gnl|my_center|LOCUS_10270 35275 35637 gene locus_tag LOCUS_10280 gene rplS 35275 35637 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI13 protein_id gnl|my_center|LOCUS_10280 35746 36144 gene locus_tag LOCUS_10290 35746 36144 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF9 protein_id gnl|my_center|LOCUS_10290 36231 36674 gene locus_tag LOCUS_10300 36231 36674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 protein_id gnl|my_center|LOCUS_10300 37286 38575 gene locus_tag LOCUS_10310 37286 38575 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5N6 protein_id gnl|my_center|LOCUS_10310 38770 40248 gene locus_tag LOCUS_10320 38770 40248 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_10320 40438 42144 gene locus_tag LOCUS_10330 40438 42144 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325471.1 protein_id gnl|my_center|LOCUS_10330 42284 43270 gene locus_tag LOCUS_10340 gene gmd 42284 43270 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_10340 43421 45322 gene locus_tag LOCUS_10350 gene ligA 43421 45322 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKD1 protein_id gnl|my_center|LOCUS_10350 46259 45333 gene locus_tag LOCUS_10360 46259 45333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 47665 46331 gene locus_tag LOCUS_10370 47665 46331 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_10370 47950 49314 gene locus_tag LOCUS_10380 47950 49314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_10380 49664 53206 gene locus_tag LOCUS_10390 49664 53206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121009.1 protein_id gnl|my_center|LOCUS_10390 53451 57161 gene locus_tag LOCUS_10400 gene metH 53451 57161 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_10400 57832 57179 gene locus_tag LOCUS_10410 57832 57179 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229518.1 protein_id gnl|my_center|LOCUS_10410 58148 58234 gene locus_tag LOCUS_t00110 58148 58234 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58364 58843 gene locus_tag LOCUS_10420 58364 58843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 59231 60154 gene locus_tag LOCUS_10430 59231 60154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 60216 60497 gene locus_tag LOCUS_10440 60216 60497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10440 61961 61665 gene locus_tag LOCUS_10450 61961 61665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 61921 62784 gene locus_tag LOCUS_10460 61921 62784 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5Q8 protein_id gnl|my_center|LOCUS_10460 62796 64241 gene locus_tag LOCUS_10470 62796 64241 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123146.1 protein_id gnl|my_center|LOCUS_10470 64252 64476 gene locus_tag LOCUS_10480 64252 64476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 64473 65723 gene locus_tag LOCUS_10490 64473 65723 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_10490 65839 65961 gene locus_tag LOCUS_10500 65839 65961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 66075 66818 gene locus_tag LOCUS_10510 66075 66818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 66954 67682 gene locus_tag LOCUS_10520 66954 67682 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123168.1 protein_id gnl|my_center|LOCUS_10520 68389 67790 gene locus_tag LOCUS_10530 68389 67790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806862.1 protein_id gnl|my_center|LOCUS_10530 68725 69360 gene locus_tag LOCUS_10540 68725 69360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 74507 69348 gene locus_tag LOCUS_10550 74507 69348 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122240.1 protein_id gnl|my_center|LOCUS_10550 91034 74637 gene locus_tag LOCUS_10560 91034 74637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 92011 92727 gene locus_tag LOCUS_10570 92011 92727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 93920 92724 gene locus_tag LOCUS_10580 93920 92724 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_10580 94048 95220 gene locus_tag LOCUS_10590 94048 95220 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_10590 95718 96116 gene locus_tag LOCUS_10600 95718 96116 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331759.1 protein_id gnl|my_center|LOCUS_10600 96116 98902 gene locus_tag LOCUS_10610 96116 98902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 100078 98924 gene locus_tag LOCUS_10620 100078 98924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 100596 100108 gene locus_tag LOCUS_10630 100596 100108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 100982 100782 gene locus_tag LOCUS_10640 100982 100782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 101489 101088 gene locus_tag LOCUS_10650 gene atpC 101489 101088 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB4 protein_id gnl|my_center|LOCUS_10650 103041 101587 gene locus_tag LOCUS_10660 gene atpD 103041 101587 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB5 protein_id gnl|my_center|LOCUS_10660 103994 103116 gene locus_tag LOCUS_10670 gene atpG 103994 103116 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_10670 105558 104041 gene locus_tag LOCUS_10680 gene atpA2 105558 104041 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB7 protein_id gnl|my_center|LOCUS_10680 106153 105509 gene locus_tag LOCUS_10690 gene atpH 106153 105509 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU47 protein_id gnl|my_center|LOCUS_10690 106848 106231 gene locus_tag LOCUS_10700 gene atpF 106848 106231 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNJ3 protein_id gnl|my_center|LOCUS_10700 107269 106940 gene locus_tag LOCUS_10710 107269 106940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 108213 107353 gene locus_tag LOCUS_10720 108213 107353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 109038 108751 gene locus_tag LOCUS_10730 109038 108751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 109948 111057 gene locus_tag LOCUS_10740 109948 111057 CDS product Rho termination factor domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327172.1 protein_id gnl|my_center|LOCUS_10740 111978 111106 gene locus_tag LOCUS_10750 111978 111106 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_10750 113188 112184 gene locus_tag LOCUS_10760 gene ilvC 113188 112184 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKY0 protein_id gnl|my_center|LOCUS_10760 113884 113366 gene locus_tag LOCUS_10770 gene ilvN 113884 113366 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122509.1 protein_id gnl|my_center|LOCUS_10770 114227 115990 gene locus_tag LOCUS_10780 gene recJ 114227 115990 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_10780 120314 116013 gene locus_tag LOCUS_10790 120314 116013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 120591 120421 gene locus_tag LOCUS_10800 120591 120421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 121020 122582 gene locus_tag LOCUS_10810 121020 122582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 122626 124269 gene locus_tag LOCUS_10820 122626 124269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 124298 125920 gene locus_tag LOCUS_10830 124298 125920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121421.1 protein_id gnl|my_center|LOCUS_10830 125917 126960 gene locus_tag LOCUS_10840 125917 126960 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_10840 128429 130291 gene locus_tag LOCUS_10850 128429 130291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 130288 133335 gene locus_tag LOCUS_10860 130288 133335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123724.1 protein_id gnl|my_center|LOCUS_10860 133362 134378 gene locus_tag LOCUS_10870 133362 134378 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_10870 134457 135290 gene locus_tag LOCUS_10880 134457 135290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_10880 135287 137170 gene locus_tag LOCUS_10890 135287 137170 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122294.1 protein_id gnl|my_center|LOCUS_10890 137256 139373 gene locus_tag LOCUS_10900 137256 139373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 139436 140365 gene locus_tag LOCUS_10910 139436 140365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_10910 140362 142239 gene locus_tag LOCUS_10920 140362 142239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 142236 144146 gene locus_tag LOCUS_10930 142236 144146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 144143 145105 gene locus_tag LOCUS_10940 144143 145105 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_10940 145105 146670 gene locus_tag LOCUS_10950 145105 146670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 146803 147702 gene locus_tag LOCUS_10960 146803 147702 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URI8 protein_id gnl|my_center|LOCUS_10960 148861 147788 gene locus_tag LOCUS_10970 gene leuB 148861 147788 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIE1 protein_id gnl|my_center|LOCUS_10970 149296 149595 gene locus_tag LOCUS_10980 149296 149595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 150294 149662 gene locus_tag LOCUS_10990 150294 149662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118740.1 protein_id gnl|my_center|LOCUS_10990 150463 153003 gene locus_tag LOCUS_11000 gene uvrA 150463 153003 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK42 protein_id gnl|my_center|LOCUS_11000 153143 153601 gene locus_tag LOCUS_11010 153143 153601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 153796 154023 gene locus_tag LOCUS_11020 153796 154023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 154137 155087 gene locus_tag LOCUS_11030 154137 155087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 157710 155113 gene locus_tag LOCUS_11040 gene comE 157710 155113 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122496.1 protein_id gnl|my_center|LOCUS_11040 158627 157740 gene locus_tag LOCUS_11050 158627 157740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 158850 160718 gene locus_tag LOCUS_11060 gene dppF 158850 160718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946429.1 protein_id gnl|my_center|LOCUS_11060 160895 161347 gene locus_tag LOCUS_11070 160895 161347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 161597 163543 gene locus_tag LOCUS_11080 161597 163543 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_11080 163655 164641 gene locus_tag LOCUS_11090 163655 164641 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_11090 164812 165813 gene locus_tag LOCUS_11100 164812 165813 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_11100 168158 165825 gene locus_tag LOCUS_11110 168158 165825 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122797.1 protein_id gnl|my_center|LOCUS_11110 169162 168197 gene locus_tag LOCUS_11120 169162 168197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 169418 169597 gene locus_tag LOCUS_11130 169418 169597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 170310 169774 gene locus_tag LOCUS_11140 170310 169774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 170599 171006 gene locus_tag LOCUS_11150 170599 171006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 172284 171019 gene locus_tag LOCUS_11160 172284 171019 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124070.1 protein_id gnl|my_center|LOCUS_11160 173156 172464 gene locus_tag LOCUS_11170 173156 172464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_11170 173459 174190 gene locus_tag LOCUS_11180 173459 174190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 175756 174215 gene locus_tag LOCUS_11190 gene miaB 175756 174215 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULM9 protein_id gnl|my_center|LOCUS_11190 176071 175853 gene locus_tag LOCUS_11200 176071 175853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 176906 176334 gene locus_tag LOCUS_11210 gene efp 176906 176334 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN7 protein_id gnl|my_center|LOCUS_11210 177147 178154 gene locus_tag LOCUS_11220 177147 178154 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_11220 179573 178158 gene locus_tag LOCUS_11230 gene murD 179573 178158 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03522 protein_id gnl|my_center|LOCUS_11230 179733 181712 gene locus_tag LOCUS_11240 179733 181712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 182707 182237 gene locus_tag LOCUS_11250 182707 182237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 183276 184379 gene locus_tag LOCUS_11260 183276 184379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 184489 185409 gene locus_tag LOCUS_11270 184489 185409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 185637 187409 gene locus_tag LOCUS_11280 185637 187409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123977.1 protein_id gnl|my_center|LOCUS_11280 187602 189338 gene locus_tag LOCUS_11290 187602 189338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 189587 190648 gene locus_tag LOCUS_11300 189587 190648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 191350 190670 gene locus_tag LOCUS_11310 191350 190670 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176077.1 protein_id gnl|my_center|LOCUS_11310 192345 191404 gene locus_tag LOCUS_11320 192345 191404 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870345.1 protein_id gnl|my_center|LOCUS_11320 192830 192414 gene locus_tag LOCUS_11330 192830 192414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 193170 194090 gene locus_tag LOCUS_11340 193170 194090 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_11340 194179 195066 gene locus_tag LOCUS_11350 gene dapA 194179 195066 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVB1 protein_id gnl|my_center|LOCUS_11350 195188 196492 gene locus_tag LOCUS_11360 195188 196492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 197076 197309 gene locus_tag LOCUS_11370 197076 197309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 199257 197524 gene locus_tag LOCUS_11380 199257 197524 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_11380 203039 199425 gene locus_tag LOCUS_11390 203039 199425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 203546 205462 gene locus_tag LOCUS_11400 203546 205462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 206871 205459 gene locus_tag LOCUS_11410 206871 205459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 207210 208430 gene locus_tag LOCUS_11420 207210 208430 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_11420 208743 208492 gene locus_tag LOCUS_11430 gene rpmA 208743 208492 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_11430 209738 208902 gene locus_tag LOCUS_11440 209738 208902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 209971 209792 gene locus_tag LOCUS_11450 209971 209792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 211739 210228 gene locus_tag LOCUS_11460 211739 210228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 212060 213319 gene locus_tag LOCUS_11470 212060 213319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 214763 213360 gene locus_tag LOCUS_11480 214763 213360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120289.1 protein_id gnl|my_center|LOCUS_11480 215258 216205 gene locus_tag LOCUS_11490 215258 216205 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_11490 216273 216737 gene locus_tag LOCUS_11500 216273 216737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 217610 216786 gene locus_tag LOCUS_11510 217610 216786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 217816 218805 gene locus_tag LOCUS_11520 gene nadA 217816 218805 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2Z1 protein_id gnl|my_center|LOCUS_11520 219373 220752 gene locus_tag LOCUS_11530 gene crnA 219373 220752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_11530 220810 223788 gene locus_tag LOCUS_11540 220810 223788 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369394.1 protein_id gnl|my_center|LOCUS_11540 223803 224573 gene locus_tag LOCUS_11550 223803 224573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 224580 226325 gene locus_tag LOCUS_11560 224580 226325 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117876.1 protein_id gnl|my_center|LOCUS_11560 226355 228562 gene locus_tag LOCUS_11570 gene narB 226355 228562 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_11570 229209 229976 gene locus_tag LOCUS_11580 229209 229976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 230352 230885 gene locus_tag LOCUS_11590 230352 230885 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404802.1 protein_id gnl|my_center|LOCUS_11590 230917 231504 gene locus_tag LOCUS_11600 230917 231504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 231509 232192 gene locus_tag LOCUS_11610 231509 232192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 232282 235008 gene locus_tag LOCUS_11620 232282 235008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120757.1 protein_id gnl|my_center|LOCUS_11620 235106 236404 gene locus_tag LOCUS_11630 235106 236404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_11630 236482 236991 gene locus_tag LOCUS_11640 236482 236991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 237255 240113 gene locus_tag LOCUS_11650 237255 240113 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121568.1 protein_id gnl|my_center|LOCUS_11650 240129 241568 gene locus_tag LOCUS_11660 240129 241568 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_11660 242419 244701 gene locus_tag LOCUS_11670 242419 244701 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120869.1 protein_id gnl|my_center|LOCUS_11670 244724 244882 gene locus_tag LOCUS_11680 244724 244882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 244902 245591 gene locus_tag LOCUS_11690 244902 245591 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120870.1 protein_id gnl|my_center|LOCUS_11690 245626 247005 gene locus_tag LOCUS_11700 245626 247005 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_11700 246984 247544 gene locus_tag LOCUS_11710 246984 247544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339097.1 protein_id gnl|my_center|LOCUS_11710 247594 248385 gene locus_tag LOCUS_11720 247594 248385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120872.1 protein_id gnl|my_center|LOCUS_11720 248574 250877 gene locus_tag LOCUS_11730 248574 250877 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120873.1 protein_id gnl|my_center|LOCUS_11730 250874 251041 gene locus_tag LOCUS_11740 250874 251041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 251349 251149 gene locus_tag LOCUS_11750 251349 251149 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_11750 252059 251808 gene locus_tag LOCUS_11760 252059 251808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 252308 252637 gene locus_tag LOCUS_11770 252308 252637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 252627 254318 gene locus_tag LOCUS_11780 252627 254318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 255690 254767 gene locus_tag LOCUS_11790 255690 254767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 256044 256679 gene locus_tag LOCUS_11800 256044 256679 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118831.1 protein_id gnl|my_center|LOCUS_11800 257276 258538 gene locus_tag LOCUS_11810 257276 258538 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143683.1 protein_id gnl|my_center|LOCUS_11810 258596 259774 gene locus_tag LOCUS_11820 258596 259774 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222016.1 protein_id gnl|my_center|LOCUS_11820 259801 261327 gene locus_tag LOCUS_11830 259801 261327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 261617 261360 gene locus_tag LOCUS_11840 261617 261360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 262274 262201 gene locus_tag LOCUS_t00120 262274 262201 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 263778 262477 gene locus_tag LOCUS_11850 263778 262477 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_11850 264187 265266 gene locus_tag LOCUS_11860 264187 265266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_11860 265279 265965 gene locus_tag LOCUS_11870 265279 265965 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_11870 266072 267421 gene locus_tag LOCUS_11880 266072 267421 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122491.1 protein_id gnl|my_center|LOCUS_11880 268332 267490 gene locus_tag LOCUS_11890 268332 267490 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123406.1 protein_id gnl|my_center|LOCUS_11890 269012 268329 gene locus_tag LOCUS_11900 269012 268329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328057.1 protein_id gnl|my_center|LOCUS_11900 269294 270154 gene locus_tag LOCUS_11910 gene nadK 269294 270154 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB8 protein_id gnl|my_center|LOCUS_11910 270280 271158 gene locus_tag LOCUS_11920 270280 271158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 271530 272459 gene locus_tag LOCUS_11930 271530 272459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660854.1 protein_id gnl|my_center|LOCUS_11930 272729 275473 gene locus_tag LOCUS_11940 272729 275473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 276120 275524 gene locus_tag LOCUS_11950 276120 275524 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_11950 276225 276152 gene locus_tag LOCUS_t00130 276225 276152 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 276333 276247 gene locus_tag LOCUS_t00140 276333 276247 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 276474 276389 gene locus_tag LOCUS_t00150 276474 276389 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 276575 276502 gene locus_tag LOCUS_t00160 276575 276502 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 276669 276597 gene locus_tag LOCUS_t00170 276669 276597 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 277007 276831 gene locus_tag LOCUS_11960 277007 276831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 277161 276994 gene locus_tag LOCUS_11970 277161 276994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 277262 278356 gene locus_tag LOCUS_11980 277262 278356 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324315.1 protein_id gnl|my_center|LOCUS_11980 278414 278962 gene locus_tag LOCUS_11990 278414 278962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 279676 278981 gene locus_tag LOCUS_12000 279676 278981 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258130.1 protein_id gnl|my_center|LOCUS_12000 281219 279828 gene locus_tag LOCUS_12010 281219 279828 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_12010 284558 281271 gene locus_tag LOCUS_12020 284558 281271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 284933 286114 gene locus_tag LOCUS_12030 284933 286114 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_12030 287968 286247 gene locus_tag LOCUS_12040 287968 286247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 288919 290049 gene locus_tag LOCUS_12050 288919 290049 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066962.1 protein_id gnl|my_center|LOCUS_12050 290929 290072 gene locus_tag LOCUS_12060 290929 290072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 291488 292282 gene locus_tag LOCUS_12070 291488 292282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 292442 295603 gene locus_tag LOCUS_12080 292442 295603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_12080 295626 297086 gene locus_tag LOCUS_12090 295626 297086 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_12090 297915 297340 gene locus_tag LOCUS_12100 297915 297340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 298345 298058 gene locus_tag LOCUS_12110 298345 298058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 298679 298347 gene locus_tag LOCUS_12120 298679 298347 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ14 protein_id gnl|my_center|LOCUS_12120 299132 298737 gene locus_tag LOCUS_12130 299132 298737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 299749 299129 gene locus_tag LOCUS_12140 299749 299129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 300155 299721 gene locus_tag LOCUS_12150 300155 299721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 300721 300221 gene locus_tag LOCUS_12160 300721 300221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 300918 301781 gene locus_tag LOCUS_12170 300918 301781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 302258 301890 gene locus_tag LOCUS_12180 gene queF 302258 301890 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG9 protein_id gnl|my_center|LOCUS_12180 303820 302369 gene locus_tag LOCUS_12190 303820 302369 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_12190 303971 304990 gene locus_tag LOCUS_12200 gene galE 303971 304990 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120830.1 protein_id gnl|my_center|LOCUS_12200 305177 307285 gene locus_tag LOCUS_12210 305177 307285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_12210 307443 308285 gene locus_tag LOCUS_12220 307443 308285 CDS product heme peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_869234.2 protein_id gnl|my_center|LOCUS_12220 309327 308338 gene locus_tag LOCUS_12230 309327 308338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123753.1 protein_id gnl|my_center|LOCUS_12230 310144 310992 gene locus_tag LOCUS_12240 310144 310992 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_12240 311947 310997 gene locus_tag LOCUS_12250 311947 310997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 312918 312046 gene locus_tag LOCUS_12260 312918 312046 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122966.1 protein_id gnl|my_center|LOCUS_12260 313462 312923 gene locus_tag LOCUS_12270 gene ymdB 313462 312923 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRB0 protein_id gnl|my_center|LOCUS_12270 313603 314718 gene locus_tag LOCUS_12280 313603 314718 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_12280 314773 316785 gene locus_tag LOCUS_12290 gene asnB 314773 316785 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_12290 316918 318285 gene locus_tag LOCUS_12300 316918 318285 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_12300 318434 319066 gene locus_tag LOCUS_12310 gene pgsA 318434 319066 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330879.1 protein_id gnl|my_center|LOCUS_12310 319223 320227 gene locus_tag LOCUS_12320 319223 320227 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_12320 321430 320348 gene locus_tag LOCUS_12330 321430 320348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_12330 323009 321540 gene locus_tag LOCUS_12340 323009 321540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_12340 328233 323092 gene locus_tag LOCUS_12350 328233 323092 CDS product vegetatible incompatibility protein HET-E-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118726.1 protein_id gnl|my_center|LOCUS_12350 330548 328752 gene locus_tag LOCUS_12360 330548 328752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 331181 330609 gene locus_tag LOCUS_12370 331181 330609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 331751 331224 gene locus_tag LOCUS_12380 331751 331224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 332161 332442 gene locus_tag LOCUS_12390 332161 332442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 332963 332460 gene locus_tag LOCUS_12400 gene folK 332963 332460 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29252 protein_id gnl|my_center|LOCUS_12400 333336 332965 gene locus_tag LOCUS_12410 gene folX 333336 332965 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316983.1 protein_id gnl|my_center|LOCUS_12410 333508 334842 gene locus_tag LOCUS_12420 333508 334842 CDS product polysaccharide pyruvyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_12420 335722 334871 gene locus_tag LOCUS_12430 335722 334871 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_12430 336635 335706 gene locus_tag LOCUS_12440 336635 335706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 336993 337880 gene locus_tag LOCUS_12450 336993 337880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 338886 339857 gene locus_tag LOCUS_12460 338886 339857 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_12460 340430 340765 gene locus_tag LOCUS_12470 340430 340765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 340987 342075 gene locus_tag LOCUS_12480 340987 342075 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI10 protein_id gnl|my_center|LOCUS_12480 343444 342185 gene locus_tag LOCUS_12490 343444 342185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 345829 343520 gene locus_tag LOCUS_12500 345829 343520 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_12500 347924 345951 gene locus_tag LOCUS_12510 347924 345951 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_12510 348180 350369 gene locus_tag LOCUS_12520 gene fdhF 348180 350369 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_12520 351095 350406 gene locus_tag LOCUS_12530 351095 350406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 352242 351466 gene locus_tag LOCUS_12540 gene tam 352242 351466 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF21 protein_id gnl|my_center|LOCUS_12540 355487 352413 gene locus_tag LOCUS_12550 355487 352413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 356261 355728 gene locus_tag LOCUS_12560 356261 355728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 357246 356857 gene locus_tag LOCUS_12570 357246 356857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 358104 357364 gene locus_tag LOCUS_12580 358104 357364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 358195 359739 gene locus_tag LOCUS_12590 358195 359739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 359736 361319 gene locus_tag LOCUS_12600 359736 361319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 361333 362580 gene locus_tag LOCUS_12610 361333 362580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 362935 362585 gene locus_tag LOCUS_12620 362935 362585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 363281 363033 gene locus_tag LOCUS_12630 gene ykoF 363281 363033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_12630 363929 364177 gene locus_tag LOCUS_12640 363929 364177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 364429 365199 gene locus_tag LOCUS_12650 364429 365199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 365604 365344 gene locus_tag LOCUS_12660 365604 365344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 365899 366876 gene locus_tag LOCUS_12670 365899 366876 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_12670 367251 367838 gene locus_tag LOCUS_12680 367251 367838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 368434 368030 gene locus_tag LOCUS_12690 368434 368030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119766.1 protein_id gnl|my_center|LOCUS_12690 369566 369066 gene locus_tag LOCUS_12700 369566 369066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 370074 369544 gene locus_tag LOCUS_12710 370074 369544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 370458 370255 gene locus_tag LOCUS_12720 370458 370255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 370745 370458 gene locus_tag LOCUS_12730 370745 370458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 370807 371004 gene locus_tag LOCUS_12740 370807 371004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 371446 373878 gene locus_tag LOCUS_12750 371446 373878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 374047 374499 gene locus_tag LOCUS_12760 374047 374499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 374889 375077 gene locus_tag LOCUS_12770 374889 375077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 375345 375950 gene locus_tag LOCUS_12780 375345 375950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 376847 376056 gene locus_tag LOCUS_12790 376847 376056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 377268 377750 gene locus_tag LOCUS_12800 377268 377750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 378527 378072 gene locus_tag LOCUS_12810 378527 378072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 378894 379148 gene locus_tag LOCUS_12820 378894 379148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 379633 379214 gene locus_tag LOCUS_12830 379633 379214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 379988 379686 gene locus_tag LOCUS_12840 379988 379686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 380391 380050 gene locus_tag LOCUS_12850 380391 380050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 380590 380411 gene locus_tag LOCUS_12860 380590 380411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12860 380780 380613 gene locus_tag LOCUS_12870 380780 380613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12870 381091 380861 gene locus_tag LOCUS_12880 381091 380861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 381526 381454 gene locus_tag LOCUS_t00180 381526 381454 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 383113 381752 gene locus_tag LOCUS_12890 383113 381752 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122601.1 protein_id gnl|my_center|LOCUS_12890 384605 383361 gene locus_tag LOCUS_12900 384605 383361 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_12900 385475 384627 gene locus_tag LOCUS_12910 gene sgaU 385475 384627 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_12910 385754 386224 gene locus_tag LOCUS_12920 385754 386224 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGK6 protein_id gnl|my_center|LOCUS_12920 386424 387929 gene locus_tag LOCUS_12930 386424 387929 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_12930 389321 387939 gene locus_tag LOCUS_12940 gene mnmE 389321 387939 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJI3 protein_id gnl|my_center|LOCUS_12940 391484 389346 gene locus_tag LOCUS_12950 391484 389346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 392233 391487 gene locus_tag LOCUS_12960 392233 391487 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_12960 393309 394703 gene locus_tag LOCUS_12970 gene atoC 393309 394703 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_12970 394938 396110 gene locus_tag LOCUS_12980 394938 396110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118832.1 protein_id gnl|my_center|LOCUS_12980 396794 396132 gene locus_tag LOCUS_12990 gene cmk 396794 396132 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEW6 protein_id gnl|my_center|LOCUS_12990 399722 396798 gene locus_tag LOCUS_13000 399722 396798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119059.1 protein_id gnl|my_center|LOCUS_13000 400365 402497 gene locus_tag LOCUS_13010 400365 402497 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_13010 402601 404307 gene locus_tag LOCUS_13020 402601 404307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 404373 406556 gene locus_tag LOCUS_13030 404373 406556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 408106 406667 gene locus_tag LOCUS_13040 gene folC 408106 406667 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319749.1 protein_id gnl|my_center|LOCUS_13040 408105 408290 gene locus_tag LOCUS_13050 408105 408290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 408313 408801 gene locus_tag LOCUS_13060 408313 408801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 408969 409298 gene locus_tag LOCUS_13070 408969 409298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 410470 409325 gene locus_tag LOCUS_13080 gene cpaE 410470 409325 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_13080 412396 410624 gene locus_tag LOCUS_13090 gene cpaC 412396 410624 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120311.1 protein_id gnl|my_center|LOCUS_13090 413594 412548 gene locus_tag LOCUS_13100 413594 412548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 414474 413923 gene locus_tag LOCUS_13110 gene cpaA 414474 413923 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_13110 415207 415034 gene locus_tag LOCUS_13120 415207 415034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 417262 415814 gene locus_tag LOCUS_13130 417262 415814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_13130 417571 418485 gene locus_tag LOCUS_13140 417571 418485 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_13140 420261 418522 gene locus_tag LOCUS_13150 420261 418522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_13150 423596 420861 gene locus_tag LOCUS_13160 423596 420861 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121470.1 protein_id gnl|my_center|LOCUS_13160 424683 423730 gene locus_tag LOCUS_13170 gene glpG 424683 423730 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 protein_id gnl|my_center|LOCUS_13170 425738 424722 gene locus_tag LOCUS_13180 425738 424722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 428096 425784 gene locus_tag LOCUS_13190 428096 425784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 428304 429743 gene locus_tag LOCUS_13200 428304 429743 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118991.1 protein_id gnl|my_center|LOCUS_13200 430100 430333 gene locus_tag LOCUS_13210 430100 430333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 430938 434084 gene locus_tag LOCUS_13220 430938 434084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 434431 434267 gene locus_tag LOCUS_13230 434431 434267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 434430 435830 gene locus_tag LOCUS_13240 434430 435830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_13240 435939 436556 gene locus_tag LOCUS_13250 435939 436556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 437607 436726 gene locus_tag LOCUS_13260 437607 436726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 438296 437757 gene locus_tag LOCUS_13270 438296 437757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 439323 439248 gene locus_tag LOCUS_t00190 439323 439248 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 439622 441286 gene locus_tag LOCUS_13280 439622 441286 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_13280 442406 441306 gene locus_tag LOCUS_13290 gene gcdH 442406 441306 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948280.1 protein_id gnl|my_center|LOCUS_13290 443674 442535 gene locus_tag LOCUS_13300 443674 442535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118099.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13300 444065 445162 gene locus_tag LOCUS_13310 444065 445162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 445507 446904 gene locus_tag LOCUS_13320 445507 446904 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123398.1 protein_id gnl|my_center|LOCUS_13320 447108 448034 gene locus_tag LOCUS_13330 gene thiL 447108 448034 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S1 protein_id gnl|my_center|LOCUS_13330 449918 448428 gene locus_tag LOCUS_13340 449918 448428 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120948.1 protein_id gnl|my_center|LOCUS_13340 450611 449985 gene locus_tag LOCUS_13350 gene recR 450611 449985 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ68 protein_id gnl|my_center|LOCUS_13350 451053 450694 gene locus_tag LOCUS_13360 gene yaaK 451053 450694 CDS product nucleoid-associated protein YaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24281 protein_id gnl|my_center|LOCUS_13360 452894 451050 gene locus_tag LOCUS_13370 gene dnaX 452894 451050 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120949.1 protein_id gnl|my_center|LOCUS_13370 453319 454644 gene locus_tag LOCUS_13380 453319 454644 CDS product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_13380 454718 455347 gene locus_tag LOCUS_13390 454718 455347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 456803 455799 gene locus_tag LOCUS_13400 456803 455799 CDS product stearoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120146.1 protein_id gnl|my_center|LOCUS_13400 457759 457025 gene locus_tag LOCUS_13410 457759 457025 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_13410 458763 457756 gene locus_tag LOCUS_13420 458763 457756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 459130 459564 gene locus_tag LOCUS_13430 459130 459564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 459696 460424 gene locus_tag LOCUS_13440 459696 460424 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_13440 460463 461518 gene locus_tag LOCUS_13450 460463 461518 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122136.1 protein_id gnl|my_center|LOCUS_13450 462983 461547 gene locus_tag LOCUS_13460 462983 461547 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_13460 464235 463132 gene locus_tag LOCUS_13470 464235 463132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_13470 464444 464232 gene locus_tag LOCUS_13480 464444 464232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 464706 465245 gene locus_tag LOCUS_13490 464706 465245 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118402.1 protein_id gnl|my_center|LOCUS_13490 465428 466678 gene locus_tag LOCUS_13500 465428 466678 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_13500 466665 467897 gene locus_tag LOCUS_13510 466665 467897 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_13510 472197 467929 gene locus_tag LOCUS_13520 472197 467929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 472395 472979 gene locus_tag LOCUS_13530 472395 472979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence04 647 174 gene locus_tag LOCUS_13540 647 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3432 703 gene locus_tag LOCUS_13550 3432 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4512 3730 gene locus_tag LOCUS_13560 4512 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5433 4582 gene locus_tag LOCUS_13570 5433 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 6176 5472 gene locus_tag LOCUS_13580 6176 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10451 6249 gene locus_tag LOCUS_13590 10451 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 12572 10755 gene locus_tag LOCUS_13600 gene fliC 12572 10755 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPE2 protein_id gnl|my_center|LOCUS_13600 13806 14078 gene locus_tag LOCUS_13610 13806 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 15302 14157 gene locus_tag LOCUS_13620 15302 14157 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_13620 16424 15351 gene locus_tag LOCUS_13630 gene moxR 16424 15351 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_13630 16624 17439 gene locus_tag LOCUS_13640 16624 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_13640 18649 17453 gene locus_tag LOCUS_13650 18649 17453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 22026 18877 gene locus_tag LOCUS_13660 22026 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 23011 22046 gene locus_tag LOCUS_13670 gene galM 23011 22046 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39840 protein_id gnl|my_center|LOCUS_13670 23644 23075 gene locus_tag LOCUS_13680 23644 23075 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEM4 protein_id gnl|my_center|LOCUS_13680 24024 26042 gene locus_tag LOCUS_13690 24024 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 27996 26176 gene locus_tag LOCUS_13700 27996 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 28318 29304 gene locus_tag LOCUS_13710 28318 29304 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123698.1 protein_id gnl|my_center|LOCUS_13710 29306 30967 gene locus_tag LOCUS_13720 29306 30967 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117576.1 protein_id gnl|my_center|LOCUS_13720 32562 31132 gene locus_tag LOCUS_13730 32562 31132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 33092 32559 gene locus_tag LOCUS_13740 33092 32559 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_13740 33396 36836 gene locus_tag LOCUS_13750 33396 36836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 37159 40668 gene locus_tag LOCUS_13760 37159 40668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 40757 42082 gene locus_tag LOCUS_13770 40757 42082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119562.1 protein_id gnl|my_center|LOCUS_13770 42297 46004 gene locus_tag LOCUS_13780 42297 46004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120599.1 protein_id gnl|my_center|LOCUS_13780 46019 46930 gene locus_tag LOCUS_13790 46019 46930 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119084.1 protein_id gnl|my_center|LOCUS_13790 47815 46961 gene locus_tag LOCUS_13800 47815 46961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 49469 47949 gene locus_tag LOCUS_13810 49469 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118110.1 protein_id gnl|my_center|LOCUS_13810 50545 49469 gene locus_tag LOCUS_13820 50545 49469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120378.1 protein_id gnl|my_center|LOCUS_13820 51343 50747 gene locus_tag LOCUS_13830 51343 50747 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_13830 52609 51599 gene locus_tag LOCUS_13840 52609 51599 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123060.1 protein_id gnl|my_center|LOCUS_13840 53014 53181 gene locus_tag LOCUS_13850 53014 53181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 53108 54499 gene locus_tag LOCUS_13860 gene ntrB 53108 54499 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123059.1 protein_id gnl|my_center|LOCUS_13860 54477 55889 gene locus_tag LOCUS_13870 gene ntrC 54477 55889 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123058.1 protein_id gnl|my_center|LOCUS_13870 55914 57407 gene locus_tag LOCUS_13880 55914 57407 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_13880 57647 58609 gene locus_tag LOCUS_13890 57647 58609 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080275.1 protein_id gnl|my_center|LOCUS_13890 58715 60052 gene locus_tag LOCUS_13900 58715 60052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 60049 62067 gene locus_tag LOCUS_13910 60049 62067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 62267 62500 gene locus_tag LOCUS_13920 62267 62500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 63682 62531 gene locus_tag LOCUS_13930 63682 62531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 63932 65260 gene locus_tag LOCUS_13940 63932 65260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 65348 67021 gene locus_tag LOCUS_13950 65348 67021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 67336 67788 gene locus_tag LOCUS_13960 67336 67788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 67867 68781 gene locus_tag LOCUS_13970 67867 68781 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_13970 70202 68919 gene locus_tag LOCUS_13980 70202 68919 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_13980 72169 70385 gene locus_tag LOCUS_13990 72169 70385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122284.1 protein_id gnl|my_center|LOCUS_13990 73321 72332 gene locus_tag LOCUS_14000 73321 72332 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_14000 74632 73451 gene locus_tag LOCUS_14010 74632 73451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_14010 75914 74712 gene locus_tag LOCUS_14020 75914 74712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_14020 76869 75973 gene locus_tag LOCUS_14030 76869 75973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 77735 77022 gene locus_tag LOCUS_14040 77735 77022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 78881 78276 gene locus_tag LOCUS_14050 78881 78276 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_14050 79660 78878 gene locus_tag LOCUS_14060 79660 78878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 81021 79660 gene locus_tag LOCUS_14070 81021 79660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_14070 82527 81181 gene locus_tag LOCUS_14080 82527 81181 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_14080 83267 82593 gene locus_tag LOCUS_14090 83267 82593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_14090 83582 84859 gene locus_tag LOCUS_14100 83582 84859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 85021 85581 gene locus_tag LOCUS_14110 gene pyrE 85021 85581 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYX5 protein_id gnl|my_center|LOCUS_14110 85624 87033 gene locus_tag LOCUS_14120 gene pgi 85624 87033 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYT0 protein_id gnl|my_center|LOCUS_14120 87615 87106 gene locus_tag LOCUS_14130 gene fabZ 87615 87106 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_14130 88749 87793 gene locus_tag LOCUS_14140 88749 87793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 89764 90336 gene locus_tag LOCUS_14150 89764 90336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_14150 90541 92202 gene locus_tag LOCUS_14160 90541 92202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 93239 92208 gene locus_tag LOCUS_14170 gene gnl 93239 92208 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120521.1 protein_id gnl|my_center|LOCUS_14170 94020 93334 gene locus_tag LOCUS_14180 94020 93334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 94889 94053 gene locus_tag LOCUS_14190 94889 94053 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_14190 96147 95164 gene locus_tag LOCUS_14200 96147 95164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 99418 96374 gene locus_tag LOCUS_14210 99418 96374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 100979 99684 gene locus_tag LOCUS_14220 100979 99684 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_14220 101330 101533 gene locus_tag LOCUS_14230 101330 101533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 101548 102126 gene locus_tag LOCUS_14240 101548 102126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14240 102226 102669 gene locus_tag LOCUS_14250 gene fur 102226 102669 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_14250 103797 102685 gene locus_tag LOCUS_14260 103797 102685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 104339 105928 gene locus_tag LOCUS_14270 gene oprO 104339 105928 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117790.1 protein_id gnl|my_center|LOCUS_14270 105992 106447 gene locus_tag LOCUS_14280 105992 106447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 106682 108148 gene locus_tag LOCUS_14290 106682 108148 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ72 protein_id gnl|my_center|LOCUS_14290 110362 108161 gene locus_tag LOCUS_14300 110362 108161 CDS product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942791.1 protein_id gnl|my_center|LOCUS_14300 110639 111736 gene locus_tag LOCUS_14310 110639 111736 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 protein_id gnl|my_center|LOCUS_14310 112136 112627 gene locus_tag LOCUS_14320 gene accB 112136 112627 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121914.1 protein_id gnl|my_center|LOCUS_14320 112717 114054 gene locus_tag LOCUS_14330 gene accC 112717 114054 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_14330 114276 115310 gene locus_tag LOCUS_14340 gene pfkA1 114276 115310 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08333 protein_id gnl|my_center|LOCUS_14340 115628 115449 gene locus_tag LOCUS_14350 115628 115449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 115603 117216 gene locus_tag LOCUS_14360 115603 117216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 117285 120353 gene locus_tag LOCUS_14370 117285 120353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 120438 121505 gene locus_tag LOCUS_14380 120438 121505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 121576 122526 gene locus_tag LOCUS_14390 121576 122526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 122665 123480 gene locus_tag LOCUS_14400 122665 123480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 123514 124179 gene locus_tag LOCUS_14410 123514 124179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 124176 124550 gene locus_tag LOCUS_14420 124176 124550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 124616 125671 gene locus_tag LOCUS_14430 124616 125671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 126876 125662 gene locus_tag LOCUS_14440 126876 125662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 128478 126934 gene locus_tag LOCUS_14450 128478 126934 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530038.1 protein_id gnl|my_center|LOCUS_14450 131358 128626 gene locus_tag LOCUS_14460 131358 128626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 132594 133046 gene locus_tag LOCUS_14470 132594 133046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 133135 134022 gene locus_tag LOCUS_14480 133135 134022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 134045 134263 gene locus_tag LOCUS_14490 134045 134263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 134432 135436 gene locus_tag LOCUS_14500 134432 135436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946797.1 protein_id gnl|my_center|LOCUS_14500 135749 135665 gene locus_tag LOCUS_t00200 135749 135665 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 136048 139245 gene locus_tag LOCUS_14510 136048 139245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 139385 140347 gene locus_tag LOCUS_14520 139385 140347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_14520 141920 140373 gene locus_tag LOCUS_14530 141920 140373 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_14530 142027 142929 gene locus_tag LOCUS_14540 gene murQ 142027 142929 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNL6 protein_id gnl|my_center|LOCUS_14540 142980 143936 gene locus_tag LOCUS_14550 142980 143936 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121426.1 protein_id gnl|my_center|LOCUS_14550 144758 143940 gene locus_tag LOCUS_14560 144758 143940 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390557.1 protein_id gnl|my_center|LOCUS_14560 145693 144788 gene locus_tag LOCUS_14570 145693 144788 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_14570 146695 145742 gene locus_tag LOCUS_14580 146695 145742 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_14580 146966 146733 gene locus_tag LOCUS_14590 146966 146733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 147003 147899 gene locus_tag LOCUS_14600 gene mscS 147003 147899 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_14600 148879 150006 gene locus_tag LOCUS_14610 148879 150006 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281794.1 protein_id gnl|my_center|LOCUS_14610 150032 150556 gene locus_tag LOCUS_14620 150032 150556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 150761 152545 gene locus_tag LOCUS_14630 150761 152545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 152713 154116 gene locus_tag LOCUS_14640 152713 154116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760980.1 protein_id gnl|my_center|LOCUS_14640 155651 154215 gene locus_tag LOCUS_14650 155651 154215 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_14650 157574 155835 gene locus_tag LOCUS_14660 157574 155835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 157603 157776 gene locus_tag LOCUS_14670 157603 157776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 158315 157950 gene locus_tag LOCUS_14680 gene cheY 158315 157950 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71403 protein_id gnl|my_center|LOCUS_14680 158869 158381 gene locus_tag LOCUS_14690 gene cheX 158869 158381 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417353.1 protein_id gnl|my_center|LOCUS_14690 159648 159902 gene locus_tag LOCUS_14700 159648 159902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 159981 160646 gene locus_tag LOCUS_14710 159981 160646 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 protein_id gnl|my_center|LOCUS_14710 161623 160670 gene locus_tag LOCUS_14720 gene yccK 161623 160670 CDS product putative oxidoreductase YccK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46905 protein_id gnl|my_center|LOCUS_14720 161774 162460 gene locus_tag LOCUS_14730 161774 162460 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_14730 163155 162457 gene locus_tag LOCUS_14740 163155 162457 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328113.1 protein_id gnl|my_center|LOCUS_14740 164042 163206 gene locus_tag LOCUS_14750 gene mshM 164042 163206 CDS product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_14750 164297 165028 gene locus_tag LOCUS_14760 164297 165028 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AE1 protein_id gnl|my_center|LOCUS_14760 165433 165056 gene locus_tag LOCUS_14770 165433 165056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 166445 165480 gene locus_tag LOCUS_14780 166445 165480 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_14780 166763 169687 gene locus_tag LOCUS_14790 gene leuS 166763 169687 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMC0 protein_id gnl|my_center|LOCUS_14790 172224 169765 gene locus_tag LOCUS_14800 172224 169765 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_14800 172817 172386 gene locus_tag LOCUS_14810 172817 172386 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_14810 172939 173871 gene locus_tag LOCUS_14820 172939 173871 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_14820 173928 174731 gene locus_tag LOCUS_14830 173928 174731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 176055 174742 gene locus_tag LOCUS_14840 gene hom 176055 174742 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFK4 protein_id gnl|my_center|LOCUS_14840 176899 176288 gene locus_tag LOCUS_14850 176899 176288 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_14850 178877 177252 gene locus_tag LOCUS_14860 gene serA 178877 177252 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQL2 protein_id gnl|my_center|LOCUS_14860 179189 180583 gene locus_tag LOCUS_14870 179189 180583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 180646 181320 gene locus_tag LOCUS_14880 180646 181320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 181977 181348 gene locus_tag LOCUS_14890 181977 181348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 182104 182673 gene locus_tag LOCUS_14900 182104 182673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 183118 185499 gene locus_tag LOCUS_14910 183118 185499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 185986 185594 gene locus_tag LOCUS_14920 185986 185594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 186256 187932 gene locus_tag LOCUS_14930 gene nadE 186256 187932 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_14930 187999 190329 gene locus_tag LOCUS_14940 187999 190329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 191267 190353 gene locus_tag LOCUS_14950 191267 190353 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_14950 191671 192492 gene locus_tag LOCUS_14960 191671 192492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 193212 192538 gene locus_tag LOCUS_14970 193212 192538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 194285 193341 gene locus_tag LOCUS_14980 194285 193341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 196290 194572 gene locus_tag LOCUS_14990 196290 194572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 197360 196503 gene locus_tag LOCUS_15000 197360 196503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 197726 197941 gene locus_tag LOCUS_15010 197726 197941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 197913 198230 gene locus_tag LOCUS_15020 gene groS 197913 198230 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61493 protein_id gnl|my_center|LOCUS_15020 198330 199928 gene locus_tag LOCUS_15030 gene groL3 198330 199928 CDS product 60 kDa chaperonin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY9 protein_id gnl|my_center|LOCUS_15030 200219 201475 gene locus_tag LOCUS_15040 gene argG 200219 201475 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDE0 protein_id gnl|my_center|LOCUS_15040 201514 202209 gene locus_tag LOCUS_15050 201514 202209 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120671.1 protein_id gnl|my_center|LOCUS_15050 203663 202245 gene locus_tag LOCUS_15060 203663 202245 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_15060 204084 204437 gene locus_tag LOCUS_15070 204084 204437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 205597 204455 gene locus_tag LOCUS_15080 gene rlmN 205597 204455 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHU7 protein_id gnl|my_center|LOCUS_15080 207687 205780 gene locus_tag LOCUS_15090 207687 205780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 209210 208011 gene locus_tag LOCUS_15100 209210 208011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_15100 209789 210067 gene locus_tag LOCUS_15110 209789 210067 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_15110 211110 210154 gene locus_tag LOCUS_15120 211110 210154 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118295.1 protein_id gnl|my_center|LOCUS_15120 211274 212635 gene locus_tag LOCUS_15130 211274 212635 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_15130 212651 212866 gene locus_tag LOCUS_15140 212651 212866 CDS product ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325922.1 protein_id gnl|my_center|LOCUS_15140 215721 213124 gene locus_tag LOCUS_15150 215721 213124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 216141 217436 gene locus_tag LOCUS_15160 216141 217436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387028.1 protein_id gnl|my_center|LOCUS_15160 218619 217420 gene locus_tag LOCUS_15170 gene trmE 218619 217420 CDS product tRNA modification GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120877.1 protein_id gnl|my_center|LOCUS_15170 219455 218625 gene locus_tag LOCUS_15180 219455 218625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 219851 219501 gene locus_tag LOCUS_15190 219851 219501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 221153 219906 gene locus_tag LOCUS_15200 gene xseA 221153 219906 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTZ9 protein_id gnl|my_center|LOCUS_15200 221969 221187 gene locus_tag LOCUS_15210 221969 221187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 222198 224879 gene locus_tag LOCUS_15220 222198 224879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119692.1 protein_id gnl|my_center|LOCUS_15220 225752 224907 gene locus_tag LOCUS_15230 225752 224907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 227352 225760 gene locus_tag LOCUS_15240 227352 225760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 228392 227748 gene locus_tag LOCUS_15250 228392 227748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 230414 228450 gene locus_tag LOCUS_15260 230414 228450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121017.1 protein_id gnl|my_center|LOCUS_15260 232331 230556 gene locus_tag LOCUS_15270 232331 230556 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_15270 233374 232376 gene locus_tag LOCUS_15280 233374 232376 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_15280 234519 233473 gene locus_tag LOCUS_15290 234519 233473 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_15290 235921 234752 gene locus_tag LOCUS_15300 gene lpxB 235921 234752 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119004.1 protein_id gnl|my_center|LOCUS_15300 236581 236201 gene locus_tag LOCUS_15310 gene rplU 236581 236201 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 protein_id gnl|my_center|LOCUS_15310 238397 236832 gene locus_tag LOCUS_15320 gene rne 238397 236832 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_15320 241038 239275 gene locus_tag LOCUS_15330 gene ptsI 241038 239275 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMU0 protein_id gnl|my_center|LOCUS_15330 241416 241114 gene locus_tag LOCUS_15340 241416 241114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 242115 241642 gene locus_tag LOCUS_15350 gene fruA 242115 241642 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_15350 242667 242305 gene locus_tag LOCUS_15360 242667 242305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 242742 243002 gene locus_tag LOCUS_15370 242742 243002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 243230 243526 gene locus_tag LOCUS_15380 243230 243526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 243628 244437 gene locus_tag LOCUS_15390 243628 244437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123367.1 protein_id gnl|my_center|LOCUS_15390 245966 244488 gene locus_tag LOCUS_15400 245966 244488 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120940.1 protein_id gnl|my_center|LOCUS_15400 247225 246089 gene locus_tag LOCUS_15410 247225 246089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 249568 247478 gene locus_tag LOCUS_15420 249568 247478 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120698.1 protein_id gnl|my_center|LOCUS_15420 250872 250087 gene locus_tag LOCUS_15430 250872 250087 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256009.1 protein_id gnl|my_center|LOCUS_15430 251022 254075 gene locus_tag LOCUS_15440 251022 254075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 254197 255576 gene locus_tag LOCUS_15450 254197 255576 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123172.1 protein_id gnl|my_center|LOCUS_15450 255749 257095 gene locus_tag LOCUS_15460 gene ndh 255749 257095 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_15460 257689 257138 gene locus_tag LOCUS_15470 257689 257138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 259049 257721 gene locus_tag LOCUS_15480 gene mntB 259049 257721 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_15480 260560 259049 gene locus_tag LOCUS_15490 gene mntB 260560 259049 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_15490 261372 260557 gene locus_tag LOCUS_15500 gene mntA 261372 260557 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_15500 262473 261478 gene locus_tag LOCUS_15510 gene mtsA 262473 261478 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123738.1 protein_id gnl|my_center|LOCUS_15510 265358 262587 gene locus_tag LOCUS_15520 265358 262587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 266209 265715 gene locus_tag LOCUS_15530 266209 265715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117810.1 protein_id gnl|my_center|LOCUS_15530 267306 266314 gene locus_tag LOCUS_15540 267306 266314 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122130.1 protein_id gnl|my_center|LOCUS_15540 268628 267804 gene locus_tag LOCUS_15550 268628 267804 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_15550 268918 269739 gene locus_tag LOCUS_15560 gene mqnA 268918 269739 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_15560 269708 270838 gene locus_tag LOCUS_15570 gene mqnC 269708 270838 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT24 protein_id gnl|my_center|LOCUS_15570 270994 271755 gene locus_tag LOCUS_15580 gene natA 270994 271755 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_15580 271761 274181 gene locus_tag LOCUS_15590 271761 274181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 274254 275480 gene locus_tag LOCUS_15600 gene trzA 274254 275480 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_15600 275640 277547 gene locus_tag LOCUS_15610 275640 277547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 277691 278866 gene locus_tag LOCUS_15620 277691 278866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118845.1 protein_id gnl|my_center|LOCUS_15620 278894 279691 gene locus_tag LOCUS_15630 278894 279691 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_15630 280233 279706 gene locus_tag LOCUS_15640 gene apt 280233 279706 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR74 protein_id gnl|my_center|LOCUS_15640 281959 280226 gene locus_tag LOCUS_15650 281959 280226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 282093 282503 gene locus_tag LOCUS_15660 gene cbiX 282093 282503 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_15660 283599 282586 gene locus_tag LOCUS_15670 283599 282586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123767.1 protein_id gnl|my_center|LOCUS_15670 284727 284978 gene locus_tag LOCUS_15680 284727 284978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 285056 285379 gene locus_tag LOCUS_15690 285056 285379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 285645 286703 gene locus_tag LOCUS_15700 gene lpxK 285645 286703 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW7 protein_id gnl|my_center|LOCUS_15700 287017 287790 gene locus_tag LOCUS_15710 287017 287790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122300.1 protein_id gnl|my_center|LOCUS_15710 287926 290094 gene locus_tag LOCUS_15720 287926 290094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 290152 290754 gene locus_tag LOCUS_15730 290152 290754 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_15730 290892 291566 gene locus_tag LOCUS_15740 290892 291566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 291799 296265 gene locus_tag LOCUS_15750 291799 296265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 297295 296306 gene locus_tag LOCUS_15760 297295 296306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_15760 297752 298231 gene locus_tag LOCUS_15770 297752 298231 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326945.1 protein_id gnl|my_center|LOCUS_15770 298520 299080 gene locus_tag LOCUS_15780 gene frr 298520 299080 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH0 protein_id gnl|my_center|LOCUS_15780 299233 300420 gene locus_tag LOCUS_15790 gene pgk 299233 300420 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEX1 protein_id gnl|my_center|LOCUS_15790 300979 301776 gene locus_tag LOCUS_15800 300979 301776 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_15800 301804 302973 gene locus_tag LOCUS_15810 301804 302973 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_15810 303108 303911 gene locus_tag LOCUS_15820 gene dapB 303108 303911 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJD7 protein_id gnl|my_center|LOCUS_15820 304270 304701 gene locus_tag LOCUS_15830 304270 304701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 304760 305587 gene locus_tag LOCUS_15840 304760 305587 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_15840 306551 308329 gene locus_tag LOCUS_15850 gene phoR 306551 308329 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_15850 308584 309540 gene locus_tag LOCUS_15860 308584 309540 CDS product protein sphX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_15860 309537 310532 gene locus_tag LOCUS_15870 gene pstC 309537 310532 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S083 protein_id gnl|my_center|LOCUS_15870 310529 311410 gene locus_tag LOCUS_15880 gene pstA 310529 311410 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S082 protein_id gnl|my_center|LOCUS_15880 311504 312394 gene locus_tag LOCUS_15890 gene pstB 311504 312394 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK4 protein_id gnl|my_center|LOCUS_15890 312399 313070 gene locus_tag LOCUS_15900 gene phoU 312399 313070 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_15900 313103 313816 gene locus_tag LOCUS_15910 313103 313816 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118951.1 protein_id gnl|my_center|LOCUS_15910 314387 314590 gene locus_tag LOCUS_15920 314387 314590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 314995 314525 gene locus_tag LOCUS_15930 gene bfr 314995 314525 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2S8 protein_id gnl|my_center|LOCUS_15930 316027 315227 gene locus_tag LOCUS_15940 316027 315227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 317223 317420 gene locus_tag LOCUS_15950 317223 317420 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_15950 318303 317431 gene locus_tag LOCUS_15960 318303 317431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 318599 319675 gene locus_tag LOCUS_15970 gene purM 318599 319675 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI59 protein_id gnl|my_center|LOCUS_15970 320118 320654 gene locus_tag LOCUS_15980 320118 320654 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 protein_id gnl|my_center|LOCUS_15980 320721 321965 gene locus_tag LOCUS_15990 320721 321965 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085760.1 protein_id gnl|my_center|LOCUS_15990 323203 321974 gene locus_tag LOCUS_16000 323203 321974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 323671 323321 gene locus_tag LOCUS_16010 323671 323321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 324961 323801 gene locus_tag LOCUS_16020 gene xylR 324961 323801 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_16020 325334 326449 gene locus_tag LOCUS_16030 325334 326449 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_16030 326526 331751 gene locus_tag LOCUS_16040 326526 331751 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119627.1 protein_id gnl|my_center|LOCUS_16040 332752 331916 gene locus_tag LOCUS_16050 332752 331916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 332902 334662 gene locus_tag LOCUS_16060 332902 334662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_16060 335055 335558 gene locus_tag LOCUS_16070 335055 335558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 336441 335596 gene locus_tag LOCUS_16080 336441 335596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 336831 338054 gene locus_tag LOCUS_16090 gene tyrS 336831 338054 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S238 protein_id gnl|my_center|LOCUS_16090 338266 339351 gene locus_tag LOCUS_16100 338266 339351 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_16100 339584 340759 gene locus_tag LOCUS_16110 339584 340759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 341413 340769 gene locus_tag LOCUS_16120 341413 340769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 341699 342748 gene locus_tag LOCUS_16130 gene mreB-1 341699 342748 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_16130 342766 343731 gene locus_tag LOCUS_16140 342766 343731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 343747 344286 gene locus_tag LOCUS_16150 343747 344286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 344332 346584 gene locus_tag LOCUS_16160 344332 346584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 348272 346596 gene locus_tag LOCUS_16170 gene phoA 348272 346596 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120609.1 protein_id gnl|my_center|LOCUS_16170 349001 348582 gene locus_tag LOCUS_16180 349001 348582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 350028 349096 gene locus_tag LOCUS_16190 350028 349096 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_16190 351224 350754 gene locus_tag LOCUS_16200 351224 350754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 352268 351348 gene locus_tag LOCUS_16210 352268 351348 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_16210 352730 354142 gene locus_tag LOCUS_16220 352730 354142 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG53 protein_id gnl|my_center|LOCUS_16220 354444 354908 gene locus_tag LOCUS_16230 354444 354908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 355208 356560 gene locus_tag LOCUS_16240 355208 356560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 359784 356956 gene locus_tag LOCUS_16250 359784 356956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 363633 360046 gene locus_tag LOCUS_16260 gene ccsA 363633 360046 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121935.1 protein_id gnl|my_center|LOCUS_16260 364793 363693 gene locus_tag LOCUS_16270 364793 363693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121934.1 protein_id gnl|my_center|LOCUS_16270 365883 367670 gene locus_tag LOCUS_16280 365883 367670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 367877 369937 gene locus_tag LOCUS_16290 367877 369937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence05 242 481 gene locus_tag LOCUS_16300 242 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 648 460 gene locus_tag LOCUS_16310 648 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2702 1470 gene locus_tag LOCUS_16320 2702 1470 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187228.1 protein_id gnl|my_center|LOCUS_16320 4297 3062 gene locus_tag LOCUS_16330 4297 3062 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061609.1 protein_id gnl|my_center|LOCUS_16330 5675 4398 gene locus_tag LOCUS_16340 5675 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5915 7339 gene locus_tag LOCUS_16350 5915 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 7565 10240 gene locus_tag LOCUS_16360 gene citB 7565 10240 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_16360 10252 11196 gene locus_tag LOCUS_16370 gene rluD 10252 11196 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H11 protein_id gnl|my_center|LOCUS_16370 12771 11284 gene locus_tag LOCUS_16380 gene sthA 12771 11284 CDS product putative soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66007 protein_id gnl|my_center|LOCUS_16380 13089 14096 gene locus_tag LOCUS_16390 gene yedY 13089 14096 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_16390 15122 14388 gene locus_tag LOCUS_16400 15122 14388 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_16400 15420 19286 gene locus_tag LOCUS_16410 gene oplaH 15420 19286 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_16410 19489 20025 gene locus_tag LOCUS_16420 19489 20025 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_16420 20031 20828 gene locus_tag LOCUS_16430 20031 20828 CDS product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MF66 protein_id gnl|my_center|LOCUS_16430 21610 22530 gene locus_tag LOCUS_16440 21610 22530 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993834.1 protein_id gnl|my_center|LOCUS_16440 22592 23542 gene locus_tag LOCUS_16450 gene mch 22592 23542 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPS1 protein_id gnl|my_center|LOCUS_16450 23577 24494 gene locus_tag LOCUS_16460 gene rimK 23577 24494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121083.1 protein_id gnl|my_center|LOCUS_16460 24529 25449 gene locus_tag LOCUS_16470 24529 25449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 26195 25437 gene locus_tag LOCUS_16480 26195 25437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 26580 27689 gene locus_tag LOCUS_16490 26580 27689 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_16490 28022 28477 gene locus_tag LOCUS_16500 gene rpiB 28022 28477 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_16500 28777 29163 gene locus_tag LOCUS_16510 gene gcvH 28777 29163 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA00 protein_id gnl|my_center|LOCUS_16510 29353 30708 gene locus_tag LOCUS_16520 gene yqhJ 29353 30708 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNH0 protein_id gnl|my_center|LOCUS_16520 30775 32247 gene locus_tag LOCUS_16530 gene gcvPB 30775 32247 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNH1 protein_id gnl|my_center|LOCUS_16530 32229 33074 gene locus_tag LOCUS_16540 gene lplA 32229 33074 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 protein_id gnl|my_center|LOCUS_16540 33514 34329 gene locus_tag LOCUS_16550 33514 34329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 34665 34877 gene locus_tag LOCUS_16560 34665 34877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 35672 36229 gene locus_tag LOCUS_16570 gene sigW 35672 36229 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118528.1 protein_id gnl|my_center|LOCUS_16570 36216 36926 gene locus_tag LOCUS_16580 36216 36926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 37046 38824 gene locus_tag LOCUS_16590 37046 38824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 39111 39287 gene locus_tag LOCUS_16600 39111 39287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 39281 39598 gene locus_tag LOCUS_16610 39281 39598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 41395 39701 gene locus_tag LOCUS_16620 41395 39701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_16620 43121 41436 gene locus_tag LOCUS_16630 43121 41436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_16630 44516 43236 gene locus_tag LOCUS_16640 44516 43236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 47941 44714 gene locus_tag LOCUS_16650 47941 44714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 50902 48101 gene locus_tag LOCUS_16660 50902 48101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 53631 51097 gene locus_tag LOCUS_16670 53631 51097 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_16670 54255 55505 gene locus_tag LOCUS_16680 gene ribA 54255 55505 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIK1 protein_id gnl|my_center|LOCUS_16680 56644 55508 gene locus_tag LOCUS_16690 gene solA 56644 55508 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_16690 57578 56688 gene locus_tag LOCUS_16700 57578 56688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 58227 58033 gene locus_tag LOCUS_16710 58227 58033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 58518 58243 gene locus_tag LOCUS_16720 58518 58243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 58992 59252 gene locus_tag LOCUS_16730 58992 59252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 59282 59572 gene locus_tag LOCUS_16740 gene gatC 59282 59572 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY3 protein_id gnl|my_center|LOCUS_16740 59674 61131 gene locus_tag LOCUS_16750 gene gatA 59674 61131 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY4 protein_id gnl|my_center|LOCUS_16750 61204 62688 gene locus_tag LOCUS_16760 gene gatB 61204 62688 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK56 protein_id gnl|my_center|LOCUS_16760 63179 62793 gene locus_tag LOCUS_16770 63179 62793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326213.1 protein_id gnl|my_center|LOCUS_16770 63602 63285 gene locus_tag LOCUS_16780 63602 63285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 64995 63646 gene locus_tag LOCUS_16790 64995 63646 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122564.1 protein_id gnl|my_center|LOCUS_16790 66539 65115 gene locus_tag LOCUS_16800 66539 65115 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_16800 67498 66701 gene locus_tag LOCUS_16810 67498 66701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122565.1 protein_id gnl|my_center|LOCUS_16810 68198 67575 gene locus_tag LOCUS_16820 68198 67575 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_16820 68726 70345 gene locus_tag LOCUS_16830 gene dagA 68726 70345 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_16830 70541 70978 gene locus_tag LOCUS_16840 70541 70978 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_16840 71771 71013 gene locus_tag LOCUS_16850 71771 71013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 72224 73282 gene locus_tag LOCUS_16860 72224 73282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118659.1 protein_id gnl|my_center|LOCUS_16860 73962 74849 gene locus_tag LOCUS_16870 73962 74849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 75139 75852 gene locus_tag LOCUS_16880 gene ptsN 75139 75852 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_16880 76028 76183 gene locus_tag LOCUS_16890 76028 76183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 76294 77025 gene locus_tag LOCUS_16900 76294 77025 CDS product LmbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_16900 77192 77932 gene locus_tag LOCUS_16910 77192 77932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 78020 79603 gene locus_tag LOCUS_16920 78020 79603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 79925 80776 gene locus_tag LOCUS_16930 79925 80776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 81179 80796 gene locus_tag LOCUS_16940 81179 80796 CDS product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJY4 protein_id gnl|my_center|LOCUS_16940 81581 82678 gene locus_tag LOCUS_16950 gene lpxD 81581 82678 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEV1 protein_id gnl|my_center|LOCUS_16950 82720 83610 gene locus_tag LOCUS_16960 82720 83610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122809.1 protein_id gnl|my_center|LOCUS_16960 84056 83631 gene locus_tag LOCUS_16970 84056 83631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 84679 87411 gene locus_tag LOCUS_16980 gene ppd 84679 87411 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_16980 87833 89977 gene locus_tag LOCUS_16990 gene fusA 87833 89977 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URV2 protein_id gnl|my_center|LOCUS_16990 90938 90006 gene locus_tag LOCUS_17000 90938 90006 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 protein_id gnl|my_center|LOCUS_17000 91104 92006 gene locus_tag LOCUS_17010 91104 92006 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532035.1 protein_id gnl|my_center|LOCUS_17010 92003 92506 gene locus_tag LOCUS_17020 92003 92506 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_17020 92562 93425 gene locus_tag LOCUS_17030 92562 93425 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204912.1 protein_id gnl|my_center|LOCUS_17030 94586 93432 gene locus_tag LOCUS_17040 94586 93432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324693.1 protein_id gnl|my_center|LOCUS_17040 96657 94588 gene locus_tag LOCUS_17050 96657 94588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 98332 96854 gene locus_tag LOCUS_17060 gene tolQ 98332 96854 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_17060 98923 102915 gene locus_tag LOCUS_17070 98923 102915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121833.1 protein_id gnl|my_center|LOCUS_17070 105114 103003 gene locus_tag LOCUS_17080 105114 103003 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_17080 106798 105518 gene locus_tag LOCUS_17090 106798 105518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 107113 108750 gene locus_tag LOCUS_17100 107113 108750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 108754 110022 gene locus_tag LOCUS_17110 108754 110022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_17110 110206 111480 gene locus_tag LOCUS_17120 110206 111480 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118005.1 protein_id gnl|my_center|LOCUS_17120 111601 112482 gene locus_tag LOCUS_17130 gene tyrA 111601 112482 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_17130 112558 115473 gene locus_tag LOCUS_17140 gene purL 112558 115473 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URX8 protein_id gnl|my_center|LOCUS_17140 115820 116896 gene locus_tag LOCUS_17150 gene moxR 115820 116896 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_17150 116862 117773 gene locus_tag LOCUS_17160 116862 117773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_17160 117837 120104 gene locus_tag LOCUS_17170 117837 120104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118533.1 protein_id gnl|my_center|LOCUS_17170 120101 122557 gene locus_tag LOCUS_17180 120101 122557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 122622 125102 gene locus_tag LOCUS_17190 122622 125102 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118596.1 protein_id gnl|my_center|LOCUS_17190 125317 127059 gene locus_tag LOCUS_17200 125317 127059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118595.1 protein_id gnl|my_center|LOCUS_17200 127100 128236 gene locus_tag LOCUS_17210 127100 128236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 128272 129438 gene locus_tag LOCUS_17220 128272 129438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 129522 131270 gene locus_tag LOCUS_17230 gene degP 129522 131270 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121355.1 protein_id gnl|my_center|LOCUS_17230 131372 132346 gene locus_tag LOCUS_17240 gene degP 131372 132346 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121356.1 protein_id gnl|my_center|LOCUS_17240 132367 134361 gene locus_tag LOCUS_17250 gene degP 132367 134361 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121357.1 protein_id gnl|my_center|LOCUS_17250 141125 134451 gene locus_tag LOCUS_17260 141125 134451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 144472 141122 gene locus_tag LOCUS_17270 144472 141122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 145565 144780 gene locus_tag LOCUS_17280 gene hisN 145565 144780 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_17280 146193 146765 gene locus_tag LOCUS_17290 146193 146765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 146879 147235 gene locus_tag LOCUS_17300 146879 147235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 147350 148447 gene locus_tag LOCUS_17310 147350 148447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 148524 149786 gene locus_tag LOCUS_17320 148524 149786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 149801 151165 gene locus_tag LOCUS_17330 149801 151165 CDS product secretory protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118230.1 protein_id gnl|my_center|LOCUS_17330 151165 152025 gene locus_tag LOCUS_17340 151165 152025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 152076 153185 gene locus_tag LOCUS_17350 152076 153185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 154601 153276 gene locus_tag LOCUS_17360 154601 153276 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_17360 154959 155606 gene locus_tag LOCUS_17370 154959 155606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 156040 155696 gene locus_tag LOCUS_17380 gene arsC 156040 155696 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_17380 157405 156047 gene locus_tag LOCUS_17390 157405 156047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 158256 157423 gene locus_tag LOCUS_17400 158256 157423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 159822 158284 gene locus_tag LOCUS_17410 159822 158284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 161998 159887 gene locus_tag LOCUS_17420 161998 159887 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_17420 162268 164526 gene locus_tag LOCUS_17430 162268 164526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_17430 164562 167105 gene locus_tag LOCUS_17440 164562 167105 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120925.1 protein_id gnl|my_center|LOCUS_17440 167237 171250 gene locus_tag LOCUS_17450 167237 171250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 171286 172326 gene locus_tag LOCUS_17460 171286 172326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120927.1 protein_id gnl|my_center|LOCUS_17460 172637 173845 gene locus_tag LOCUS_17470 172637 173845 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59806 protein_id gnl|my_center|LOCUS_17470 173940 174482 gene locus_tag LOCUS_17480 173940 174482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 175687 174509 gene locus_tag LOCUS_17490 175687 174509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 176808 175825 gene locus_tag LOCUS_17500 176808 175825 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_17500 177434 176859 gene locus_tag LOCUS_17510 177434 176859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_17510 180136 177587 gene locus_tag LOCUS_17520 180136 177587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 181220 180612 gene locus_tag LOCUS_17530 181220 180612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 181801 181217 gene locus_tag LOCUS_17540 gene rpoE 181801 181217 CDS product ECF RNA polymerase sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AGB6 protein_id gnl|my_center|LOCUS_17540 182811 181948 gene locus_tag LOCUS_17550 gene mtdA 182811 181948 CDS product MtdA bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_17550 183419 182922 gene locus_tag LOCUS_17560 gene fae 183419 182922 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122706.1 protein_id gnl|my_center|LOCUS_17560 183659 185008 gene locus_tag LOCUS_17570 183659 185008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 185123 186475 gene locus_tag LOCUS_17580 185123 186475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118694.1 protein_id gnl|my_center|LOCUS_17580 187190 186495 gene locus_tag LOCUS_17590 187190 186495 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_17590 187734 189026 gene locus_tag LOCUS_17600 187734 189026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 189332 189820 gene locus_tag LOCUS_17610 189332 189820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 190771 189905 gene locus_tag LOCUS_17620 190771 189905 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_17620 191635 192399 gene locus_tag LOCUS_17630 191635 192399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 195125 192414 gene locus_tag LOCUS_17640 gene topA 195125 192414 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 protein_id gnl|my_center|LOCUS_17640 195556 198045 gene locus_tag LOCUS_17650 195556 198045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 198508 199275 gene locus_tag LOCUS_17660 198508 199275 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_17660 199335 201983 gene locus_tag LOCUS_17670 199335 201983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118284.1 protein_id gnl|my_center|LOCUS_17670 202086 203921 gene locus_tag LOCUS_17680 202086 203921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118285.1 protein_id gnl|my_center|LOCUS_17680 204243 204746 gene locus_tag LOCUS_17690 204243 204746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 204805 206211 gene locus_tag LOCUS_17700 204805 206211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 206295 207176 gene locus_tag LOCUS_17710 gene panC 206295 207176 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM60 protein_id gnl|my_center|LOCUS_17710 207310 207960 gene locus_tag LOCUS_17720 gene sigE 207310 207960 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW35 protein_id gnl|my_center|LOCUS_17720 207957 209579 gene locus_tag LOCUS_17730 207957 209579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 210665 209625 gene locus_tag LOCUS_17740 gene gnl 210665 209625 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 protein_id gnl|my_center|LOCUS_17740 210942 211016 gene locus_tag LOCUS_t00210 210942 211016 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 211425 212069 gene locus_tag LOCUS_17750 gene gmhA2 211425 212069 CDS product phosphoheptose isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMN3 protein_id gnl|my_center|LOCUS_17750 212077 212661 gene locus_tag LOCUS_17760 212077 212661 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP45 protein_id gnl|my_center|LOCUS_17760 212976 212833 gene locus_tag LOCUS_17770 212976 212833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 213606 214463 gene locus_tag LOCUS_17780 213606 214463 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_17780 217471 214508 gene locus_tag LOCUS_17790 217471 214508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 218703 217897 gene locus_tag LOCUS_17800 218703 217897 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_17800 218983 218744 gene locus_tag LOCUS_17810 218983 218744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 220139 219120 gene locus_tag LOCUS_17820 220139 219120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118962.1 protein_id gnl|my_center|LOCUS_17820 221036 220302 gene locus_tag LOCUS_17830 221036 220302 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258130.1 protein_id gnl|my_center|LOCUS_17830 221292 222572 gene locus_tag LOCUS_17840 221292 222572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 222655 224061 gene locus_tag LOCUS_17850 222655 224061 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963690.1 protein_id gnl|my_center|LOCUS_17850 225114 224149 gene locus_tag LOCUS_17860 225114 224149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 226867 225326 gene locus_tag LOCUS_17870 226867 225326 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_17870 227657 226938 gene locus_tag LOCUS_17880 227657 226938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 228243 230720 gene locus_tag LOCUS_17890 gene ydcI 228243 230720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31489 protein_id gnl|my_center|LOCUS_17890 230768 231340 gene locus_tag LOCUS_17900 230768 231340 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H57 protein_id gnl|my_center|LOCUS_17900 232230 231337 gene locus_tag LOCUS_17910 232230 231337 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_17910 233007 232267 gene locus_tag LOCUS_17920 gene hisA 233007 232267 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG70 protein_id gnl|my_center|LOCUS_17920 233649 233044 gene locus_tag LOCUS_17930 gene hisH 233649 233044 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHA2 protein_id gnl|my_center|LOCUS_17930 235078 233801 gene locus_tag LOCUS_17940 235078 233801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 235630 235103 gene locus_tag LOCUS_17950 gene aroK 235630 235103 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU71 protein_id gnl|my_center|LOCUS_17950 237139 235643 gene locus_tag LOCUS_17960 237139 235643 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ72 protein_id gnl|my_center|LOCUS_17960 237424 237915 gene locus_tag LOCUS_17970 237424 237915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 237893 238465 gene locus_tag LOCUS_17980 237893 238465 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268557.1 protein_id gnl|my_center|LOCUS_17980 239428 238790 gene locus_tag LOCUS_17990 239428 238790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 240514 239687 gene locus_tag LOCUS_18000 240514 239687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964099.1 protein_id gnl|my_center|LOCUS_18000 242128 240785 gene locus_tag LOCUS_18010 242128 240785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_18010 242995 242627 gene locus_tag LOCUS_18020 242995 242627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 244132 243161 gene locus_tag LOCUS_18030 244132 243161 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_18030 244858 244673 gene locus_tag LOCUS_18040 244858 244673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 247325 245361 gene locus_tag LOCUS_18050 gene mutL 247325 245361 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPE9 protein_id gnl|my_center|LOCUS_18050 248166 247483 gene locus_tag LOCUS_18060 gene ubiX 248166 247483 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA7 protein_id gnl|my_center|LOCUS_18060 248931 248197 gene locus_tag LOCUS_18070 gene menG 248931 248197 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59912 protein_id gnl|my_center|LOCUS_18070 250423 248957 gene locus_tag LOCUS_18080 250423 248957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67542 protein_id gnl|my_center|LOCUS_18080 250578 251561 gene locus_tag LOCUS_18090 250578 251561 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115569.1 protein_id gnl|my_center|LOCUS_18090 251845 251558 gene locus_tag LOCUS_18100 251845 251558 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_18100 252340 255255 gene locus_tag LOCUS_18110 252340 255255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 255645 256676 gene locus_tag LOCUS_18120 gene fba 255645 256676 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQA3 protein_id gnl|my_center|LOCUS_18120 257557 256754 gene locus_tag LOCUS_18130 257557 256754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 257981 258487 gene locus_tag LOCUS_18140 gene ispF 257981 258487 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F830 protein_id gnl|my_center|LOCUS_18140 258573 260129 gene locus_tag LOCUS_18150 gene cysS 258573 260129 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US70 protein_id gnl|my_center|LOCUS_18150 260173 260703 gene locus_tag LOCUS_18160 gene ruvC 260173 260703 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US71 protein_id gnl|my_center|LOCUS_18160 260742 261362 gene locus_tag LOCUS_18170 gene ruvA 260742 261362 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USB0 protein_id gnl|my_center|LOCUS_18170 261628 262956 gene locus_tag LOCUS_18180 261628 262956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 264348 262990 gene locus_tag LOCUS_18190 264348 262990 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122935.1 protein_id gnl|my_center|LOCUS_18190 264957 264400 gene locus_tag LOCUS_18200 264957 264400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 265176 264958 gene locus_tag LOCUS_18210 265176 264958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 266179 265523 gene locus_tag LOCUS_18220 266179 265523 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 protein_id gnl|my_center|LOCUS_18220 266517 266206 gene locus_tag LOCUS_18230 266517 266206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 267641 266661 gene locus_tag LOCUS_18240 gene htrB 267641 266661 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_18240 268473 271286 gene locus_tag LOCUS_18250 268473 271286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_18250 271354 273282 gene locus_tag LOCUS_18260 271354 273282 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_18260 273709 275007 gene locus_tag LOCUS_18270 273709 275007 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_18270 275138 277594 gene locus_tag LOCUS_18280 275138 277594 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120680.1 protein_id gnl|my_center|LOCUS_18280 277694 280327 gene locus_tag LOCUS_18290 277694 280327 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_18290 280453 282534 gene locus_tag LOCUS_18300 280453 282534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120678.1 protein_id gnl|my_center|LOCUS_18300 282683 283690 gene locus_tag LOCUS_18310 282683 283690 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230883.1 protein_id gnl|my_center|LOCUS_18310 283878 284987 gene locus_tag LOCUS_18320 gene mnmA 283878 284987 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ4 protein_id gnl|my_center|LOCUS_18320 287972 284994 gene locus_tag LOCUS_18330 gene hpnN 287972 284994 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_18330 288825 289742 gene locus_tag LOCUS_18340 288825 289742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 291546 289825 gene locus_tag LOCUS_18350 gene glnS 291546 289825 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_18350 293176 291605 gene locus_tag LOCUS_18360 gene gltX 293176 291605 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNF9 protein_id gnl|my_center|LOCUS_18360 293414 294076 gene locus_tag LOCUS_18370 293414 294076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 294490 294116 gene locus_tag LOCUS_18380 294490 294116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124225.1 protein_id gnl|my_center|LOCUS_18380 295623 294502 gene locus_tag LOCUS_18390 gene amsD 295623 294502 CDS product amylovoran biosynthesis protein AmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887320.1 protein_id gnl|my_center|LOCUS_18390 295751 296929 gene locus_tag LOCUS_18400 295751 296929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 297857 296943 gene locus_tag LOCUS_18410 297857 296943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 298002 298271 gene locus_tag LOCUS_18420 298002 298271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 298346 300175 gene locus_tag LOCUS_18430 298346 300175 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_18430 300348 301295 gene locus_tag LOCUS_18440 gene xynE 300348 301295 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122022.1 protein_id gnl|my_center|LOCUS_18440 302160 301330 gene locus_tag LOCUS_18450 302160 301330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 303255 302206 gene locus_tag LOCUS_18460 303255 302206 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989751.1 protein_id gnl|my_center|LOCUS_18460 304168 305547 gene locus_tag LOCUS_18470 304168 305547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 306537 305641 gene locus_tag LOCUS_18480 306537 305641 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_18480 307017 307919 gene locus_tag LOCUS_18490 307017 307919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124104.1 protein_id gnl|my_center|LOCUS_18490 308195 308455 gene locus_tag LOCUS_18500 308195 308455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 309776 308568 gene locus_tag LOCUS_18510 gene galM 309776 308568 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882J1 protein_id gnl|my_center|LOCUS_18510 310357 310989 gene locus_tag LOCUS_18520 gene sigW 310357 310989 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_18520 310996 311562 gene locus_tag LOCUS_18530 310996 311562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 311688 312593 gene locus_tag LOCUS_18540 311688 312593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 312973 314493 gene locus_tag LOCUS_18550 gene dnaA 312973 314493 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XBZ3 protein_id gnl|my_center|LOCUS_18550 316734 314521 gene locus_tag LOCUS_18560 316734 314521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 317926 317300 gene locus_tag LOCUS_18570 317926 317300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 320256 318091 gene locus_tag LOCUS_18580 320256 318091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 321309 320722 gene locus_tag LOCUS_18590 321309 320722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 321795 322421 gene locus_tag LOCUS_18600 321795 322421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 323534 322452 gene locus_tag LOCUS_18610 gene mtnA 323534 322452 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKL8 protein_id gnl|my_center|LOCUS_18610 323772 324446 gene locus_tag LOCUS_18620 323772 324446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 324501 325790 gene locus_tag LOCUS_18630 324501 325790 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119180.1 protein_id gnl|my_center|LOCUS_18630 327947 326667 gene locus_tag LOCUS_18640 327947 326667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_18640 329476 327944 gene locus_tag LOCUS_18650 329476 327944 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118373.1 protein_id gnl|my_center|LOCUS_18650 330581 329550 gene locus_tag LOCUS_18660 330581 329550 CDS product Ta11 non-LTR retroelement inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120214.1 protein_id gnl|my_center|LOCUS_18660 331104 330850 gene locus_tag LOCUS_18670 331104 330850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 331744 332103 gene locus_tag LOCUS_18680 331744 332103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 333135 332260 gene locus_tag LOCUS_18690 333135 332260 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 protein_id gnl|my_center|LOCUS_18690 335661 333508 gene locus_tag LOCUS_18700 335661 333508 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_18700 336071 336940 gene locus_tag LOCUS_18710 336071 336940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 338210 336996 gene locus_tag LOCUS_18720 338210 336996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 338645 341146 gene locus_tag LOCUS_18730 338645 341146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence06 2926 194 gene locus_tag LOCUS_18740 2926 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 4128 2983 gene locus_tag LOCUS_18750 4128 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 5204 4176 gene locus_tag LOCUS_18760 5204 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 6742 6581 gene locus_tag LOCUS_18770 6742 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 7400 14752 gene locus_tag LOCUS_18780 7400 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 14755 15243 gene locus_tag LOCUS_18790 14755 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 15279 17474 gene locus_tag LOCUS_18800 15279 17474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 17471 17938 gene locus_tag LOCUS_18810 17471 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 18188 21007 gene locus_tag LOCUS_18820 18188 21007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 21021 21491 gene locus_tag LOCUS_18830 21021 21491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 21632 22108 gene locus_tag LOCUS_18840 21632 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 22405 24312 gene locus_tag LOCUS_18850 22405 24312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 25733 26758 gene locus_tag LOCUS_18860 25733 26758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 26733 27332 gene locus_tag LOCUS_18870 26733 27332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 27695 28135 gene locus_tag LOCUS_18880 27695 28135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 29267 29022 gene locus_tag LOCUS_18890 29267 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 29924 31354 gene locus_tag LOCUS_18900 29924 31354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 31351 35946 gene locus_tag LOCUS_18910 31351 35946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 35953 38274 gene locus_tag LOCUS_18920 35953 38274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 38302 42174 gene locus_tag LOCUS_18930 38302 42174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 42219 43664 gene locus_tag LOCUS_18940 42219 43664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 44077 44298 gene locus_tag LOCUS_18950 44077 44298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 45873 44407 gene locus_tag LOCUS_18960 45873 44407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 47958 49061 gene locus_tag LOCUS_18970 47958 49061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 49550 49969 gene locus_tag LOCUS_18980 49550 49969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 50009 51232 gene locus_tag LOCUS_18990 50009 51232 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083921.1 protein_id gnl|my_center|LOCUS_18990 51355 52371 gene locus_tag LOCUS_19000 51355 52371 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_19000 52561 53484 gene locus_tag LOCUS_19010 52561 53484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 53683 58752 gene locus_tag LOCUS_19020 53683 58752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 58770 60011 gene locus_tag LOCUS_19030 58770 60011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 60955 60050 gene locus_tag LOCUS_19040 60955 60050 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_19040 61089 62558 gene locus_tag LOCUS_19050 61089 62558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 62612 64411 gene locus_tag LOCUS_19060 62612 64411 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_19060 64529 65221 gene locus_tag LOCUS_19070 64529 65221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 65376 66170 gene locus_tag LOCUS_19080 65376 66170 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203675.1 protein_id gnl|my_center|LOCUS_19080 66432 66653 gene locus_tag LOCUS_19090 66432 66653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 69764 67275 gene locus_tag LOCUS_19100 69764 67275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123787.1 protein_id gnl|my_center|LOCUS_19100 70999 69797 gene locus_tag LOCUS_19110 70999 69797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123786.1 protein_id gnl|my_center|LOCUS_19110 71666 72640 gene locus_tag LOCUS_19120 71666 72640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 72724 73173 gene locus_tag LOCUS_19130 72724 73173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 73148 73945 gene locus_tag LOCUS_19140 73148 73945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 74257 75225 gene locus_tag LOCUS_19150 74257 75225 CDS product Ta11 non-LTR retroelement inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120215.1 protein_id gnl|my_center|LOCUS_19150 75855 77141 gene locus_tag LOCUS_19160 75855 77141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 77275 79470 gene locus_tag LOCUS_19170 77275 79470 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124011.1 protein_id gnl|my_center|LOCUS_19170 79509 80495 gene locus_tag LOCUS_19180 79509 80495 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124010.1 protein_id gnl|my_center|LOCUS_19180 80550 81014 gene locus_tag LOCUS_19190 80550 81014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 81065 82603 gene locus_tag LOCUS_19200 81065 82603 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124008.1 protein_id gnl|my_center|LOCUS_19200 84151 82727 gene locus_tag LOCUS_19210 84151 82727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 84768 84367 gene locus_tag LOCUS_19220 84768 84367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 86098 84797 gene locus_tag LOCUS_19230 86098 84797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 88161 86095 gene locus_tag LOCUS_19240 88161 86095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 88886 89446 gene locus_tag LOCUS_19250 88886 89446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 89557 93690 gene locus_tag LOCUS_19260 89557 93690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 95261 93891 gene locus_tag LOCUS_19270 95261 93891 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_19270 97283 95697 gene locus_tag LOCUS_19280 gene czcC 97283 95697 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_19280 100464 97411 gene locus_tag LOCUS_19290 100464 97411 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_19290 101913 100618 gene locus_tag LOCUS_19300 101913 100618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 103411 101984 gene locus_tag LOCUS_19310 103411 101984 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_19310 104031 103408 gene locus_tag LOCUS_19320 104031 103408 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_19320 104718 109148 gene locus_tag LOCUS_19330 104718 109148 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117959.1 protein_id gnl|my_center|LOCUS_19330 113380 109160 gene locus_tag LOCUS_19340 113380 109160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 113799 113443 gene locus_tag LOCUS_19350 113799 113443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 114109 114306 gene locus_tag LOCUS_19360 114109 114306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 115243 114473 gene locus_tag LOCUS_19370 115243 114473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 115923 115291 gene locus_tag LOCUS_19380 115923 115291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 116501 117583 gene locus_tag LOCUS_19390 116501 117583 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948100.1 protein_id gnl|my_center|LOCUS_19390 118318 120186 gene locus_tag LOCUS_19400 gene korA 118318 120186 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_19400 120266 121288 gene locus_tag LOCUS_19410 gene korB 120266 121288 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_19410 121965 121393 gene locus_tag LOCUS_19420 gene dcd 121965 121393 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_19420 122803 122108 gene locus_tag LOCUS_19430 gene nth 122803 122108 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH55 protein_id gnl|my_center|LOCUS_19430 122939 123643 gene locus_tag LOCUS_19440 122939 123643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 123808 125403 gene locus_tag LOCUS_19450 123808 125403 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_19450 125844 125422 gene locus_tag LOCUS_19460 125844 125422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 126311 127153 gene locus_tag LOCUS_19470 126311 127153 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_19470 127267 128220 gene locus_tag LOCUS_19480 127267 128220 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_19480 128320 129276 gene locus_tag LOCUS_19490 128320 129276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 129377 130333 gene locus_tag LOCUS_19500 129377 130333 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_19500 131289 130351 gene locus_tag LOCUS_19510 131289 130351 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_19510 131397 131900 gene locus_tag LOCUS_19520 131397 131900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117967.1 protein_id gnl|my_center|LOCUS_19520 131939 132982 gene locus_tag LOCUS_19530 131939 132982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 133207 136188 gene locus_tag LOCUS_19540 133207 136188 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_19540 136185 136439 gene locus_tag LOCUS_19550 136185 136439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 136481 136915 gene locus_tag LOCUS_19560 gene moaE 136481 136915 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31705 protein_id gnl|my_center|LOCUS_19560 137016 138017 gene locus_tag LOCUS_19570 gene moaA 137016 138017 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT69 protein_id gnl|my_center|LOCUS_19570 138051 139226 gene locus_tag LOCUS_19580 138051 139226 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_19580 139614 141317 gene locus_tag LOCUS_19590 gene pilB 139614 141317 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123899.1 protein_id gnl|my_center|LOCUS_19590 141729 142847 gene locus_tag LOCUS_19600 gene pilT 141729 142847 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_19600 142952 144658 gene locus_tag LOCUS_19610 gene pilB 142952 144658 CDS product type IV fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123902.1 protein_id gnl|my_center|LOCUS_19610 144724 145986 gene locus_tag LOCUS_19620 144724 145986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 146225 147100 gene locus_tag LOCUS_19630 146225 147100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 147138 148196 gene locus_tag LOCUS_19640 147138 148196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 148201 149526 gene locus_tag LOCUS_19650 148201 149526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 149601 150854 gene locus_tag LOCUS_19660 149601 150854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 150914 152374 gene locus_tag LOCUS_19670 150914 152374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 152451 157175 gene locus_tag LOCUS_19680 152451 157175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 157471 158544 gene locus_tag LOCUS_19690 157471 158544 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_19690 158773 159828 gene locus_tag LOCUS_19700 158773 159828 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_19700 160308 160952 gene locus_tag LOCUS_19710 gene clpP1 160308 160952 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK67 protein_id gnl|my_center|LOCUS_19710 161027 161638 gene locus_tag LOCUS_19720 gene clpP2 161027 161638 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK66 protein_id gnl|my_center|LOCUS_19720 161690 162514 gene locus_tag LOCUS_19730 161690 162514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 163050 162742 gene locus_tag LOCUS_19740 163050 162742 CDS product nuclear scaffold-like protein p76 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333113.1 protein_id gnl|my_center|LOCUS_19740 163332 165161 gene locus_tag LOCUS_19750 163332 165161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 165421 166404 gene locus_tag LOCUS_19760 gene parB 165421 166404 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 protein_id gnl|my_center|LOCUS_19760 168639 166453 gene locus_tag LOCUS_19770 168639 166453 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120826.1 protein_id gnl|my_center|LOCUS_19770 170218 168866 gene locus_tag LOCUS_19780 gene hflX 170218 168866 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD7 protein_id gnl|my_center|LOCUS_19780 172340 170433 gene locus_tag LOCUS_19790 172340 170433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 172839 172582 gene locus_tag LOCUS_19800 172839 172582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 174217 173396 gene locus_tag LOCUS_19810 174217 173396 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_19810 175278 174766 gene locus_tag LOCUS_19820 175278 174766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 175806 176015 gene locus_tag LOCUS_19830 175806 176015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 177537 176500 gene locus_tag LOCUS_19840 177537 176500 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_19840 179029 177662 gene locus_tag LOCUS_19850 179029 177662 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118124.1 protein_id gnl|my_center|LOCUS_19850 179556 179029 gene locus_tag LOCUS_19860 179556 179029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 180012 180824 gene locus_tag LOCUS_19870 180012 180824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_19870 181911 180850 gene locus_tag LOCUS_19880 181911 180850 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_19880 183633 182143 gene locus_tag LOCUS_19890 183633 182143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 184637 184083 gene locus_tag LOCUS_19900 184637 184083 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 protein_id gnl|my_center|LOCUS_19900 185356 184769 gene locus_tag LOCUS_19910 gene rpsH 185356 184769 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_19910 185650 186891 gene locus_tag LOCUS_19920 185650 186891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 187899 186916 gene locus_tag LOCUS_19930 187899 186916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 189393 187930 gene locus_tag LOCUS_19940 189393 187930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122307.1 protein_id gnl|my_center|LOCUS_19940 189509 190912 gene locus_tag LOCUS_19950 189509 190912 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_19950 190934 191557 gene locus_tag LOCUS_19960 gene ychE 190934 191557 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_19960 191616 193178 gene locus_tag LOCUS_19970 191616 193178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 194027 193191 gene locus_tag LOCUS_19980 194027 193191 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_19980 195112 194522 gene locus_tag LOCUS_19990 195112 194522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 195626 196792 gene locus_tag LOCUS_20000 195626 196792 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393402.1 protein_id gnl|my_center|LOCUS_20000 196789 199029 gene locus_tag LOCUS_20010 196789 199029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 199185 200117 gene locus_tag LOCUS_20020 199185 200117 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240519.1 protein_id gnl|my_center|LOCUS_20020 200440 200730 gene locus_tag LOCUS_20030 200440 200730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 201219 201659 gene locus_tag LOCUS_20040 201219 201659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 201968 202042 gene locus_tag LOCUS_t00220 201968 202042 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 203402 202563 gene locus_tag LOCUS_20050 203402 202563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 203556 203861 gene locus_tag LOCUS_20060 203556 203861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 205054 205641 gene locus_tag LOCUS_20070 205054 205641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 205668 206876 gene locus_tag LOCUS_20080 205668 206876 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202557.1 protein_id gnl|my_center|LOCUS_20080 206975 207910 gene locus_tag LOCUS_20090 206975 207910 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_20090 207942 208412 gene locus_tag LOCUS_20100 207942 208412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 208464 209402 gene locus_tag LOCUS_20110 208464 209402 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_20110 209516 209956 gene locus_tag LOCUS_20120 209516 209956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 211143 209974 gene locus_tag LOCUS_20130 211143 209974 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_20130 213757 211121 gene locus_tag LOCUS_20140 213757 211121 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_20140 214681 213917 gene locus_tag LOCUS_20150 214681 213917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 215770 214835 gene locus_tag LOCUS_20160 gene nanA 215770 214835 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119312.1 protein_id gnl|my_center|LOCUS_20160 217473 216502 gene locus_tag LOCUS_20170 217473 216502 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_20170 219317 217545 gene locus_tag LOCUS_20180 219317 217545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 220071 220892 gene locus_tag LOCUS_20190 220071 220892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122695.1 protein_id gnl|my_center|LOCUS_20190 221059 222543 gene locus_tag LOCUS_20200 221059 222543 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 protein_id gnl|my_center|LOCUS_20200 222585 224270 gene locus_tag LOCUS_20210 222585 224270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 228556 224315 gene locus_tag LOCUS_20220 228556 224315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 228951 228553 gene locus_tag LOCUS_20230 228951 228553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459510.1 protein_id gnl|my_center|LOCUS_20230 229396 230697 gene locus_tag LOCUS_20240 229396 230697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118110.1 protein_id gnl|my_center|LOCUS_20240 230694 232091 gene locus_tag LOCUS_20250 230694 232091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 232650 232183 gene locus_tag LOCUS_20260 232650 232183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 233638 232664 gene locus_tag LOCUS_20270 233638 232664 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_20270 234131 233802 gene locus_tag LOCUS_20280 234131 233802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 235089 234109 gene locus_tag LOCUS_20290 235089 234109 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_20290 235821 235402 gene locus_tag LOCUS_20300 235821 235402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 236043 236492 gene locus_tag LOCUS_20310 236043 236492 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX54 protein_id gnl|my_center|LOCUS_20310 238341 236614 gene locus_tag LOCUS_20320 238341 236614 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122637.1 protein_id gnl|my_center|LOCUS_20320 238942 239154 gene locus_tag LOCUS_20330 238942 239154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 239309 239680 gene locus_tag LOCUS_20340 gene blaI 239309 239680 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038312.1 protein_id gnl|my_center|LOCUS_20340 239683 242019 gene locus_tag LOCUS_20350 239683 242019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 242403 242089 gene locus_tag LOCUS_20360 242403 242089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 243487 242405 gene locus_tag LOCUS_20370 243487 242405 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_20370 243408 243731 gene locus_tag LOCUS_20380 243408 243731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 244065 243763 gene locus_tag LOCUS_20390 244065 243763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 245000 246115 gene locus_tag LOCUS_20400 245000 246115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 246820 246179 gene locus_tag LOCUS_20410 246820 246179 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109570.1 protein_id gnl|my_center|LOCUS_20410 247732 246947 gene locus_tag LOCUS_20420 247732 246947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 248014 250281 gene locus_tag LOCUS_20430 248014 250281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 251034 251240 gene locus_tag LOCUS_20440 251034 251240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 251285 252079 gene locus_tag LOCUS_20450 251285 252079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 252124 253344 gene locus_tag LOCUS_20460 252124 253344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817388.1 protein_id gnl|my_center|LOCUS_20460 253349 254041 gene locus_tag LOCUS_20470 253349 254041 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYI7 protein_id gnl|my_center|LOCUS_20470 >Feature sequence07 2261 102 gene locus_tag LOCUS_20480 2261 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123984.1 protein_id gnl|my_center|LOCUS_20480 3082 2258 gene locus_tag LOCUS_20490 3082 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4818 3079 gene locus_tag LOCUS_20500 4818 3079 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123986.1 protein_id gnl|my_center|LOCUS_20500 6051 4861 gene locus_tag LOCUS_20510 6051 4861 CDS product cytochrome c554 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119032.1 protein_id gnl|my_center|LOCUS_20510 6403 8145 gene locus_tag LOCUS_20520 gene cya 6403 8145 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_20520 8449 10374 gene locus_tag LOCUS_20530 8449 10374 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121318.1 protein_id gnl|my_center|LOCUS_20530 10390 12039 gene locus_tag LOCUS_20540 10390 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 12237 12869 gene locus_tag LOCUS_20550 gene sigG 12237 12869 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123035.1 protein_id gnl|my_center|LOCUS_20550 12925 15837 gene locus_tag LOCUS_20560 12925 15837 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123102.1 protein_id gnl|my_center|LOCUS_20560 17091 15889 gene locus_tag LOCUS_20570 17091 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 19799 17424 gene locus_tag LOCUS_20580 19799 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 25510 20321 gene locus_tag LOCUS_20590 25510 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 25839 26459 gene locus_tag LOCUS_20600 25839 26459 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258641.1 protein_id gnl|my_center|LOCUS_20600 27723 26542 gene locus_tag LOCUS_20610 27723 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 31224 28213 gene locus_tag LOCUS_20620 31224 28213 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_20620 32358 34337 gene locus_tag LOCUS_20630 32358 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_20630 34424 35713 gene locus_tag LOCUS_20640 34424 35713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_20640 35994 38675 gene locus_tag LOCUS_20650 35994 38675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 38876 39430 gene locus_tag LOCUS_20660 38876 39430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120344.1 protein_id gnl|my_center|LOCUS_20660 39551 41416 gene locus_tag LOCUS_20670 39551 41416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 41461 42117 gene locus_tag LOCUS_20680 41461 42117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 43764 42139 gene locus_tag LOCUS_20690 43764 42139 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_20690 44896 43775 gene locus_tag LOCUS_20700 gene yjmC 44896 43775 CDS product putative oxidoreductase YjmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34736 protein_id gnl|my_center|LOCUS_20700 46368 44941 gene locus_tag LOCUS_20710 46368 44941 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_20710 49696 46406 gene locus_tag LOCUS_20720 49696 46406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 51000 51575 gene locus_tag LOCUS_20730 51000 51575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 52165 52440 gene locus_tag LOCUS_20740 52165 52440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 54825 52495 gene locus_tag LOCUS_20750 54825 52495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 55430 54825 gene locus_tag LOCUS_20760 55430 54825 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_20760 58254 55798 gene locus_tag LOCUS_20770 gene pheT 58254 55798 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYT3 protein_id gnl|my_center|LOCUS_20770 59291 58308 gene locus_tag LOCUS_20780 gene pheS 59291 58308 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q60 protein_id gnl|my_center|LOCUS_20780 61019 59610 gene locus_tag LOCUS_20790 61019 59610 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_20790 64056 61072 gene locus_tag LOCUS_20800 64056 61072 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121568.1 protein_id gnl|my_center|LOCUS_20800 65893 65153 gene locus_tag LOCUS_20810 65893 65153 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120363.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20810 66072 67019 gene locus_tag LOCUS_20820 66072 67019 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118357.1 protein_id gnl|my_center|LOCUS_20820 67037 67981 gene locus_tag LOCUS_20830 67037 67981 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206386.1 protein_id gnl|my_center|LOCUS_20830 67978 69237 gene locus_tag LOCUS_20840 gene dadA 67978 69237 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_20840 69585 72203 gene locus_tag LOCUS_20850 69585 72203 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496762.1 protein_id gnl|my_center|LOCUS_20850 72382 73329 gene locus_tag LOCUS_20860 72382 73329 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_20860 73563 74006 gene locus_tag LOCUS_20870 73563 74006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 74190 75026 gene locus_tag LOCUS_20880 74190 75026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_20880 75023 75496 gene locus_tag LOCUS_20890 75023 75496 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427918.1 protein_id gnl|my_center|LOCUS_20890 77144 75786 gene locus_tag LOCUS_20900 77144 75786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 77330 78436 gene locus_tag LOCUS_20910 77330 78436 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067131.1 protein_id gnl|my_center|LOCUS_20910 78463 80001 gene locus_tag LOCUS_20920 78463 80001 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926191.1 protein_id gnl|my_center|LOCUS_20920 80776 80327 gene locus_tag LOCUS_20930 80776 80327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 81827 80856 gene locus_tag LOCUS_20940 81827 80856 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_20940 83560 82106 gene locus_tag LOCUS_20950 83560 82106 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_20950 86655 83575 gene locus_tag LOCUS_20960 86655 83575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_20960 88425 86686 gene locus_tag LOCUS_20970 88425 86686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 88952 88422 gene locus_tag LOCUS_20980 88952 88422 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_20980 90252 89377 gene locus_tag LOCUS_20990 90252 89377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 92221 90500 gene locus_tag LOCUS_21000 92221 90500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21000 92483 93196 gene locus_tag LOCUS_21010 92483 93196 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972794.1 protein_id gnl|my_center|LOCUS_21010 93224 94300 gene locus_tag LOCUS_21020 93224 94300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072840.1 protein_id gnl|my_center|LOCUS_21020 94327 95445 gene locus_tag LOCUS_21030 94327 95445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 95557 98571 gene locus_tag LOCUS_21040 95557 98571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 99519 99734 gene locus_tag LOCUS_21050 99519 99734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 99731 100147 gene locus_tag LOCUS_21060 99731 100147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 100593 100228 gene locus_tag LOCUS_21070 100593 100228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 101662 100688 gene locus_tag LOCUS_21080 101662 100688 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_21080 102687 104255 gene locus_tag LOCUS_21090 102687 104255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 104802 106166 gene locus_tag LOCUS_21100 104802 106166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 106831 108252 gene locus_tag LOCUS_21110 106831 108252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 109177 108281 gene locus_tag LOCUS_21120 109177 108281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 110278 109226 gene locus_tag LOCUS_21130 gene thrC2 110278 109226 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66740 protein_id gnl|my_center|LOCUS_21130 110533 111252 gene locus_tag LOCUS_21140 110533 111252 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530404.1 protein_id gnl|my_center|LOCUS_21140 111449 112360 gene locus_tag LOCUS_21150 111449 112360 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120930.1 protein_id gnl|my_center|LOCUS_21150 112454 112876 gene locus_tag LOCUS_21160 112454 112876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117810.1 protein_id gnl|my_center|LOCUS_21160 112944 114011 gene locus_tag LOCUS_21170 112944 114011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 114746 114318 gene locus_tag LOCUS_21180 114746 114318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 115323 116420 gene locus_tag LOCUS_21190 gene lacI 115323 116420 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227579.1 protein_id gnl|my_center|LOCUS_21190 116456 117394 gene locus_tag LOCUS_21200 116456 117394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 117470 119989 gene locus_tag LOCUS_21210 117470 119989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_21210 120023 121411 gene locus_tag LOCUS_21220 120023 121411 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_21220 121614 122732 gene locus_tag LOCUS_21230 121614 122732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119080.1 protein_id gnl|my_center|LOCUS_21230 123665 122733 gene locus_tag LOCUS_21240 123665 122733 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920172.1 protein_id gnl|my_center|LOCUS_21240 125119 123662 gene locus_tag LOCUS_21250 125119 123662 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118987.1 protein_id gnl|my_center|LOCUS_21250 128165 125112 gene locus_tag LOCUS_21260 128165 125112 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_21260 128612 129571 gene locus_tag LOCUS_21270 128612 129571 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_21270 129720 130211 gene locus_tag LOCUS_21280 129720 130211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 130571 132463 gene locus_tag LOCUS_21290 gene msaB 130571 132463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_21290 132723 133991 gene locus_tag LOCUS_21300 132723 133991 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117842.1 protein_id gnl|my_center|LOCUS_21300 134193 134906 gene locus_tag LOCUS_21310 gene gufA 134193 134906 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123018.1 protein_id gnl|my_center|LOCUS_21310 135088 136983 gene locus_tag LOCUS_21320 135088 136983 CDS product metal-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120156.1 protein_id gnl|my_center|LOCUS_21320 138123 137005 gene locus_tag LOCUS_21330 138123 137005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 138216 139343 gene locus_tag LOCUS_21340 138216 139343 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942690.1 protein_id gnl|my_center|LOCUS_21340 139663 140628 gene locus_tag LOCUS_21350 139663 140628 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971124.1 protein_id gnl|my_center|LOCUS_21350 140625 142856 gene locus_tag LOCUS_21360 140625 142856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 142853 143692 gene locus_tag LOCUS_21370 142853 143692 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 protein_id gnl|my_center|LOCUS_21370 143689 143904 gene locus_tag LOCUS_21380 143689 143904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 143901 144431 gene locus_tag LOCUS_21390 143901 144431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 144466 145902 gene locus_tag LOCUS_21400 144466 145902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 145968 147560 gene locus_tag LOCUS_21410 gene glt 145968 147560 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082931.1 protein_id gnl|my_center|LOCUS_21410 148107 149219 gene locus_tag LOCUS_21420 148107 149219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 149370 150587 gene locus_tag LOCUS_21430 149370 150587 CDS product SOS mutagenesis and repair UmuC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947430.1 protein_id gnl|my_center|LOCUS_21430 150578 151057 gene locus_tag LOCUS_21440 150578 151057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 151292 151104 gene locus_tag LOCUS_21450 151292 151104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 151505 152359 gene locus_tag LOCUS_21460 151505 152359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 152356 152835 gene locus_tag LOCUS_21470 152356 152835 CDS product Appr-1-p processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031144.1 protein_id gnl|my_center|LOCUS_21470 153829 153329 gene locus_tag LOCUS_21480 153829 153329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 154235 155320 gene locus_tag LOCUS_21490 154235 155320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 155356 155766 gene locus_tag LOCUS_21500 155356 155766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 157902 156283 gene locus_tag LOCUS_21510 157902 156283 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_21510 159640 157982 gene locus_tag LOCUS_21520 159640 157982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 160598 159684 gene locus_tag LOCUS_21530 160598 159684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 161068 160619 gene locus_tag LOCUS_21540 161068 160619 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_21540 161319 162566 gene locus_tag LOCUS_21550 161319 162566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 163874 162675 gene locus_tag LOCUS_21560 163874 162675 CDS product selenocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704265.1 protein_id gnl|my_center|LOCUS_21560 165138 163981 gene locus_tag LOCUS_21570 165138 163981 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123966.1 protein_id gnl|my_center|LOCUS_21570 165431 166096 gene locus_tag LOCUS_21580 165431 166096 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_21580 166397 166774 gene locus_tag LOCUS_21590 166397 166774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 167194 166922 gene locus_tag LOCUS_21600 167194 166922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 167517 167302 gene locus_tag LOCUS_21610 167517 167302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 167836 167489 gene locus_tag LOCUS_21620 167836 167489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 168333 169793 gene locus_tag LOCUS_21630 168333 169793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 169999 171405 gene locus_tag LOCUS_21640 gene chlI 169999 171405 CDS product magnesium protoporphyrin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117844.1 protein_id gnl|my_center|LOCUS_21640 171456 173156 gene locus_tag LOCUS_21650 171456 173156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_21650 176559 173236 gene locus_tag LOCUS_21660 176559 173236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 177033 178667 gene locus_tag LOCUS_21670 177033 178667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 179563 178688 gene locus_tag LOCUS_21680 179563 178688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 180322 179921 gene locus_tag LOCUS_21690 180322 179921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121521.1 protein_id gnl|my_center|LOCUS_21690 181514 180408 gene locus_tag LOCUS_21700 181514 180408 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121519.1 protein_id gnl|my_center|LOCUS_21700 182940 181642 gene locus_tag LOCUS_21710 182940 181642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 183998 182937 gene locus_tag LOCUS_21720 183998 182937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121523.1 protein_id gnl|my_center|LOCUS_21720 184591 185394 gene locus_tag LOCUS_21730 gene yedP 184591 185394 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XB99 protein_id gnl|my_center|LOCUS_21730 185439 186659 gene locus_tag LOCUS_21740 185439 186659 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_21740 186664 188424 gene locus_tag LOCUS_21750 186664 188424 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_21750 188860 188453 gene locus_tag LOCUS_21760 188860 188453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 189361 188993 gene locus_tag LOCUS_21770 189361 188993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 189569 190111 gene locus_tag LOCUS_21780 189569 190111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 190158 190688 gene locus_tag LOCUS_21790 gene pfpI 190158 190688 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121904.1 protein_id gnl|my_center|LOCUS_21790 196179 190735 gene locus_tag LOCUS_21800 196179 190735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 196389 197561 gene locus_tag LOCUS_21810 gene xylR 196389 197561 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_21810 197670 198155 gene locus_tag LOCUS_21820 197670 198155 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123033.1 protein_id gnl|my_center|LOCUS_21820 199049 199663 gene locus_tag LOCUS_21830 gene nccH 199049 199663 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121583.1 protein_id gnl|my_center|LOCUS_21830 199682 201790 gene locus_tag LOCUS_21840 199682 201790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 201991 203448 gene locus_tag LOCUS_21850 201991 203448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 204134 205057 gene locus_tag LOCUS_21860 204134 205057 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_21860 205029 205634 gene locus_tag LOCUS_21870 205029 205634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 205720 206340 gene locus_tag LOCUS_21880 205720 206340 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729516.1 protein_id gnl|my_center|LOCUS_21880 206359 209751 gene locus_tag LOCUS_21890 206359 209751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_21890 209767 211167 gene locus_tag LOCUS_21900 209767 211167 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_21900 211216 212334 gene locus_tag LOCUS_21910 211216 212334 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815495.1 protein_id gnl|my_center|LOCUS_21910 212381 213415 gene locus_tag LOCUS_21920 212381 213415 CDS product N-alpha-acetyl diaminobutyric acid deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975303.1 protein_id gnl|my_center|LOCUS_21920 213448 215121 gene locus_tag LOCUS_21930 213448 215121 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405542.1 protein_id gnl|my_center|LOCUS_21930 215177 215992 gene locus_tag LOCUS_21940 215177 215992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 216354 216022 gene locus_tag LOCUS_21950 216354 216022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 216885 216959 gene locus_tag LOCUS_t00230 216885 216959 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 217188 218177 gene locus_tag LOCUS_21960 217188 218177 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_21960 218543 219706 gene locus_tag LOCUS_21970 218543 219706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 221002 219767 gene locus_tag LOCUS_21980 221002 219767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886733.1 protein_id gnl|my_center|LOCUS_21980 221687 221268 gene locus_tag LOCUS_21990 221687 221268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 222799 221873 gene locus_tag LOCUS_22000 222799 221873 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122231.1 protein_id gnl|my_center|LOCUS_22000 224235 223381 gene locus_tag LOCUS_22010 224235 223381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 225930 224527 gene locus_tag LOCUS_22020 225930 224527 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122056.1 protein_id gnl|my_center|LOCUS_22020 227456 226311 gene locus_tag LOCUS_22030 227456 226311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 228362 227547 gene locus_tag LOCUS_22040 228362 227547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_22040 229162 228401 gene locus_tag LOCUS_22050 229162 228401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121261.1 protein_id gnl|my_center|LOCUS_22050 229603 230373 gene locus_tag LOCUS_22060 229603 230373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 230695 231162 gene locus_tag LOCUS_22070 230695 231162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 232875 231217 gene locus_tag LOCUS_22080 232875 231217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 233168 232890 gene locus_tag LOCUS_22090 233168 232890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 234653 233268 gene locus_tag LOCUS_22100 234653 233268 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_22100 235203 234688 gene locus_tag LOCUS_22110 gene yuxK 235203 234688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_22110 235495 236472 gene locus_tag LOCUS_22120 235495 236472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 236767 240294 gene locus_tag LOCUS_22130 236767 240294 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_22130 240427 241095 gene locus_tag LOCUS_22140 240427 241095 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_22140 241598 241110 gene locus_tag LOCUS_22150 241598 241110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 241953 242026 gene locus_tag LOCUS_t00240 241953 242026 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 242231 243775 gene locus_tag LOCUS_22160 242231 243775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120663.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence08 1173 151 gene locus_tag LOCUS_22170 1173 151 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118196.1 protein_id gnl|my_center|LOCUS_22170 1537 2400 gene locus_tag LOCUS_22180 1537 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 4138 2465 gene locus_tag LOCUS_22190 4138 2465 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_22190 6647 4533 gene locus_tag LOCUS_22200 6647 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6812 7513 gene locus_tag LOCUS_22210 6812 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 7551 8888 gene locus_tag LOCUS_22220 7551 8888 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118912.1 protein_id gnl|my_center|LOCUS_22220 9034 10212 gene locus_tag LOCUS_22230 9034 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 10376 10867 gene locus_tag LOCUS_22240 10376 10867 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937374.1 protein_id gnl|my_center|LOCUS_22240 11000 12220 gene locus_tag LOCUS_22250 gene acrE 11000 12220 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_22250 12245 15796 gene locus_tag LOCUS_22260 12245 15796 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_22260 15869 18796 gene locus_tag LOCUS_22270 15869 18796 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119333.1 protein_id gnl|my_center|LOCUS_22270 19501 18809 gene locus_tag LOCUS_22280 19501 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_22280 20131 21249 gene locus_tag LOCUS_22290 20131 21249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 23340 21268 gene locus_tag LOCUS_22300 23340 21268 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120179.1 protein_id gnl|my_center|LOCUS_22300 23651 25681 gene locus_tag LOCUS_22310 gene acs 23651 25681 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404558.1 protein_id gnl|my_center|LOCUS_22310 25687 26886 gene locus_tag LOCUS_22320 25687 26886 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098579.1 protein_id gnl|my_center|LOCUS_22320 26917 27861 gene locus_tag LOCUS_22330 26917 27861 CDS product hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 protein_id gnl|my_center|LOCUS_22330 27854 28621 gene locus_tag LOCUS_22340 27854 28621 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258808.1 protein_id gnl|my_center|LOCUS_22340 28924 30261 gene locus_tag LOCUS_22350 gene GALNS 28924 30261 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_22350 30293 31708 gene locus_tag LOCUS_22360 30293 31708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_22360 31781 32569 gene locus_tag LOCUS_22370 31781 32569 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117823.1 protein_id gnl|my_center|LOCUS_22370 32646 33689 gene locus_tag LOCUS_22380 32646 33689 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118362.1 protein_id gnl|my_center|LOCUS_22380 34355 33756 gene locus_tag LOCUS_22390 34355 33756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 35195 35836 gene locus_tag LOCUS_22400 35195 35836 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462333.1 protein_id gnl|my_center|LOCUS_22400 36265 37956 gene locus_tag LOCUS_22410 36265 37956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 40572 37984 gene locus_tag LOCUS_22420 40572 37984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 40904 43006 gene locus_tag LOCUS_22430 40904 43006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 43156 43071 gene locus_tag LOCUS_t00250 43156 43071 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43675 43292 gene locus_tag LOCUS_22440 43675 43292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 44940 43879 gene locus_tag LOCUS_22450 44940 43879 CDS product dihydrodipicolinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_22450 46042 45005 gene locus_tag LOCUS_22460 46042 45005 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_22460 46684 46148 gene locus_tag LOCUS_22470 46684 46148 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395060.1 protein_id gnl|my_center|LOCUS_22470 47041 46766 gene locus_tag LOCUS_22480 47041 46766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 48449 47070 gene locus_tag LOCUS_22490 48449 47070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_22490 49519 48614 gene locus_tag LOCUS_22500 49519 48614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_22500 49741 50421 gene locus_tag LOCUS_22510 49741 50421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 50470 51918 gene locus_tag LOCUS_22520 50470 51918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 53429 51930 gene locus_tag LOCUS_22530 gene pepA 53429 51930 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ62 protein_id gnl|my_center|LOCUS_22530 53515 54471 gene locus_tag LOCUS_22540 53515 54471 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_22540 55175 54480 gene locus_tag LOCUS_22550 gene queC 55175 54480 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_22550 55955 55296 gene locus_tag LOCUS_22560 55955 55296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 56238 57617 gene locus_tag LOCUS_22570 gene argH 56238 57617 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK64 protein_id gnl|my_center|LOCUS_22570 57681 58484 gene locus_tag LOCUS_22580 gene truA 57681 58484 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFT1 protein_id gnl|my_center|LOCUS_22580 58587 59771 gene locus_tag LOCUS_22590 58587 59771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_22590 59995 60987 gene locus_tag LOCUS_22600 gene mdh 59995 60987 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A2 protein_id gnl|my_center|LOCUS_22600 61087 62454 gene locus_tag LOCUS_22610 gene bioA 61087 62454 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728P4 protein_id gnl|my_center|LOCUS_22610 63540 62461 gene locus_tag LOCUS_22620 63540 62461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 65071 63635 gene locus_tag LOCUS_22630 gene lpd 65071 63635 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM8 protein_id gnl|my_center|LOCUS_22630 66446 65121 gene locus_tag LOCUS_22640 66446 65121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 69197 66504 gene locus_tag LOCUS_22650 69197 66504 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU96 protein_id gnl|my_center|LOCUS_22650 69878 70927 gene locus_tag LOCUS_22660 69878 70927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 71045 72220 gene locus_tag LOCUS_22670 71045 72220 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUP0 protein_id gnl|my_center|LOCUS_22670 72217 73089 gene locus_tag LOCUS_22680 gene pyrK 72217 73089 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_22680 73202 74236 gene locus_tag LOCUS_22690 73202 74236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 74568 76226 gene locus_tag LOCUS_22700 74568 76226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 76576 76295 gene locus_tag LOCUS_22710 76576 76295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 77650 76589 gene locus_tag LOCUS_22720 77650 76589 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_22720 78186 78494 gene locus_tag LOCUS_22730 78186 78494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 79199 78516 gene locus_tag LOCUS_22740 79199 78516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 79316 81049 gene locus_tag LOCUS_22750 79316 81049 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_22750 82709 81129 gene locus_tag LOCUS_22760 82709 81129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 84886 83330 gene locus_tag LOCUS_22770 84886 83330 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 protein_id gnl|my_center|LOCUS_22770 86731 85097 gene locus_tag LOCUS_22780 86731 85097 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_22780 88055 87075 gene locus_tag LOCUS_22790 88055 87075 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_22790 89743 88160 gene locus_tag LOCUS_22800 gene aslA 89743 88160 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119604.1 protein_id gnl|my_center|LOCUS_22800 90186 90704 gene locus_tag LOCUS_22810 90186 90704 CDS product putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702324.1 protein_id gnl|my_center|LOCUS_22810 91491 90778 gene locus_tag LOCUS_22820 91491 90778 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120235.1 protein_id gnl|my_center|LOCUS_22820 91724 92620 gene locus_tag LOCUS_22830 91724 92620 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_22830 95055 93685 gene locus_tag LOCUS_22840 95055 93685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_22840 95572 95282 gene locus_tag LOCUS_22850 95572 95282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 96749 95793 gene locus_tag LOCUS_22860 96749 95793 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_22860 97525 96815 gene locus_tag LOCUS_22870 97525 96815 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931531.1 protein_id gnl|my_center|LOCUS_22870 97887 98237 gene locus_tag LOCUS_22880 97887 98237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 98389 100455 gene locus_tag LOCUS_22890 98389 100455 CDS product protein-xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123507.1 protein_id gnl|my_center|LOCUS_22890 100872 103085 gene locus_tag LOCUS_22900 100872 103085 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_22900 103208 103945 gene locus_tag LOCUS_22910 103208 103945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117860.1 protein_id gnl|my_center|LOCUS_22910 104282 103995 gene locus_tag LOCUS_22920 104282 103995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 104483 104614 gene locus_tag LOCUS_22930 104483 104614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 105189 106364 gene locus_tag LOCUS_22940 105189 106364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 108009 106606 gene locus_tag LOCUS_22950 108009 106606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 110479 109145 gene locus_tag LOCUS_22960 110479 109145 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118373.1 protein_id gnl|my_center|LOCUS_22960 110854 110516 gene locus_tag LOCUS_22970 gene phnA 110854 110516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123128.1 protein_id gnl|my_center|LOCUS_22970 111828 113021 gene locus_tag LOCUS_22980 111828 113021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 113089 114051 gene locus_tag LOCUS_22990 113089 114051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 114521 114084 gene locus_tag LOCUS_23000 114521 114084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 116474 114525 gene locus_tag LOCUS_23010 116474 114525 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123461.1 protein_id gnl|my_center|LOCUS_23010 116776 116471 gene locus_tag LOCUS_23020 116776 116471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 117385 116990 gene locus_tag LOCUS_23030 117385 116990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 117667 118638 gene locus_tag LOCUS_23040 117667 118638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 119510 118653 gene locus_tag LOCUS_23050 119510 118653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 120645 120430 gene locus_tag LOCUS_23060 120645 120430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 121179 123275 gene locus_tag LOCUS_23070 gene glgX 121179 123275 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT9 protein_id gnl|my_center|LOCUS_23070 124055 123285 gene locus_tag LOCUS_23080 gene uppP 124055 123285 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNQ8 protein_id gnl|my_center|LOCUS_23080 124307 124708 gene locus_tag LOCUS_23090 124307 124708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 126559 124736 gene locus_tag LOCUS_23100 126559 124736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 128560 126656 gene locus_tag LOCUS_23110 128560 126656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 128924 129679 gene locus_tag LOCUS_23120 gene rpsB 128924 129679 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH4 protein_id gnl|my_center|LOCUS_23120 129835 130671 gene locus_tag LOCUS_23130 gene tsf 129835 130671 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X5U9 protein_id gnl|my_center|LOCUS_23130 130785 131546 gene locus_tag LOCUS_23140 gene pyrH 130785 131546 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH1 protein_id gnl|my_center|LOCUS_23140 132408 131629 gene locus_tag LOCUS_23150 132408 131629 CDS product N,N-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_23150 133045 132581 gene locus_tag LOCUS_23160 133045 132581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 134219 133356 gene locus_tag LOCUS_23170 134219 133356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121285.1 protein_id gnl|my_center|LOCUS_23170 134795 134307 gene locus_tag LOCUS_23180 134795 134307 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 protein_id gnl|my_center|LOCUS_23180 135858 134779 gene locus_tag LOCUS_23190 gene manC 135858 134779 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_23190 137285 135864 gene locus_tag LOCUS_23200 137285 135864 CDS product UDP-N-acetylhexosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_23200 139032 137341 gene locus_tag LOCUS_23210 gene ilvD 139032 137341 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH32 protein_id gnl|my_center|LOCUS_23210 139657 139944 gene locus_tag LOCUS_23220 gene rpmE 139657 139944 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D733 protein_id gnl|my_center|LOCUS_23220 140122 141204 gene locus_tag LOCUS_23230 gene prfA 140122 141204 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT3 protein_id gnl|my_center|LOCUS_23230 141255 142172 gene locus_tag LOCUS_23240 gene prmC 141255 142172 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_23240 142233 143666 gene locus_tag LOCUS_23250 gene murA 142233 143666 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFY2 protein_id gnl|my_center|LOCUS_23250 145199 143676 gene locus_tag LOCUS_23260 145199 143676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_23260 146818 145226 gene locus_tag LOCUS_23270 146818 145226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121620.1 protein_id gnl|my_center|LOCUS_23270 147180 146899 gene locus_tag LOCUS_23280 147180 146899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 148943 147327 gene locus_tag LOCUS_23290 148943 147327 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938166.1 protein_id gnl|my_center|LOCUS_23290 150240 149122 gene locus_tag LOCUS_23300 150240 149122 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_23300 150433 151701 gene locus_tag LOCUS_23310 150433 151701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 151999 153606 gene locus_tag LOCUS_23320 151999 153606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085894.1 protein_id gnl|my_center|LOCUS_23320 153667 154938 gene locus_tag LOCUS_23330 153667 154938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 156634 154970 gene locus_tag LOCUS_23340 156634 154970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 159530 156912 gene locus_tag LOCUS_23350 159530 156912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 159737 163057 gene locus_tag LOCUS_23360 159737 163057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 164386 163067 gene locus_tag LOCUS_23370 164386 163067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 166796 164499 gene locus_tag LOCUS_23380 166796 164499 CDS product NADH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121573.1 protein_id gnl|my_center|LOCUS_23380 167900 166974 gene locus_tag LOCUS_23390 167900 166974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 168128 168748 gene locus_tag LOCUS_23400 168128 168748 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121675.1 protein_id gnl|my_center|LOCUS_23400 168745 171291 gene locus_tag LOCUS_23410 168745 171291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 172995 171298 gene locus_tag LOCUS_23420 172995 171298 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975360.1 protein_id gnl|my_center|LOCUS_23420 173478 173017 gene locus_tag LOCUS_23430 173478 173017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 173606 174829 gene locus_tag LOCUS_23440 173606 174829 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_23440 174999 175562 gene locus_tag LOCUS_23450 174999 175562 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_23450 175605 176933 gene locus_tag LOCUS_23460 175605 176933 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_23460 176998 177756 gene locus_tag LOCUS_23470 176998 177756 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_23470 177796 178737 gene locus_tag LOCUS_23480 177796 178737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 178775 180586 gene locus_tag LOCUS_23490 gene arsA 178775 180586 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121660.1 protein_id gnl|my_center|LOCUS_23490 180864 180604 gene locus_tag LOCUS_23500 180864 180604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120076.1 protein_id gnl|my_center|LOCUS_23500 182073 181396 gene locus_tag LOCUS_23510 182073 181396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 182910 182113 gene locus_tag LOCUS_23520 182910 182113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 186926 182964 gene locus_tag LOCUS_23530 186926 182964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 187269 188597 gene locus_tag LOCUS_23540 187269 188597 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123726.1 protein_id gnl|my_center|LOCUS_23540 188612 189523 gene locus_tag LOCUS_23550 188612 189523 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120542.1 protein_id gnl|my_center|LOCUS_23550 190071 189541 gene locus_tag LOCUS_23560 190071 189541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 191451 190411 gene locus_tag LOCUS_23570 191451 190411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 192117 191479 gene locus_tag LOCUS_23580 192117 191479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 192436 193674 gene locus_tag LOCUS_23590 192436 193674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 195131 193701 gene locus_tag LOCUS_23600 195131 193701 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816080.1 protein_id gnl|my_center|LOCUS_23600 195359 201574 gene locus_tag LOCUS_23610 195359 201574 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_23610 203463 201580 gene locus_tag LOCUS_23620 203463 201580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 204131 203733 gene locus_tag LOCUS_23630 204131 203733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 206862 204262 gene locus_tag LOCUS_23640 gene mutS 206862 204262 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP05 protein_id gnl|my_center|LOCUS_23640 207874 206936 gene locus_tag LOCUS_23650 gene prs 207874 206936 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCQ2 protein_id gnl|my_center|LOCUS_23650 208217 209302 gene locus_tag LOCUS_23660 208217 209302 CDS product 3-phosphoserine/phosphohydroxythreonine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_23660 209299 210057 gene locus_tag LOCUS_23670 209299 210057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 210879 210148 gene locus_tag LOCUS_23680 210879 210148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122318.1 protein_id gnl|my_center|LOCUS_23680 211874 210939 gene locus_tag LOCUS_23690 211874 210939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 212862 211912 gene locus_tag LOCUS_23700 212862 211912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 213881 212931 gene locus_tag LOCUS_23710 213881 212931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 214085 214888 gene locus_tag LOCUS_23720 214085 214888 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_23720 214980 216614 gene locus_tag LOCUS_23730 214980 216614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 216617 217750 gene locus_tag LOCUS_23740 216617 217750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 218155 217772 gene locus_tag LOCUS_23750 218155 217772 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194251.1 protein_id gnl|my_center|LOCUS_23750 218621 218166 gene locus_tag LOCUS_23760 218621 218166 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706152.1 protein_id gnl|my_center|LOCUS_23760 219120 218887 gene locus_tag LOCUS_23770 219120 218887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 220515 219121 gene locus_tag LOCUS_23780 220515 219121 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_23780 221581 220571 gene locus_tag LOCUS_23790 221581 220571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 221723 221899 gene locus_tag LOCUS_23800 221723 221899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 221932 223329 gene locus_tag LOCUS_23810 221932 223329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 223484 223798 gene locus_tag LOCUS_23820 gene rpsT 223484 223798 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPC9 protein_id gnl|my_center|LOCUS_23820 224705 223896 gene locus_tag LOCUS_23830 gene fabG 224705 223896 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122369.1 protein_id gnl|my_center|LOCUS_23830 224852 225673 gene locus_tag LOCUS_23840 224852 225673 CDS product L-xylulose 5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704177.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence09 3107 240 gene locus_tag LOCUS_23850 3107 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3556 4161 gene locus_tag LOCUS_23860 3556 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4339 4812 gene locus_tag LOCUS_23870 4339 4812 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_23870 4969 6243 gene locus_tag LOCUS_23880 gene rlmI 4969 6243 CDS product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FYN3 protein_id gnl|my_center|LOCUS_23880 6335 7453 gene locus_tag LOCUS_23890 6335 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 7754 8482 gene locus_tag LOCUS_23900 7754 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 8643 9764 gene locus_tag LOCUS_23910 8643 9764 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957813.1 protein_id gnl|my_center|LOCUS_23910 9960 11537 gene locus_tag LOCUS_23920 9960 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 11631 12602 gene locus_tag LOCUS_23930 gene accA 11631 12602 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY7 protein_id gnl|my_center|LOCUS_23930 15168 12877 gene locus_tag LOCUS_23940 15168 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 17723 16512 gene locus_tag LOCUS_23950 17723 16512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 18185 17937 gene locus_tag LOCUS_23960 18185 17937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 18665 18216 gene locus_tag LOCUS_23970 18665 18216 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_23970 19785 18667 gene locus_tag LOCUS_23980 19785 18667 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_23980 21833 19938 gene locus_tag LOCUS_23990 21833 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 22191 23054 gene locus_tag LOCUS_24000 22191 23054 CDS product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_24000 23137 24234 gene locus_tag LOCUS_24010 23137 24234 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_24010 24621 25055 gene locus_tag LOCUS_24020 24621 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 25100 25597 gene locus_tag LOCUS_24030 gene fur 25100 25597 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121869.1 protein_id gnl|my_center|LOCUS_24030 26734 25637 gene locus_tag LOCUS_24040 gene pilD 26734 25637 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_24040 27097 28461 gene locus_tag LOCUS_24050 gene amtB 27097 28461 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYZ3 protein_id gnl|my_center|LOCUS_24050 28688 29026 gene locus_tag LOCUS_24060 gene glnB 28688 29026 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_24060 29122 29460 gene locus_tag LOCUS_24070 gene glnB 29122 29460 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_24070 29547 32240 gene locus_tag LOCUS_24080 gene glnD 29547 32240 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C55 protein_id gnl|my_center|LOCUS_24080 33175 32285 gene locus_tag LOCUS_24090 gene pmi 33175 32285 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_24090 33610 33798 gene locus_tag LOCUS_24100 33610 33798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 35326 33890 gene locus_tag LOCUS_24110 35326 33890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 37319 35685 gene locus_tag LOCUS_24120 37319 35685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085894.1 protein_id gnl|my_center|LOCUS_24120 37742 37470 gene locus_tag LOCUS_24130 37742 37470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 38577 40220 gene locus_tag LOCUS_24140 38577 40220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 40312 40914 gene locus_tag LOCUS_24150 40312 40914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 41141 42280 gene locus_tag LOCUS_24160 41141 42280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 43808 42306 gene locus_tag LOCUS_24170 43808 42306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 46251 44023 gene locus_tag LOCUS_24180 46251 44023 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123527.1 protein_id gnl|my_center|LOCUS_24180 47376 46528 gene locus_tag LOCUS_24190 47376 46528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 48413 47385 gene locus_tag LOCUS_24200 48413 47385 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123048.1 protein_id gnl|my_center|LOCUS_24200 49152 49754 gene locus_tag LOCUS_24210 gene lexA 49152 49754 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2R7 protein_id gnl|my_center|LOCUS_24210 51316 49922 gene locus_tag LOCUS_24220 51316 49922 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119007.1 protein_id gnl|my_center|LOCUS_24220 53278 51707 gene locus_tag LOCUS_24230 53278 51707 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119006.1 protein_id gnl|my_center|LOCUS_24230 54768 53428 gene locus_tag LOCUS_24240 54768 53428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 56067 54991 gene locus_tag LOCUS_24250 gene flhB 56067 54991 CDS product flagellar biosynthetic protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329631.1 protein_id gnl|my_center|LOCUS_24250 57085 56096 gene locus_tag LOCUS_24260 57085 56096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 57391 57125 gene locus_tag LOCUS_24270 gene fliQ 57391 57125 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 protein_id gnl|my_center|LOCUS_24270 58408 57443 gene locus_tag LOCUS_24280 gene fliP 58408 57443 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXG5 protein_id gnl|my_center|LOCUS_24280 59312 58401 gene locus_tag LOCUS_24290 59312 58401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 60088 59372 gene locus_tag LOCUS_24300 60088 59372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 60665 60117 gene locus_tag LOCUS_24310 60665 60117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 61554 60826 gene locus_tag LOCUS_24320 gene motB 61554 60826 CDS product MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_24320 62436 61657 gene locus_tag LOCUS_24330 gene pomA 62436 61657 CDS product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326458.1 protein_id gnl|my_center|LOCUS_24330 62749 62555 gene locus_tag LOCUS_24340 gene flbD 62749 62555 CDS product flagellar protein FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326457.1 protein_id gnl|my_center|LOCUS_24340 64507 62816 gene locus_tag LOCUS_24350 64507 62816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 65130 64699 gene locus_tag LOCUS_24360 gene flgD 65130 64699 CDS product flagellar basal body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123778.1 protein_id gnl|my_center|LOCUS_24360 67111 65162 gene locus_tag LOCUS_24370 67111 65162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 67961 67311 gene locus_tag LOCUS_24380 67961 67311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 68410 67958 gene locus_tag LOCUS_24390 68410 67958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 69849 68464 gene locus_tag LOCUS_24400 69849 68464 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_24400 70578 69859 gene locus_tag LOCUS_24410 70578 69859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 71654 70659 gene locus_tag LOCUS_24420 gene fliG 71654 70659 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337481.1 protein_id gnl|my_center|LOCUS_24420 73327 71711 gene locus_tag LOCUS_24430 73327 71711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 73706 73392 gene locus_tag LOCUS_24440 gene fliE 73706 73392 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97H50 protein_id gnl|my_center|LOCUS_24440 74181 73768 gene locus_tag LOCUS_24450 gene flgC 74181 73768 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNQ3 protein_id gnl|my_center|LOCUS_24450 74697 74233 gene locus_tag LOCUS_24460 gene flgB 74697 74233 CDS product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121392.1 protein_id gnl|my_center|LOCUS_24460 76185 74737 gene locus_tag LOCUS_24470 76185 74737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 76691 76239 gene locus_tag LOCUS_24480 76691 76239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 79414 76787 gene locus_tag LOCUS_24490 79414 76787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 81491 79764 gene locus_tag LOCUS_24500 gene ftsI 81491 79764 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_24500 81906 81586 gene locus_tag LOCUS_24510 81906 81586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 83895 82000 gene locus_tag LOCUS_24520 83895 82000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 84861 84001 gene locus_tag LOCUS_24530 gene rsmH 84861 84001 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFX8 protein_id gnl|my_center|LOCUS_24530 85997 85542 gene locus_tag LOCUS_24540 gene mraZ 85997 85542 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG81 protein_id gnl|my_center|LOCUS_24540 87321 86200 gene locus_tag LOCUS_24550 87321 86200 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122846.1 protein_id gnl|my_center|LOCUS_24550 87561 88616 gene locus_tag LOCUS_24560 gene queA 87561 88616 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGI9 protein_id gnl|my_center|LOCUS_24560 91689 88630 gene locus_tag LOCUS_24570 91689 88630 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_24570 92045 92527 gene locus_tag LOCUS_24580 92045 92527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 93825 92545 gene locus_tag LOCUS_24590 gene hemA 93825 92545 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKZ2 protein_id gnl|my_center|LOCUS_24590 94730 93822 gene locus_tag LOCUS_24600 94730 93822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 95882 94842 gene locus_tag LOCUS_24610 gene atoC 95882 94842 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123506.1 protein_id gnl|my_center|LOCUS_24610 96595 96206 gene locus_tag LOCUS_24620 gene panD 96595 96206 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9Q6 protein_id gnl|my_center|LOCUS_24620 99959 96726 gene locus_tag LOCUS_24630 99959 96726 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120478.1 protein_id gnl|my_center|LOCUS_24630 101404 99956 gene locus_tag LOCUS_24640 101404 99956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 102278 101610 gene locus_tag LOCUS_24650 102278 101610 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118095.1 protein_id gnl|my_center|LOCUS_24650 102819 102574 gene locus_tag LOCUS_24660 102819 102574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 103255 104523 gene locus_tag LOCUS_24670 gene papS 103255 104523 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_24670 104571 105674 gene locus_tag LOCUS_24680 104571 105674 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888061.1 protein_id gnl|my_center|LOCUS_24680 106613 105678 gene locus_tag LOCUS_24690 106613 105678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 107089 107259 gene locus_tag LOCUS_24700 107089 107259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 110074 107459 gene locus_tag LOCUS_24710 gene clpB 110074 107459 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHJ8 protein_id gnl|my_center|LOCUS_24710 112248 110338 gene locus_tag LOCUS_24720 gene dnaK 112248 110338 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM31 protein_id gnl|my_center|LOCUS_24720 112936 114099 gene locus_tag LOCUS_24730 gene pheA 112936 114099 CDS product P-protein (PheA) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122147.1 protein_id gnl|my_center|LOCUS_24730 114383 115156 gene locus_tag LOCUS_24740 gene tpiA 114383 115156 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_24740 115330 115860 gene locus_tag LOCUS_24750 115330 115860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 115948 116832 gene locus_tag LOCUS_24760 115948 116832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_24760 116900 117514 gene locus_tag LOCUS_24770 gene gmk 116900 117514 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP92 protein_id gnl|my_center|LOCUS_24770 117498 117782 gene locus_tag LOCUS_24780 gene rpoZ 117498 117782 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP93 protein_id gnl|my_center|LOCUS_24780 117816 118355 gene locus_tag LOCUS_24790 117816 118355 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121238.1 protein_id gnl|my_center|LOCUS_24790 118405 119034 gene locus_tag LOCUS_24800 gene dfp 118405 119034 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_24800 119319 119122 gene locus_tag LOCUS_24810 119319 119122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 119508 121808 gene locus_tag LOCUS_24820 119508 121808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 122238 123812 gene locus_tag LOCUS_24830 gene leuA 122238 123812 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_24830 123921 126899 gene locus_tag LOCUS_24840 gene valS 123921 126899 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH0 protein_id gnl|my_center|LOCUS_24840 127061 127465 gene locus_tag LOCUS_24850 127061 127465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_24850 128616 127666 gene locus_tag LOCUS_24860 128616 127666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 129113 130315 gene locus_tag LOCUS_24870 129113 130315 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972288.1 protein_id gnl|my_center|LOCUS_24870 130378 133542 gene locus_tag LOCUS_24880 130378 133542 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_24880 133701 134966 gene locus_tag LOCUS_24890 133701 134966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 136235 135087 gene locus_tag LOCUS_24900 gene fabH 136235 135087 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59814 protein_id gnl|my_center|LOCUS_24900 137700 136714 gene locus_tag LOCUS_24910 137700 136714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 138930 137752 gene locus_tag LOCUS_24920 gene metK 138930 137752 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URU7 protein_id gnl|my_center|LOCUS_24920 140643 139300 gene locus_tag LOCUS_24930 gene kdtA 140643 139300 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_24930 144238 140690 gene locus_tag LOCUS_24940 gene secA1 144238 140690 CDS product protein translocase subunit SecA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDY6 protein_id gnl|my_center|LOCUS_24940 144635 145345 gene locus_tag LOCUS_24950 144635 145345 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 protein_id gnl|my_center|LOCUS_24950 146298 146558 gene locus_tag LOCUS_24960 146298 146558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 146618 147580 gene locus_tag LOCUS_24970 146618 147580 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_24970 147648 151748 gene locus_tag LOCUS_24980 147648 151748 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020441.1 protein_id gnl|my_center|LOCUS_24980 151772 152452 gene locus_tag LOCUS_24990 151772 152452 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020402.1 protein_id gnl|my_center|LOCUS_24990 152433 152783 gene locus_tag LOCUS_25000 152433 152783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024510.1 protein_id gnl|my_center|LOCUS_25000 152947 153078 gene locus_tag LOCUS_25010 152947 153078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 154005 153409 gene locus_tag LOCUS_25020 154005 153409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 154251 154081 gene locus_tag LOCUS_25030 154251 154081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 154467 155402 gene locus_tag LOCUS_25040 154467 155402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 155782 155420 gene locus_tag LOCUS_25050 155782 155420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 156054 156665 gene locus_tag LOCUS_25060 156054 156665 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888793.1 protein_id gnl|my_center|LOCUS_25060 157903 157154 gene locus_tag LOCUS_25070 157903 157154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 159686 158100 gene locus_tag LOCUS_25080 gene pckA2 159686 158100 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S008 protein_id gnl|my_center|LOCUS_25080 160874 159873 gene locus_tag LOCUS_25090 160874 159873 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259367.1 protein_id gnl|my_center|LOCUS_25090 162556 160871 gene locus_tag LOCUS_25100 162556 160871 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_25100 163393 162572 gene locus_tag LOCUS_25110 163393 162572 CDS product tungsten-containing formylmethanofuran dehydrogenase 2 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870684.1 protein_id gnl|my_center|LOCUS_25110 164212 163424 gene locus_tag LOCUS_25120 164212 163424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 164463 166547 gene locus_tag LOCUS_25130 164463 166547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 166862 168139 gene locus_tag LOCUS_25140 166862 168139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 169729 168164 gene locus_tag LOCUS_25150 169729 168164 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257355.1 protein_id gnl|my_center|LOCUS_25150 171509 169938 gene locus_tag LOCUS_25160 171509 169938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 172781 171582 gene locus_tag LOCUS_25170 172781 171582 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_25170 173160 173663 gene locus_tag LOCUS_25180 173160 173663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 174945 173773 gene locus_tag LOCUS_25190 174945 173773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257321.1 protein_id gnl|my_center|LOCUS_25190 178475 174954 gene locus_tag LOCUS_25200 178475 174954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 181862 178485 gene locus_tag LOCUS_25210 gene rexB 181862 178485 CDS product ATP-dependent helicase/deoxyribonuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CNU0 protein_id gnl|my_center|LOCUS_25210 182152 183585 gene locus_tag LOCUS_25220 gene prc 182152 183585 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_25220 183695 184726 gene locus_tag LOCUS_25230 gene tsaD 183695 184726 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM42 protein_id gnl|my_center|LOCUS_25230 185979 184744 gene locus_tag LOCUS_25240 185979 184744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 188648 186180 gene locus_tag LOCUS_25250 188648 186180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 188863 189060 gene locus_tag LOCUS_25260 188863 189060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 189592 191496 gene locus_tag LOCUS_25270 189592 191496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 192000 191512 gene locus_tag LOCUS_25280 192000 191512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 192281 192613 gene locus_tag LOCUS_25290 192281 192613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 192980 192669 gene locus_tag LOCUS_25300 192980 192669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 193500 194624 gene locus_tag LOCUS_25310 193500 194624 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_25310 195581 194640 gene locus_tag LOCUS_25320 195581 194640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 196117 195875 gene locus_tag LOCUS_25330 196117 195875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 196415 196770 gene locus_tag LOCUS_tm00010 196415 196770 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 197447 196968 gene locus_tag LOCUS_25340 197447 196968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 197600 198403 gene locus_tag LOCUS_25350 197600 198403 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 protein_id gnl|my_center|LOCUS_25350 198860 200143 gene locus_tag LOCUS_25360 198860 200143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 209185 200396 gene locus_tag LOCUS_25370 gene ndvB 209185 200396 CDS product cyclic beta 1-2 glucan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037218.1 protein_id gnl|my_center|LOCUS_25370 209704 209393 gene locus_tag LOCUS_25380 209704 209393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 211876 210491 gene locus_tag LOCUS_25390 211876 210491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 212001 213368 gene locus_tag LOCUS_25400 212001 213368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 214591 213392 gene locus_tag LOCUS_25410 214591 213392 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence10 240 806 gene locus_tag LOCUS_25420 240 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_25420 1549 1040 gene locus_tag LOCUS_25430 1549 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 3288 1909 gene locus_tag LOCUS_25440 gene hisD 3288 1909 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX39 protein_id gnl|my_center|LOCUS_25440 4539 3298 gene locus_tag LOCUS_25450 gene glyA 4539 3298 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN2 protein_id gnl|my_center|LOCUS_25450 4778 6043 gene locus_tag LOCUS_25460 gene ogt 4778 6043 CDS product O-linked GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118172.1 protein_id gnl|my_center|LOCUS_25460 6212 7390 gene locus_tag LOCUS_25470 6212 7390 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029014.1 protein_id gnl|my_center|LOCUS_25470 7455 8846 gene locus_tag LOCUS_25480 7455 8846 CDS product alkaline ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_25480 8919 9824 gene locus_tag LOCUS_25490 8919 9824 CDS product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KQ75 protein_id gnl|my_center|LOCUS_25490 9860 11230 gene locus_tag LOCUS_25500 9860 11230 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703312.1 protein_id gnl|my_center|LOCUS_25500 11488 11297 gene locus_tag LOCUS_25510 11488 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 12293 11529 gene locus_tag LOCUS_25520 12293 11529 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_25520 12517 14415 gene locus_tag LOCUS_25530 gene gpi2 12517 14415 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_25530 14745 16112 gene locus_tag LOCUS_25540 14745 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 18458 16215 gene locus_tag LOCUS_25550 18458 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 20151 18880 gene locus_tag LOCUS_25560 gene lysA 20151 18880 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL42 protein_id gnl|my_center|LOCUS_25560 21271 20258 gene locus_tag LOCUS_25570 gene asd 21271 20258 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UL17 protein_id gnl|my_center|LOCUS_25570 21759 23030 gene locus_tag LOCUS_25580 gene purD 21759 23030 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPZ8 protein_id gnl|my_center|LOCUS_25580 23079 23840 gene locus_tag LOCUS_25590 gene comB 23079 23840 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM81 protein_id gnl|my_center|LOCUS_25590 23931 25598 gene locus_tag LOCUS_25600 gene glyQS 23931 25598 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_25600 25654 27192 gene locus_tag LOCUS_25610 25654 27192 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_25610 27302 27231 gene locus_tag LOCUS_t00260 27302 27231 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32066 27366 gene locus_tag LOCUS_25620 32066 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 32366 34852 gene locus_tag LOCUS_25630 32366 34852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_25630 35017 36516 gene locus_tag LOCUS_25640 35017 36516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_25640 37887 36532 gene locus_tag LOCUS_25650 gene GALNS 37887 36532 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121570.1 protein_id gnl|my_center|LOCUS_25650 38965 37982 gene locus_tag LOCUS_25660 38965 37982 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728439.1 protein_id gnl|my_center|LOCUS_25660 39139 40173 gene locus_tag LOCUS_25670 39139 40173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 40791 40294 gene locus_tag LOCUS_25680 gene ilvH 40791 40294 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_25680 41110 41715 gene locus_tag LOCUS_25690 41110 41715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 42035 43699 gene locus_tag LOCUS_25700 42035 43699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 43696 44889 gene locus_tag LOCUS_25710 43696 44889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 45380 45700 gene locus_tag LOCUS_25720 45380 45700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 45789 46115 gene locus_tag LOCUS_25730 45789 46115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 46296 46589 gene locus_tag LOCUS_25740 46296 46589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 46999 47733 gene locus_tag LOCUS_25750 46999 47733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 47945 49276 gene locus_tag LOCUS_25760 gene tadA 47945 49276 CDS product secretion system protein TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120689.1 protein_id gnl|my_center|LOCUS_25760 49349 50281 gene locus_tag LOCUS_25770 49349 50281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 50338 51345 gene locus_tag LOCUS_25780 50338 51345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 52882 51446 gene locus_tag LOCUS_25790 52882 51446 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_25790 53680 54897 gene locus_tag LOCUS_25800 53680 54897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 55185 55111 gene locus_tag LOCUS_t00270 55185 55111 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 55678 56469 gene locus_tag LOCUS_25810 55678 56469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 56587 57762 gene locus_tag LOCUS_25820 gene degP 56587 57762 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_25820 58001 58366 gene locus_tag LOCUS_25830 58001 58366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 58518 58324 gene locus_tag LOCUS_25840 58518 58324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 58703 58891 gene locus_tag LOCUS_25850 58703 58891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 59092 59640 gene locus_tag LOCUS_25860 59092 59640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 61036 59699 gene locus_tag LOCUS_25870 gene adh 61036 59699 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_25870 61629 61162 gene locus_tag LOCUS_25880 61629 61162 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_25880 61806 62840 gene locus_tag LOCUS_25890 61806 62840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 63029 64591 gene locus_tag LOCUS_25900 63029 64591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 64783 66627 gene locus_tag LOCUS_25910 64783 66627 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119224.1 protein_id gnl|my_center|LOCUS_25910 70242 66694 gene locus_tag LOCUS_25920 gene ileS2 70242 66694 CDS product isoleucine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJF2 protein_id gnl|my_center|LOCUS_25920 70605 71057 gene locus_tag LOCUS_25930 gene spoU 70605 71057 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU01 protein_id gnl|my_center|LOCUS_25930 72065 71064 gene locus_tag LOCUS_25940 72065 71064 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084113.1 protein_id gnl|my_center|LOCUS_25940 73707 72748 gene locus_tag LOCUS_25950 gene fpr 73707 72748 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_25950 75063 74089 gene locus_tag LOCUS_25960 75063 74089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 75854 75120 gene locus_tag LOCUS_25970 75854 75120 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121331.1 protein_id gnl|my_center|LOCUS_25970 77410 75974 gene locus_tag LOCUS_25980 gene 6pgD 77410 75974 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UV82 protein_id gnl|my_center|LOCUS_25980 78384 77500 gene locus_tag LOCUS_25990 78384 77500 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_25990 79758 78472 gene locus_tag LOCUS_26000 gene pfp 79758 78472 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ41 protein_id gnl|my_center|LOCUS_26000 81388 80246 gene locus_tag LOCUS_26010 81388 80246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 81636 83690 gene locus_tag LOCUS_26020 gene dnaK 81636 83690 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK6 protein_id gnl|my_center|LOCUS_26020 83761 84873 gene locus_tag LOCUS_26030 gene menC 83761 84873 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ9 protein_id gnl|my_center|LOCUS_26030 85021 85533 gene locus_tag LOCUS_26040 85021 85533 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 protein_id gnl|my_center|LOCUS_26040 85649 86344 gene locus_tag LOCUS_26050 85649 86344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 86423 87502 gene locus_tag LOCUS_26060 86423 87502 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083200.1 protein_id gnl|my_center|LOCUS_26060 87781 88197 gene locus_tag LOCUS_26070 87781 88197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 88604 88272 gene locus_tag LOCUS_26080 88604 88272 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227522.1 protein_id gnl|my_center|LOCUS_26080 88953 89885 gene locus_tag LOCUS_26090 88953 89885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119280.1 protein_id gnl|my_center|LOCUS_26090 91580 89895 gene locus_tag LOCUS_26100 91580 89895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 91763 92839 gene locus_tag LOCUS_26110 91763 92839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 92908 93384 gene locus_tag LOCUS_26120 92908 93384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 94135 93464 gene locus_tag LOCUS_26130 94135 93464 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122734.1 protein_id gnl|my_center|LOCUS_26130 95580 94225 gene locus_tag LOCUS_26140 95580 94225 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTN0 protein_id gnl|my_center|LOCUS_26140 96887 95637 gene locus_tag LOCUS_26150 96887 95637 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_26150 98465 96957 gene locus_tag LOCUS_26160 gene glcD 98465 96957 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_26160 100137 98641 gene locus_tag LOCUS_26170 100137 98641 CDS product Tat pathway signal sequence inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109362.1 protein_id gnl|my_center|LOCUS_26170 101813 100290 gene locus_tag LOCUS_26180 gene merA 101813 100290 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_26180 102631 101846 gene locus_tag LOCUS_26190 102631 101846 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 protein_id gnl|my_center|LOCUS_26190 104446 102752 gene locus_tag LOCUS_26200 104446 102752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 106474 105626 gene locus_tag LOCUS_26210 106474 105626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 113225 106584 gene locus_tag LOCUS_26220 113225 106584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 113544 115031 gene locus_tag LOCUS_26230 113544 115031 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 protein_id gnl|my_center|LOCUS_26230 115194 119639 gene locus_tag LOCUS_26240 115194 119639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 120590 119649 gene locus_tag LOCUS_26250 120590 119649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 121438 120851 gene locus_tag LOCUS_26260 gene trpG 121438 120851 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_26260 122962 121463 gene locus_tag LOCUS_26270 gene pabB 122962 121463 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861217.1 protein_id gnl|my_center|LOCUS_26270 124472 123060 gene locus_tag LOCUS_26280 124472 123060 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_26280 124852 124508 gene locus_tag LOCUS_26290 124852 124508 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE73 protein_id gnl|my_center|LOCUS_26290 125186 128086 gene locus_tag LOCUS_26300 125186 128086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_26300 128130 129593 gene locus_tag LOCUS_26310 128130 129593 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_26310 129820 130548 gene locus_tag LOCUS_26320 129820 130548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 130918 130556 gene locus_tag LOCUS_26330 130918 130556 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_26330 132312 131038 gene locus_tag LOCUS_26340 132312 131038 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_26340 132535 133647 gene locus_tag LOCUS_26350 132535 133647 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_26350 133814 134812 gene locus_tag LOCUS_26360 133814 134812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 135819 134881 gene locus_tag LOCUS_26370 gene xerC 135819 134881 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_26370 136122 135892 gene locus_tag LOCUS_26380 136122 135892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 137380 136229 gene locus_tag LOCUS_26390 137380 136229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120717.1 protein_id gnl|my_center|LOCUS_26390 137758 138765 gene locus_tag LOCUS_26400 gene dusB 137758 138765 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_26400 140090 138780 gene locus_tag LOCUS_26410 140090 138780 CDS product hemolysin activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119979.1 protein_id gnl|my_center|LOCUS_26410 140712 140215 gene locus_tag LOCUS_26420 gene ybeY 140712 140215 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T3 protein_id gnl|my_center|LOCUS_26420 143053 140732 gene locus_tag LOCUS_26430 143053 140732 CDS product 7TM receptor with intracellular metal dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330940.1 protein_id gnl|my_center|LOCUS_26430 144071 143106 gene locus_tag LOCUS_26440 144071 143106 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_26440 144696 146585 gene locus_tag LOCUS_26450 gene gspA 144696 146585 CDS product general secretion pathway protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118564.1 protein_id gnl|my_center|LOCUS_26450 146830 146582 gene locus_tag LOCUS_26460 146830 146582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 146912 148309 gene locus_tag LOCUS_26470 146912 148309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 149165 148356 gene locus_tag LOCUS_26480 gene phnP 149165 148356 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_26480 150492 149197 gene locus_tag LOCUS_26490 150492 149197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 152957 151104 gene locus_tag LOCUS_26500 gene glgB 152957 151104 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_26500 153619 154578 gene locus_tag LOCUS_26510 153619 154578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 154741 155571 gene locus_tag LOCUS_26520 154741 155571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26520 155697 156755 gene locus_tag LOCUS_26530 155697 156755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26530 156911 158398 gene locus_tag LOCUS_26540 gene hemY 156911 158398 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_26540 160166 158370 gene locus_tag LOCUS_26550 gene arsA 160166 158370 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121660.1 protein_id gnl|my_center|LOCUS_26550 161811 160453 gene locus_tag LOCUS_26560 161811 160453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119040.1 protein_id gnl|my_center|LOCUS_26560 162321 163406 gene locus_tag LOCUS_26570 gene tal 162321 163406 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ7 protein_id gnl|my_center|LOCUS_26570 163713 164435 gene locus_tag LOCUS_26580 163713 164435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 164930 164484 gene locus_tag LOCUS_26590 164930 164484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 165100 166176 gene locus_tag LOCUS_26600 165100 166176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 166956 167966 gene locus_tag LOCUS_26610 166956 167966 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_26610 167956 168195 gene locus_tag LOCUS_26620 167956 168195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 168330 169085 gene locus_tag LOCUS_26630 168330 169085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118370.1 protein_id gnl|my_center|LOCUS_26630 169089 169358 gene locus_tag LOCUS_26640 169089 169358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 170468 171619 gene locus_tag LOCUS_26650 170468 171619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 171609 172697 gene locus_tag LOCUS_26660 171609 172697 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_26660 172808 175396 gene locus_tag LOCUS_26670 172808 175396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 176201 175788 gene locus_tag LOCUS_26680 176201 175788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26680 177480 176269 gene locus_tag LOCUS_26690 177480 176269 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937637.1 protein_id gnl|my_center|LOCUS_26690 179054 177567 gene locus_tag LOCUS_26700 179054 177567 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120048.1 protein_id gnl|my_center|LOCUS_26700 181042 179042 gene locus_tag LOCUS_26710 gene fixL 181042 179042 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119443.1 protein_id gnl|my_center|LOCUS_26710 181336 181076 gene locus_tag LOCUS_26720 181336 181076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 182134 182421 gene locus_tag LOCUS_26730 182134 182421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 184838 182688 gene locus_tag LOCUS_26740 184838 182688 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_26740 186080 184905 gene locus_tag LOCUS_26750 186080 184905 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_26750 186212 187267 gene locus_tag LOCUS_26760 186212 187267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 188416 187343 gene locus_tag LOCUS_26770 188416 187343 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_26770 190481 188865 gene locus_tag LOCUS_26780 190481 188865 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_26780 190802 191188 gene locus_tag LOCUS_26790 190802 191188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 191286 192827 gene locus_tag LOCUS_26800 191286 192827 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_26800 192946 193515 gene locus_tag LOCUS_26810 192946 193515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 193582 194709 gene locus_tag LOCUS_26820 193582 194709 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726907.1 protein_id gnl|my_center|LOCUS_26820 195621 194770 gene locus_tag LOCUS_26830 gene lppC 195621 194770 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404190.1 protein_id gnl|my_center|LOCUS_26830 196669 195677 gene locus_tag LOCUS_26840 196669 195677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 197593 197054 gene locus_tag LOCUS_26850 197593 197054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence11 537 139 gene locus_tag LOCUS_26860 537 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1314 550 gene locus_tag LOCUS_26870 1314 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1890 1327 gene locus_tag LOCUS_26880 1890 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2206 3150 gene locus_tag LOCUS_26890 gene gspG 2206 3150 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118411.1 protein_id gnl|my_center|LOCUS_26890 3207 3632 gene locus_tag LOCUS_26900 3207 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 4622 3681 gene locus_tag LOCUS_26910 4622 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_26910 5582 4731 gene locus_tag LOCUS_26920 gene xynB 5582 4731 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_26920 5836 7083 gene locus_tag LOCUS_26930 5836 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 7311 8900 gene locus_tag LOCUS_26940 gene phoD 7311 8900 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339980.1 protein_id gnl|my_center|LOCUS_26940 14292 8953 gene locus_tag LOCUS_26950 14292 8953 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267807.1 protein_id gnl|my_center|LOCUS_26950 14332 14529 gene locus_tag LOCUS_26960 14332 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 14595 14978 gene locus_tag LOCUS_26970 14595 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 15578 15117 gene locus_tag LOCUS_26980 15578 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 16912 16824 gene locus_tag LOCUS_t00280 16912 16824 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18084 17224 gene locus_tag LOCUS_26990 18084 17224 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_26990 18614 18120 gene locus_tag LOCUS_27000 18614 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 18777 19346 gene locus_tag LOCUS_27010 18777 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 19462 20862 gene locus_tag LOCUS_27020 gene sthA 19462 20862 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPQ0 protein_id gnl|my_center|LOCUS_27020 20898 22352 gene locus_tag LOCUS_27030 20898 22352 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_27030 26507 22389 gene locus_tag LOCUS_27040 26507 22389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 28801 26816 gene locus_tag LOCUS_27050 28801 26816 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_27050 29070 29456 gene locus_tag LOCUS_27060 gene acpS 29070 29456 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE72 protein_id gnl|my_center|LOCUS_27060 30069 29479 gene locus_tag LOCUS_27070 30069 29479 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_27070 32132 30066 gene locus_tag LOCUS_27080 gene ftsH2 32132 30066 CDS product ATP-dependent zinc metalloprotease FtsH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URM7 protein_id gnl|my_center|LOCUS_27080 32522 33667 gene locus_tag LOCUS_27090 gene dxr 32522 33667 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW4 protein_id gnl|my_center|LOCUS_27090 33658 35667 gene locus_tag LOCUS_27100 33658 35667 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120518.1 protein_id gnl|my_center|LOCUS_27100 35798 36235 gene locus_tag LOCUS_27110 35798 36235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 37660 36254 gene locus_tag LOCUS_27120 37660 36254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 38449 39600 gene locus_tag LOCUS_27130 38449 39600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 39575 40804 gene locus_tag LOCUS_27140 39575 40804 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_27140 40820 41728 gene locus_tag LOCUS_27150 40820 41728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 41913 45050 gene locus_tag LOCUS_27160 41913 45050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123598.1 protein_id gnl|my_center|LOCUS_27160 45108 46535 gene locus_tag LOCUS_27170 45108 46535 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_27170 46723 48843 gene locus_tag LOCUS_27180 gene flhA 46723 48843 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_27180 48949 50388 gene locus_tag LOCUS_27190 48949 50388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 50481 51464 gene locus_tag LOCUS_27200 50481 51464 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6A3 protein_id gnl|my_center|LOCUS_27200 51839 52060 gene locus_tag LOCUS_27210 51839 52060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 52138 52914 gene locus_tag LOCUS_27220 gene whiG 52138 52914 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFV6 protein_id gnl|my_center|LOCUS_27220 54952 55911 gene locus_tag LOCUS_27230 gene moxR 54952 55911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119708.1 protein_id gnl|my_center|LOCUS_27230 55908 57218 gene locus_tag LOCUS_27240 55908 57218 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 protein_id gnl|my_center|LOCUS_27240 57715 57227 gene locus_tag LOCUS_27250 57715 57227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 58114 58686 gene locus_tag LOCUS_27260 58114 58686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 60727 58694 gene locus_tag LOCUS_27270 60727 58694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 62121 60904 gene locus_tag LOCUS_27280 62121 60904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 63123 62197 gene locus_tag LOCUS_27290 gene ldh 63123 62197 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_27290 64078 63188 gene locus_tag LOCUS_27300 64078 63188 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_27300 64417 64136 gene locus_tag LOCUS_27310 64417 64136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 65127 64438 gene locus_tag LOCUS_27320 65127 64438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 65419 65162 gene locus_tag LOCUS_27330 65419 65162 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118934.1 protein_id gnl|my_center|LOCUS_27330 66922 65492 gene locus_tag LOCUS_27340 gene eutE 66922 65492 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_27340 67511 66993 gene locus_tag LOCUS_27350 67511 66993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 67849 67538 gene locus_tag LOCUS_27360 gene eutN 67849 67538 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118935.1 protein_id gnl|my_center|LOCUS_27360 69090 67900 gene locus_tag LOCUS_27370 gene ackA 69090 67900 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVK1 protein_id gnl|my_center|LOCUS_27370 69583 69191 gene locus_tag LOCUS_27380 69583 69191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 69899 69600 gene locus_tag LOCUS_27390 gene eutM 69899 69600 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_27390 70714 70004 gene locus_tag LOCUS_27400 70714 70004 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVJ7 protein_id gnl|my_center|LOCUS_27400 71531 70770 gene locus_tag LOCUS_27410 71531 70770 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_27410 72080 73612 gene locus_tag LOCUS_27420 72080 73612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 73637 75040 gene locus_tag LOCUS_27430 73637 75040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 75717 75064 gene locus_tag LOCUS_27440 gene pur3 75717 75064 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_27440 76662 75751 gene locus_tag LOCUS_27450 76662 75751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 76927 76709 gene locus_tag LOCUS_27460 76927 76709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 77043 77369 gene locus_tag LOCUS_27470 77043 77369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 77560 79596 gene locus_tag LOCUS_27480 77560 79596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 79805 79617 gene locus_tag LOCUS_27490 79805 79617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 80462 80049 gene locus_tag LOCUS_27500 80462 80049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 81640 80495 gene locus_tag LOCUS_27510 gene mqnE 81640 80495 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_27510 82614 81751 gene locus_tag LOCUS_27520 gene ubiA 82614 81751 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_27520 83479 82775 gene locus_tag LOCUS_27530 83479 82775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 84034 83705 gene locus_tag LOCUS_27540 84034 83705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 85156 84155 gene locus_tag LOCUS_27550 85156 84155 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_27550 85885 85295 gene locus_tag LOCUS_27560 gene def 85885 85295 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ5 protein_id gnl|my_center|LOCUS_27560 86471 86175 gene locus_tag LOCUS_27570 86471 86175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 87486 86557 gene locus_tag LOCUS_27580 87486 86557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 88199 89143 gene locus_tag LOCUS_27590 88199 89143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 90648 89215 gene locus_tag LOCUS_27600 90648 89215 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_27600 93844 90737 gene locus_tag LOCUS_27610 93844 90737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123598.1 protein_id gnl|my_center|LOCUS_27610 94559 95716 gene locus_tag LOCUS_27620 94559 95716 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327030.1 protein_id gnl|my_center|LOCUS_27620 97259 95811 gene locus_tag LOCUS_27630 97259 95811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_27630 100240 97280 gene locus_tag LOCUS_27640 100240 97280 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120962.1 protein_id gnl|my_center|LOCUS_27640 100721 100404 gene locus_tag LOCUS_27650 100721 100404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 101838 100915 gene locus_tag LOCUS_27660 101838 100915 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_27660 102186 102725 gene locus_tag LOCUS_27670 102186 102725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 102722 104419 gene locus_tag LOCUS_27680 102722 104419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120965.1 protein_id gnl|my_center|LOCUS_27680 105212 104526 gene locus_tag LOCUS_27690 105212 104526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 105661 105347 gene locus_tag LOCUS_27700 105661 105347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27700 107200 105902 gene locus_tag LOCUS_27710 107200 105902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_27710 108194 107325 gene locus_tag LOCUS_27720 108194 107325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 109453 108977 gene locus_tag LOCUS_27730 109453 108977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 111043 109742 gene locus_tag LOCUS_27740 111043 109742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 111593 111790 gene locus_tag LOCUS_27750 111593 111790 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_27750 113632 112397 gene locus_tag LOCUS_27760 gene sufS 113632 112397 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UNL0 protein_id gnl|my_center|LOCUS_27760 116038 114605 gene locus_tag LOCUS_27770 116038 114605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 116407 117681 gene locus_tag LOCUS_27780 116407 117681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 117994 117710 gene locus_tag LOCUS_27790 117994 117710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_27790 118538 118203 gene locus_tag LOCUS_27800 118538 118203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 119125 119382 gene locus_tag LOCUS_27810 119125 119382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 119896 120312 gene locus_tag LOCUS_27820 119896 120312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 120418 121500 gene locus_tag LOCUS_27830 120418 121500 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMF2 protein_id gnl|my_center|LOCUS_27830 121500 121970 gene locus_tag LOCUS_27840 121500 121970 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_27840 123381 122020 gene locus_tag LOCUS_27850 123381 122020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 123726 124850 gene locus_tag LOCUS_27860 123726 124850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 125869 124847 gene locus_tag LOCUS_27870 125869 124847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 127629 125866 gene locus_tag LOCUS_27880 127629 125866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 128044 128733 gene locus_tag LOCUS_27890 128044 128733 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678714.1 protein_id gnl|my_center|LOCUS_27890 128824 130254 gene locus_tag LOCUS_27900 gene purB 128824 130254 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFU0 protein_id gnl|my_center|LOCUS_27900 131801 130353 gene locus_tag LOCUS_27910 131801 130353 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121859.1 protein_id gnl|my_center|LOCUS_27910 134200 131807 gene locus_tag LOCUS_27920 134200 131807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 134589 135560 gene locus_tag LOCUS_27930 134589 135560 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_27930 135751 136518 gene locus_tag LOCUS_27940 135751 136518 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_27940 136626 137390 gene locus_tag LOCUS_27950 136626 137390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_27950 137469 139001 gene locus_tag LOCUS_27960 gene xylB 137469 139001 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123533.1 protein_id gnl|my_center|LOCUS_27960 139479 140642 gene locus_tag LOCUS_27970 gene stf3 139479 140642 CDS product PAPS-dependent sulfotransferase Stf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLG1 protein_id gnl|my_center|LOCUS_27970 141221 140703 gene locus_tag LOCUS_27980 141221 140703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 142569 141529 gene locus_tag LOCUS_27990 gene cydB 142569 141529 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546753.1 protein_id gnl|my_center|LOCUS_27990 143931 142573 gene locus_tag LOCUS_28000 gene cydA 143931 142573 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_28000 144948 144007 gene locus_tag LOCUS_28010 144948 144007 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123991.1 protein_id gnl|my_center|LOCUS_28010 145835 145038 gene locus_tag LOCUS_28020 145835 145038 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_28020 146711 146010 gene locus_tag LOCUS_28030 146711 146010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404657.1 protein_id gnl|my_center|LOCUS_28030 146991 148139 gene locus_tag LOCUS_28040 gene aroC 146991 148139 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI34 protein_id gnl|my_center|LOCUS_28040 148157 148585 gene locus_tag LOCUS_28050 148157 148585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_28050 149962 148598 gene locus_tag LOCUS_28060 149962 148598 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_28060 150529 150017 gene locus_tag LOCUS_28070 150529 150017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 150693 150529 gene locus_tag LOCUS_28080 150693 150529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 152416 151085 gene locus_tag LOCUS_28090 152416 151085 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_28090 153272 152643 gene locus_tag LOCUS_28100 153272 152643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 154362 153265 gene locus_tag LOCUS_28110 154362 153265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 154555 154349 gene locus_tag LOCUS_28120 154555 154349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 154931 154635 gene locus_tag LOCUS_28130 154931 154635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 155526 154969 gene locus_tag LOCUS_28140 155526 154969 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_28140 156744 155605 gene locus_tag LOCUS_28150 gene dnaJ 156744 155605 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM96 protein_id gnl|my_center|LOCUS_28150 158544 156925 gene locus_tag LOCUS_28160 gene groL2 158544 156925 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM97 protein_id gnl|my_center|LOCUS_28160 158997 158707 gene locus_tag LOCUS_28170 gene groS1 158997 158707 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM98 protein_id gnl|my_center|LOCUS_28170 160859 159141 gene locus_tag LOCUS_28180 gene groL1 160859 159141 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM99 protein_id gnl|my_center|LOCUS_28180 161586 162944 gene locus_tag LOCUS_28190 gene amt-2 161586 162944 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ9 protein_id gnl|my_center|LOCUS_28190 163193 164680 gene locus_tag LOCUS_28200 gene glpK2 163193 164680 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_28200 165414 164725 gene locus_tag LOCUS_28210 165414 164725 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_28210 167232 165484 gene locus_tag LOCUS_28220 167232 165484 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582679.1 protein_id gnl|my_center|LOCUS_28220 167393 168799 gene locus_tag LOCUS_28230 167393 168799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 169006 169356 gene locus_tag LOCUS_28240 169006 169356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 169834 169571 gene locus_tag LOCUS_28250 169834 169571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 170577 171374 gene locus_tag LOCUS_28260 gene folP 170577 171374 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X9 protein_id gnl|my_center|LOCUS_28260 171457 172140 gene locus_tag LOCUS_28270 171457 172140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_28270 173128 172166 gene locus_tag LOCUS_28280 173128 172166 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_28280 173764 173213 gene locus_tag LOCUS_28290 173764 173213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941058.1 protein_id gnl|my_center|LOCUS_28290 174335 174706 gene locus_tag LOCUS_28300 174335 174706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 174740 175546 gene locus_tag LOCUS_28310 gene birA 174740 175546 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CI75 protein_id gnl|my_center|LOCUS_28310 175578 176582 gene locus_tag LOCUS_28320 175578 176582 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_28320 177534 177743 gene locus_tag LOCUS_28330 177534 177743 CDS product pressure-regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123651.1 protein_id gnl|my_center|LOCUS_28330 178513 177845 gene locus_tag LOCUS_28340 178513 177845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 178819 179643 gene locus_tag LOCUS_28350 178819 179643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence12 815 384 gene locus_tag LOCUS_28360 815 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1967 1425 gene locus_tag LOCUS_28370 1967 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 5624 2115 gene locus_tag LOCUS_28380 5624 2115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_28380 6352 5660 gene locus_tag LOCUS_28390 gene lolD1 6352 5660 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_28390 6804 6373 gene locus_tag LOCUS_28400 6804 6373 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_28400 8916 6910 gene locus_tag LOCUS_28410 8916 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 9167 8916 gene locus_tag LOCUS_28420 9167 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 9540 10610 gene locus_tag LOCUS_28430 9540 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 10882 11565 gene locus_tag LOCUS_28440 10882 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 11701 12750 gene locus_tag LOCUS_28450 11701 12750 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQD2 protein_id gnl|my_center|LOCUS_28450 12826 13533 gene locus_tag LOCUS_28460 12826 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 13597 14691 gene locus_tag LOCUS_28470 13597 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 14768 16018 gene locus_tag LOCUS_28480 gene cinA 14768 16018 CDS product damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117966.1 protein_id gnl|my_center|LOCUS_28480 20322 16033 gene locus_tag LOCUS_28490 20322 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 21659 20319 gene locus_tag LOCUS_28500 21659 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 22421 22002 gene locus_tag LOCUS_28510 22421 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 23763 22687 gene locus_tag LOCUS_28520 23763 22687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 25255 23972 gene locus_tag LOCUS_28530 gene fabF 25255 23972 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ1 protein_id gnl|my_center|LOCUS_28530 25925 25437 gene locus_tag LOCUS_28540 gene fabZ 25925 25437 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121272.1 protein_id gnl|my_center|LOCUS_28540 26478 26092 gene locus_tag LOCUS_28550 gene acpP 26478 26092 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP48 protein_id gnl|my_center|LOCUS_28550 27428 26676 gene locus_tag LOCUS_28560 gene fabG 27428 26676 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402833.1 protein_id gnl|my_center|LOCUS_28560 28001 27513 gene locus_tag LOCUS_28570 gene fabZ 28001 27513 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121271.1 protein_id gnl|my_center|LOCUS_28570 28541 29188 gene locus_tag LOCUS_28580 28541 29188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 30005 29211 gene locus_tag LOCUS_28590 30005 29211 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_28590 30460 32106 gene locus_tag LOCUS_28600 30460 32106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_28600 32183 33457 gene locus_tag LOCUS_28610 32183 33457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_28610 33582 34172 gene locus_tag LOCUS_28620 33582 34172 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_28620 34165 36354 gene locus_tag LOCUS_28630 34165 36354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 36456 37208 gene locus_tag LOCUS_28640 36456 37208 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 protein_id gnl|my_center|LOCUS_28640 37608 37213 gene locus_tag LOCUS_28650 37608 37213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 39116 37773 gene locus_tag LOCUS_28660 gene trkA 39116 37773 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_28660 40063 39167 gene locus_tag LOCUS_28670 40063 39167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120863.1 protein_id gnl|my_center|LOCUS_28670 40393 41061 gene locus_tag LOCUS_28680 40393 41061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 41259 41047 gene locus_tag LOCUS_28690 41259 41047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 41404 41261 gene locus_tag LOCUS_28700 41404 41261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 41487 42623 gene locus_tag LOCUS_28710 41487 42623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 42711 44237 gene locus_tag LOCUS_28720 42711 44237 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_28720 44445 45113 gene locus_tag LOCUS_28730 44445 45113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 45188 46723 gene locus_tag LOCUS_28740 45188 46723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 47232 48602 gene locus_tag LOCUS_28750 gene czcC 47232 48602 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_28750 50034 48631 gene locus_tag LOCUS_28760 50034 48631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_28760 50550 54008 gene locus_tag LOCUS_28770 50550 54008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 54228 62138 gene locus_tag LOCUS_28780 54228 62138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 62215 62898 gene locus_tag LOCUS_28790 62215 62898 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCR8 protein_id gnl|my_center|LOCUS_28790 63245 62889 gene locus_tag LOCUS_28800 gene nasE 63245 62889 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_28800 64498 63263 gene locus_tag LOCUS_28810 64498 63263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 65219 64470 gene locus_tag LOCUS_28820 65219 64470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 66181 65264 gene locus_tag LOCUS_28830 66181 65264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 67245 66178 gene locus_tag LOCUS_28840 67245 66178 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_28840 68116 67238 gene locus_tag LOCUS_28850 68116 67238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 68472 69602 gene locus_tag LOCUS_28860 68472 69602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119080.1 protein_id gnl|my_center|LOCUS_28860 70364 69636 gene locus_tag LOCUS_28870 70364 69636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 70922 70461 gene locus_tag LOCUS_28880 70922 70461 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893498.1 protein_id gnl|my_center|LOCUS_28880 71313 72476 gene locus_tag LOCUS_28890 71313 72476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 74870 72573 gene locus_tag LOCUS_28900 74870 72573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 75900 75136 gene locus_tag LOCUS_28910 75900 75136 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ43 protein_id gnl|my_center|LOCUS_28910 76841 75954 gene locus_tag LOCUS_28920 76841 75954 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_28920 77474 76938 gene locus_tag LOCUS_28930 77474 76938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 78959 77580 gene locus_tag LOCUS_28940 78959 77580 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_28940 79550 78990 gene locus_tag LOCUS_28950 79550 78990 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_28950 79909 79604 gene locus_tag LOCUS_28960 gene arsR 79909 79604 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123144.1 protein_id gnl|my_center|LOCUS_28960 80090 81013 gene locus_tag LOCUS_28970 80090 81013 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119404.1 protein_id gnl|my_center|LOCUS_28970 81135 82601 gene locus_tag LOCUS_28980 gene atsA 81135 82601 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118387.1 protein_id gnl|my_center|LOCUS_28980 83828 82638 gene locus_tag LOCUS_28990 83828 82638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 85250 83991 gene locus_tag LOCUS_29000 85250 83991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_29000 86802 85369 gene locus_tag LOCUS_29010 86802 85369 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_29010 88309 86981 gene locus_tag LOCUS_29020 gene ftsA 88309 86981 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_29020 88640 89167 gene locus_tag LOCUS_29030 88640 89167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123400.1 protein_id gnl|my_center|LOCUS_29030 89230 91158 gene locus_tag LOCUS_29040 89230 91158 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_29040 92441 91170 gene locus_tag LOCUS_29050 92441 91170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 92984 92550 gene locus_tag LOCUS_29060 92984 92550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 96055 93002 gene locus_tag LOCUS_29070 96055 93002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 97665 96301 gene locus_tag LOCUS_29080 97665 96301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122501.1 protein_id gnl|my_center|LOCUS_29080 98036 100231 gene locus_tag LOCUS_29090 98036 100231 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122735.1 protein_id gnl|my_center|LOCUS_29090 101341 100220 gene locus_tag LOCUS_29100 gene citZ 101341 100220 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39120 protein_id gnl|my_center|LOCUS_29100 102505 101549 gene locus_tag LOCUS_29110 gene hemC 102505 101549 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_29110 103741 102554 gene locus_tag LOCUS_29120 103741 102554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 104503 103814 gene locus_tag LOCUS_29130 104503 103814 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_29130 104699 106159 gene locus_tag LOCUS_29140 gene pds 104699 106159 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_29140 106170 107228 gene locus_tag LOCUS_29150 106170 107228 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_29150 108469 108278 gene locus_tag LOCUS_29160 108469 108278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 109286 108486 gene locus_tag LOCUS_29170 109286 108486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 109529 111094 gene locus_tag LOCUS_29180 gene phoD 109529 111094 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_29180 111883 111101 gene locus_tag LOCUS_29190 111883 111101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 112525 113535 gene locus_tag LOCUS_29200 112525 113535 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_29200 113655 114074 gene locus_tag LOCUS_29210 113655 114074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 115477 114089 gene locus_tag LOCUS_29220 gene gadB 115477 114089 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI34 protein_id gnl|my_center|LOCUS_29220 117031 115598 gene locus_tag LOCUS_29230 117031 115598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 117324 117130 gene locus_tag LOCUS_29240 117324 117130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 119221 117440 gene locus_tag LOCUS_29250 119221 117440 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW9 protein_id gnl|my_center|LOCUS_29250 119581 119336 gene locus_tag LOCUS_29260 119581 119336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 119854 121230 gene locus_tag LOCUS_29270 119854 121230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_29270 121640 121272 gene locus_tag LOCUS_29280 121640 121272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 123634 122519 gene locus_tag LOCUS_29290 123634 122519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_29290 123954 123685 gene locus_tag LOCUS_29300 123954 123685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 124874 127264 gene locus_tag LOCUS_29310 124874 127264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 128078 127530 gene locus_tag LOCUS_29320 128078 127530 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_29320 128921 128184 gene locus_tag LOCUS_29330 128921 128184 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122515.1 protein_id gnl|my_center|LOCUS_29330 128920 129141 gene locus_tag LOCUS_29340 128920 129141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 129110 130402 gene locus_tag LOCUS_29350 129110 130402 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_29350 130475 133024 gene locus_tag LOCUS_29360 130475 133024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 133158 135242 gene locus_tag LOCUS_29370 gene uvrD 133158 135242 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CVE9 protein_id gnl|my_center|LOCUS_29370 136556 135255 gene locus_tag LOCUS_29380 136556 135255 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460048.1 protein_id gnl|my_center|LOCUS_29380 136784 137770 gene locus_tag LOCUS_29390 136784 137770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 137886 139304 gene locus_tag LOCUS_29400 137886 139304 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_29400 139368 140993 gene locus_tag LOCUS_29410 gene aslA 139368 140993 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118456.1 protein_id gnl|my_center|LOCUS_29410 141500 141327 gene locus_tag LOCUS_29420 141500 141327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 142144 141635 gene locus_tag LOCUS_29430 142144 141635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 143122 142355 gene locus_tag LOCUS_29440 gene ispD 143122 142355 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM15 protein_id gnl|my_center|LOCUS_29440 143551 145050 gene locus_tag LOCUS_29450 gene atoC 143551 145050 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_29450 145675 145103 gene locus_tag LOCUS_29460 145675 145103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 149288 145917 gene locus_tag LOCUS_29470 149288 145917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 149667 149275 gene locus_tag LOCUS_29480 149667 149275 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764156.1 protein_id gnl|my_center|LOCUS_29480 149977 150519 gene locus_tag LOCUS_29490 149977 150519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 150688 151296 gene locus_tag LOCUS_29500 150688 151296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 152082 151318 gene locus_tag LOCUS_29510 152082 151318 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402891.1 protein_id gnl|my_center|LOCUS_29510 153447 152182 gene locus_tag LOCUS_29520 153447 152182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 153970 154905 gene locus_tag LOCUS_29530 153970 154905 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_29530 155536 155102 gene locus_tag LOCUS_29540 155536 155102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 157511 156405 gene locus_tag LOCUS_29550 157511 156405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 157732 158457 gene locus_tag LOCUS_29560 gene bioD 157732 158457 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53558 protein_id gnl|my_center|LOCUS_29560 158581 160230 gene locus_tag LOCUS_29570 158581 160230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 161984 160476 gene locus_tag LOCUS_29580 gene htrA 161984 160476 CDS product putative periplasmic serine endoprotease DegP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6T0 protein_id gnl|my_center|LOCUS_29580 162508 163260 gene locus_tag LOCUS_29590 gene rnc 162508 163260 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ7 protein_id gnl|my_center|LOCUS_29590 165303 163726 gene locus_tag LOCUS_29600 165303 163726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 165919 165467 gene locus_tag LOCUS_29610 165919 165467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 166353 166120 gene locus_tag LOCUS_29620 166353 166120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 166479 167633 gene locus_tag LOCUS_29630 166479 167633 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329274.1 protein_id gnl|my_center|LOCUS_29630 167972 168556 gene locus_tag LOCUS_29640 167972 168556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008653063.1 protein_id gnl|my_center|LOCUS_29640 170489 169062 gene locus_tag LOCUS_29650 170489 169062 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_29650 173732 170535 gene locus_tag LOCUS_29660 173732 170535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 174506 173790 gene locus_tag LOCUS_29670 174506 173790 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965838.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence13 927 190 gene locus_tag LOCUS_29680 927 190 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224710.1 protein_id gnl|my_center|LOCUS_29680 1203 2813 gene locus_tag LOCUS_29690 1203 2813 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118712.1 protein_id gnl|my_center|LOCUS_29690 4028 3009 gene locus_tag LOCUS_29700 4028 3009 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GE3 protein_id gnl|my_center|LOCUS_29700 4246 4070 gene locus_tag LOCUS_29710 4246 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 5083 4319 gene locus_tag LOCUS_29720 5083 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247460.1 protein_id gnl|my_center|LOCUS_29720 5670 5287 gene locus_tag LOCUS_29730 5670 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 5933 7396 gene locus_tag LOCUS_29740 5933 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 7466 8509 gene locus_tag LOCUS_29750 7466 8509 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_29750 10106 8748 gene locus_tag LOCUS_29760 10106 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 11692 10307 gene locus_tag LOCUS_29770 11692 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 13616 12024 gene locus_tag LOCUS_29780 13616 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 15467 14226 gene locus_tag LOCUS_29790 15467 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 16832 15690 gene locus_tag LOCUS_29800 16832 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 17804 18547 gene locus_tag LOCUS_29810 17804 18547 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403528.1 protein_id gnl|my_center|LOCUS_29810 18579 19928 gene locus_tag LOCUS_29820 18579 19928 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_29820 20061 21269 gene locus_tag LOCUS_29830 gene apgM 20061 21269 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X295 protein_id gnl|my_center|LOCUS_29830 21541 22197 gene locus_tag LOCUS_29840 21541 22197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123691.1 protein_id gnl|my_center|LOCUS_29840 22194 23069 gene locus_tag LOCUS_29850 22194 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123690.1 protein_id gnl|my_center|LOCUS_29850 24284 23100 gene locus_tag LOCUS_29860 gene kbl 24284 23100 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KL61 protein_id gnl|my_center|LOCUS_29860 25368 24337 gene locus_tag LOCUS_29870 gene tdh 25368 24337 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEM0 protein_id gnl|my_center|LOCUS_29870 25500 26117 gene locus_tag LOCUS_29880 25500 26117 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_29880 27176 26136 gene locus_tag LOCUS_29890 27176 26136 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122268.1 protein_id gnl|my_center|LOCUS_29890 28899 27214 gene locus_tag LOCUS_29900 28899 27214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 29898 29032 gene locus_tag LOCUS_29910 gene kdsA 29898 29032 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ25 protein_id gnl|my_center|LOCUS_29910 30839 29970 gene locus_tag LOCUS_29920 30839 29970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545034.1 protein_id gnl|my_center|LOCUS_29920 31243 32967 gene locus_tag LOCUS_29930 31243 32967 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_29930 33203 34510 gene locus_tag LOCUS_29940 33203 34510 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_29940 35218 34838 gene locus_tag LOCUS_29950 35218 34838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 36474 35509 gene locus_tag LOCUS_29960 gene uxuA 36474 35509 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0M8 protein_id gnl|my_center|LOCUS_29960 36707 38404 gene locus_tag LOCUS_29970 gene fhs 36707 38404 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM91 protein_id gnl|my_center|LOCUS_29970 39641 38418 gene locus_tag LOCUS_29980 39641 38418 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_29980 41145 39673 gene locus_tag LOCUS_29990 41145 39673 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3U9 protein_id gnl|my_center|LOCUS_29990 41291 42037 gene locus_tag LOCUS_30000 41291 42037 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582830.1 protein_id gnl|my_center|LOCUS_30000 42055 42723 gene locus_tag LOCUS_30010 42055 42723 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602230.1 protein_id gnl|my_center|LOCUS_30010 44212 42737 gene locus_tag LOCUS_30020 gene GALNS 44212 42737 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121931.1 protein_id gnl|my_center|LOCUS_30020 44551 45798 gene locus_tag LOCUS_30030 44551 45798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947366.1 protein_id gnl|my_center|LOCUS_30030 45871 47223 gene locus_tag LOCUS_30040 gene ndh 45871 47223 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_30040 47272 47478 gene locus_tag LOCUS_30050 47272 47478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 48487 47657 gene locus_tag LOCUS_30060 48487 47657 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_30060 49122 48676 gene locus_tag LOCUS_30070 49122 48676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 50090 49215 gene locus_tag LOCUS_30080 50090 49215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 51005 50250 gene locus_tag LOCUS_30090 51005 50250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 51888 51232 gene locus_tag LOCUS_30100 51888 51232 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105616.1 protein_id gnl|my_center|LOCUS_30100 53966 52062 gene locus_tag LOCUS_30110 53966 52062 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602099.1 protein_id gnl|my_center|LOCUS_30110 55013 54141 gene locus_tag LOCUS_30120 55013 54141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 55729 55217 gene locus_tag LOCUS_30130 55729 55217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 56625 55942 gene locus_tag LOCUS_30140 56625 55942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 57327 56680 gene locus_tag LOCUS_30150 57327 56680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 57326 57493 gene locus_tag LOCUS_30160 57326 57493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 57583 57813 gene locus_tag LOCUS_30170 57583 57813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 57806 58387 gene locus_tag LOCUS_30180 57806 58387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 58511 58437 gene locus_tag LOCUS_t00290 58511 58437 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 59970 58771 gene locus_tag LOCUS_30190 59970 58771 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 protein_id gnl|my_center|LOCUS_30190 60640 60059 gene locus_tag LOCUS_30200 60640 60059 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545477.1 protein_id gnl|my_center|LOCUS_30200 60840 61757 gene locus_tag LOCUS_30210 60840 61757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 61936 63687 gene locus_tag LOCUS_30220 gene rpsA 61936 63687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 protein_id gnl|my_center|LOCUS_30220 64534 63788 gene locus_tag LOCUS_30230 64534 63788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_30230 64920 65357 gene locus_tag LOCUS_30240 64920 65357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 65544 66062 gene locus_tag LOCUS_30250 65544 66062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 67512 66088 gene locus_tag LOCUS_30260 gene arsA 67512 66088 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_30260 67760 68332 gene locus_tag LOCUS_30270 67760 68332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 68471 71173 gene locus_tag LOCUS_30280 68471 71173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 71226 72896 gene locus_tag LOCUS_30290 71226 72896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 72893 73606 gene locus_tag LOCUS_30300 72893 73606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_30300 73662 75002 gene locus_tag LOCUS_30310 73662 75002 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_30310 75205 77283 gene locus_tag LOCUS_30320 75205 77283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 77543 77815 gene locus_tag LOCUS_30330 77543 77815 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438991.1 protein_id gnl|my_center|LOCUS_30330 77847 80216 gene locus_tag LOCUS_30340 77847 80216 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117853.1 protein_id gnl|my_center|LOCUS_30340 81083 80220 gene locus_tag LOCUS_30350 81083 80220 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_30350 82702 81158 gene locus_tag LOCUS_30360 82702 81158 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_30360 82913 84682 gene locus_tag LOCUS_30370 82913 84682 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_30370 85020 86327 gene locus_tag LOCUS_30380 85020 86327 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_30380 87522 86392 gene locus_tag LOCUS_30390 87522 86392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 88102 90126 gene locus_tag LOCUS_30400 88102 90126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 90138 91316 gene locus_tag LOCUS_30410 90138 91316 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_30410 91811 91398 gene locus_tag LOCUS_30420 91811 91398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 93424 92075 gene locus_tag LOCUS_30430 93424 92075 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 protein_id gnl|my_center|LOCUS_30430 93933 93475 gene locus_tag LOCUS_30440 93933 93475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 94549 94142 gene locus_tag LOCUS_30450 94549 94142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 95661 94654 gene locus_tag LOCUS_30460 95661 94654 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_30460 96129 95716 gene locus_tag LOCUS_30470 96129 95716 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016656.1 protein_id gnl|my_center|LOCUS_30470 96555 96169 gene locus_tag LOCUS_30480 96555 96169 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_30480 96738 97775 gene locus_tag LOCUS_30490 96738 97775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 98276 97785 gene locus_tag LOCUS_30500 98276 97785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334492.1 protein_id gnl|my_center|LOCUS_30500 99152 98553 gene locus_tag LOCUS_30510 99152 98553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 99502 99320 gene locus_tag LOCUS_30520 99502 99320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 99816 101114 gene locus_tag LOCUS_30530 99816 101114 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_30530 103818 101698 gene locus_tag LOCUS_30540 gene ppk 103818 101698 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULJ4 protein_id gnl|my_center|LOCUS_30540 105515 103899 gene locus_tag LOCUS_30550 105515 103899 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123565.1 protein_id gnl|my_center|LOCUS_30550 106534 105512 gene locus_tag LOCUS_30560 106534 105512 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_30560 106930 108402 gene locus_tag LOCUS_30570 106930 108402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056967.1 protein_id gnl|my_center|LOCUS_30570 108422 109216 gene locus_tag LOCUS_30580 108422 109216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 110684 109383 gene locus_tag LOCUS_30590 110684 109383 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_30590 111296 110982 gene locus_tag LOCUS_30600 111296 110982 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFY2 protein_id gnl|my_center|LOCUS_30600 112049 111306 gene locus_tag LOCUS_30610 gene ylmE 112049 111306 CDS product UPF0001 protein YlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31727 protein_id gnl|my_center|LOCUS_30610 112592 112200 gene locus_tag LOCUS_30620 112592 112200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 113389 112796 gene locus_tag LOCUS_30630 113389 112796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 113819 113430 gene locus_tag LOCUS_30640 113819 113430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 115336 114164 gene locus_tag LOCUS_30650 gene aroB 115336 114164 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK19 protein_id gnl|my_center|LOCUS_30650 115555 118896 gene locus_tag LOCUS_30660 gene mfd 115555 118896 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN7 protein_id gnl|my_center|LOCUS_30660 119082 120335 gene locus_tag LOCUS_30670 119082 120335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 120733 125733 gene locus_tag LOCUS_30680 120733 125733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 125981 126652 gene locus_tag LOCUS_30690 125981 126652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 127103 126669 gene locus_tag LOCUS_30700 127103 126669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 127387 127899 gene locus_tag LOCUS_30710 127387 127899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 127967 128509 gene locus_tag LOCUS_30720 gene ppa 127967 128509 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S122 protein_id gnl|my_center|LOCUS_30720 129815 128604 gene locus_tag LOCUS_30730 129815 128604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 130653 129985 gene locus_tag LOCUS_30740 130653 129985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 131170 130640 gene locus_tag LOCUS_30750 131170 130640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 132362 131565 gene locus_tag LOCUS_30760 132362 131565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 134096 132426 gene locus_tag LOCUS_30770 134096 132426 CDS product antibiotic hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_30770 134476 134549 gene locus_tag LOCUS_t00300 134476 134549 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 138040 135464 gene locus_tag LOCUS_30780 138040 135464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 138500 138243 gene locus_tag LOCUS_30790 138500 138243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 139488 138601 gene locus_tag LOCUS_30800 139488 138601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 140261 139689 gene locus_tag LOCUS_30810 140261 139689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 140478 140657 gene locus_tag LOCUS_30820 140478 140657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 140968 143358 gene locus_tag LOCUS_30830 140968 143358 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121671.1 protein_id gnl|my_center|LOCUS_30830 143394 144737 gene locus_tag LOCUS_30840 143394 144737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_30840 146182 144767 gene locus_tag LOCUS_30850 gene ykoK 146182 144767 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM21 protein_id gnl|my_center|LOCUS_30850 146629 146823 gene locus_tag LOCUS_30860 146629 146823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 146949 147407 gene locus_tag LOCUS_30870 146949 147407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 150800 147708 gene locus_tag LOCUS_30880 150800 147708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 151101 151027 gene locus_tag LOCUS_t00310 151101 151027 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 151286 152263 gene locus_tag LOCUS_30890 151286 152263 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_30890 152436 152759 gene locus_tag LOCUS_30900 152436 152759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 153293 154981 gene locus_tag LOCUS_30910 153293 154981 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503960.1 protein_id gnl|my_center|LOCUS_30910 155164 156444 gene locus_tag LOCUS_30920 gene serS 155164 156444 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXX6 protein_id gnl|my_center|LOCUS_30920 156754 159891 gene locus_tag LOCUS_30930 156754 159891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 160222 159914 gene locus_tag LOCUS_30940 160222 159914 CDS product quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160770.1 protein_id gnl|my_center|LOCUS_30940 160730 160329 gene locus_tag LOCUS_30950 160730 160329 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261952.1 protein_id gnl|my_center|LOCUS_30950 164496 160765 gene locus_tag LOCUS_30960 164496 160765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 164897 165175 gene locus_tag LOCUS_30970 164897 165175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 165383 167122 gene locus_tag LOCUS_30980 165383 167122 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_30980 167942 168586 gene locus_tag LOCUS_30990 167942 168586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 170038 168701 gene locus_tag LOCUS_31000 170038 168701 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence14 964 164 gene locus_tag LOCUS_31010 gene axeA 964 164 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120225.1 protein_id gnl|my_center|LOCUS_31010 1086 2000 gene locus_tag LOCUS_31020 1086 2000 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_31020 2900 2130 gene locus_tag LOCUS_31030 gene fabG 2900 2130 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 protein_id gnl|my_center|LOCUS_31030 3321 3755 gene locus_tag LOCUS_31040 3321 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 3898 5076 gene locus_tag LOCUS_31050 gene carA 3898 5076 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_31050 5277 5744 gene locus_tag LOCUS_31060 gene ndk 5277 5744 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK7 protein_id gnl|my_center|LOCUS_31060 6714 5836 gene locus_tag LOCUS_31070 gene sucD 6714 5836 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_31070 8019 6832 gene locus_tag LOCUS_31080 gene sucC 8019 6832 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI3 protein_id gnl|my_center|LOCUS_31080 8281 8712 gene locus_tag LOCUS_31090 gene fucU 8281 8712 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_31090 10487 9201 gene locus_tag LOCUS_31100 gene purA 10487 9201 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CQU5 protein_id gnl|my_center|LOCUS_31100 10730 11119 gene locus_tag LOCUS_31110 10730 11119 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120691.1 protein_id gnl|my_center|LOCUS_31110 11777 11343 gene locus_tag LOCUS_31120 11777 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 11927 12115 gene locus_tag LOCUS_31130 11927 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 12382 12119 gene locus_tag LOCUS_31140 12382 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 14695 12401 gene locus_tag LOCUS_31150 14695 12401 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_31150 15201 14695 gene locus_tag LOCUS_31160 15201 14695 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_31160 16142 15273 gene locus_tag LOCUS_31170 16142 15273 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_31170 16636 19638 gene locus_tag LOCUS_31180 gene putA 16636 19638 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_31180 20310 22220 gene locus_tag LOCUS_31190 20310 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 22208 24466 gene locus_tag LOCUS_31200 22208 24466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 24512 25405 gene locus_tag LOCUS_31210 24512 25405 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_31210 26877 25444 gene locus_tag LOCUS_31220 gene dnaB 26877 25444 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWY4 protein_id gnl|my_center|LOCUS_31220 27565 27059 gene locus_tag LOCUS_31230 gene rplI 27565 27059 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV4 protein_id gnl|my_center|LOCUS_31230 28147 27656 gene locus_tag LOCUS_31240 gene ssb 28147 27656 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66846 protein_id gnl|my_center|LOCUS_31240 28707 28231 gene locus_tag LOCUS_31250 28707 28231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 29409 28813 gene locus_tag LOCUS_31260 gene pth 29409 28813 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV0 protein_id gnl|my_center|LOCUS_31260 30047 29439 gene locus_tag LOCUS_31270 gene rplY 30047 29439 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU9 protein_id gnl|my_center|LOCUS_31270 30698 35389 gene locus_tag LOCUS_31280 30698 35389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 36161 36604 gene locus_tag LOCUS_31290 36161 36604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327803.1 protein_id gnl|my_center|LOCUS_31290 37924 36725 gene locus_tag LOCUS_31300 gene argJ 37924 36725 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUJ7 protein_id gnl|my_center|LOCUS_31300 38966 37953 gene locus_tag LOCUS_31310 gene argC 38966 37953 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVL4 protein_id gnl|my_center|LOCUS_31310 39481 40704 gene locus_tag LOCUS_31320 39481 40704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_31320 40789 41841 gene locus_tag LOCUS_31330 40789 41841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_31330 41902 43059 gene locus_tag LOCUS_31340 41902 43059 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_31340 43195 43671 gene locus_tag LOCUS_31350 gene greA 43195 43671 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA0 protein_id gnl|my_center|LOCUS_31350 44119 43775 gene locus_tag LOCUS_31360 44119 43775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 45792 44458 gene locus_tag LOCUS_31370 45792 44458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582879.1 protein_id gnl|my_center|LOCUS_31370 46399 45953 gene locus_tag LOCUS_31380 46399 45953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 47476 46526 gene locus_tag LOCUS_31390 47476 46526 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122231.1 protein_id gnl|my_center|LOCUS_31390 48435 48109 gene locus_tag LOCUS_31400 48435 48109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 50974 48941 gene locus_tag LOCUS_31410 50974 48941 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119758.1 protein_id gnl|my_center|LOCUS_31410 51224 52489 gene locus_tag LOCUS_31420 51224 52489 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122959.1 protein_id gnl|my_center|LOCUS_31420 52707 53156 gene locus_tag LOCUS_31430 52707 53156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 53520 53173 gene locus_tag LOCUS_31440 53520 53173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 54183 53827 gene locus_tag LOCUS_31450 gene rplT 54183 53827 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP74 protein_id gnl|my_center|LOCUS_31450 54467 54267 gene locus_tag LOCUS_31460 gene rpmI 54467 54267 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189N0 protein_id gnl|my_center|LOCUS_31460 55931 54879 gene locus_tag LOCUS_31470 55931 54879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 57271 56006 gene locus_tag LOCUS_31480 gene proA 57271 56006 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNV2 protein_id gnl|my_center|LOCUS_31480 58056 57532 gene locus_tag LOCUS_31490 58056 57532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 59373 58144 gene locus_tag LOCUS_31500 gene gdhA 59373 58144 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPH7 protein_id gnl|my_center|LOCUS_31500 60960 59740 gene locus_tag LOCUS_31510 60960 59740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 61206 62411 gene locus_tag LOCUS_31520 gene pepT 61206 62411 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121827.1 protein_id gnl|my_center|LOCUS_31520 62448 63344 gene locus_tag LOCUS_31530 62448 63344 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_31530 63344 65257 gene locus_tag LOCUS_31540 gene dxs 63344 65257 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB7 protein_id gnl|my_center|LOCUS_31540 65314 66714 gene locus_tag LOCUS_31550 65314 66714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 67046 67927 gene locus_tag LOCUS_31560 67046 67927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 70196 67968 gene locus_tag LOCUS_31570 70196 67968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072834.1 protein_id gnl|my_center|LOCUS_31570 72044 70347 gene locus_tag LOCUS_31580 72044 70347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057740.1 protein_id gnl|my_center|LOCUS_31580 73111 72101 gene locus_tag LOCUS_31590 73111 72101 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_31590 73658 73476 gene locus_tag LOCUS_31600 73658 73476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 73624 74238 gene locus_tag LOCUS_31610 73624 74238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 74655 76718 gene locus_tag LOCUS_31620 gene prc 74655 76718 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_31620 76951 78027 gene locus_tag LOCUS_31630 gene pyr 76951 78027 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389462.1 protein_id gnl|my_center|LOCUS_31630 78128 79159 gene locus_tag LOCUS_31640 78128 79159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120248.1 protein_id gnl|my_center|LOCUS_31640 79240 80064 gene locus_tag LOCUS_31650 79240 80064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120864.1 protein_id gnl|my_center|LOCUS_31650 80477 81727 gene locus_tag LOCUS_31660 80477 81727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 82015 81749 gene locus_tag LOCUS_31670 82015 81749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 82549 83589 gene locus_tag LOCUS_31680 82549 83589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 84819 83722 gene locus_tag LOCUS_31690 gene gcvT 84819 83722 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZV9 protein_id gnl|my_center|LOCUS_31690 85815 85054 gene locus_tag LOCUS_31700 85815 85054 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_31700 87746 85815 gene locus_tag LOCUS_31710 gene sdhA 87746 85815 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_31710 88565 87822 gene locus_tag LOCUS_31720 88565 87822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_31720 91244 88953 gene locus_tag LOCUS_31730 gene rnr 91244 88953 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR0 protein_id gnl|my_center|LOCUS_31730 92220 91249 gene locus_tag LOCUS_31740 92220 91249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_31740 92699 94453 gene locus_tag LOCUS_31750 gene proS 92699 94453 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D59 protein_id gnl|my_center|LOCUS_31750 95224 94556 gene locus_tag LOCUS_31760 95224 94556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 96799 95333 gene locus_tag LOCUS_31770 96799 95333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 97494 96958 gene locus_tag LOCUS_31780 97494 96958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 98986 97925 gene locus_tag LOCUS_31790 98986 97925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 99991 99530 gene locus_tag LOCUS_31800 99991 99530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 100283 99942 gene locus_tag LOCUS_31810 100283 99942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 100410 102038 gene locus_tag LOCUS_31820 100410 102038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 102909 102064 gene locus_tag LOCUS_31830 102909 102064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 103107 104228 gene locus_tag LOCUS_31840 gene rfe 103107 104228 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 protein_id gnl|my_center|LOCUS_31840 104225 106639 gene locus_tag LOCUS_31850 104225 106639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 106759 108012 gene locus_tag LOCUS_31860 106759 108012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121147.1 protein_id gnl|my_center|LOCUS_31860 108205 109899 gene locus_tag LOCUS_31870 108205 109899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 109952 110518 gene locus_tag LOCUS_31880 109952 110518 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762860.1 protein_id gnl|my_center|LOCUS_31880 110807 111883 gene locus_tag LOCUS_31890 gene recA 110807 111883 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJJ0 protein_id gnl|my_center|LOCUS_31890 112085 113695 gene locus_tag LOCUS_31900 gene htrA 112085 113695 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880939.1 protein_id gnl|my_center|LOCUS_31900 113692 116319 gene locus_tag LOCUS_31910 gene alaS 113692 116319 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFH9 protein_id gnl|my_center|LOCUS_31910 117359 116334 gene locus_tag LOCUS_31920 gene dapA 117359 116334 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_31920 119610 117451 gene locus_tag LOCUS_31930 119610 117451 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_31930 121022 119748 gene locus_tag LOCUS_31940 121022 119748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 121699 121106 gene locus_tag LOCUS_31950 121699 121106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 124074 122242 gene locus_tag LOCUS_31960 gene mnmG 124074 122242 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULV7 protein_id gnl|my_center|LOCUS_31960 125184 124114 gene locus_tag LOCUS_31970 gene ruvB 125184 124114 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPG4 protein_id gnl|my_center|LOCUS_31970 126337 125330 gene locus_tag LOCUS_31980 126337 125330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121463.1 protein_id gnl|my_center|LOCUS_31980 127120 126368 gene locus_tag LOCUS_31990 127120 126368 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2P4 protein_id gnl|my_center|LOCUS_31990 129505 127232 gene locus_tag LOCUS_32000 129505 127232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 130683 129748 gene locus_tag LOCUS_32010 130683 129748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 131181 130771 gene locus_tag LOCUS_32020 gene rbfA 131181 130771 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR1 protein_id gnl|my_center|LOCUS_32020 133976 131217 gene locus_tag LOCUS_32030 gene infB 133976 131217 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR0 protein_id gnl|my_center|LOCUS_32030 135653 134127 gene locus_tag LOCUS_32040 gene nusA 135653 134127 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URQ7 protein_id gnl|my_center|LOCUS_32040 136428 137846 gene locus_tag LOCUS_32050 136428 137846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 139370 138069 gene locus_tag LOCUS_32060 139370 138069 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_32060 141027 139783 gene locus_tag LOCUS_32070 gene fabF 141027 139783 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY0 protein_id gnl|my_center|LOCUS_32070 141345 141112 gene locus_tag LOCUS_32080 gene acpP 141345 141112 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67611 protein_id gnl|my_center|LOCUS_32080 142593 141736 gene locus_tag LOCUS_32090 gene fabD 142593 141736 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY3 protein_id gnl|my_center|LOCUS_32090 143693 142692 gene locus_tag LOCUS_32100 gene plsX 143693 142692 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_32100 143879 143700 gene locus_tag LOCUS_32110 143879 143700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 144281 145402 gene locus_tag LOCUS_32120 144281 145402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 146582 145410 gene locus_tag LOCUS_32130 146582 145410 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119138.1 protein_id gnl|my_center|LOCUS_32130 147826 146774 gene locus_tag LOCUS_32140 147826 146774 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120424.1 protein_id gnl|my_center|LOCUS_32140 148284 147898 gene locus_tag LOCUS_32150 148284 147898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 148664 149161 gene locus_tag LOCUS_32160 148664 149161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 149178 149435 gene locus_tag LOCUS_32170 149178 149435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 151848 149470 gene locus_tag LOCUS_32180 151848 149470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 152829 153800 gene locus_tag LOCUS_32190 152829 153800 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_32190 153896 154312 gene locus_tag LOCUS_32200 153896 154312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119281.1 protein_id gnl|my_center|LOCUS_32200 155425 154397 gene locus_tag LOCUS_32210 155425 154397 CDS product ferric enterobactin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123377.1 protein_id gnl|my_center|LOCUS_32210 155734 156165 gene locus_tag LOCUS_32220 gene osmC 155734 156165 CDS product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_32220 156537 156722 gene locus_tag LOCUS_32230 156537 156722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 156727 157131 gene locus_tag LOCUS_32240 156727 157131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 157360 158505 gene locus_tag LOCUS_32250 157360 158505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 158524 158919 gene locus_tag LOCUS_32260 158524 158919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 159050 160288 gene locus_tag LOCUS_32270 159050 160288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 160304 160723 gene locus_tag LOCUS_32280 160304 160723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 160924 162126 gene locus_tag LOCUS_32290 160924 162126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 162129 162530 gene locus_tag LOCUS_32300 162129 162530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence15 1503 406 gene locus_tag LOCUS_32310 1503 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120226.1 protein_id gnl|my_center|LOCUS_32310 1710 2924 gene locus_tag LOCUS_32320 1710 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 3052 3270 gene locus_tag LOCUS_32330 3052 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 4641 3229 gene locus_tag LOCUS_32340 4641 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_32340 4784 6004 gene locus_tag LOCUS_32350 4784 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 6045 7487 gene locus_tag LOCUS_32360 6045 7487 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122874.1 protein_id gnl|my_center|LOCUS_32360 7785 8684 gene locus_tag LOCUS_32370 7785 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 8756 9646 gene locus_tag LOCUS_32380 8756 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 9723 10529 gene locus_tag LOCUS_32390 9723 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 14450 10587 gene locus_tag LOCUS_32400 14450 10587 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120793.1 protein_id gnl|my_center|LOCUS_32400 14692 15021 gene locus_tag LOCUS_32410 14692 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 15061 15264 gene locus_tag LOCUS_32420 15061 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 15350 16330 gene locus_tag LOCUS_32430 15350 16330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 16479 17144 gene locus_tag LOCUS_32440 16479 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 17199 17546 gene locus_tag LOCUS_32450 17199 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 17641 18561 gene locus_tag LOCUS_32460 17641 18561 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_32460 18661 19173 gene locus_tag LOCUS_32470 18661 19173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 19209 20096 gene locus_tag LOCUS_32480 19209 20096 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_32480 20362 21348 gene locus_tag LOCUS_32490 20362 21348 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_32490 21561 21947 gene locus_tag LOCUS_32500 21561 21947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 22340 22783 gene locus_tag LOCUS_32510 22340 22783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 22853 23791 gene locus_tag LOCUS_32520 22853 23791 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122231.1 protein_id gnl|my_center|LOCUS_32520 23992 24354 gene locus_tag LOCUS_32530 23992 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 24556 25098 gene locus_tag LOCUS_32540 24556 25098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 25328 27124 gene locus_tag LOCUS_32550 25328 27124 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 protein_id gnl|my_center|LOCUS_32550 27502 27945 gene locus_tag LOCUS_32560 27502 27945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 28013 28942 gene locus_tag LOCUS_32570 28013 28942 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_32570 29186 29779 gene locus_tag LOCUS_32580 29186 29779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 29907 30311 gene locus_tag LOCUS_32590 29907 30311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 30420 30851 gene locus_tag LOCUS_32600 30420 30851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 31421 31765 gene locus_tag LOCUS_32610 31421 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 31829 32626 gene locus_tag LOCUS_32620 31829 32626 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067428.1 protein_id gnl|my_center|LOCUS_32620 33706 32705 gene locus_tag LOCUS_32630 33706 32705 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_32630 34381 33746 gene locus_tag LOCUS_32640 34381 33746 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_32640 35319 34378 gene locus_tag LOCUS_32650 gene pyrF 35319 34378 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_32650 35597 36511 gene locus_tag LOCUS_32660 35597 36511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 37955 37215 gene locus_tag LOCUS_32670 37955 37215 CDS product pectinesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119462.1 protein_id gnl|my_center|LOCUS_32670 38301 39557 gene locus_tag LOCUS_32680 38301 39557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_32680 39842 40642 gene locus_tag LOCUS_32690 39842 40642 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_32690 41176 44046 gene locus_tag LOCUS_32700 41176 44046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 44652 44047 gene locus_tag LOCUS_32710 44652 44047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 45327 44758 gene locus_tag LOCUS_32720 45327 44758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 46060 45497 gene locus_tag LOCUS_32730 46060 45497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 46467 46796 gene locus_tag LOCUS_32740 46467 46796 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_32740 47331 47543 gene locus_tag LOCUS_32750 gene csrA 47331 47543 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_32750 47726 47800 gene locus_tag LOCUS_t00320 47726 47800 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 49035 47815 gene locus_tag LOCUS_32760 49035 47815 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_32760 49231 50337 gene locus_tag LOCUS_32770 49231 50337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_32770 50391 51671 gene locus_tag LOCUS_32780 gene mutY 50391 51671 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_32780 53488 53006 gene locus_tag LOCUS_32790 53488 53006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 55789 54416 gene locus_tag LOCUS_32800 gene strI 55789 54416 CDS product streptomycin biosynthesis protein StrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_32800 56951 56124 gene locus_tag LOCUS_32810 56951 56124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_32810 57660 58523 gene locus_tag LOCUS_32820 57660 58523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 59035 58619 gene locus_tag LOCUS_32830 59035 58619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 59721 60935 gene locus_tag LOCUS_32840 59721 60935 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_32840 62448 61024 gene locus_tag LOCUS_32850 62448 61024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 62553 62825 gene locus_tag LOCUS_32860 62553 62825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 62996 63673 gene locus_tag LOCUS_32870 62996 63673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 63791 64672 gene locus_tag LOCUS_32880 gene lpxC 63791 64672 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ2 protein_id gnl|my_center|LOCUS_32880 64757 65623 gene locus_tag LOCUS_32890 gene lpxA 64757 65623 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ1 protein_id gnl|my_center|LOCUS_32890 65620 66696 gene locus_tag LOCUS_32900 gene gnnA 65620 66696 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_32900 67235 66750 gene locus_tag LOCUS_32910 67235 66750 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109808.1 protein_id gnl|my_center|LOCUS_32910 68922 67417 gene locus_tag LOCUS_32920 68922 67417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 69197 70090 gene locus_tag LOCUS_32930 gene purC 69197 70090 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ19 protein_id gnl|my_center|LOCUS_32930 70314 71783 gene locus_tag LOCUS_32940 70314 71783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 71878 74286 gene locus_tag LOCUS_32950 71878 74286 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_32950 75518 74304 gene locus_tag LOCUS_32960 75518 74304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 75737 76714 gene locus_tag LOCUS_32970 75737 76714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_32970 78282 76783 gene locus_tag LOCUS_32980 gene trkH 78282 76783 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121515.1 protein_id gnl|my_center|LOCUS_32980 78494 80440 gene locus_tag LOCUS_32990 78494 80440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122005.1 protein_id gnl|my_center|LOCUS_32990 80474 81040 gene locus_tag LOCUS_33000 80474 81040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_33000 82431 81112 gene locus_tag LOCUS_33010 82431 81112 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_33010 84831 82741 gene locus_tag LOCUS_33020 84831 82741 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_33020 85111 86148 gene locus_tag LOCUS_33030 85111 86148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121358.1 protein_id gnl|my_center|LOCUS_33030 86235 86648 gene locus_tag LOCUS_33040 86235 86648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 86705 87763 gene locus_tag LOCUS_33050 86705 87763 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_33050 87803 88780 gene locus_tag LOCUS_33060 87803 88780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 88879 90273 gene locus_tag LOCUS_33070 88879 90273 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_33070 90281 90727 gene locus_tag LOCUS_33080 90281 90727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 91568 90747 gene locus_tag LOCUS_33090 gene trpA 91568 90747 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URN0 protein_id gnl|my_center|LOCUS_33090 92842 91637 gene locus_tag LOCUS_33100 gene trpB 92842 91637 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG9 protein_id gnl|my_center|LOCUS_33100 93156 93359 gene locus_tag LOCUS_33110 93156 93359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 95649 93382 gene locus_tag LOCUS_33120 95649 93382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 96657 95767 gene locus_tag LOCUS_33130 gene nadC 96657 95767 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_33130 96826 97935 gene locus_tag LOCUS_33140 gene ald 96826 97935 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXF1 protein_id gnl|my_center|LOCUS_33140 113342 98004 gene locus_tag LOCUS_33150 113342 98004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 113956 115353 gene locus_tag LOCUS_33160 113956 115353 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_33160 115581 117125 gene locus_tag LOCUS_33170 gene hldE 115581 117125 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF6 protein_id gnl|my_center|LOCUS_33170 117122 118186 gene locus_tag LOCUS_33180 117122 118186 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_33180 119453 118194 gene locus_tag LOCUS_33190 119453 118194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 120313 119561 gene locus_tag LOCUS_33200 120313 119561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 120531 121289 gene locus_tag LOCUS_33210 120531 121289 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_33210 121297 122118 gene locus_tag LOCUS_33220 121297 122118 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_33220 123946 122153 gene locus_tag LOCUS_33230 123946 122153 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123572.1 protein_id gnl|my_center|LOCUS_33230 124287 125378 gene locus_tag LOCUS_33240 gene ychF 124287 125378 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ1 protein_id gnl|my_center|LOCUS_33240 125559 126623 gene locus_tag LOCUS_33250 gene hisC 125559 126623 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC3 protein_id gnl|my_center|LOCUS_33250 126817 127404 gene locus_tag LOCUS_33260 gene hisB 126817 127404 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33564 protein_id gnl|my_center|LOCUS_33260 128823 128146 gene locus_tag LOCUS_33270 128823 128146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 130344 128998 gene locus_tag LOCUS_33280 130344 128998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_33280 132713 130341 gene locus_tag LOCUS_33290 132713 130341 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 protein_id gnl|my_center|LOCUS_33290 133206 134522 gene locus_tag LOCUS_33300 133206 134522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 134583 136121 gene locus_tag LOCUS_33310 134583 136121 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_33310 138355 136862 gene locus_tag LOCUS_33320 138355 136862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 138781 138563 gene locus_tag LOCUS_33330 138781 138563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 138689 139408 gene locus_tag LOCUS_33340 gene lgt 138689 139408 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_33340 139723 140307 gene locus_tag LOCUS_33350 139723 140307 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335404.1 protein_id gnl|my_center|LOCUS_33350 140537 140304 gene locus_tag LOCUS_33360 140537 140304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 141402 140425 gene locus_tag LOCUS_33370 141402 140425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 141834 144428 gene locus_tag LOCUS_33380 141834 144428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 146054 144429 gene locus_tag LOCUS_33390 gene nuoM 146054 144429 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222463.1 protein_id gnl|my_center|LOCUS_33390 148002 146116 gene locus_tag LOCUS_33400 148002 146116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 148327 147995 gene locus_tag LOCUS_33410 148327 147995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 149124 148330 gene locus_tag LOCUS_33420 149124 148330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 150162 149158 gene locus_tag LOCUS_33430 150162 149158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 150620 150162 gene locus_tag LOCUS_33440 150620 150162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 150757 151080 gene locus_tag LOCUS_33450 150757 151080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 151092 151472 gene locus_tag LOCUS_33460 151092 151472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 151575 152042 gene locus_tag LOCUS_33470 151575 152042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 153926 152058 gene locus_tag LOCUS_33480 153926 152058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 154183 155853 gene locus_tag LOCUS_33490 gene noxA 154183 155853 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122081.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence16 708 1673 gene locus_tag LOCUS_33500 708 1673 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_33500 1838 2248 gene locus_tag LOCUS_33510 1838 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2541 2825 gene locus_tag LOCUS_33520 2541 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3010 3369 gene locus_tag LOCUS_33530 3010 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3538 4728 gene locus_tag LOCUS_33540 3538 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 5278 5712 gene locus_tag LOCUS_33550 5278 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 5847 6875 gene locus_tag LOCUS_33560 5847 6875 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_33560 7132 8784 gene locus_tag LOCUS_33570 7132 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 10650 8791 gene locus_tag LOCUS_33580 10650 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 11354 10722 gene locus_tag LOCUS_33590 11354 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 11704 11414 gene locus_tag LOCUS_33600 11704 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 12054 13700 gene locus_tag LOCUS_33610 gene nanT 12054 13700 CDS product acetylneuraminate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 protein_id gnl|my_center|LOCUS_33610 13708 14454 gene locus_tag LOCUS_33620 13708 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 15648 14455 gene locus_tag LOCUS_33630 15648 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 16091 16777 gene locus_tag LOCUS_33640 16091 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 16853 18691 gene locus_tag LOCUS_33650 gene asnB 16853 18691 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545305.1 protein_id gnl|my_center|LOCUS_33650 18734 19420 gene locus_tag LOCUS_33660 18734 19420 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140461.1 protein_id gnl|my_center|LOCUS_33660 19706 21022 gene locus_tag LOCUS_33670 19706 21022 CDS product O-antigen biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816144.1 protein_id gnl|my_center|LOCUS_33670 21413 21649 gene locus_tag LOCUS_33680 21413 21649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 21627 21980 gene locus_tag LOCUS_33690 21627 21980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 21980 23497 gene locus_tag LOCUS_33700 21980 23497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039036.1 protein_id gnl|my_center|LOCUS_33700 23497 24330 gene locus_tag LOCUS_33710 23497 24330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 24701 25633 gene locus_tag LOCUS_33720 gene uxs 24701 25633 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_33720 25642 26655 gene locus_tag LOCUS_33730 25642 26655 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_33730 27502 26681 gene locus_tag LOCUS_33740 gene punA 27502 26681 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ11 protein_id gnl|my_center|LOCUS_33740 27988 27671 gene locus_tag LOCUS_33750 27988 27671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 29576 28536 gene locus_tag LOCUS_33760 29576 28536 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_33760 30809 29631 gene locus_tag LOCUS_33770 30809 29631 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_33770 31066 31809 gene locus_tag LOCUS_33780 gene wcaA 31066 31809 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124718.1 protein_id gnl|my_center|LOCUS_33780 31773 32471 gene locus_tag LOCUS_33790 31773 32471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404594.1 protein_id gnl|my_center|LOCUS_33790 33322 32489 gene locus_tag LOCUS_33800 33322 32489 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8E6 protein_id gnl|my_center|LOCUS_33800 34766 33369 gene locus_tag LOCUS_33810 34766 33369 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_33810 35735 34785 gene locus_tag LOCUS_33820 35735 34785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 37007 35778 gene locus_tag LOCUS_33830 37007 35778 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_33830 38895 37342 gene locus_tag LOCUS_33840 38895 37342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119516.1 protein_id gnl|my_center|LOCUS_33840 40251 39175 gene locus_tag LOCUS_33850 gene tilS 40251 39175 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE1 protein_id gnl|my_center|LOCUS_33850 40680 40937 gene locus_tag LOCUS_33860 40680 40937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 41236 42783 gene locus_tag LOCUS_33870 gene rny 41236 42783 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE3 protein_id gnl|my_center|LOCUS_33870 43429 42806 gene locus_tag LOCUS_33880 43429 42806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807705.1 protein_id gnl|my_center|LOCUS_33880 43623 43988 gene locus_tag LOCUS_33890 43623 43988 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_33890 44494 44042 gene locus_tag LOCUS_33900 gene phnB 44494 44042 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_33900 44685 46496 gene locus_tag LOCUS_33910 44685 46496 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_33910 47390 46509 gene locus_tag LOCUS_33920 47390 46509 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118351.1 protein_id gnl|my_center|LOCUS_33920 47638 48585 gene locus_tag LOCUS_33930 gene rpoD 47638 48585 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118349.1 protein_id gnl|my_center|LOCUS_33930 48582 49034 gene locus_tag LOCUS_33940 48582 49034 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123244.1 protein_id gnl|my_center|LOCUS_33940 49034 50368 gene locus_tag LOCUS_33950 49034 50368 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889265.1 protein_id gnl|my_center|LOCUS_33950 50368 51066 gene locus_tag LOCUS_33960 50368 51066 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_33960 51063 52376 gene locus_tag LOCUS_33970 51063 52376 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_33970 52373 53167 gene locus_tag LOCUS_33980 52373 53167 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_33980 53164 54282 gene locus_tag LOCUS_33990 53164 54282 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_33990 54564 57224 gene locus_tag LOCUS_34000 54564 57224 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120914.1 protein_id gnl|my_center|LOCUS_34000 57227 58654 gene locus_tag LOCUS_34010 57227 58654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120913.1 protein_id gnl|my_center|LOCUS_34010 62398 58685 gene locus_tag LOCUS_34020 62398 58685 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_34020 64273 62588 gene locus_tag LOCUS_34030 64273 62588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 68531 64410 gene locus_tag LOCUS_34040 68531 64410 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRT4 protein_id gnl|my_center|LOCUS_34040 69490 68972 gene locus_tag LOCUS_34050 69490 68972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769876.1 protein_id gnl|my_center|LOCUS_34050 69876 69544 gene locus_tag LOCUS_34060 69876 69544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722968.1 protein_id gnl|my_center|LOCUS_34060 70767 69994 gene locus_tag LOCUS_34070 70767 69994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 71108 72202 gene locus_tag LOCUS_34080 71108 72202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_34080 72409 75186 gene locus_tag LOCUS_34090 72409 75186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 75542 75615 gene locus_tag LOCUS_t00330 75542 75615 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 75687 75758 gene locus_tag LOCUS_t00340 75687 75758 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 75781 75854 gene locus_tag LOCUS_t00350 75781 75854 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 75887 75958 gene locus_tag LOCUS_t00360 75887 75958 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 75968 76044 gene locus_tag LOCUS_t00370 75968 76044 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 76083 76158 gene locus_tag LOCUS_t00380 76083 76158 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 76194 76265 gene locus_tag LOCUS_t00390 76194 76265 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 76286 76360 gene locus_tag LOCUS_t00400 76286 76360 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 76373 76448 gene locus_tag LOCUS_t00410 76373 76448 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 76457 76535 gene locus_tag LOCUS_t00420 76457 76535 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 76631 76714 gene locus_tag LOCUS_t00430 76631 76714 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 76735 76818 gene locus_tag LOCUS_t00440 76735 76818 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77017 77595 gene locus_tag LOCUS_34100 77017 77595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 77627 78409 gene locus_tag LOCUS_34110 77627 78409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117701.1 protein_id gnl|my_center|LOCUS_34110 78440 79222 gene locus_tag LOCUS_34120 78440 79222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 80723 79284 gene locus_tag LOCUS_34130 gene katA 80723 79284 CDS product catalase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95631 protein_id gnl|my_center|LOCUS_34130 81837 80941 gene locus_tag LOCUS_34140 81837 80941 CDS product hyalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119128.1 protein_id gnl|my_center|LOCUS_34140 86934 81997 gene locus_tag LOCUS_34150 86934 81997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 87389 90532 gene locus_tag LOCUS_34160 87389 90532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 90614 92074 gene locus_tag LOCUS_34170 90614 92074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124058.1 protein_id gnl|my_center|LOCUS_34170 92393 95194 gene locus_tag LOCUS_34180 92393 95194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 95356 96234 gene locus_tag LOCUS_34190 95356 96234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124104.1 protein_id gnl|my_center|LOCUS_34190 96436 97107 gene locus_tag LOCUS_34200 96436 97107 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_34200 97104 98267 gene locus_tag LOCUS_34210 97104 98267 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122038.1 protein_id gnl|my_center|LOCUS_34210 98296 99399 gene locus_tag LOCUS_34220 gene chsA 98296 99399 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 protein_id gnl|my_center|LOCUS_34220 101687 99396 gene locus_tag LOCUS_34230 101687 99396 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119225.1 protein_id gnl|my_center|LOCUS_34230 102538 101762 gene locus_tag LOCUS_34240 102538 101762 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084036.1 protein_id gnl|my_center|LOCUS_34240 103442 102573 gene locus_tag LOCUS_34250 103442 102573 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_34250 104167 103502 gene locus_tag LOCUS_34260 104167 103502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 104376 104810 gene locus_tag LOCUS_34270 104376 104810 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331759.1 protein_id gnl|my_center|LOCUS_34270 104807 105886 gene locus_tag LOCUS_34280 104807 105886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124103.1 protein_id gnl|my_center|LOCUS_34280 106227 108467 gene locus_tag LOCUS_34290 gene butB 106227 108467 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122380.1 protein_id gnl|my_center|LOCUS_34290 108637 110847 gene locus_tag LOCUS_34300 108637 110847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 110850 112271 gene locus_tag LOCUS_34310 110850 112271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_34310 113707 112277 gene locus_tag LOCUS_34320 113707 112277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584110.1 protein_id gnl|my_center|LOCUS_34320 114227 114415 gene locus_tag LOCUS_34330 114227 114415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 114419 114862 gene locus_tag LOCUS_34340 114419 114862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34340 114859 115623 gene locus_tag LOCUS_34350 114859 115623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34350 117112 115670 gene locus_tag LOCUS_34360 gene cls 117112 115670 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_34360 117275 118111 gene locus_tag LOCUS_34370 117275 118111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 118276 119400 gene locus_tag LOCUS_34380 gene acrE 118276 119400 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_34380 119390 122734 gene locus_tag LOCUS_34390 119390 122734 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_34390 122842 124218 gene locus_tag LOCUS_34400 122842 124218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_34400 124539 127142 gene locus_tag LOCUS_34410 124539 127142 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123804.1 protein_id gnl|my_center|LOCUS_34410 127178 128656 gene locus_tag LOCUS_34420 127178 128656 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_34420 129919 128711 gene locus_tag LOCUS_34430 129919 128711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 130549 130370 gene locus_tag LOCUS_34440 130549 130370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 130798 133866 gene locus_tag LOCUS_34450 130798 133866 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122121.1 protein_id gnl|my_center|LOCUS_34450 133879 135285 gene locus_tag LOCUS_34460 133879 135285 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121859.1 protein_id gnl|my_center|LOCUS_34460 136107 135334 gene locus_tag LOCUS_34470 136107 135334 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_34470 136406 138085 gene locus_tag LOCUS_34480 136406 138085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 138130 139389 gene locus_tag LOCUS_34490 138130 139389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_34490 139386 140459 gene locus_tag LOCUS_34500 139386 140459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 141894 140476 gene locus_tag LOCUS_34510 141894 140476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 142214 144397 gene locus_tag LOCUS_34520 142214 144397 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121109.1 protein_id gnl|my_center|LOCUS_34520 144482 145126 gene locus_tag LOCUS_34530 144482 145126 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258321.1 protein_id gnl|my_center|LOCUS_34530 145532 145212 gene locus_tag LOCUS_34540 145532 145212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 146110 145679 gene locus_tag LOCUS_34550 146110 145679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 146595 146158 gene locus_tag LOCUS_34560 gene cdd 146595 146158 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 protein_id gnl|my_center|LOCUS_34560 147250 146825 gene locus_tag LOCUS_34570 147250 146825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 148229 148957 gene locus_tag LOCUS_34580 148229 148957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119681.1 protein_id gnl|my_center|LOCUS_34580 149008 149994 gene locus_tag LOCUS_34590 149008 149994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence17 230 859 gene locus_tag LOCUS_34600 230 859 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118831.1 protein_id gnl|my_center|LOCUS_34600 1035 1235 gene locus_tag LOCUS_34610 1035 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 1552 2634 gene locus_tag LOCUS_34620 1552 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2698 4752 gene locus_tag LOCUS_34630 2698 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 5642 6871 gene locus_tag LOCUS_34640 5642 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 6946 6873 gene locus_tag LOCUS_t00450 6946 6873 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8610 7210 gene locus_tag LOCUS_34650 8610 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122307.1 protein_id gnl|my_center|LOCUS_34650 9065 10015 gene locus_tag LOCUS_34660 9065 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 11051 10029 gene locus_tag LOCUS_34670 11051 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 11799 11467 gene locus_tag LOCUS_34680 11799 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 11872 13257 gene locus_tag LOCUS_34690 11872 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 13548 14492 gene locus_tag LOCUS_34700 gene ytaP 13548 14492 CDS product putative hydrolase YtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34973 protein_id gnl|my_center|LOCUS_34700 14516 15643 gene locus_tag LOCUS_34710 gene argE 14516 15643 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122153.1 protein_id gnl|my_center|LOCUS_34710 16843 15659 gene locus_tag LOCUS_34720 16843 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 17160 17438 gene locus_tag LOCUS_34730 17160 17438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 18866 17541 gene locus_tag LOCUS_34740 18866 17541 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_34740 19192 20796 gene locus_tag LOCUS_34750 19192 20796 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893877.1 protein_id gnl|my_center|LOCUS_34750 21155 20784 gene locus_tag LOCUS_34760 21155 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 22337 21234 gene locus_tag LOCUS_34770 22337 21234 CDS product tRNA adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123874.1 protein_id gnl|my_center|LOCUS_34770 24626 22476 gene locus_tag LOCUS_34780 24626 22476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 25702 24950 gene locus_tag LOCUS_34790 25702 24950 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393468.1 protein_id gnl|my_center|LOCUS_34790 26032 25754 gene locus_tag LOCUS_34800 26032 25754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 26767 26060 gene locus_tag LOCUS_34810 26767 26060 CDS product molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948647.1 protein_id gnl|my_center|LOCUS_34810 27772 26828 gene locus_tag LOCUS_34820 gene modB 27772 26828 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948646.1 protein_id gnl|my_center|LOCUS_34820 29346 27769 gene locus_tag LOCUS_34830 29346 27769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 30143 29454 gene locus_tag LOCUS_34840 30143 29454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755963.1 protein_id gnl|my_center|LOCUS_34840 31435 30155 gene locus_tag LOCUS_34850 31435 30155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817388.1 protein_id gnl|my_center|LOCUS_34850 32773 31496 gene locus_tag LOCUS_34860 32773 31496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 33748 33284 gene locus_tag LOCUS_34870 33748 33284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 34789 33800 gene locus_tag LOCUS_34880 34789 33800 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_34880 35445 35170 gene locus_tag LOCUS_34890 35445 35170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 35799 35572 gene locus_tag LOCUS_34900 35799 35572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 37428 36268 gene locus_tag LOCUS_34910 37428 36268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_34910 38654 37785 gene locus_tag LOCUS_34920 gene cheR 38654 37785 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_34920 39697 38642 gene locus_tag LOCUS_34930 gene cheB1 39697 38642 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 protein_id gnl|my_center|LOCUS_34930 40062 39694 gene locus_tag LOCUS_34940 gene cheY 40062 39694 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 protein_id gnl|my_center|LOCUS_34940 43300 40391 gene locus_tag LOCUS_34950 43300 40391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 43817 43341 gene locus_tag LOCUS_34960 gene cheW 43817 43341 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083224.1 protein_id gnl|my_center|LOCUS_34960 46489 43814 gene locus_tag LOCUS_34970 46489 43814 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 protein_id gnl|my_center|LOCUS_34970 47000 48019 gene locus_tag LOCUS_34980 47000 48019 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH8 protein_id gnl|my_center|LOCUS_34980 48356 49000 gene locus_tag LOCUS_34990 48356 49000 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_34990 49016 49690 gene locus_tag LOCUS_35000 49016 49690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 49692 50549 gene locus_tag LOCUS_35010 gene accD 49692 50549 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX0 protein_id gnl|my_center|LOCUS_35010 50726 51835 gene locus_tag LOCUS_35020 50726 51835 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_35020 51916 53886 gene locus_tag LOCUS_35030 gene pcrA 51916 53886 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR6 protein_id gnl|my_center|LOCUS_35030 55771 53903 gene locus_tag LOCUS_35040 55771 53903 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_35040 56002 56730 gene locus_tag LOCUS_35050 56002 56730 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002313134.1 protein_id gnl|my_center|LOCUS_35050 56998 57321 gene locus_tag LOCUS_35060 56998 57321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_35060 57378 58604 gene locus_tag LOCUS_35070 gene pyrC 57378 58604 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F061 protein_id gnl|my_center|LOCUS_35070 61742 58767 gene locus_tag LOCUS_35080 61742 58767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 62193 61840 gene locus_tag LOCUS_35090 62193 61840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 63505 62387 gene locus_tag LOCUS_35100 gene tgt 63505 62387 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_35100 64553 63570 gene locus_tag LOCUS_35110 gene hofF 64553 63570 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123458.1 protein_id gnl|my_center|LOCUS_35110 64810 65607 gene locus_tag LOCUS_35120 gene fabI 64810 65607 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_35120 66358 65711 gene locus_tag LOCUS_35130 66358 65711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 66651 67751 gene locus_tag LOCUS_35140 gene rfaF 66651 67751 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_35140 69450 67768 gene locus_tag LOCUS_35150 gene pknB 69450 67768 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_35150 70129 69518 gene locus_tag LOCUS_35160 gene rpoE 70129 69518 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339513.1 protein_id gnl|my_center|LOCUS_35160 71071 70220 gene locus_tag LOCUS_35170 gene glpG 71071 70220 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_35170 71975 71163 gene locus_tag LOCUS_35180 71975 71163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 72726 73172 gene locus_tag LOCUS_35190 72726 73172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 73251 74573 gene locus_tag LOCUS_35200 gene hisS 73251 74573 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UZ20 protein_id gnl|my_center|LOCUS_35200 74731 75246 gene locus_tag LOCUS_35210 74731 75246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 75679 76965 gene locus_tag LOCUS_35220 75679 76965 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_35220 77717 77082 gene locus_tag LOCUS_35230 77717 77082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 79441 77783 gene locus_tag LOCUS_35240 79441 77783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 80994 79999 gene locus_tag LOCUS_35250 80994 79999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 81670 81167 gene locus_tag LOCUS_35260 81670 81167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 82096 84495 gene locus_tag LOCUS_35270 82096 84495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 84876 86525 gene locus_tag LOCUS_35280 84876 86525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 87254 86649 gene locus_tag LOCUS_35290 87254 86649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 87441 87286 gene locus_tag LOCUS_35300 87441 87286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 89455 87671 gene locus_tag LOCUS_35310 gene cya 89455 87671 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_35310 91735 89489 gene locus_tag LOCUS_35320 gene pknB 91735 89489 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337392.1 protein_id gnl|my_center|LOCUS_35320 92234 95029 gene locus_tag LOCUS_35330 gene gyrA 92234 95029 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMG7 protein_id gnl|my_center|LOCUS_35330 95082 96104 gene locus_tag LOCUS_35340 95082 96104 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_35340 96137 97519 gene locus_tag LOCUS_35350 gene ugd 96137 97519 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_35350 97755 98750 gene locus_tag LOCUS_35360 gene prfB 97755 98750 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ31 protein_id gnl|my_center|LOCUS_35360 98803 100101 gene locus_tag LOCUS_35370 98803 100101 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121268.1 protein_id gnl|my_center|LOCUS_35370 100882 100085 gene locus_tag LOCUS_35380 100882 100085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 101137 103446 gene locus_tag LOCUS_35390 101137 103446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 103599 104579 gene locus_tag LOCUS_35400 gene pyrB 103599 104579 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNR3 protein_id gnl|my_center|LOCUS_35400 104576 105856 gene locus_tag LOCUS_35410 gene pyrC 104576 105856 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_35410 106278 107027 gene locus_tag LOCUS_35420 106278 107027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 107119 109608 gene locus_tag LOCUS_35430 107119 109608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 109805 111943 gene locus_tag LOCUS_35440 109805 111943 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122941.1 protein_id gnl|my_center|LOCUS_35440 112099 115653 gene locus_tag LOCUS_35450 112099 115653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122481.1 protein_id gnl|my_center|LOCUS_35450 118986 115660 gene locus_tag LOCUS_35460 118986 115660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 119490 120734 gene locus_tag LOCUS_35470 119490 120734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_35470 120818 121621 gene locus_tag LOCUS_35480 120818 121621 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118358.1 protein_id gnl|my_center|LOCUS_35480 121759 122478 gene locus_tag LOCUS_35490 121759 122478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 122597 123445 gene locus_tag LOCUS_35500 122597 123445 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120581.1 protein_id gnl|my_center|LOCUS_35500 123563 125914 gene locus_tag LOCUS_35510 123563 125914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 127638 125980 gene locus_tag LOCUS_35520 127638 125980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 127993 128724 gene locus_tag LOCUS_35530 127993 128724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_35530 128721 129803 gene locus_tag LOCUS_35540 128721 129803 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_35540 130871 129837 gene locus_tag LOCUS_35550 130871 129837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 131924 134677 gene locus_tag LOCUS_35560 131924 134677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 134787 135836 gene locus_tag LOCUS_35570 134787 135836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 136277 136480 gene locus_tag LOCUS_35580 136277 136480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 136598 136924 gene locus_tag LOCUS_35590 136598 136924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 138578 136962 gene locus_tag LOCUS_35600 138578 136962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 139499 138852 gene locus_tag LOCUS_35610 139499 138852 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_35610 140036 139551 gene locus_tag LOCUS_35620 140036 139551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324288.1 protein_id gnl|my_center|LOCUS_35620 140623 141033 gene locus_tag LOCUS_35630 140623 141033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 141340 142536 gene locus_tag LOCUS_35640 gene clpX 141340 142536 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU7 protein_id gnl|my_center|LOCUS_35640 142632 143201 gene locus_tag LOCUS_35650 142632 143201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 143235 143624 gene locus_tag LOCUS_35660 143235 143624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 143638 144018 gene locus_tag LOCUS_35670 143638 144018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 145834 144038 gene locus_tag LOCUS_35680 gene ask 145834 144038 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_35680 147269 146118 gene locus_tag LOCUS_35690 gene murG 147269 146118 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT4 protein_id gnl|my_center|LOCUS_35690 >Feature sequence18 14314 15252 gene locus_tag LOCUS_35700 14314 15252 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_35700 15346 15783 gene locus_tag LOCUS_35710 15346 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 16947 15859 gene locus_tag LOCUS_35720 gene corA 16947 15859 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_35720 18242 17136 gene locus_tag LOCUS_35730 18242 17136 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_35730 18501 18244 gene locus_tag LOCUS_35740 18501 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 20719 19148 gene locus_tag LOCUS_35750 20719 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 21826 20981 gene locus_tag LOCUS_35760 21826 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964099.1 protein_id gnl|my_center|LOCUS_35760 23425 21935 gene locus_tag LOCUS_35770 23425 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118384.1 protein_id gnl|my_center|LOCUS_35770 23660 25093 gene locus_tag LOCUS_35780 23660 25093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 25167 26237 gene locus_tag LOCUS_35790 25167 26237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 26303 27415 gene locus_tag LOCUS_35800 26303 27415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 27426 27944 gene locus_tag LOCUS_35810 27426 27944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 29319 28126 gene locus_tag LOCUS_35820 29319 28126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 30314 29439 gene locus_tag LOCUS_35830 30314 29439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119598.1 protein_id gnl|my_center|LOCUS_35830 31320 30397 gene locus_tag LOCUS_35840 31320 30397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 32755 31394 gene locus_tag LOCUS_35850 32755 31394 CDS product alkaline ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_35850 33637 32987 gene locus_tag LOCUS_35860 33637 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 33706 34704 gene locus_tag LOCUS_35870 33706 34704 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947299.1 protein_id gnl|my_center|LOCUS_35870 35176 34721 gene locus_tag LOCUS_35880 35176 34721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 36029 35667 gene locus_tag LOCUS_35890 36029 35667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 36398 36207 gene locus_tag LOCUS_35900 36398 36207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 37275 36571 gene locus_tag LOCUS_35910 37275 36571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 39755 37443 gene locus_tag LOCUS_35920 39755 37443 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709186.1 protein_id gnl|my_center|LOCUS_35920 41301 39886 gene locus_tag LOCUS_35930 41301 39886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_35930 44129 41319 gene locus_tag LOCUS_35940 44129 41319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123598.1 protein_id gnl|my_center|LOCUS_35940 45040 44276 gene locus_tag LOCUS_35950 45040 44276 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888024.1 protein_id gnl|my_center|LOCUS_35950 45948 45157 gene locus_tag LOCUS_35960 45948 45157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 48592 46073 gene locus_tag LOCUS_35970 48592 46073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 52071 48970 gene locus_tag LOCUS_35980 gene czcA 52071 48970 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123153.1 protein_id gnl|my_center|LOCUS_35980 53580 52120 gene locus_tag LOCUS_35990 gene czcB 53580 52120 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123152.1 protein_id gnl|my_center|LOCUS_35990 54087 53707 gene locus_tag LOCUS_36000 54087 53707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 54783 58313 gene locus_tag LOCUS_36010 gene kefA 54783 58313 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120603.1 protein_id gnl|my_center|LOCUS_36010 58781 58323 gene locus_tag LOCUS_36020 58781 58323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 59729 58908 gene locus_tag LOCUS_36030 59729 58908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 60112 60852 gene locus_tag LOCUS_36040 60112 60852 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122939.1 protein_id gnl|my_center|LOCUS_36040 61120 63375 gene locus_tag LOCUS_36050 61120 63375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121270.1 protein_id gnl|my_center|LOCUS_36050 63372 64298 gene locus_tag LOCUS_36060 63372 64298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_36060 65119 64316 gene locus_tag LOCUS_36070 65119 64316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 65623 68349 gene locus_tag LOCUS_36080 65623 68349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 68472 68837 gene locus_tag LOCUS_36090 68472 68837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 68896 69960 gene locus_tag LOCUS_36100 68896 69960 CDS product Rossman fold protein, TIGR00730 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122653.1 protein_id gnl|my_center|LOCUS_36100 70595 69969 gene locus_tag LOCUS_36110 gene sigG 70595 69969 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123035.1 protein_id gnl|my_center|LOCUS_36110 70805 73045 gene locus_tag LOCUS_36120 gene ppkA 70805 73045 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121633.1 protein_id gnl|my_center|LOCUS_36120 73301 73128 gene locus_tag LOCUS_36130 73301 73128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 73694 73867 gene locus_tag LOCUS_36140 73694 73867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 73876 74283 gene locus_tag LOCUS_36150 73876 74283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 75740 74379 gene locus_tag LOCUS_36160 gene eno 75740 74379 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z3 protein_id gnl|my_center|LOCUS_36160 76892 75846 gene locus_tag LOCUS_36170 76892 75846 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459460.1 protein_id gnl|my_center|LOCUS_36170 77288 78175 gene locus_tag LOCUS_36180 77288 78175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 78335 79273 gene locus_tag LOCUS_36190 78335 79273 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_36190 79554 82667 gene locus_tag LOCUS_36200 79554 82667 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_36200 82720 84201 gene locus_tag LOCUS_36210 82720 84201 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_36210 85591 84236 gene locus_tag LOCUS_36220 85591 84236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 86452 85895 gene locus_tag LOCUS_36230 86452 85895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 87447 86500 gene locus_tag LOCUS_36240 87447 86500 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_36240 87763 89256 gene locus_tag LOCUS_36250 87763 89256 CDS product L-fuculose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_36250 89385 90323 gene locus_tag LOCUS_36260 gene ftsY 89385 90323 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT17 protein_id gnl|my_center|LOCUS_36260 90743 92176 gene locus_tag LOCUS_36270 90743 92176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121818.1 protein_id gnl|my_center|LOCUS_36270 93880 92297 gene locus_tag LOCUS_36280 gene purH 93880 92297 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ8 protein_id gnl|my_center|LOCUS_36280 95366 94089 gene locus_tag LOCUS_36290 95366 94089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 95733 95548 gene locus_tag LOCUS_36300 95733 95548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 95967 97226 gene locus_tag LOCUS_36310 95967 97226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121193.1 protein_id gnl|my_center|LOCUS_36310 98636 97290 gene locus_tag LOCUS_36320 98636 97290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 100914 98692 gene locus_tag LOCUS_36330 100914 98692 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_36330 102043 100982 gene locus_tag LOCUS_36340 102043 100982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 102607 104631 gene locus_tag LOCUS_36350 102607 104631 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122783.1 protein_id gnl|my_center|LOCUS_36350 105388 104723 gene locus_tag LOCUS_36360 105388 104723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 106918 105527 gene locus_tag LOCUS_36370 106918 105527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 107559 106963 gene locus_tag LOCUS_36380 107559 106963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 107991 107686 gene locus_tag LOCUS_36390 107991 107686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 108928 107978 gene locus_tag LOCUS_36400 108928 107978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 110252 108918 gene locus_tag LOCUS_36410 110252 108918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 110442 111614 gene locus_tag LOCUS_36420 110442 111614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 protein_id gnl|my_center|LOCUS_36420 111750 112409 gene locus_tag LOCUS_36430 gene trpF 111750 112409 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH7 protein_id gnl|my_center|LOCUS_36430 112617 113051 gene locus_tag LOCUS_36440 112617 113051 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120691.1 protein_id gnl|my_center|LOCUS_36440 113566 113072 gene locus_tag LOCUS_36450 113566 113072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 113813 114568 gene locus_tag LOCUS_36460 gene kdsB 113813 114568 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI86 protein_id gnl|my_center|LOCUS_36460 114706 116340 gene locus_tag LOCUS_36470 gene pyrG 114706 116340 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_36470 116391 117320 gene locus_tag LOCUS_36480 gene truB 116391 117320 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM3 protein_id gnl|my_center|LOCUS_36480 117373 117948 gene locus_tag LOCUS_36490 117373 117948 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV4 protein_id gnl|my_center|LOCUS_36490 118613 118062 gene locus_tag LOCUS_36500 118613 118062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 119172 118882 gene locus_tag LOCUS_36510 119172 118882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 121275 119551 gene locus_tag LOCUS_36520 121275 119551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 122262 123059 gene locus_tag LOCUS_36530 122262 123059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 123227 123880 gene locus_tag LOCUS_36540 123227 123880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 125242 123974 gene locus_tag LOCUS_36550 125242 123974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 126566 125244 gene locus_tag LOCUS_36560 126566 125244 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_36560 127205 126771 gene locus_tag LOCUS_36570 127205 126771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 <129035 127762 gene locus_tag LOCUS_36580 <129035 127762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CR03:sulfate adenylyltransferase >Feature sequence19 364 4320 gene locus_tag LOCUS_36590 364 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388260.1 protein_id gnl|my_center|LOCUS_36590 4491 5822 gene locus_tag LOCUS_36600 4491 5822 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_36600 6109 6642 gene locus_tag LOCUS_36610 6109 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 6816 7289 gene locus_tag LOCUS_36620 6816 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 7425 7997 gene locus_tag LOCUS_36630 7425 7997 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_36630 8345 9328 gene locus_tag LOCUS_36640 8345 9328 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118191.1 protein_id gnl|my_center|LOCUS_36640 10438 9377 gene locus_tag LOCUS_36650 10438 9377 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXX4 protein_id gnl|my_center|LOCUS_36650 10934 10476 gene locus_tag LOCUS_36660 10934 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_36660 15379 10979 gene locus_tag LOCUS_36670 15379 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 15739 16947 gene locus_tag LOCUS_36680 15739 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 16980 18518 gene locus_tag LOCUS_36690 16980 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 18792 20138 gene locus_tag LOCUS_36700 18792 20138 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122540.1 protein_id gnl|my_center|LOCUS_36700 20233 20844 gene locus_tag LOCUS_36710 20233 20844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 20894 21937 gene locus_tag LOCUS_36720 20894 21937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 22025 22684 gene locus_tag LOCUS_36730 22025 22684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 22730 23797 gene locus_tag LOCUS_36740 22730 23797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 23886 24578 gene locus_tag LOCUS_36750 23886 24578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 24892 25860 gene locus_tag LOCUS_36760 24892 25860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 25860 26888 gene locus_tag LOCUS_36770 gene rluD 25860 26888 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX8 protein_id gnl|my_center|LOCUS_36770 26891 27763 gene locus_tag LOCUS_36780 gene hpaG 26891 27763 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_36780 28709 27786 gene locus_tag LOCUS_36790 28709 27786 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_36790 29224 28748 gene locus_tag LOCUS_36800 29224 28748 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064305.1 protein_id gnl|my_center|LOCUS_36800 29398 30141 gene locus_tag LOCUS_36810 29398 30141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870208.1 protein_id gnl|my_center|LOCUS_36810 32114 30201 gene locus_tag LOCUS_36820 32114 30201 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121956.1 protein_id gnl|my_center|LOCUS_36820 35250 32263 gene locus_tag LOCUS_36830 35250 32263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 35806 36411 gene locus_tag LOCUS_36840 gene plsY 35806 36411 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_36840 36752 36519 gene locus_tag LOCUS_36850 36752 36519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 38423 37140 gene locus_tag LOCUS_36860 38423 37140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 38740 39252 gene locus_tag LOCUS_36870 gene coaD 38740 39252 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG6 protein_id gnl|my_center|LOCUS_36870 39305 39898 gene locus_tag LOCUS_36880 39305 39898 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_36880 40125 43196 gene locus_tag LOCUS_36890 40125 43196 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_36890 44335 43331 gene locus_tag LOCUS_36900 44335 43331 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_36900 44852 45409 gene locus_tag LOCUS_36910 44852 45409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 45406 47103 gene locus_tag LOCUS_36920 45406 47103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 47182 50412 gene locus_tag LOCUS_36930 47182 50412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 50454 51905 gene locus_tag LOCUS_36940 50454 51905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_36940 52197 55106 gene locus_tag LOCUS_36950 52197 55106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 55171 56634 gene locus_tag LOCUS_36960 55171 56634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_36960 57925 56729 gene locus_tag LOCUS_36970 57925 56729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 60035 57999 gene locus_tag LOCUS_36980 60035 57999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121017.1 protein_id gnl|my_center|LOCUS_36980 60273 60965 gene locus_tag LOCUS_36990 60273 60965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 61144 61749 gene locus_tag LOCUS_37000 61144 61749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 61840 62562 gene locus_tag LOCUS_37010 61840 62562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 62906 64939 gene locus_tag LOCUS_37020 gene flgI 62906 64939 CDS product flagellar P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 protein_id gnl|my_center|LOCUS_37020 65034 68957 gene locus_tag LOCUS_37030 gene smc 65034 68957 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H9B0 protein_id gnl|my_center|LOCUS_37030 69028 69507 gene locus_tag LOCUS_37040 gene moaC 69028 69507 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFM0 protein_id gnl|my_center|LOCUS_37040 69767 70759 gene locus_tag LOCUS_37050 69767 70759 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121274.1 protein_id gnl|my_center|LOCUS_37050 70868 72610 gene locus_tag LOCUS_37060 70868 72610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335479.1 protein_id gnl|my_center|LOCUS_37060 72628 73932 gene locus_tag LOCUS_37070 72628 73932 CDS product hemolysin activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120735.1 protein_id gnl|my_center|LOCUS_37070 74335 74015 gene locus_tag LOCUS_37080 74335 74015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 75531 74494 gene locus_tag LOCUS_37090 75531 74494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 77237 75654 gene locus_tag LOCUS_37100 gene dnaK 77237 75654 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYH6 protein_id gnl|my_center|LOCUS_37100 77275 77547 gene locus_tag LOCUS_37110 77275 77547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 77863 79710 gene locus_tag LOCUS_37120 gene pmm 77863 79710 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_37120 79991 81205 gene locus_tag LOCUS_37130 79991 81205 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_37130 81219 82118 gene locus_tag LOCUS_37140 81219 82118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 82416 82147 gene locus_tag LOCUS_37150 82416 82147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 82683 83855 gene locus_tag LOCUS_37160 gene bcr 82683 83855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 protein_id gnl|my_center|LOCUS_37160 83908 84849 gene locus_tag LOCUS_37170 83908 84849 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_37170 84980 85603 gene locus_tag LOCUS_37180 84980 85603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 86123 85614 gene locus_tag LOCUS_37190 86123 85614 CDS product phosphinothricin acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 protein_id gnl|my_center|LOCUS_37190 86428 86183 gene locus_tag LOCUS_37200 86428 86183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 86726 86517 gene locus_tag LOCUS_37210 86726 86517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 87638 86889 gene locus_tag LOCUS_37220 gene hpcH 87638 86889 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_37220 87795 88643 gene locus_tag LOCUS_37230 87795 88643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 90496 88793 gene locus_tag LOCUS_37240 90496 88793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 90720 91298 gene locus_tag LOCUS_37250 90720 91298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 92369 91323 gene locus_tag LOCUS_37260 92369 91323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 92850 92476 gene locus_tag LOCUS_37270 92850 92476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 93832 92954 gene locus_tag LOCUS_37280 93832 92954 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_37280 95347 93932 gene locus_tag LOCUS_37290 95347 93932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 95841 95347 gene locus_tag LOCUS_37300 95841 95347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 96463 97521 gene locus_tag LOCUS_37310 96463 97521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 98531 97569 gene locus_tag LOCUS_37320 98531 97569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 98793 99170 gene locus_tag LOCUS_37330 98793 99170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 99167 101158 gene locus_tag LOCUS_37340 99167 101158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 101207 102046 gene locus_tag LOCUS_37350 101207 102046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268243.1 protein_id gnl|my_center|LOCUS_37350 102074 103189 gene locus_tag LOCUS_37360 102074 103189 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_37360 103258 104142 gene locus_tag LOCUS_37370 103258 104142 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121957.1 protein_id gnl|my_center|LOCUS_37370 104403 105272 gene locus_tag LOCUS_37380 104403 105272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 105936 105280 gene locus_tag LOCUS_37390 105936 105280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 106355 106573 gene locus_tag LOCUS_37400 gene csrA 106355 106573 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44879 protein_id gnl|my_center|LOCUS_37400 106980 107753 gene locus_tag LOCUS_37410 gene flgF 106980 107753 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F0 protein_id gnl|my_center|LOCUS_37410 107824 108624 gene locus_tag LOCUS_37420 gene flgG 107824 108624 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329888.1 protein_id gnl|my_center|LOCUS_37420 108716 109810 gene locus_tag LOCUS_37430 108716 109810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 110107 110769 gene locus_tag LOCUS_37440 110107 110769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 110774 111889 gene locus_tag LOCUS_37450 gene flgI 110774 111889 CDS product flagellar P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123602.1 protein_id gnl|my_center|LOCUS_37450 111951 112325 gene locus_tag LOCUS_37460 111951 112325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 112465 112986 gene locus_tag LOCUS_37470 112465 112986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 113058 114758 gene locus_tag LOCUS_37480 gene flgK 113058 114758 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH1 protein_id gnl|my_center|LOCUS_37480 114827 117088 gene locus_tag LOCUS_37490 114827 117088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 117458 117946 gene locus_tag LOCUS_37500 gene rplM 117458 117946 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1G5 protein_id gnl|my_center|LOCUS_37500 118017 118631 gene locus_tag LOCUS_37510 118017 118631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 118874 120220 gene locus_tag LOCUS_37520 gene mgtE 118874 120220 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN8 protein_id gnl|my_center|LOCUS_37520 122088 120238 gene locus_tag LOCUS_37530 122088 120238 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_37530 122357 123229 gene locus_tag LOCUS_37540 122357 123229 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_37540 >Feature sequence20 4419 5180 gene locus_tag LOCUS_37550 4419 5180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705765.1 protein_id gnl|my_center|LOCUS_37550 6248 5238 gene locus_tag LOCUS_37560 6248 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 7008 6481 gene locus_tag LOCUS_37570 gene prx-1 7008 6481 CDS product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941557.1 protein_id gnl|my_center|LOCUS_37570 8317 7109 gene locus_tag LOCUS_37580 8317 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 9446 8403 gene locus_tag LOCUS_37590 9446 8403 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117842.1 protein_id gnl|my_center|LOCUS_37590 11398 9704 gene locus_tag LOCUS_37600 11398 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 13185 11491 gene locus_tag LOCUS_37610 13185 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 14995 13247 gene locus_tag LOCUS_37620 14995 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 15936 15034 gene locus_tag LOCUS_37630 15936 15034 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121967.1 protein_id gnl|my_center|LOCUS_37630 16331 15933 gene locus_tag LOCUS_37640 gene gntR 16331 15933 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_37640 16550 17989 gene locus_tag LOCUS_37650 16550 17989 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118996.1 protein_id gnl|my_center|LOCUS_37650 20200 18509 gene locus_tag LOCUS_37660 gene ilvD 20200 18509 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ69 protein_id gnl|my_center|LOCUS_37660 20597 20307 gene locus_tag LOCUS_37670 20597 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 21052 23055 gene locus_tag LOCUS_37680 21052 23055 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122938.1 protein_id gnl|my_center|LOCUS_37680 25053 23425 gene locus_tag LOCUS_37690 25053 23425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 26200 25292 gene locus_tag LOCUS_37700 26200 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 26990 26217 gene locus_tag LOCUS_37710 26990 26217 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_37710 28637 27018 gene locus_tag LOCUS_37720 gene nadB 28637 27018 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTK8 protein_id gnl|my_center|LOCUS_37720 29503 28706 gene locus_tag LOCUS_37730 29503 28706 CDS product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_37730 30406 29558 gene locus_tag LOCUS_37740 gene mqnD 30406 29558 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_37740 31642 30698 gene locus_tag LOCUS_37750 gene miaA 31642 30698 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31795 protein_id gnl|my_center|LOCUS_37750 31929 32375 gene locus_tag LOCUS_37760 31929 32375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 34036 32399 gene locus_tag LOCUS_37770 34036 32399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 34344 35624 gene locus_tag LOCUS_37780 34344 35624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_37780 35651 36382 gene locus_tag LOCUS_37790 35651 36382 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086579.1 protein_id gnl|my_center|LOCUS_37790 37671 36673 gene locus_tag LOCUS_37800 37671 36673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 38011 38982 gene locus_tag LOCUS_37810 38011 38982 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_37810 39085 39507 gene locus_tag LOCUS_37820 39085 39507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 39582 42947 gene locus_tag LOCUS_37830 39582 42947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 42987 44504 gene locus_tag LOCUS_37840 42987 44504 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_37840 44693 44529 gene locus_tag LOCUS_37850 44693 44529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 44743 45093 gene locus_tag LOCUS_37860 44743 45093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 47244 45874 gene locus_tag LOCUS_37870 47244 45874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 47482 47997 gene locus_tag LOCUS_37880 47482 47997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 48613 49542 gene locus_tag LOCUS_37890 48613 49542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 49637 50332 gene locus_tag LOCUS_37900 49637 50332 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814029.1 protein_id gnl|my_center|LOCUS_37900 50399 53299 gene locus_tag LOCUS_37910 50399 53299 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117969.1 protein_id gnl|my_center|LOCUS_37910 53314 54804 gene locus_tag LOCUS_37920 53314 54804 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_37920 54938 55013 gene locus_tag LOCUS_t00460 54938 55013 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 55643 59632 gene locus_tag LOCUS_37930 55643 59632 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_37930 60391 59849 gene locus_tag LOCUS_37940 60391 59849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 61549 60404 gene locus_tag LOCUS_37950 gene proB 61549 60404 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJA8 protein_id gnl|my_center|LOCUS_37950 61821 61624 gene locus_tag LOCUS_37960 61821 61624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 61837 63432 gene locus_tag LOCUS_37970 gene purF 61837 63432 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGS5 protein_id gnl|my_center|LOCUS_37970 63456 63857 gene locus_tag LOCUS_37980 gene tesB 63456 63857 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331599.1 protein_id gnl|my_center|LOCUS_37980 65109 64138 gene locus_tag LOCUS_37990 65109 64138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 65625 65323 gene locus_tag LOCUS_38000 65625 65323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 66147 66455 gene locus_tag LOCUS_38010 66147 66455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 68046 66478 gene locus_tag LOCUS_38020 68046 66478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 68591 68917 gene locus_tag LOCUS_38030 68591 68917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 69322 68930 gene locus_tag LOCUS_38040 69322 68930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 70956 69343 gene locus_tag LOCUS_38050 70956 69343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 72044 71208 gene locus_tag LOCUS_38060 72044 71208 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_38060 72801 72145 gene locus_tag LOCUS_38070 72801 72145 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_38070 74839 72965 gene locus_tag LOCUS_38080 74839 72965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_38080 76970 75033 gene locus_tag LOCUS_38090 76970 75033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_38090 77399 77968 gene locus_tag LOCUS_38100 77399 77968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 78528 78085 gene locus_tag LOCUS_38110 78528 78085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 79677 78703 gene locus_tag LOCUS_38120 79677 78703 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_38120 80695 80252 gene locus_tag LOCUS_38130 80695 80252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 81710 80763 gene locus_tag LOCUS_38140 81710 80763 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_38140 82161 83099 gene locus_tag LOCUS_38150 82161 83099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 83381 84076 gene locus_tag LOCUS_38160 gene chd1 83381 84076 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 protein_id gnl|my_center|LOCUS_38160 84243 85070 gene locus_tag LOCUS_38170 84243 85070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 86420 85107 gene locus_tag LOCUS_38180 86420 85107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 87860 86517 gene locus_tag LOCUS_38190 87860 86517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 89549 87924 gene locus_tag LOCUS_38200 89549 87924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 90553 89732 gene locus_tag LOCUS_38210 gene yqiK 90553 89732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54527 protein_id gnl|my_center|LOCUS_38210 92137 90716 gene locus_tag LOCUS_38220 92137 90716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124058.1 protein_id gnl|my_center|LOCUS_38220 94988 92211 gene locus_tag LOCUS_38230 94988 92211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_38230 95351 96508 gene locus_tag LOCUS_38240 95351 96508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 96687 97874 gene locus_tag LOCUS_38250 96687 97874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 97905 99350 gene locus_tag LOCUS_38260 97905 99350 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117864.1 protein_id gnl|my_center|LOCUS_38260 100756 99347 gene locus_tag LOCUS_38270 100756 99347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_38270 101948 100989 gene locus_tag LOCUS_38280 101948 100989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 103523 102048 gene locus_tag LOCUS_38290 103523 102048 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118737.1 protein_id gnl|my_center|LOCUS_38290 103809 106238 gene locus_tag LOCUS_38300 103809 106238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 106670 106251 gene locus_tag LOCUS_38310 106670 106251 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 protein_id gnl|my_center|LOCUS_38310 107006 106857 gene locus_tag LOCUS_38320 107006 106857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence21 789 382 gene locus_tag LOCUS_38330 789 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 5628 895 gene locus_tag LOCUS_38340 5628 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 6358 5792 gene locus_tag LOCUS_38350 6358 5792 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_38350 7312 8097 gene locus_tag LOCUS_38360 7312 8097 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118657.1 protein_id gnl|my_center|LOCUS_38360 10130 8532 gene locus_tag LOCUS_38370 10130 8532 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767371.1 protein_id gnl|my_center|LOCUS_38370 10371 11474 gene locus_tag LOCUS_38380 gene pam 10371 11474 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_38380 11546 13477 gene locus_tag LOCUS_38390 11546 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 14764 13487 gene locus_tag LOCUS_38400 14764 13487 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_38400 15150 16289 gene locus_tag LOCUS_38410 15150 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 16462 17748 gene locus_tag LOCUS_38420 16462 17748 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_38420 17799 18839 gene locus_tag LOCUS_38430 17799 18839 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086445.1 protein_id gnl|my_center|LOCUS_38430 20331 18865 gene locus_tag LOCUS_38440 20331 18865 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_38440 21831 20536 gene locus_tag LOCUS_38450 21831 20536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 22390 21818 gene locus_tag LOCUS_38460 gene rfaY 22390 21818 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122442.1 protein_id gnl|my_center|LOCUS_38460 23345 22743 gene locus_tag LOCUS_38470 23345 22743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 23712 25124 gene locus_tag LOCUS_38480 23712 25124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_38480 25391 26119 gene locus_tag LOCUS_38490 25391 26119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 26431 28638 gene locus_tag LOCUS_38500 26431 28638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_38500 28653 29972 gene locus_tag LOCUS_38510 28653 29972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_38510 30170 30550 gene locus_tag LOCUS_38520 30170 30550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 30780 31778 gene locus_tag LOCUS_38530 30780 31778 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_38530 31876 32319 gene locus_tag LOCUS_38540 31876 32319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 32478 34601 gene locus_tag LOCUS_38550 32478 34601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 34883 37030 gene locus_tag LOCUS_38560 34883 37030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 37027 38196 gene locus_tag LOCUS_38570 gene mtrA 37027 38196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122589.1 protein_id gnl|my_center|LOCUS_38570 38760 39929 gene locus_tag LOCUS_38580 38760 39929 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119840.1 protein_id gnl|my_center|LOCUS_38580 39982 40527 gene locus_tag LOCUS_38590 39982 40527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119839.1 protein_id gnl|my_center|LOCUS_38590 40531 42084 gene locus_tag LOCUS_38600 40531 42084 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_38600 42087 42818 gene locus_tag LOCUS_38610 42087 42818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119837.1 protein_id gnl|my_center|LOCUS_38610 42815 43954 gene locus_tag LOCUS_38620 42815 43954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119834.1 protein_id gnl|my_center|LOCUS_38620 45498 44053 gene locus_tag LOCUS_38630 45498 44053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_38630 45963 46250 gene locus_tag LOCUS_38640 45963 46250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 46487 47833 gene locus_tag LOCUS_38650 46487 47833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_38650 48261 49943 gene locus_tag LOCUS_38660 48261 49943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 49940 50731 gene locus_tag LOCUS_38670 49940 50731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 50733 51959 gene locus_tag LOCUS_38680 50733 51959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 51959 53416 gene locus_tag LOCUS_38690 51959 53416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 53506 53979 gene locus_tag LOCUS_38700 53506 53979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 55250 54009 gene locus_tag LOCUS_38710 55250 54009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 56521 55535 gene locus_tag LOCUS_38720 56521 55535 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_38720 57032 56640 gene locus_tag LOCUS_38730 57032 56640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 58092 57103 gene locus_tag LOCUS_38740 58092 57103 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_38740 58794 60113 gene locus_tag LOCUS_38750 58794 60113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_38750 61165 60317 gene locus_tag LOCUS_38760 61165 60317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 64461 61279 gene locus_tag LOCUS_38770 64461 61279 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120142.1 protein_id gnl|my_center|LOCUS_38770 65819 64542 gene locus_tag LOCUS_38780 65819 64542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 66599 65871 gene locus_tag LOCUS_38790 66599 65871 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120144.1 protein_id gnl|my_center|LOCUS_38790 68365 66932 gene locus_tag LOCUS_38800 68365 66932 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_38800 69260 68544 gene locus_tag LOCUS_38810 69260 68544 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121114.1 protein_id gnl|my_center|LOCUS_38810 71573 69438 gene locus_tag LOCUS_38820 gene pnp 71573 69438 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR95 protein_id gnl|my_center|LOCUS_38820 71898 71629 gene locus_tag LOCUS_38830 gene rpsO 71898 71629 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_38830 74537 72225 gene locus_tag LOCUS_38840 74537 72225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 75018 79613 gene locus_tag LOCUS_38850 gene lhr1 75018 79613 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037460.1 protein_id gnl|my_center|LOCUS_38850 79716 82622 gene locus_tag LOCUS_38860 79716 82622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 82689 83057 gene locus_tag LOCUS_38870 82689 83057 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_38870 83279 84979 gene locus_tag LOCUS_38880 83279 84979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 85025 85924 gene locus_tag LOCUS_38890 85025 85924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122886.1 protein_id gnl|my_center|LOCUS_38890 85945 86601 gene locus_tag LOCUS_38900 gene tolQ 85945 86601 CDS product MotA/TolQ/ExbB proton channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324221.1 protein_id gnl|my_center|LOCUS_38900 86623 87102 gene locus_tag LOCUS_38910 86623 87102 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324222.1 protein_id gnl|my_center|LOCUS_38910 87146 88183 gene locus_tag LOCUS_38920 87146 88183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 88250 91933 gene locus_tag LOCUS_38930 88250 91933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 91930 94464 gene locus_tag LOCUS_38940 91930 94464 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122892.1 protein_id gnl|my_center|LOCUS_38940 94476 96098 gene locus_tag LOCUS_38950 94476 96098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 96100 96933 gene locus_tag LOCUS_38960 96100 96933 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_38960 97174 97371 gene locus_tag LOCUS_38970 gene csrA 97174 97371 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_38970 98313 97420 gene locus_tag LOCUS_38980 98313 97420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 98628 100547 gene locus_tag LOCUS_38990 98628 100547 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_38990 102057 100564 gene locus_tag LOCUS_39000 gene prnC 102057 100564 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118477.1 protein_id gnl|my_center|LOCUS_39000 102159 103742 gene locus_tag LOCUS_39010 102159 103742 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122083.1 protein_id gnl|my_center|LOCUS_39010 104028 104102 gene locus_tag LOCUS_t00470 104028 104102 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 105219 104902 gene locus_tag LOCUS_39020 105219 104902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39020 105496 105200 gene locus_tag LOCUS_39030 105496 105200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39030 >Feature sequence22 815 1807 gene locus_tag LOCUS_39040 815 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118058.1 protein_id gnl|my_center|LOCUS_39040 2257 3177 gene locus_tag LOCUS_39050 2257 3177 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_39050 3813 3739 gene locus_tag LOCUS_t00480 3813 3739 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5503 4031 gene locus_tag LOCUS_39060 5503 4031 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118678.1 protein_id gnl|my_center|LOCUS_39060 5787 6488 gene locus_tag LOCUS_39070 5787 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 6589 7494 gene locus_tag LOCUS_39080 6589 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120923.1 protein_id gnl|my_center|LOCUS_39080 7495 7866 gene locus_tag LOCUS_39090 7495 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 9015 7897 gene locus_tag LOCUS_39100 9015 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 9522 9088 gene locus_tag LOCUS_39110 9522 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 9889 11136 gene locus_tag LOCUS_39120 9889 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 13208 11145 gene locus_tag LOCUS_39130 13208 11145 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122783.1 protein_id gnl|my_center|LOCUS_39130 13637 16144 gene locus_tag LOCUS_39140 13637 16144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 16432 16980 gene locus_tag LOCUS_39150 gene infC 16432 16980 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ17 protein_id gnl|my_center|LOCUS_39150 18107 17115 gene locus_tag LOCUS_39160 gene socC 18107 17115 CDS product deoxyfructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_39160 18802 18362 gene locus_tag LOCUS_39170 18802 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 19897 18977 gene locus_tag LOCUS_39180 19897 18977 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_39180 21091 21774 gene locus_tag LOCUS_39190 21091 21774 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_39190 21786 24896 gene locus_tag LOCUS_39200 21786 24896 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123849.1 protein_id gnl|my_center|LOCUS_39200 24992 26386 gene locus_tag LOCUS_39210 24992 26386 CDS product molybdopterin oxidoreductase membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_39210 26448 27845 gene locus_tag LOCUS_39220 26448 27845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123851.1 protein_id gnl|my_center|LOCUS_39220 27905 29134 gene locus_tag LOCUS_39230 27905 29134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123852.1 protein_id gnl|my_center|LOCUS_39230 29186 29515 gene locus_tag LOCUS_39240 29186 29515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 29512 30369 gene locus_tag LOCUS_39250 29512 30369 CDS product photosynthetic protein synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885550.1 protein_id gnl|my_center|LOCUS_39250 30459 31433 gene locus_tag LOCUS_39260 gene coxB1 30459 31433 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0S5 protein_id gnl|my_center|LOCUS_39260 31538 33256 gene locus_tag LOCUS_39270 gene ctaD 31538 33256 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_39270 33256 34332 gene locus_tag LOCUS_39280 33256 34332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 34415 34822 gene locus_tag LOCUS_39290 34415 34822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 34971 35573 gene locus_tag LOCUS_39300 gene cox3 34971 35573 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120015.1 protein_id gnl|my_center|LOCUS_39300 35805 37493 gene locus_tag LOCUS_39310 gene lepB 35805 37493 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGK9 protein_id gnl|my_center|LOCUS_39310 37641 39509 gene locus_tag LOCUS_39320 gene lepB 37641 39509 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGK9 protein_id gnl|my_center|LOCUS_39320 39626 40408 gene locus_tag LOCUS_39330 39626 40408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 41508 40405 gene locus_tag LOCUS_39340 41508 40405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 41904 41698 gene locus_tag LOCUS_39350 41904 41698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 42858 41971 gene locus_tag LOCUS_39360 42858 41971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 43903 43121 gene locus_tag LOCUS_39370 gene gdh 43903 43121 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_39370 44635 44303 gene locus_tag LOCUS_39380 44635 44303 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_39380 45164 46183 gene locus_tag LOCUS_39390 45164 46183 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939418.1 protein_id gnl|my_center|LOCUS_39390 46243 47082 gene locus_tag LOCUS_39400 gene dapF 46243 47082 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FS5 protein_id gnl|my_center|LOCUS_39400 47176 47667 gene locus_tag LOCUS_39410 47176 47667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 47772 48464 gene locus_tag LOCUS_39420 47772 48464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 48528 49223 gene locus_tag LOCUS_39430 48528 49223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 49368 49715 gene locus_tag LOCUS_39440 49368 49715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325780.1 protein_id gnl|my_center|LOCUS_39440 51578 49770 gene locus_tag LOCUS_39450 gene lepA1 51578 49770 CDS product elongation factor 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX15 protein_id gnl|my_center|LOCUS_39450 52658 51642 gene locus_tag LOCUS_39460 gene glcK 52658 51642 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118462.1 protein_id gnl|my_center|LOCUS_39460 53177 54535 gene locus_tag LOCUS_39470 53177 54535 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120321.1 protein_id gnl|my_center|LOCUS_39470 54752 56434 gene locus_tag LOCUS_39480 54752 56434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 56893 58239 gene locus_tag LOCUS_39490 gene nqrA 56893 58239 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_39490 58461 59705 gene locus_tag LOCUS_39500 gene nqrB 58461 59705 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_39500 59695 60498 gene locus_tag LOCUS_39510 gene nqrC 59695 60498 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG54 protein_id gnl|my_center|LOCUS_39510 60498 61121 gene locus_tag LOCUS_39520 gene nqrD 60498 61121 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS2 protein_id gnl|my_center|LOCUS_39520 61123 61734 gene locus_tag LOCUS_39530 gene nqrE 61123 61734 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_39530 61780 63003 gene locus_tag LOCUS_39540 gene nqrF 61780 63003 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_39540 62990 64069 gene locus_tag LOCUS_39550 gene apbE 62990 64069 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WC52 protein_id gnl|my_center|LOCUS_39550 64066 64296 gene locus_tag LOCUS_39560 64066 64296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 64506 65084 gene locus_tag LOCUS_39570 64506 65084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 66469 65108 gene locus_tag LOCUS_39580 66469 65108 CDS product glycoside hydrolase family 43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312415.1 protein_id gnl|my_center|LOCUS_39580 68856 66472 gene locus_tag LOCUS_39590 68856 66472 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_39590 69608 68856 gene locus_tag LOCUS_39600 69608 68856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932633.1 protein_id gnl|my_center|LOCUS_39600 70900 70004 gene locus_tag LOCUS_39610 70900 70004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 72973 70937 gene locus_tag LOCUS_39620 72973 70937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 73482 74324 gene locus_tag LOCUS_39630 73482 74324 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_39630 74467 74892 gene locus_tag LOCUS_39640 74467 74892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 76185 74902 gene locus_tag LOCUS_39650 76185 74902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_39650 77666 76212 gene locus_tag LOCUS_39660 77666 76212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 78529 80199 gene locus_tag LOCUS_39670 78529 80199 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_39670 80648 80721 gene locus_tag LOCUS_t00490 80648 80721 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 80807 80888 gene locus_tag LOCUS_t00500 80807 80888 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 80924 80994 gene locus_tag LOCUS_t00510 80924 80994 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 81038 81110 gene locus_tag LOCUS_t00520 81038 81110 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 81262 82458 gene locus_tag LOCUS_39680 gene tuf 81262 82458 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_39680 82567 82722 gene locus_tag LOCUS_39690 gene rpmG 82567 82722 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51357 protein_id gnl|my_center|LOCUS_39690 82809 82881 gene locus_tag LOCUS_t00530 82809 82881 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 83013 83450 gene locus_tag LOCUS_39700 gene secE 83013 83450 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY9 protein_id gnl|my_center|LOCUS_39700 83625 84227 gene locus_tag LOCUS_39710 gene nusG 83625 84227 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY8 protein_id gnl|my_center|LOCUS_39710 84298 84723 gene locus_tag LOCUS_39720 gene rplK 84298 84723 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY7 protein_id gnl|my_center|LOCUS_39720 84810 85514 gene locus_tag LOCUS_39730 gene rplA 84810 85514 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI03 protein_id gnl|my_center|LOCUS_39730 85601 86119 gene locus_tag LOCUS_39740 gene rplJ 85601 86119 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_39740 86198 86668 gene locus_tag LOCUS_39750 gene rplL 86198 86668 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI01 protein_id gnl|my_center|LOCUS_39750 87205 90921 gene locus_tag LOCUS_39760 gene rpoB 87205 90921 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URW6 protein_id gnl|my_center|LOCUS_39760 91018 95379 gene locus_tag LOCUS_39770 gene rpoC 91018 95379 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URW4 protein_id gnl|my_center|LOCUS_39770 95604 95975 gene locus_tag LOCUS_39780 gene rpsL 95604 95975 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_213505.1 protein_id gnl|my_center|LOCUS_39780 96070 96549 gene locus_tag LOCUS_39790 gene rpsG 96070 96549 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN31 protein_id gnl|my_center|LOCUS_39790 96706 98865 gene locus_tag LOCUS_39800 gene fusA 96706 98865 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_39800 99138 99470 gene locus_tag LOCUS_39810 gene rpsJ 99138 99470 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN22 protein_id gnl|my_center|LOCUS_39810 99632 100321 gene locus_tag LOCUS_39820 gene rplC 99632 100321 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN20 protein_id gnl|my_center|LOCUS_39820 100377 101006 gene locus_tag LOCUS_39830 gene rplD 100377 101006 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN19 protein_id gnl|my_center|LOCUS_39830 101060 101368 gene locus_tag LOCUS_39840 gene rplW 101060 101368 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN18 protein_id gnl|my_center|LOCUS_39840 101448 102305 gene locus_tag LOCUS_39850 gene rplB 101448 102305 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN17 protein_id gnl|my_center|LOCUS_39850 102367 102633 gene locus_tag LOCUS_39860 gene rpsS 102367 102633 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A480 protein_id gnl|my_center|LOCUS_39860 102714 103058 gene locus_tag LOCUS_39870 gene rplV 102714 103058 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN15 protein_id gnl|my_center|LOCUS_39870 103140 103841 gene locus_tag LOCUS_39880 gene rpsC 103140 103841 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN14 protein_id gnl|my_center|LOCUS_39880 >Feature sequence23 1743 181 gene locus_tag LOCUS_39890 1743 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 2349 4892 gene locus_tag LOCUS_39900 gene clpC 2349 4892 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_39900 5014 5715 gene locus_tag LOCUS_39910 5014 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143958.1 protein_id gnl|my_center|LOCUS_39910 6057 5827 gene locus_tag LOCUS_39920 gene csrA 6057 5827 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_39920 6712 8607 gene locus_tag LOCUS_39930 gene cstA 6712 8607 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_39930 10889 9897 gene locus_tag LOCUS_39940 10889 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 11649 12842 gene locus_tag LOCUS_39950 11649 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 14392 13154 gene locus_tag LOCUS_39960 14392 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 14549 14836 gene locus_tag LOCUS_39970 14549 14836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 14920 15606 gene locus_tag LOCUS_39980 14920 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 15687 16121 gene locus_tag LOCUS_39990 15687 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 17730 16525 gene locus_tag LOCUS_40000 17730 16525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 17887 18174 gene locus_tag LOCUS_40010 17887 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 18258 18935 gene locus_tag LOCUS_40020 18258 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 19193 19277 gene locus_tag LOCUS_t00540 19193 19277 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19847 19407 gene locus_tag LOCUS_40030 19847 19407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 20669 21172 gene locus_tag LOCUS_40040 20669 21172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 21207 22361 gene locus_tag LOCUS_40050 gene rsgA 21207 22361 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ6 protein_id gnl|my_center|LOCUS_40050 22552 24000 gene locus_tag LOCUS_40060 22552 24000 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_40060 25375 24188 gene locus_tag LOCUS_40070 25375 24188 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122352.1 protein_id gnl|my_center|LOCUS_40070 26753 25524 gene locus_tag LOCUS_40080 26753 25524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329769.1 protein_id gnl|my_center|LOCUS_40080 29006 26823 gene locus_tag LOCUS_40090 29006 26823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 30466 29120 gene locus_tag LOCUS_40100 30466 29120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_40100 30993 33494 gene locus_tag LOCUS_40110 gene butB 30993 33494 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122380.1 protein_id gnl|my_center|LOCUS_40110 35399 33891 gene locus_tag LOCUS_40120 35399 33891 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 protein_id gnl|my_center|LOCUS_40120 36157 35636 gene locus_tag LOCUS_40130 36157 35636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 38760 36715 gene locus_tag LOCUS_40140 gene metG 38760 36715 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URP3 protein_id gnl|my_center|LOCUS_40140 39996 38977 gene locus_tag LOCUS_40150 39996 38977 CDS product hemolysin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324277.1 protein_id gnl|my_center|LOCUS_40150 40336 41832 gene locus_tag LOCUS_40160 40336 41832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324153.1 protein_id gnl|my_center|LOCUS_40160 41902 42876 gene locus_tag LOCUS_40170 gene lolI 41902 42876 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_40170 42879 44000 gene locus_tag LOCUS_40180 42879 44000 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887512.1 protein_id gnl|my_center|LOCUS_40180 44442 44035 gene locus_tag LOCUS_40190 44442 44035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 45778 44621 gene locus_tag LOCUS_40200 45778 44621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 47285 45804 gene locus_tag LOCUS_40210 gene guaB 47285 45804 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJL3 protein_id gnl|my_center|LOCUS_40210 48315 47416 gene locus_tag LOCUS_40220 gene rsmA 48315 47416 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR4 protein_id gnl|my_center|LOCUS_40220 48955 48338 gene locus_tag LOCUS_40230 gene ribE 48955 48338 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_870472.2 protein_id gnl|my_center|LOCUS_40230 49898 49011 gene locus_tag LOCUS_40240 gene pss 49898 49011 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119571.1 protein_id gnl|my_center|LOCUS_40240 50967 49918 gene locus_tag LOCUS_40250 50967 49918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 51444 52718 gene locus_tag LOCUS_40260 gene eno 51444 52718 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR2 protein_id gnl|my_center|LOCUS_40260 52988 53545 gene locus_tag LOCUS_40270 52988 53545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 53856 54122 gene locus_tag LOCUS_40280 53856 54122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 54877 54161 gene locus_tag LOCUS_40290 gene motB 54877 54161 CDS product MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_40290 55220 56407 gene locus_tag LOCUS_40300 gene rnd 55220 56407 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120569.1 protein_id gnl|my_center|LOCUS_40300 56467 56922 gene locus_tag LOCUS_40310 56467 56922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 57251 56934 gene locus_tag LOCUS_40320 57251 56934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 58480 57398 gene locus_tag LOCUS_40330 58480 57398 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326928.1 protein_id gnl|my_center|LOCUS_40330 60219 58717 gene locus_tag LOCUS_40340 60219 58717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 60259 60540 gene locus_tag LOCUS_40350 60259 60540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 62436 60541 gene locus_tag LOCUS_40360 gene lnt 62436 60541 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_40360 63873 62659 gene locus_tag LOCUS_40370 63873 62659 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_40370 64500 63895 gene locus_tag LOCUS_40380 gene trpG 64500 63895 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120844.1 protein_id gnl|my_center|LOCUS_40380 65038 66780 gene locus_tag LOCUS_40390 65038 66780 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_40390 66932 67906 gene locus_tag LOCUS_40400 gene rbsB 66932 67906 CDS product ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_40400 67910 69424 gene locus_tag LOCUS_40410 gene rbsA2 67910 69424 CDS product ribose import ATP-binding protein RbsA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDI1 protein_id gnl|my_center|LOCUS_40410 69411 70361 gene locus_tag LOCUS_40420 69411 70361 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_40420 70559 72898 gene locus_tag LOCUS_40430 70559 72898 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119225.1 protein_id gnl|my_center|LOCUS_40430 74875 72917 gene locus_tag LOCUS_40440 gene secA2 74875 72917 CDS product protein translocase subunit SecA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWI5 protein_id gnl|my_center|LOCUS_40440 76146 75244 gene locus_tag LOCUS_40450 76146 75244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 76869 76228 gene locus_tag LOCUS_40460 76869 76228 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121612.1 protein_id gnl|my_center|LOCUS_40460 77995 76925 gene locus_tag LOCUS_40470 77995 76925 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_40470 79515 78205 gene locus_tag LOCUS_40480 79515 78205 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_40480 81013 79544 gene locus_tag LOCUS_40490 gene pyk 81013 79544 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P2 protein_id gnl|my_center|LOCUS_40490 83708 81081 gene locus_tag LOCUS_40500 83708 81081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 84864 83911 gene locus_tag LOCUS_40510 gene yeaC 84864 83911 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_40510 85262 87370 gene locus_tag LOCUS_40520 85262 87370 CDS product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 protein_id gnl|my_center|LOCUS_40520 87496 88566 gene locus_tag LOCUS_40530 gene moxR 87496 88566 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_40530 88523 89428 gene locus_tag LOCUS_40540 88523 89428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_40540 89450 91699 gene locus_tag LOCUS_40550 89450 91699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 91796 91975 gene locus_tag LOCUS_40560 91796 91975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 92038 92496 gene locus_tag LOCUS_40570 92038 92496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 95173 92510 gene locus_tag LOCUS_40580 95173 92510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 95958 99221 gene locus_tag LOCUS_40590 gene carB 95958 99221 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ58 protein_id gnl|my_center|LOCUS_40590 100234 99755 gene locus_tag LOCUS_40600 100234 99755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 100552 102726 gene locus_tag LOCUS_40610 100552 102726 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020540.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence24 564 770 gene locus_tag LOCUS_40620 564 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 857 1876 gene locus_tag LOCUS_40630 857 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 1931 3475 gene locus_tag LOCUS_40640 1931 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 3526 4230 gene locus_tag LOCUS_40650 3526 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 4280 4690 gene locus_tag LOCUS_40660 gene nifU 4280 4690 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330765.1 protein_id gnl|my_center|LOCUS_40660 4687 7707 gene locus_tag LOCUS_40670 4687 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 9370 8186 gene locus_tag LOCUS_40680 gene xylR 9370 8186 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_40680 9369 9515 gene locus_tag LOCUS_40690 9369 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 9630 10796 gene locus_tag LOCUS_40700 9630 10796 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120646.1 protein_id gnl|my_center|LOCUS_40700 10952 13936 gene locus_tag LOCUS_40710 10952 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 14178 15440 gene locus_tag LOCUS_40720 14178 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 15802 16785 gene locus_tag LOCUS_40730 15802 16785 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_40730 16984 17319 gene locus_tag LOCUS_40740 16984 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 17563 17372 gene locus_tag LOCUS_40750 17563 17372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 20349 17491 gene locus_tag LOCUS_40760 20349 17491 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119333.1 protein_id gnl|my_center|LOCUS_40760 23527 20483 gene locus_tag LOCUS_40770 23527 20483 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119333.1 protein_id gnl|my_center|LOCUS_40770 24031 23549 gene locus_tag LOCUS_40780 24031 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 25247 24153 gene locus_tag LOCUS_40790 25247 24153 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_40790 26086 27666 gene locus_tag LOCUS_40800 26086 27666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 28000 29238 gene locus_tag LOCUS_40810 28000 29238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_40810 34015 29342 gene locus_tag LOCUS_40820 34015 29342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 36195 34834 gene locus_tag LOCUS_40830 36195 34834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_40830 37854 36388 gene locus_tag LOCUS_40840 37854 36388 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 protein_id gnl|my_center|LOCUS_40840 41040 37861 gene locus_tag LOCUS_40850 41040 37861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_40850 41424 44471 gene locus_tag LOCUS_40860 41424 44471 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_40860 44476 45936 gene locus_tag LOCUS_40870 44476 45936 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_40870 47449 46001 gene locus_tag LOCUS_40880 47449 46001 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117906.1 protein_id gnl|my_center|LOCUS_40880 50712 47515 gene locus_tag LOCUS_40890 50712 47515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_40890 52263 50902 gene locus_tag LOCUS_40900 gene atoC 52263 50902 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122716.1 protein_id gnl|my_center|LOCUS_40900 53618 52266 gene locus_tag LOCUS_40910 53618 52266 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122715.1 protein_id gnl|my_center|LOCUS_40910 54198 55559 gene locus_tag LOCUS_40920 gene oprP 54198 55559 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119574.1 protein_id gnl|my_center|LOCUS_40920 55858 56223 gene locus_tag LOCUS_40930 55858 56223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 57052 56741 gene locus_tag LOCUS_40940 57052 56741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 58514 57216 gene locus_tag LOCUS_40950 58514 57216 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412289.1 protein_id gnl|my_center|LOCUS_40950 60032 58851 gene locus_tag LOCUS_40960 60032 58851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 62338 60242 gene locus_tag LOCUS_40970 62338 60242 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_40970 63690 62536 gene locus_tag LOCUS_40980 63690 62536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124103.1 protein_id gnl|my_center|LOCUS_40980 64061 63687 gene locus_tag LOCUS_40990 64061 63687 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331759.1 protein_id gnl|my_center|LOCUS_40990 65019 64168 gene locus_tag LOCUS_41000 65019 64168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124104.1 protein_id gnl|my_center|LOCUS_41000 67901 65226 gene locus_tag LOCUS_41010 67901 65226 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_41010 68231 68584 gene locus_tag LOCUS_41020 68231 68584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 68935 69207 gene locus_tag LOCUS_41030 68935 69207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 69223 70428 gene locus_tag LOCUS_41040 69223 70428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 70425 71609 gene locus_tag LOCUS_41050 70425 71609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 71694 72761 gene locus_tag LOCUS_41060 71694 72761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 72830 73378 gene locus_tag LOCUS_41070 72830 73378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 73774 74178 gene locus_tag LOCUS_41080 73774 74178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 74246 75553 gene locus_tag LOCUS_41090 74246 75553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 76298 76777 gene locus_tag LOCUS_41100 76298 76777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 78290 76902 gene locus_tag LOCUS_41110 78290 76902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_41110 78396 78545 gene locus_tag LOCUS_41120 78396 78545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 78583 81093 gene locus_tag LOCUS_41130 78583 81093 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_41130 81123 83522 gene locus_tag LOCUS_41140 81123 83522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 84997 83579 gene locus_tag LOCUS_41150 gene atsG 84997 83579 CDS product sulfatase atsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122623.1 protein_id gnl|my_center|LOCUS_41150 87154 85115 gene locus_tag LOCUS_41160 87154 85115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 87556 90528 gene locus_tag LOCUS_41170 87556 90528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_41170 90578 92032 gene locus_tag LOCUS_41180 90578 92032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_41180 92555 92064 gene locus_tag LOCUS_41190 92555 92064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 92992 94056 gene locus_tag LOCUS_41200 92992 94056 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_41200 >Feature sequence25 552 295 gene locus_tag LOCUS_41210 552 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 1247 663 gene locus_tag LOCUS_41220 1247 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 2421 1786 gene locus_tag LOCUS_41230 2421 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 2819 2478 gene locus_tag LOCUS_41240 2819 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 3081 3557 gene locus_tag LOCUS_41250 3081 3557 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_41250 4722 5591 gene locus_tag LOCUS_41260 4722 5591 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118181.1 protein_id gnl|my_center|LOCUS_41260 5776 6102 gene locus_tag LOCUS_41270 5776 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 6145 7188 gene locus_tag LOCUS_41280 6145 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 7545 7225 gene locus_tag LOCUS_41290 7545 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_41290 7894 7553 gene locus_tag LOCUS_41300 7894 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 8344 11244 gene locus_tag LOCUS_41310 8344 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 11870 11358 gene locus_tag LOCUS_41320 11870 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 12353 12009 gene locus_tag LOCUS_41330 12353 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 12761 13216 gene locus_tag LOCUS_41340 12761 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 13462 14046 gene locus_tag LOCUS_41350 13462 14046 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW63 protein_id gnl|my_center|LOCUS_41350 14117 15286 gene locus_tag LOCUS_41360 14117 15286 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369257.1 protein_id gnl|my_center|LOCUS_41360 15396 16706 gene locus_tag LOCUS_41370 15396 16706 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 protein_id gnl|my_center|LOCUS_41370 16761 17684 gene locus_tag LOCUS_41380 gene lacC 16761 17684 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F04 protein_id gnl|my_center|LOCUS_41380 17684 18385 gene locus_tag LOCUS_41390 17684 18385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535853.1 protein_id gnl|my_center|LOCUS_41390 18509 18874 gene locus_tag LOCUS_41400 18509 18874 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072800.1 protein_id gnl|my_center|LOCUS_41400 20446 18893 gene locus_tag LOCUS_41410 20446 18893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266666.1 protein_id gnl|my_center|LOCUS_41410 21285 20542 gene locus_tag LOCUS_41420 gene ubiE 21285 20542 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_41420 22532 21336 gene locus_tag LOCUS_41430 22532 21336 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_41430 23479 22571 gene locus_tag LOCUS_41440 23479 22571 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_41440 23810 24604 gene locus_tag LOCUS_41450 23810 24604 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538235.1 protein_id gnl|my_center|LOCUS_41450 26354 24627 gene locus_tag LOCUS_41460 26354 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_41460 27329 26553 gene locus_tag LOCUS_41470 27329 26553 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_41470 27631 28242 gene locus_tag LOCUS_41480 gene sodA 27631 28242 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_41480 28412 28732 gene locus_tag LOCUS_41490 28412 28732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 28924 29280 gene locus_tag LOCUS_41500 28924 29280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 29607 31325 gene locus_tag LOCUS_41510 29607 31325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 35683 31346 gene locus_tag LOCUS_41520 35683 31346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 36827 35931 gene locus_tag LOCUS_41530 36827 35931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 38509 36827 gene locus_tag LOCUS_41540 gene ctpA 38509 36827 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119232.1 protein_id gnl|my_center|LOCUS_41540 40177 38945 gene locus_tag LOCUS_41550 gene pepT 40177 38945 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_41550 41339 40227 gene locus_tag LOCUS_41560 41339 40227 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_41560 41696 41770 gene locus_tag LOCUS_t00550 41696 41770 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 42757 41909 gene locus_tag LOCUS_41570 42757 41909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 43785 42757 gene locus_tag LOCUS_41580 43785 42757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 45576 44569 gene locus_tag LOCUS_41590 45576 44569 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_41590 46101 45664 gene locus_tag LOCUS_41600 46101 45664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 47268 46999 gene locus_tag LOCUS_41610 47268 46999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 47624 47421 gene locus_tag LOCUS_41620 47624 47421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 48005 48364 gene locus_tag LOCUS_41630 48005 48364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 48416 48718 gene locus_tag LOCUS_41640 48416 48718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 49036 50241 gene locus_tag LOCUS_41650 49036 50241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 50842 50279 gene locus_tag LOCUS_41660 50842 50279 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948431.1 protein_id gnl|my_center|LOCUS_41660 51258 52223 gene locus_tag LOCUS_41670 51258 52223 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_41670 52490 52960 gene locus_tag LOCUS_41680 52490 52960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 53583 53077 gene locus_tag LOCUS_41690 53583 53077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 54547 53588 gene locus_tag LOCUS_41700 54547 53588 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_41700 56213 55071 gene locus_tag LOCUS_41710 56213 55071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108907.1 protein_id gnl|my_center|LOCUS_41710 56407 57321 gene locus_tag LOCUS_41720 56407 57321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 58921 57401 gene locus_tag LOCUS_41730 58921 57401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119399.1 protein_id gnl|my_center|LOCUS_41730 59081 60805 gene locus_tag LOCUS_41740 59081 60805 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_41740 61964 60828 gene locus_tag LOCUS_41750 61964 60828 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020737.1 protein_id gnl|my_center|LOCUS_41750 63307 61961 gene locus_tag LOCUS_41760 gene cfa 63307 61961 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229043.1 protein_id gnl|my_center|LOCUS_41760 63861 65201 gene locus_tag LOCUS_41770 63861 65201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_41770 65318 67147 gene locus_tag LOCUS_41780 gene recQ 65318 67147 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120701.1 protein_id gnl|my_center|LOCUS_41780 67520 68437 gene locus_tag LOCUS_41790 67520 68437 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_41790 68427 68894 gene locus_tag LOCUS_41800 68427 68894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 69024 69806 gene locus_tag LOCUS_41810 69024 69806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 69850 71511 gene locus_tag LOCUS_41820 69850 71511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122614.1 protein_id gnl|my_center|LOCUS_41820 71630 72421 gene locus_tag LOCUS_41830 71630 72421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 72465 72896 gene locus_tag LOCUS_41840 72465 72896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 72883 74250 gene locus_tag LOCUS_41850 72883 74250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 76241 74790 gene locus_tag LOCUS_41860 76241 74790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120217.1 protein_id gnl|my_center|LOCUS_41860 76720 76307 gene locus_tag LOCUS_41870 76720 76307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 77761 76796 gene locus_tag LOCUS_41880 77761 76796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 78094 78543 gene locus_tag LOCUS_41890 gene yhfO 78094 78543 CDS product putative N-acetyltransferase YhfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07614 protein_id gnl|my_center|LOCUS_41890 78651 80054 gene locus_tag LOCUS_41900 gene rimK 78651 80054 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_41900 81397 80069 gene locus_tag LOCUS_41910 81397 80069 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120415.1 protein_id gnl|my_center|LOCUS_41910 82248 81499 gene locus_tag LOCUS_41920 82248 81499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 82535 82801 gene locus_tag LOCUS_41930 82535 82801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 82798 85035 gene locus_tag LOCUS_41940 gene sps 82798 85035 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336886.1 protein_id gnl|my_center|LOCUS_41940 85032 86999 gene locus_tag LOCUS_41950 85032 86999 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120322.1 protein_id gnl|my_center|LOCUS_41950 87016 89673 gene locus_tag LOCUS_41960 87016 89673 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120324.1 protein_id gnl|my_center|LOCUS_41960 90367 89963 gene locus_tag LOCUS_41970 90367 89963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 90625 91245 gene locus_tag LOCUS_41980 90625 91245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123243.1 protein_id gnl|my_center|LOCUS_41980 91457 91732 gene locus_tag LOCUS_41990 91457 91732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 92028 92894 gene locus_tag LOCUS_42000 92028 92894 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_42000 92937 93131 gene locus_tag LOCUS_42010 92937 93131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 93407 94711 gene locus_tag LOCUS_42020 93407 94711 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y94 protein_id gnl|my_center|LOCUS_42020 100154 95019 gene locus_tag LOCUS_42030 100154 95019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 101691 100369 gene locus_tag LOCUS_42040 101691 100369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_42040 >Feature sequence26 <1 1608 gene locus_tag LOCUS_42050 <1 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886845.1:copper-translocating P-type ATPase 2872 2207 gene locus_tag LOCUS_42060 2872 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 3432 2869 gene locus_tag LOCUS_42070 3432 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 4471 3419 gene locus_tag LOCUS_42080 4471 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 4774 4550 gene locus_tag LOCUS_42090 4774 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 5213 4998 gene locus_tag LOCUS_42100 5213 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 5573 5322 gene locus_tag LOCUS_42110 5573 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 6525 5584 gene locus_tag LOCUS_42120 6525 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 8047 6551 gene locus_tag LOCUS_42130 8047 6551 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057713.1 protein_id gnl|my_center|LOCUS_42130 8348 8094 gene locus_tag LOCUS_42140 8348 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 8952 8758 gene locus_tag LOCUS_42150 8952 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 9317 8949 gene locus_tag LOCUS_42160 9317 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 9888 9319 gene locus_tag LOCUS_42170 9888 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 10018 9827 gene locus_tag LOCUS_42180 10018 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 12391 10427 gene locus_tag LOCUS_42190 12391 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 13832 12462 gene locus_tag LOCUS_42200 13832 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 14039 13952 gene locus_tag LOCUS_t00560 14039 13952 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14325 14092 gene locus_tag LOCUS_42210 14325 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 14912 14595 gene locus_tag LOCUS_42220 14912 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 15913 17097 gene locus_tag LOCUS_42230 15913 17097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 17148 18494 gene locus_tag LOCUS_42240 17148 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_42240 20397 18496 gene locus_tag LOCUS_42250 20397 18496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 22103 20745 gene locus_tag LOCUS_42260 22103 20745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_42260 25122 22444 gene locus_tag LOCUS_42270 25122 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 25562 25119 gene locus_tag LOCUS_42280 25562 25119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 26611 25559 gene locus_tag LOCUS_42290 26611 25559 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_42290 27474 26686 gene locus_tag LOCUS_42300 27474 26686 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_42300 27585 28334 gene locus_tag LOCUS_42310 gene fabG2 27585 28334 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707219.1 protein_id gnl|my_center|LOCUS_42310 28606 28815 gene locus_tag LOCUS_42320 28606 28815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 29740 28832 gene locus_tag LOCUS_42330 29740 28832 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_42330 30679 29759 gene locus_tag LOCUS_42340 30679 29759 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_42340 30838 31881 gene locus_tag LOCUS_42350 30838 31881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_42350 32024 33352 gene locus_tag LOCUS_42360 32024 33352 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_42360 33490 33939 gene locus_tag LOCUS_42370 gene yjaB 33490 33939 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 protein_id gnl|my_center|LOCUS_42370 35348 33972 gene locus_tag LOCUS_42380 35348 33972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119021.1 protein_id gnl|my_center|LOCUS_42380 35637 35395 gene locus_tag LOCUS_42390 35637 35395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42390 37662 35734 gene locus_tag LOCUS_42400 37662 35734 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42400 37931 38803 gene locus_tag LOCUS_42410 37931 38803 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_42410 38955 40112 gene locus_tag LOCUS_42420 38955 40112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 40180 42438 gene locus_tag LOCUS_42430 40180 42438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 43816 42452 gene locus_tag LOCUS_42440 43816 42452 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085873.1 protein_id gnl|my_center|LOCUS_42440 45019 44123 gene locus_tag LOCUS_42450 45019 44123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 45879 45019 gene locus_tag LOCUS_42460 45879 45019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 46611 45883 gene locus_tag LOCUS_42470 46611 45883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 47870 46611 gene locus_tag LOCUS_42480 47870 46611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 49013 47877 gene locus_tag LOCUS_42490 49013 47877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 50877 49036 gene locus_tag LOCUS_42500 50877 49036 CDS product ornithine aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_42500 51345 50944 gene locus_tag LOCUS_42510 51345 50944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 52322 51525 gene locus_tag LOCUS_42520 52322 51525 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118949.1 protein_id gnl|my_center|LOCUS_42520 52820 52338 gene locus_tag LOCUS_42530 52820 52338 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119076.1 protein_id gnl|my_center|LOCUS_42530 53248 52832 gene locus_tag LOCUS_42540 53248 52832 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_42540 54141 53245 gene locus_tag LOCUS_42550 54141 53245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 55201 54143 gene locus_tag LOCUS_42560 55201 54143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 55793 55230 gene locus_tag LOCUS_42570 gene lspA 55793 55230 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MC09 protein_id gnl|my_center|LOCUS_42570 56877 55858 gene locus_tag LOCUS_42580 56877 55858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 58011 57037 gene locus_tag LOCUS_42590 58011 57037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 58337 59476 gene locus_tag LOCUS_42600 58337 59476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 59632 60378 gene locus_tag LOCUS_42610 59632 60378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123868.1 protein_id gnl|my_center|LOCUS_42610 60446 61702 gene locus_tag LOCUS_42620 60446 61702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123867.1 protein_id gnl|my_center|LOCUS_42620 62185 62520 gene locus_tag LOCUS_42630 62185 62520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 62683 63798 gene locus_tag LOCUS_42640 62683 63798 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_42640 63924 64733 gene locus_tag LOCUS_42650 63924 64733 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_42650 69279 64693 gene locus_tag LOCUS_42660 69279 64693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 69595 70311 gene locus_tag LOCUS_42670 gene pdxJ 69595 70311 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKM1 protein_id gnl|my_center|LOCUS_42670 70980 72392 gene locus_tag LOCUS_42680 gene glnA 70980 72392 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C40 protein_id gnl|my_center|LOCUS_42680 72525 72310 gene locus_tag LOCUS_42690 72525 72310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 72752 73195 gene locus_tag LOCUS_42700 72752 73195 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_42700 73769 74584 gene locus_tag LOCUS_42710 gene nagD 73769 74584 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULY1 protein_id gnl|my_center|LOCUS_42710 74812 75603 gene locus_tag LOCUS_42720 gene cysH 74812 75603 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADG3 protein_id gnl|my_center|LOCUS_42720 76515 75610 gene locus_tag LOCUS_42730 76515 75610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 76682 78187 gene locus_tag LOCUS_42740 gene GALNS 76682 78187 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_42740 81100 78200 gene locus_tag LOCUS_42750 81100 78200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 81851 81192 gene locus_tag LOCUS_42760 81851 81192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 82837 81857 gene locus_tag LOCUS_42770 gene trpS 82837 81857 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA4 protein_id gnl|my_center|LOCUS_42770 83855 82917 gene locus_tag LOCUS_42780 gene pyrD 83855 82917 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UML7 protein_id gnl|my_center|LOCUS_42780 84407 84189 gene locus_tag LOCUS_42790 84407 84189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 85396 84938 gene locus_tag LOCUS_42800 85396 84938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 86444 86013 gene locus_tag LOCUS_42810 86444 86013 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_42810 86583 87164 gene locus_tag LOCUS_42820 gene mobA 86583 87164 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH6 protein_id gnl|my_center|LOCUS_42820 88892 87180 gene locus_tag LOCUS_42830 88892 87180 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_42830 89844 89410 gene locus_tag LOCUS_42840 89844 89410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 91400 89877 gene locus_tag LOCUS_42850 gene leuA 91400 89877 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI51 protein_id gnl|my_center|LOCUS_42850 93504 91783 gene locus_tag LOCUS_42860 gene sir 93504 91783 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121401.1 protein_id gnl|my_center|LOCUS_42860 93806 94321 gene locus_tag LOCUS_42870 gene pgpA 93806 94321 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ6 protein_id gnl|my_center|LOCUS_42870 94392 95267 gene locus_tag LOCUS_42880 gene folD 94392 95267 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNN9 protein_id gnl|my_center|LOCUS_42880 95646 95386 gene locus_tag LOCUS_42890 95646 95386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 96133 97065 gene locus_tag LOCUS_42900 96133 97065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 97508 97774 gene locus_tag LOCUS_42910 97508 97774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 97771 98775 gene locus_tag LOCUS_42920 97771 98775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 100326 99994 gene locus_tag LOCUS_42930 100326 99994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence27 500 847 gene locus_tag LOCUS_42940 500 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 3061 1466 gene locus_tag LOCUS_42950 3061 1466 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_42950 5429 3240 gene locus_tag LOCUS_42960 5429 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 5990 8269 gene locus_tag LOCUS_42970 5990 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_42970 8272 9738 gene locus_tag LOCUS_42980 8272 9738 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_42980 10496 9798 gene locus_tag LOCUS_42990 10496 9798 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225250.1 protein_id gnl|my_center|LOCUS_42990 11817 10513 gene locus_tag LOCUS_43000 11817 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_43000 16194 11911 gene locus_tag LOCUS_43010 16194 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 17487 16423 gene locus_tag LOCUS_43020 17487 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 18905 17487 gene locus_tag LOCUS_43030 18905 17487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140647.1 protein_id gnl|my_center|LOCUS_43030 20567 18951 gene locus_tag LOCUS_43040 20567 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 21538 20648 gene locus_tag LOCUS_43050 21538 20648 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285667.1 protein_id gnl|my_center|LOCUS_43050 23787 21610 gene locus_tag LOCUS_43060 23787 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 24805 24014 gene locus_tag LOCUS_43070 gene map 24805 24014 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU68 protein_id gnl|my_center|LOCUS_43070 25020 25805 gene locus_tag LOCUS_43080 25020 25805 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387444.1 protein_id gnl|my_center|LOCUS_43080 28989 25828 gene locus_tag LOCUS_43090 gene mexF 28989 25828 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122351.1 protein_id gnl|my_center|LOCUS_43090 30188 29061 gene locus_tag LOCUS_43100 30188 29061 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_43100 30456 31196 gene locus_tag LOCUS_43110 30456 31196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 32378 31212 gene locus_tag LOCUS_43120 32378 31212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 32591 34093 gene locus_tag LOCUS_43130 32591 34093 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUQ1 protein_id gnl|my_center|LOCUS_43130 34456 34115 gene locus_tag LOCUS_43140 gene sui1 34456 34115 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326321.1 protein_id gnl|my_center|LOCUS_43140 36263 34470 gene locus_tag LOCUS_43150 gene uup 36263 34470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120247.1 protein_id gnl|my_center|LOCUS_43150 36707 36429 gene locus_tag LOCUS_43160 36707 36429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 37022 38200 gene locus_tag LOCUS_43170 37022 38200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 38277 38927 gene locus_tag LOCUS_43180 38277 38927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 38961 40439 gene locus_tag LOCUS_43190 38961 40439 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119180.1 protein_id gnl|my_center|LOCUS_43190 42230 40452 gene locus_tag LOCUS_43200 gene ybiT 42230 40452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122134.1 protein_id gnl|my_center|LOCUS_43200 42570 44054 gene locus_tag LOCUS_43210 42570 44054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 44089 45597 gene locus_tag LOCUS_43220 44089 45597 CDS product teichoic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_43220 45635 46816 gene locus_tag LOCUS_43230 45635 46816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 46868 48016 gene locus_tag LOCUS_43240 46868 48016 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_43240 48021 49286 gene locus_tag LOCUS_43250 48021 49286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 49334 50578 gene locus_tag LOCUS_43260 49334 50578 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021091.1 protein_id gnl|my_center|LOCUS_43260 50596 51333 gene locus_tag LOCUS_43270 50596 51333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 51363 52772 gene locus_tag LOCUS_43280 51363 52772 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_43280 52823 53407 gene locus_tag LOCUS_43290 gene cysE-1 52823 53407 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A19 protein_id gnl|my_center|LOCUS_43290 53404 54675 gene locus_tag LOCUS_43300 53404 54675 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_43300 54682 55875 gene locus_tag LOCUS_43310 54682 55875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 56253 57254 gene locus_tag LOCUS_43320 56253 57254 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_43320 60266 57261 gene locus_tag LOCUS_43330 60266 57261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 60654 61439 gene locus_tag LOCUS_43340 gene hydH 60654 61439 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121413.1 protein_id gnl|my_center|LOCUS_43340 61546 61630 gene locus_tag LOCUS_t00570 61546 61630 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 63104 61833 gene locus_tag LOCUS_43350 63104 61833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 64018 64482 gene locus_tag LOCUS_43360 64018 64482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 64615 64860 gene locus_tag LOCUS_43370 64615 64860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 65734 64808 gene locus_tag LOCUS_43380 65734 64808 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_43380 66614 65691 gene locus_tag LOCUS_43390 66614 65691 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_43390 67720 66611 gene locus_tag LOCUS_43400 67720 66611 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705996.1 protein_id gnl|my_center|LOCUS_43400 69034 69249 gene locus_tag LOCUS_43410 69034 69249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 70788 74027 gene locus_tag LOCUS_43420 70788 74027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 75893 76810 gene locus_tag LOCUS_43430 75893 76810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 76807 77838 gene locus_tag LOCUS_43440 76807 77838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 77835 78635 gene locus_tag LOCUS_43450 77835 78635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 78892 78683 gene locus_tag LOCUS_43460 78892 78683 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945907.1 protein_id gnl|my_center|LOCUS_43460 80512 78905 gene locus_tag LOCUS_43470 80512 78905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 81819 80509 gene locus_tag LOCUS_43480 81819 80509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 82677 81934 gene locus_tag LOCUS_43490 82677 81934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 83563 82811 gene locus_tag LOCUS_43500 gene rfbI 83563 82811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771814.1 protein_id gnl|my_center|LOCUS_43500 84356 83565 gene locus_tag LOCUS_43510 84356 83565 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731237.1 protein_id gnl|my_center|LOCUS_43510 85439 84363 gene locus_tag LOCUS_43520 85439 84363 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756756.1 protein_id gnl|my_center|LOCUS_43520 86546 87469 gene locus_tag LOCUS_43530 86546 87469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 87491 88486 gene locus_tag LOCUS_43540 87491 88486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 >Feature sequence28 469 768 gene locus_tag LOCUS_43550 469 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 1856 924 gene locus_tag LOCUS_43560 1856 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 2356 3147 gene locus_tag LOCUS_43570 2356 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 4419 3136 gene locus_tag LOCUS_43580 4419 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 4716 4635 gene locus_tag LOCUS_t00580 4716 4635 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5378 4854 gene locus_tag LOCUS_43590 gene yacH 5378 4854 CDS product UvrB/UvrC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_43590 5873 5490 gene locus_tag LOCUS_43600 5873 5490 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942259.1 protein_id gnl|my_center|LOCUS_43600 6838 5882 gene locus_tag LOCUS_43610 6838 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 8491 6995 gene locus_tag LOCUS_43620 8491 6995 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119180.1 protein_id gnl|my_center|LOCUS_43620 8771 9706 gene locus_tag LOCUS_43630 gene ribF 8771 9706 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFW8 protein_id gnl|my_center|LOCUS_43630 9782 10780 gene locus_tag LOCUS_43640 9782 10780 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_43640 10908 13961 gene locus_tag LOCUS_43650 10908 13961 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118999.1 protein_id gnl|my_center|LOCUS_43650 16528 14096 gene locus_tag LOCUS_43660 16528 14096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 17619 17176 gene locus_tag LOCUS_43670 gene blaI 17619 17176 CDS product penicillinase repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182645.1 protein_id gnl|my_center|LOCUS_43670 19915 17918 gene locus_tag LOCUS_43680 19915 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 20512 19994 gene locus_tag LOCUS_43690 20512 19994 CDS product menaquinol-cytochrome C reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290418.1 protein_id gnl|my_center|LOCUS_43690 21261 21034 gene locus_tag LOCUS_43700 21261 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 21582 21971 gene locus_tag LOCUS_43710 21582 21971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 23060 24421 gene locus_tag LOCUS_43720 23060 24421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 24460 25221 gene locus_tag LOCUS_43730 24460 25221 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_43730 26063 25248 gene locus_tag LOCUS_43740 gene panB 26063 25248 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C32 protein_id gnl|my_center|LOCUS_43740 26713 27765 gene locus_tag LOCUS_43750 gene trx 26713 27765 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_43750 27821 28960 gene locus_tag LOCUS_43760 27821 28960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 29072 30262 gene locus_tag LOCUS_43770 gene bioF 29072 30262 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_43770 30352 31248 gene locus_tag LOCUS_43780 gene dhlA 30352 31248 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122685.1 protein_id gnl|my_center|LOCUS_43780 32523 31270 gene locus_tag LOCUS_43790 gene deaD 32523 31270 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121346.1 protein_id gnl|my_center|LOCUS_43790 34587 32590 gene locus_tag LOCUS_43800 gene ftsH1 34587 32590 CDS product ATP-dependent zinc metalloprotease FtsH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ7 protein_id gnl|my_center|LOCUS_43800 35721 34879 gene locus_tag LOCUS_43810 35721 34879 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_43810 35962 37140 gene locus_tag LOCUS_43820 35962 37140 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118418.1 protein_id gnl|my_center|LOCUS_43820 37637 39553 gene locus_tag LOCUS_43830 37637 39553 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118918.1 protein_id gnl|my_center|LOCUS_43830 40009 40848 gene locus_tag LOCUS_43840 gene rpoS 40009 40848 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTR4 protein_id gnl|my_center|LOCUS_43840 41953 40889 gene locus_tag LOCUS_43850 41953 40889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121746.1 protein_id gnl|my_center|LOCUS_43850 44286 41953 gene locus_tag LOCUS_43860 44286 41953 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_43860 47921 44283 gene locus_tag LOCUS_43870 47921 44283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 protein_id gnl|my_center|LOCUS_43870 50023 47924 gene locus_tag LOCUS_43880 50023 47924 CDS product inter-alpha-trypsin inhibitor heavy chain H2 [precursor] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_43880 50990 50052 gene locus_tag LOCUS_43890 50990 50052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_43890 52012 50987 gene locus_tag LOCUS_43900 gene moxR 52012 50987 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121741.1 protein_id gnl|my_center|LOCUS_43900 52861 52055 gene locus_tag LOCUS_43910 52861 52055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 55574 52914 gene locus_tag LOCUS_43920 55574 52914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121739.1 protein_id gnl|my_center|LOCUS_43920 56873 55902 gene locus_tag LOCUS_43930 56873 55902 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_43930 59352 57196 gene locus_tag LOCUS_43940 gene shc 59352 57196 CDS product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204722.1 protein_id gnl|my_center|LOCUS_43940 60595 59537 gene locus_tag LOCUS_43950 gene bioB 60595 59537 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53557 protein_id gnl|my_center|LOCUS_43950 61450 60851 gene locus_tag LOCUS_43960 61450 60851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 65100 61585 gene locus_tag LOCUS_43970 gene dnaE 65100 61585 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUS6 protein_id gnl|my_center|LOCUS_43970 65348 66568 gene locus_tag LOCUS_43980 65348 66568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 67077 66610 gene locus_tag LOCUS_43990 67077 66610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117810.1 protein_id gnl|my_center|LOCUS_43990 68171 67149 gene locus_tag LOCUS_44000 68171 67149 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_44000 68843 68553 gene locus_tag LOCUS_44010 68843 68553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 69951 68947 gene locus_tag LOCUS_44020 69951 68947 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122968.1 protein_id gnl|my_center|LOCUS_44020 70483 70013 gene locus_tag LOCUS_44030 70483 70013 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_44030 70706 71902 gene locus_tag LOCUS_44040 70706 71902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267172.1 protein_id gnl|my_center|LOCUS_44040 72053 72256 gene locus_tag LOCUS_44050 72053 72256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 72815 73624 gene locus_tag LOCUS_44060 gene guaA 72815 73624 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_44060 73921 74805 gene locus_tag LOCUS_44070 gene ypuG 73921 74805 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327962.1 protein_id gnl|my_center|LOCUS_44070 74989 77076 gene locus_tag LOCUS_44080 gene uvrB 74989 77076 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR2 protein_id gnl|my_center|LOCUS_44080 79711 77090 gene locus_tag LOCUS_44090 gene uvrA 79711 77090 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK42 protein_id gnl|my_center|LOCUS_44090 80209 79724 gene locus_tag LOCUS_44100 80209 79724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 80923 80609 gene locus_tag LOCUS_44110 80923 80609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 82427 81099 gene locus_tag LOCUS_44120 82427 81099 CDS product PhoPQ-activated pathogenicity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120441.1 protein_id gnl|my_center|LOCUS_44120 82976 82536 gene locus_tag LOCUS_44130 82976 82536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 84089 83082 gene locus_tag LOCUS_44140 gene pilE1 84089 83082 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_44140 84971 86335 gene locus_tag LOCUS_44150 gene murE 84971 86335 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819Q0 protein_id gnl|my_center|LOCUS_44150 86384 87796 gene locus_tag LOCUS_44160 gene murF 86384 87796 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9Q4 protein_id gnl|my_center|LOCUS_44160 88089 89195 gene locus_tag LOCUS_44170 gene mraY 88089 89195 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_44170 >Feature sequence29 1774 299 gene locus_tag LOCUS_44180 1774 299 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117906.1 protein_id gnl|my_center|LOCUS_44180 4998 1864 gene locus_tag LOCUS_44190 4998 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_44190 5715 7136 gene locus_tag LOCUS_44200 gene rtcB 5715 7136 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_44200 10154 7707 gene locus_tag LOCUS_44210 10154 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 10436 11989 gene locus_tag LOCUS_44220 10436 11989 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH36 protein_id gnl|my_center|LOCUS_44220 13081 12077 gene locus_tag LOCUS_44230 13081 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123831.1 protein_id gnl|my_center|LOCUS_44230 14800 13115 gene locus_tag LOCUS_44240 14800 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 15975 14848 gene locus_tag LOCUS_44250 15975 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 16205 17680 gene locus_tag LOCUS_44260 16205 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 17814 18827 gene locus_tag LOCUS_44270 gene wlbA 17814 18827 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_44270 18847 19650 gene locus_tag LOCUS_44280 18847 19650 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015757.1 protein_id gnl|my_center|LOCUS_44280 19770 21422 gene locus_tag LOCUS_44290 19770 21422 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800966.1 protein_id gnl|my_center|LOCUS_44290 21972 21514 gene locus_tag LOCUS_44300 21972 21514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 23066 22038 gene locus_tag LOCUS_44310 23066 22038 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324315.1 protein_id gnl|my_center|LOCUS_44310 24751 23123 gene locus_tag LOCUS_44320 24751 23123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 25281 24751 gene locus_tag LOCUS_44330 25281 24751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 25510 25947 gene locus_tag LOCUS_44340 25510 25947 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123483.1 protein_id gnl|my_center|LOCUS_44340 27376 25955 gene locus_tag LOCUS_44350 27376 25955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123574.1 protein_id gnl|my_center|LOCUS_44350 30143 27384 gene locus_tag LOCUS_44360 30143 27384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123573.1 protein_id gnl|my_center|LOCUS_44360 30467 31297 gene locus_tag LOCUS_44370 30467 31297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 31429 34944 gene locus_tag LOCUS_44380 31429 34944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 35002 37077 gene locus_tag LOCUS_44390 35002 37077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 38165 37074 gene locus_tag LOCUS_44400 38165 37074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 38434 38509 gene locus_tag LOCUS_t00590 38434 38509 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 40003 38702 gene locus_tag LOCUS_44410 40003 38702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 40961 40404 gene locus_tag LOCUS_44420 40961 40404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 41350 40985 gene locus_tag LOCUS_44430 41350 40985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 44047 41456 gene locus_tag LOCUS_44440 44047 41456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 45578 44037 gene locus_tag LOCUS_44450 45578 44037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 46586 45837 gene locus_tag LOCUS_44460 46586 45837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 47900 46710 gene locus_tag LOCUS_44470 gene mdoC 47900 46710 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816063.1 protein_id gnl|my_center|LOCUS_44470 48386 49408 gene locus_tag LOCUS_44480 gene hemH 48386 49408 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFZ7 protein_id gnl|my_center|LOCUS_44480 49734 49501 gene locus_tag LOCUS_44490 49734 49501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 51080 49734 gene locus_tag LOCUS_44500 gene rhlE 51080 49734 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948368.1 protein_id gnl|my_center|LOCUS_44500 51940 53313 gene locus_tag LOCUS_44510 51940 53313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_44510 53704 53925 gene locus_tag LOCUS_44520 53704 53925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 54581 54733 gene locus_tag LOCUS_44530 54581 54733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44530 55602 54901 gene locus_tag LOCUS_44540 55602 54901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 55818 56006 gene locus_tag LOCUS_44550 55818 56006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 56442 57455 gene locus_tag LOCUS_44560 56442 57455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 59044 58199 gene locus_tag LOCUS_44570 59044 58199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231174.2 protein_id gnl|my_center|LOCUS_44570 60998 59184 gene locus_tag LOCUS_44580 60998 59184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 61397 62587 gene locus_tag LOCUS_44590 61397 62587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 62618 65932 gene locus_tag LOCUS_44600 62618 65932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 66126 65962 gene locus_tag LOCUS_44610 66126 65962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 66775 66206 gene locus_tag LOCUS_44620 66775 66206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 67120 67605 gene locus_tag LOCUS_44630 67120 67605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 67649 68821 gene locus_tag LOCUS_44640 67649 68821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 68932 68750 gene locus_tag LOCUS_44650 68932 68750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 70696 69149 gene locus_tag LOCUS_44660 gene aslA 70696 69149 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_44660 71276 72226 gene locus_tag LOCUS_44670 71276 72226 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_44670 72396 72842 gene locus_tag LOCUS_44680 72396 72842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 73406 74176 gene locus_tag LOCUS_44690 73406 74176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941264.1 protein_id gnl|my_center|LOCUS_44690 74325 76652 gene locus_tag LOCUS_44700 74325 76652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 77084 78085 gene locus_tag LOCUS_44710 77084 78085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 78676 78230 gene locus_tag LOCUS_44720 78676 78230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 >Feature sequence30 4078 5511 gene locus_tag LOCUS_44730 4078 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 6574 5579 gene locus_tag LOCUS_44740 6574 5579 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250768.1 protein_id gnl|my_center|LOCUS_44740 7942 6779 gene locus_tag LOCUS_44750 7942 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 10113 8377 gene locus_tag LOCUS_44760 10113 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 10535 10110 gene locus_tag LOCUS_44770 10535 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 11269 10874 gene locus_tag LOCUS_44780 11269 10874 CDS product chromosome condensation protein CcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_44780 12527 11319 gene locus_tag LOCUS_44790 12527 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_44790 13732 12587 gene locus_tag LOCUS_44800 13732 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120897.1 protein_id gnl|my_center|LOCUS_44800 14027 15049 gene locus_tag LOCUS_44810 14027 15049 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774558.1 protein_id gnl|my_center|LOCUS_44810 15240 15713 gene locus_tag LOCUS_44820 15240 15713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 17106 15742 gene locus_tag LOCUS_44830 gene GALNS 17106 15742 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_44830 19304 17256 gene locus_tag LOCUS_44840 19304 17256 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072120.1 protein_id gnl|my_center|LOCUS_44840 19842 21641 gene locus_tag LOCUS_44850 gene deaD-1 19842 21641 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_44850 23223 21727 gene locus_tag LOCUS_44860 23223 21727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 23709 26414 gene locus_tag LOCUS_44870 gene polA 23709 26414 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123909.1 protein_id gnl|my_center|LOCUS_44870 26714 27358 gene locus_tag LOCUS_44880 gene coaE 26714 27358 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E081 protein_id gnl|my_center|LOCUS_44880 27574 29007 gene locus_tag LOCUS_44890 gene rho 27574 29007 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGV0 protein_id gnl|my_center|LOCUS_44890 29163 29645 gene locus_tag LOCUS_44900 gene ribH 29163 29645 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66041 protein_id gnl|my_center|LOCUS_44900 29723 30271 gene locus_tag LOCUS_44910 29723 30271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 31410 30277 gene locus_tag LOCUS_44920 31410 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 33897 31669 gene locus_tag LOCUS_44930 33897 31669 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119225.1 protein_id gnl|my_center|LOCUS_44930 34459 34809 gene locus_tag LOCUS_44940 34459 34809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 36708 34849 gene locus_tag LOCUS_44950 36708 34849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 37784 36927 gene locus_tag LOCUS_44960 gene nfo 37784 36927 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WII8 protein_id gnl|my_center|LOCUS_44960 38074 39441 gene locus_tag LOCUS_44970 38074 39441 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 protein_id gnl|my_center|LOCUS_44970 41012 39450 gene locus_tag LOCUS_44980 gene arsA 41012 39450 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_44980 41836 41132 gene locus_tag LOCUS_44990 41836 41132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 42437 41817 gene locus_tag LOCUS_45000 42437 41817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 43720 42434 gene locus_tag LOCUS_45010 43720 42434 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259610.1 protein_id gnl|my_center|LOCUS_45010 44159 45715 gene locus_tag LOCUS_45020 44159 45715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 46393 45758 gene locus_tag LOCUS_45030 46393 45758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 47136 46549 gene locus_tag LOCUS_45040 47136 46549 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142113.1 protein_id gnl|my_center|LOCUS_45040 49077 47173 gene locus_tag LOCUS_45050 49077 47173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 50278 49352 gene locus_tag LOCUS_45060 50278 49352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 50938 50627 gene locus_tag LOCUS_45070 50938 50627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 51249 51046 gene locus_tag LOCUS_45080 51249 51046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 51966 53027 gene locus_tag LOCUS_45090 51966 53027 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120584.1 protein_id gnl|my_center|LOCUS_45090 53283 54122 gene locus_tag LOCUS_45100 53283 54122 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122511.1 protein_id gnl|my_center|LOCUS_45100 55631 54258 gene locus_tag LOCUS_45110 55631 54258 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_45110 55957 57153 gene locus_tag LOCUS_45120 gene dinB 55957 57153 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_45120 59418 57187 gene locus_tag LOCUS_45130 gene natB 59418 57187 CDS product sodium extrusion protein NatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120937.1 protein_id gnl|my_center|LOCUS_45130 60194 59415 gene locus_tag LOCUS_45140 60194 59415 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327800.1 protein_id gnl|my_center|LOCUS_45140 60649 61905 gene locus_tag LOCUS_45150 60649 61905 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120510.1 protein_id gnl|my_center|LOCUS_45150 61957 62241 gene locus_tag LOCUS_45160 61957 62241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 62238 62705 gene locus_tag LOCUS_45170 62238 62705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 62797 63867 gene locus_tag LOCUS_45180 62797 63867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 63867 64439 gene locus_tag LOCUS_45190 63867 64439 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_45190 64704 64447 gene locus_tag LOCUS_45200 64704 64447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 64984 64799 gene locus_tag LOCUS_45210 64984 64799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 64973 66241 gene locus_tag LOCUS_45220 64973 66241 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729293.1 protein_id gnl|my_center|LOCUS_45220 67936 66887 gene locus_tag LOCUS_45230 67936 66887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 >Feature sequence31 352 1680 gene locus_tag LOCUS_45240 352 1680 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706069.1 protein_id gnl|my_center|LOCUS_45240 2262 1687 gene locus_tag LOCUS_45250 2262 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 3348 2464 gene locus_tag LOCUS_45260 3348 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 7239 3352 gene locus_tag LOCUS_45270 7239 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 9569 7671 gene locus_tag LOCUS_45280 9569 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 11126 9639 gene locus_tag LOCUS_45290 11126 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 12913 11174 gene locus_tag LOCUS_45300 gene gspK 12913 11174 CDS product general secretion pathway protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120491.1 protein_id gnl|my_center|LOCUS_45300 13853 12939 gene locus_tag LOCUS_45310 13853 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 14320 13850 gene locus_tag LOCUS_45320 14320 13850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 14937 14317 gene locus_tag LOCUS_45330 14937 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 15445 14987 gene locus_tag LOCUS_45340 15445 14987 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087289.1 protein_id gnl|my_center|LOCUS_45340 16742 15534 gene locus_tag LOCUS_45350 16742 15534 CDS product type IV pilus biogenesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_45350 18493 16811 gene locus_tag LOCUS_45360 18493 16811 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330716.1 protein_id gnl|my_center|LOCUS_45360 22117 18545 gene locus_tag LOCUS_45370 22117 18545 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119380.1 protein_id gnl|my_center|LOCUS_45370 22320 22114 gene locus_tag LOCUS_45380 22320 22114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 22704 23777 gene locus_tag LOCUS_45390 22704 23777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 25632 23812 gene locus_tag LOCUS_45400 25632 23812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 29261 25920 gene locus_tag LOCUS_45410 29261 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 29667 31178 gene locus_tag LOCUS_45420 29667 31178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 31681 31163 gene locus_tag LOCUS_45430 31681 31163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 33275 31836 gene locus_tag LOCUS_45440 33275 31836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_45440 34150 34638 gene locus_tag LOCUS_45450 34150 34638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 34981 34781 gene locus_tag LOCUS_45460 34981 34781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 34932 35216 gene locus_tag LOCUS_45470 34932 35216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 36201 35248 gene locus_tag LOCUS_45480 36201 35248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 37145 37600 gene locus_tag LOCUS_45490 37145 37600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 38006 37629 gene locus_tag LOCUS_45500 38006 37629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 38376 38564 gene locus_tag LOCUS_45510 38376 38564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 38994 38584 gene locus_tag LOCUS_45520 gene yciA 38994 38584 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261656.1 protein_id gnl|my_center|LOCUS_45520 40749 39055 gene locus_tag LOCUS_45530 40749 39055 CDS product pyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946889.1 protein_id gnl|my_center|LOCUS_45530 42480 40810 gene locus_tag LOCUS_45540 gene sfcA 42480 40810 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF5 protein_id gnl|my_center|LOCUS_45540 42794 43690 gene locus_tag LOCUS_45550 42794 43690 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_45550 43687 44745 gene locus_tag LOCUS_45560 43687 44745 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_45560 44893 46998 gene locus_tag LOCUS_45570 44893 46998 CDS product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 protein_id gnl|my_center|LOCUS_45570 47161 49479 gene locus_tag LOCUS_45580 47161 49479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 49545 50885 gene locus_tag LOCUS_45590 gene mucD 49545 50885 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122202.1 protein_id gnl|my_center|LOCUS_45590 51796 50897 gene locus_tag LOCUS_45600 51796 50897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 52534 51896 gene locus_tag LOCUS_45610 52534 51896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 53961 52594 gene locus_tag LOCUS_45620 gene GALNS 53961 52594 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_45620 55417 54059 gene locus_tag LOCUS_45630 55417 54059 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_45630 57737 55461 gene locus_tag LOCUS_45640 57737 55461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_45640 58119 59654 gene locus_tag LOCUS_45650 58119 59654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 59951 60700 gene locus_tag LOCUS_45660 59951 60700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 >Feature sequence32 1071 274 gene locus_tag LOCUS_45670 1071 274 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807737.1 protein_id gnl|my_center|LOCUS_45670 1691 1308 gene locus_tag LOCUS_45680 1691 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 2103 1711 gene locus_tag LOCUS_45690 2103 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 2700 2236 gene locus_tag LOCUS_45700 2700 2236 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003305140.1 protein_id gnl|my_center|LOCUS_45700 3201 2749 gene locus_tag LOCUS_45710 3201 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 3948 3283 gene locus_tag LOCUS_45720 3948 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 4775 3966 gene locus_tag LOCUS_45730 4775 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036393.1 protein_id gnl|my_center|LOCUS_45730 5377 5003 gene locus_tag LOCUS_45740 5377 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 6246 5485 gene locus_tag LOCUS_45750 6246 5485 CDS product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104707.1 protein_id gnl|my_center|LOCUS_45750 7000 6263 gene locus_tag LOCUS_45760 7000 6263 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810480.1 protein_id gnl|my_center|LOCUS_45760 7773 7057 gene locus_tag LOCUS_45770 7773 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 8275 7826 gene locus_tag LOCUS_45780 8275 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223324.1 protein_id gnl|my_center|LOCUS_45780 9413 8892 gene locus_tag LOCUS_45790 9413 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 10176 9529 gene locus_tag LOCUS_45800 10176 9529 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_45800 10738 10349 gene locus_tag LOCUS_45810 10738 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 12317 10809 gene locus_tag LOCUS_45820 gene gltD 12317 10809 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_45820 17047 12431 gene locus_tag LOCUS_45830 gene gltB 17047 12431 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_45830 18304 17315 gene locus_tag LOCUS_45840 18304 17315 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_45840 18920 20167 gene locus_tag LOCUS_45850 18920 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 20521 20288 gene locus_tag LOCUS_45860 20521 20288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 20873 20715 gene locus_tag LOCUS_45870 20873 20715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 21048 21371 gene locus_tag LOCUS_45880 21048 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 23709 21388 gene locus_tag LOCUS_45890 gene pepN 23709 21388 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_45890 24973 23966 gene locus_tag LOCUS_45900 24973 23966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147169.1 protein_id gnl|my_center|LOCUS_45900 25652 26893 gene locus_tag LOCUS_45910 25652 26893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 26993 27841 gene locus_tag LOCUS_45920 gene ctaC 26993 27841 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL9 protein_id gnl|my_center|LOCUS_45920 27838 29652 gene locus_tag LOCUS_45930 gene ctaD 27838 29652 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM0 protein_id gnl|my_center|LOCUS_45930 29684 30649 gene locus_tag LOCUS_45940 29684 30649 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_45940 30642 31583 gene locus_tag LOCUS_45950 gene ctaB 30642 31583 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_45950 31650 32663 gene locus_tag LOCUS_45960 31650 32663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 32746 33156 gene locus_tag LOCUS_45970 32746 33156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 33146 34108 gene locus_tag LOCUS_45980 33146 34108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123496.1 protein_id gnl|my_center|LOCUS_45980 34105 34965 gene locus_tag LOCUS_45990 34105 34965 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJF6 protein_id gnl|my_center|LOCUS_45990 35010 36428 gene locus_tag LOCUS_46000 35010 36428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 36518 36829 gene locus_tag LOCUS_46010 36518 36829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 37273 36851 gene locus_tag LOCUS_46020 37273 36851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 37546 37686 gene locus_tag LOCUS_46030 37546 37686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 38098 38418 gene locus_tag LOCUS_46040 38098 38418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 39229 38438 gene locus_tag LOCUS_46050 39229 38438 CDS product iron-dicitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_46050 40281 39244 gene locus_tag LOCUS_46060 40281 39244 CDS product corrinoid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_46060 41304 40285 gene locus_tag LOCUS_46070 41304 40285 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_46070 43758 41440 gene locus_tag LOCUS_46080 gene metE 43758 41440 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4V6 protein_id gnl|my_center|LOCUS_46080 44918 44430 gene locus_tag LOCUS_46090 44918 44430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 45616 45098 gene locus_tag LOCUS_46100 45616 45098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 46697 45723 gene locus_tag LOCUS_46110 46697 45723 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_46110 47384 47124 gene locus_tag LOCUS_46120 47384 47124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 48553 47471 gene locus_tag LOCUS_46130 gene nrdB 48553 47471 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK81 protein_id gnl|my_center|LOCUS_46130 51469 48623 gene locus_tag LOCUS_46140 gene nrdA 51469 48623 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MCP2 protein_id gnl|my_center|LOCUS_46140 53246 52260 gene locus_tag LOCUS_46150 gene ctrB 53246 52260 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122225.1 protein_id gnl|my_center|LOCUS_46150 53584 54996 gene locus_tag LOCUS_46160 gene der 53584 54996 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URJ8 protein_id gnl|my_center|LOCUS_46160 >Feature sequence33 292 690 gene locus_tag LOCUS_46170 292 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 764 3328 gene locus_tag LOCUS_46180 764 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 4150 3461 gene locus_tag LOCUS_46190 4150 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110398.1 protein_id gnl|my_center|LOCUS_46190 4783 4430 gene locus_tag LOCUS_46200 4783 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 5045 5392 gene locus_tag LOCUS_46210 5045 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 6474 5767 gene locus_tag LOCUS_46220 gene vanR 6474 5767 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227204.1 protein_id gnl|my_center|LOCUS_46220 6700 7611 gene locus_tag LOCUS_46230 6700 7611 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_46230 7676 8101 gene locus_tag LOCUS_46240 7676 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121901.1 protein_id gnl|my_center|LOCUS_46240 8161 9303 gene locus_tag LOCUS_46250 8161 9303 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_46250 9997 9689 gene locus_tag LOCUS_46260 9997 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224860.1 protein_id gnl|my_center|LOCUS_46260 10685 10311 gene locus_tag LOCUS_46270 10685 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 11352 10972 gene locus_tag LOCUS_46280 11352 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 12337 11531 gene locus_tag LOCUS_46290 12337 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 13198 12461 gene locus_tag LOCUS_46300 13198 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 13573 13418 gene locus_tag LOCUS_46310 13573 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 14794 13802 gene locus_tag LOCUS_46320 14794 13802 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_46320 15908 15240 gene locus_tag LOCUS_46330 gene pcp 15908 15240 CDS product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIJ5 protein_id gnl|my_center|LOCUS_46330 17544 16039 gene locus_tag LOCUS_46340 17544 16039 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_46340 18014 17676 gene locus_tag LOCUS_46350 18014 17676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016863.1 protein_id gnl|my_center|LOCUS_46350 18715 18083 gene locus_tag LOCUS_46360 18715 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 19310 18795 gene locus_tag LOCUS_46370 19310 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 19441 21126 gene locus_tag LOCUS_46380 19441 21126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 21566 21162 gene locus_tag LOCUS_46390 21566 21162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 22318 21815 gene locus_tag LOCUS_46400 22318 21815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 22589 22347 gene locus_tag LOCUS_46410 22589 22347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 23120 22617 gene locus_tag LOCUS_46420 23120 22617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 23600 23175 gene locus_tag LOCUS_46430 23600 23175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 24028 23855 gene locus_tag LOCUS_46440 24028 23855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 24630 24193 gene locus_tag LOCUS_46450 24630 24193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 25547 24945 gene locus_tag LOCUS_46460 25547 24945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_46460 25927 25574 gene locus_tag LOCUS_46470 25927 25574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 26505 25999 gene locus_tag LOCUS_46480 26505 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 27123 26524 gene locus_tag LOCUS_46490 27123 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 27646 27209 gene locus_tag LOCUS_46500 27646 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 28516 27884 gene locus_tag LOCUS_46510 28516 27884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 28763 28527 gene locus_tag LOCUS_46520 28763 28527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 29125 28763 gene locus_tag LOCUS_46530 29125 28763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 29521 29150 gene locus_tag LOCUS_46540 29521 29150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 30136 29528 gene locus_tag LOCUS_46550 30136 29528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 30828 30241 gene locus_tag LOCUS_46560 30828 30241 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335808.1 protein_id gnl|my_center|LOCUS_46560 31670 30972 gene locus_tag LOCUS_46570 31670 30972 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261725.1 protein_id gnl|my_center|LOCUS_46570 32986 31808 gene locus_tag LOCUS_46580 32986 31808 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_46580 34129 33272 gene locus_tag LOCUS_46590 34129 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 34725 34180 gene locus_tag LOCUS_46600 34725 34180 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941232.1 protein_id gnl|my_center|LOCUS_46600 35545 34982 gene locus_tag LOCUS_46610 35545 34982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 36598 35762 gene locus_tag LOCUS_46620 36598 35762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 36969 36616 gene locus_tag LOCUS_46630 36969 36616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 37926 37066 gene locus_tag LOCUS_46640 37926 37066 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027437.1 protein_id gnl|my_center|LOCUS_46640 38329 39897 gene locus_tag LOCUS_46650 38329 39897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 41272 40274 gene locus_tag LOCUS_46660 gene rbsC 41272 40274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120702.1 protein_id gnl|my_center|LOCUS_46660 42825 41269 gene locus_tag LOCUS_46670 gene rbsA 42825 41269 CDS product sugar ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120703.1 protein_id gnl|my_center|LOCUS_46670 43763 42822 gene locus_tag LOCUS_46680 gene rbsB 43763 42822 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120704.1 protein_id gnl|my_center|LOCUS_46680 44751 43819 gene locus_tag LOCUS_46690 gene rbsK 44751 43819 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2F4 protein_id gnl|my_center|LOCUS_46690 45810 44764 gene locus_tag LOCUS_46700 45810 44764 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_46700 46885 45851 gene locus_tag LOCUS_46710 46885 45851 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_46710 48782 47283 gene locus_tag LOCUS_46720 48782 47283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 49079 50518 gene locus_tag LOCUS_46730 49079 50518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_46730 50804 51988 gene locus_tag LOCUS_46740 50804 51988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 53090 52344 gene locus_tag LOCUS_46750 gene fabG 53090 52344 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_46750 54279 53161 gene locus_tag LOCUS_46760 54279 53161 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_46760 54692 55786 gene locus_tag LOCUS_46770 54692 55786 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_46770 >Feature sequence34 3581 219 gene locus_tag LOCUS_46780 gene gdhP 3581 219 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_46780 3903 5183 gene locus_tag LOCUS_46790 gene glgC 3903 5183 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337168.1 protein_id gnl|my_center|LOCUS_46790 5355 6656 gene locus_tag LOCUS_46800 5355 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 6667 7891 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggattgattacgagtaaggatcgaatacact 8245 7940 gene locus_tag LOCUS_46810 8245 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 9171 8233 gene locus_tag LOCUS_46820 gene cas1 9171 8233 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_46820 12333 9316 gene locus_tag LOCUS_46830 gene cas9 12333 9316 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P897 protein_id gnl|my_center|LOCUS_46830 12971 12666 gene locus_tag LOCUS_46840 12971 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 13357 12968 gene locus_tag LOCUS_46850 13357 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 13486 13671 gene locus_tag LOCUS_46860 13486 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 14421 15335 gene locus_tag LOCUS_46870 14421 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 15382 15744 gene locus_tag LOCUS_46880 15382 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 15731 16294 gene locus_tag LOCUS_46890 15731 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 16593 16838 gene locus_tag LOCUS_46900 16593 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 16944 18029 gene locus_tag LOCUS_46910 16944 18029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 18849 18073 gene locus_tag LOCUS_46920 18849 18073 CDS product biofilm PGA synthesis protein PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336892.1 protein_id gnl|my_center|LOCUS_46920 20179 18881 gene locus_tag LOCUS_46930 20179 18881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 20484 21296 gene locus_tag LOCUS_46940 20484 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 21308 22138 gene locus_tag LOCUS_46950 21308 22138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 22152 22985 gene locus_tag LOCUS_46960 22152 22985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 23037 23780 gene locus_tag LOCUS_46970 23037 23780 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 protein_id gnl|my_center|LOCUS_46970 25273 23798 gene locus_tag LOCUS_46980 gene arsA 25273 23798 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_46980 25954 25340 gene locus_tag LOCUS_46990 gene adk 25954 25340 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHQ9 protein_id gnl|my_center|LOCUS_46990 26782 26174 gene locus_tag LOCUS_47000 gene rpsD 26782 26174 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM6 protein_id gnl|my_center|LOCUS_47000 28129 27131 gene locus_tag LOCUS_47010 28129 27131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 protein_id gnl|my_center|LOCUS_47010 29172 28171 gene locus_tag LOCUS_47020 gene nadE1 29172 28171 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KLS9 protein_id gnl|my_center|LOCUS_47020 30818 29262 gene locus_tag LOCUS_47030 30818 29262 CDS product AMP-dependent synthetase and ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 protein_id gnl|my_center|LOCUS_47030 31104 30838 gene locus_tag LOCUS_47040 31104 30838 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061274.1 protein_id gnl|my_center|LOCUS_47040 33133 31160 gene locus_tag LOCUS_47050 33133 31160 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887989.1 protein_id gnl|my_center|LOCUS_47050 33581 35170 gene locus_tag LOCUS_47060 33581 35170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 35531 35208 gene locus_tag LOCUS_47070 35531 35208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 35921 36937 gene locus_tag LOCUS_47080 35921 36937 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_47080 37853 36969 gene locus_tag LOCUS_47090 37853 36969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 39189 37981 gene locus_tag LOCUS_47100 gene citZ 39189 37981 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39120 protein_id gnl|my_center|LOCUS_47100 40190 41956 gene locus_tag LOCUS_47110 gene sigA 40190 41956 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQG1 protein_id gnl|my_center|LOCUS_47110 42156 42977 gene locus_tag LOCUS_47120 gene fabI 42156 42977 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK85 protein_id gnl|my_center|LOCUS_47120 43417 44037 gene locus_tag LOCUS_47130 43417 44037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 44042 46195 gene locus_tag LOCUS_47140 44042 46195 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_47140 46346 51676 gene locus_tag LOCUS_47150 46346 51676 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_47150 53744 52644 gene locus_tag LOCUS_47160 53744 52644 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888021.1 protein_id gnl|my_center|LOCUS_47160 >Feature sequence35 1715 186 gene locus_tag LOCUS_47170 1715 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_47170 1949 3226 gene locus_tag LOCUS_47180 1949 3226 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_47180 3231 4346 gene locus_tag LOCUS_47190 3231 4346 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI89 protein_id gnl|my_center|LOCUS_47190 4425 5801 gene locus_tag LOCUS_47200 gene uvrC 4425 5801 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD6 protein_id gnl|my_center|LOCUS_47200 6297 5848 gene locus_tag LOCUS_47210 6297 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 6728 6438 gene locus_tag LOCUS_47220 6728 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 7516 8436 gene locus_tag LOCUS_47230 7516 8436 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_47230 8660 8962 gene locus_tag LOCUS_47240 8660 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 9259 10245 gene locus_tag LOCUS_47250 9259 10245 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123048.1 protein_id gnl|my_center|LOCUS_47250 10367 11716 gene locus_tag LOCUS_47260 10367 11716 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390892.1 protein_id gnl|my_center|LOCUS_47260 12139 11726 gene locus_tag LOCUS_47270 12139 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 12511 12666 gene locus_tag LOCUS_47280 12511 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 13356 15473 gene locus_tag LOCUS_47290 gene glnN 13356 15473 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_47290 15601 16722 gene locus_tag LOCUS_47300 15601 16722 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121795.1 protein_id gnl|my_center|LOCUS_47300 17228 16740 gene locus_tag LOCUS_47310 17228 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 17516 17259 gene locus_tag LOCUS_47320 17516 17259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 17698 18240 gene locus_tag LOCUS_47330 17698 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118787.1 protein_id gnl|my_center|LOCUS_47330 19405 18317 gene locus_tag LOCUS_47340 19405 18317 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 protein_id gnl|my_center|LOCUS_47340 22382 19527 gene locus_tag LOCUS_47350 22382 19527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 22779 23126 gene locus_tag LOCUS_47360 22779 23126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 23213 23776 gene locus_tag LOCUS_47370 23213 23776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 24359 24904 gene locus_tag LOCUS_47380 24359 24904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 24904 26592 gene locus_tag LOCUS_47390 24904 26592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 28240 26984 gene locus_tag LOCUS_47400 28240 26984 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_47400 28593 28237 gene locus_tag LOCUS_47410 28593 28237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 protein_id gnl|my_center|LOCUS_47410 29075 28719 gene locus_tag LOCUS_47420 29075 28719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 protein_id gnl|my_center|LOCUS_47420 29190 29369 gene locus_tag LOCUS_47430 29190 29369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 29533 30243 gene locus_tag LOCUS_47440 29533 30243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 30568 33309 gene locus_tag LOCUS_47450 30568 33309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 33578 34036 gene locus_tag LOCUS_47460 33578 34036 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090697.1 protein_id gnl|my_center|LOCUS_47460 34036 34731 gene locus_tag LOCUS_47470 34036 34731 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 protein_id gnl|my_center|LOCUS_47470 35030 36031 gene locus_tag LOCUS_47480 35030 36031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 37310 36207 gene locus_tag LOCUS_47490 37310 36207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 39682 38687 gene locus_tag LOCUS_47500 39682 38687 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_47500 39928 40422 gene locus_tag LOCUS_47510 gene purE 39928 40422 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKX9 protein_id gnl|my_center|LOCUS_47510 40419 41558 gene locus_tag LOCUS_47520 gene purK 40419 41558 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQS2 protein_id gnl|my_center|LOCUS_47520 42266 41586 gene locus_tag LOCUS_47530 gene queE 42266 41586 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG8 protein_id gnl|my_center|LOCUS_47530 42426 43166 gene locus_tag LOCUS_47540 gene rph 42426 43166 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URE2 protein_id gnl|my_center|LOCUS_47540 43325 43963 gene locus_tag LOCUS_47550 43325 43963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 44770 44414 gene locus_tag LOCUS_47560 44770 44414 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093127.1 protein_id gnl|my_center|LOCUS_47560 45337 45822 gene locus_tag LOCUS_47570 45337 45822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 45893 46672 gene locus_tag LOCUS_47580 45893 46672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 46831 47847 gene locus_tag LOCUS_47590 46831 47847 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_47590 48259 49269 gene locus_tag LOCUS_47600 48259 49269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 49544 50134 gene locus_tag LOCUS_47610 49544 50134 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121085.1 protein_id gnl|my_center|LOCUS_47610 50761 50414 gene locus_tag LOCUS_47620 50761 50414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 51167 50892 gene locus_tag LOCUS_47630 51167 50892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 >Feature sequence36 393 465 gene locus_tag LOCUS_t00600 393 465 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 664 2136 gene locus_tag LOCUS_47640 gene tig 664 2136 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URG5 protein_id gnl|my_center|LOCUS_47640 2268 3077 gene locus_tag LOCUS_47650 2268 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 3241 9378 gene locus_tag LOCUS_47660 3241 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 11217 9394 gene locus_tag LOCUS_47670 gene typA 11217 9394 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120935.1 protein_id gnl|my_center|LOCUS_47670 11505 13118 gene locus_tag LOCUS_47680 11505 13118 CDS product N-acyl-D-amino-acid deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_47680 13120 13890 gene locus_tag LOCUS_47690 13120 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120568.1 protein_id gnl|my_center|LOCUS_47690 14976 13882 gene locus_tag LOCUS_47700 14976 13882 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118643.1 protein_id gnl|my_center|LOCUS_47700 16069 15062 gene locus_tag LOCUS_47710 16069 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 16452 17000 gene locus_tag LOCUS_47720 gene rfbC 16452 17000 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_47720 16997 18034 gene locus_tag LOCUS_47730 gene pdxA 16997 18034 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VV96 protein_id gnl|my_center|LOCUS_47730 18067 18735 gene locus_tag LOCUS_47740 18067 18735 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259011.1 protein_id gnl|my_center|LOCUS_47740 20219 18762 gene locus_tag LOCUS_47750 20219 18762 CDS product polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122555.1 protein_id gnl|my_center|LOCUS_47750 22440 20263 gene locus_tag LOCUS_47760 22440 20263 CDS product protein-xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123507.1 protein_id gnl|my_center|LOCUS_47760 22730 23209 gene locus_tag LOCUS_47770 22730 23209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 23573 23226 gene locus_tag LOCUS_47780 23573 23226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 24248 26245 gene locus_tag LOCUS_47790 24248 26245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 26381 27421 gene locus_tag LOCUS_47800 26381 27421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705582.1 protein_id gnl|my_center|LOCUS_47800 27497 28078 gene locus_tag LOCUS_47810 27497 28078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 28260 29183 gene locus_tag LOCUS_47820 28260 29183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 29185 29553 gene locus_tag LOCUS_47830 29185 29553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_47830 30854 29649 gene locus_tag LOCUS_47840 30854 29649 CDS product protein up-regulated by thyroid hormone- PQQ-dependent glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122629.1 protein_id gnl|my_center|LOCUS_47840 32196 30991 gene locus_tag LOCUS_47850 32196 30991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 33262 32237 gene locus_tag LOCUS_47860 33262 32237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_47860 33677 33447 gene locus_tag LOCUS_47870 33677 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 34151 34966 gene locus_tag LOCUS_47880 gene pfaS 34151 34966 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_47880 36205 34985 gene locus_tag LOCUS_47890 36205 34985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 36475 38286 gene locus_tag LOCUS_47900 36475 38286 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_47900 39803 38346 gene locus_tag LOCUS_47910 39803 38346 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_47910 40821 40108 gene locus_tag LOCUS_47920 40821 40108 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122587.1 protein_id gnl|my_center|LOCUS_47920 41040 41333 gene locus_tag LOCUS_47930 41040 41333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 41632 45186 gene locus_tag LOCUS_47940 41632 45186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 45191 46663 gene locus_tag LOCUS_47950 45191 46663 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_47950 46751 47458 gene locus_tag LOCUS_47960 46751 47458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 protein_id gnl|my_center|LOCUS_47960 >Feature sequence37 562 254 gene locus_tag LOCUS_47970 562 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 1542 766 gene locus_tag LOCUS_47980 1542 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 2324 1605 gene locus_tag LOCUS_47990 2324 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 3625 2747 gene locus_tag LOCUS_48000 3625 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 4551 3622 gene locus_tag LOCUS_48010 4551 3622 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_48010 5206 4691 gene locus_tag LOCUS_48020 5206 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 5539 6384 gene locus_tag LOCUS_48030 5539 6384 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_48030 6604 7416 gene locus_tag LOCUS_48040 6604 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 8438 7542 gene locus_tag LOCUS_48050 8438 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 8794 9669 gene locus_tag LOCUS_48060 8794 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 10324 9719 gene locus_tag LOCUS_48070 10324 9719 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530095.1 protein_id gnl|my_center|LOCUS_48070 10425 11171 gene locus_tag LOCUS_48080 10425 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_48080 11246 12547 gene locus_tag LOCUS_48090 11246 12547 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH36 protein_id gnl|my_center|LOCUS_48090 12619 13026 gene locus_tag LOCUS_48100 12619 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 14614 13055 gene locus_tag LOCUS_48110 gene zwf 14614 13055 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_48110 15824 14679 gene locus_tag LOCUS_48120 gene ispG 15824 14679 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWC8 protein_id gnl|my_center|LOCUS_48120 16031 17482 gene locus_tag LOCUS_48130 16031 17482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 17506 17901 gene locus_tag LOCUS_48140 17506 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 18994 17933 gene locus_tag LOCUS_48150 18994 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 19576 19163 gene locus_tag LOCUS_48160 19576 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 20630 19611 gene locus_tag LOCUS_48170 20630 19611 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330020.1 protein_id gnl|my_center|LOCUS_48170 22075 21563 gene locus_tag LOCUS_48180 22075 21563 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119636.1 protein_id gnl|my_center|LOCUS_48180 22606 22136 gene locus_tag LOCUS_48190 22606 22136 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_48190 23283 22681 gene locus_tag LOCUS_48200 23283 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 23429 23280 gene locus_tag LOCUS_48210 23429 23280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 24767 23721 gene locus_tag LOCUS_48220 24767 23721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122118.1 protein_id gnl|my_center|LOCUS_48220 28414 24836 gene locus_tag LOCUS_48230 28414 24836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 28991 29076 gene locus_tag LOCUS_t00610 28991 29076 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29196 30566 gene locus_tag LOCUS_48240 29196 30566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 30638 32602 gene locus_tag LOCUS_48250 30638 32602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 33047 33361 gene locus_tag LOCUS_48260 33047 33361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 33748 33368 gene locus_tag LOCUS_48270 33748 33368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 >Feature sequence38 169 414 gene locus_tag LOCUS_48280 169 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 369 662 gene locus_tag LOCUS_48290 369 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 1648 674 gene locus_tag LOCUS_48300 1648 674 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728439.1 protein_id gnl|my_center|LOCUS_48300 3158 1851 gene locus_tag LOCUS_48310 3158 1851 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_48310 4562 3411 gene locus_tag LOCUS_48320 4562 3411 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_48320 5500 4583 gene locus_tag LOCUS_48330 5500 4583 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_48330 6507 5701 gene locus_tag LOCUS_48340 6507 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 7837 6671 gene locus_tag LOCUS_48350 7837 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_48350 10657 8069 gene locus_tag LOCUS_48360 10657 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_48360 11557 10865 gene locus_tag LOCUS_48370 11557 10865 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_48370 12338 11637 gene locus_tag LOCUS_48380 12338 11637 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_48380 12537 13436 gene locus_tag LOCUS_48390 12537 13436 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_48390 13660 14091 gene locus_tag LOCUS_48400 13660 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 14271 14074 gene locus_tag LOCUS_48410 14271 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 14568 17066 gene locus_tag LOCUS_48420 14568 17066 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_48420 17082 18257 gene locus_tag LOCUS_48430 17082 18257 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_48430 18376 19404 gene locus_tag LOCUS_48440 18376 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121674.1 protein_id gnl|my_center|LOCUS_48440 20399 19698 gene locus_tag LOCUS_48450 20399 19698 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869088.1 protein_id gnl|my_center|LOCUS_48450 >Feature sequence39 70 876 gene locus_tag LOCUS_48460 70 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 1107 1778 gene locus_tag LOCUS_48470 1107 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 1835 2059 gene locus_tag LOCUS_48480 1835 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 2257 2496 gene locus_tag LOCUS_48490 2257 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020226.1 protein_id gnl|my_center|LOCUS_48490 2549 2773 gene locus_tag LOCUS_48500 2549 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020226.1 protein_id gnl|my_center|LOCUS_48500 2926 4929 gene locus_tag LOCUS_48510 2926 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 4926 5819 gene locus_tag LOCUS_48520 4926 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 5877 6521 gene locus_tag LOCUS_48530 5877 6521 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119950.1 protein_id gnl|my_center|LOCUS_48530 7014 8570 gene locus_tag LOCUS_48540 gene comM 7014 8570 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_48540 11567 8577 gene locus_tag LOCUS_48550 11567 8577 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122988.1 protein_id gnl|my_center|LOCUS_48550 12959 11892 gene locus_tag LOCUS_48560 12959 11892 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXK8 protein_id gnl|my_center|LOCUS_48560 13482 13303 gene locus_tag LOCUS_48570 13482 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 13442 14431 gene locus_tag LOCUS_48580 13442 14431 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_48580 14609 15067 gene locus_tag LOCUS_48590 14609 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 >Feature sequence40 5355 436 gene locus_tag LOCUS_48600 5355 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 6653 6378 gene locus_tag LOCUS_48610 6653 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 6868 7197 gene locus_tag LOCUS_48620 6868 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 7197 8039 gene locus_tag LOCUS_48630 7197 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 8039 11299 gene locus_tag LOCUS_48640 8039 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 12502 12275 gene locus_tag LOCUS_48650 12502 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 >Feature sequence41 1518 193 gene locus_tag LOCUS_48660 1518 193 CDS product cephalosporin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108337.1 protein_id gnl|my_center|LOCUS_48660 2832 1846 gene locus_tag LOCUS_48670 2832 1846 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_48670 3307 2888 gene locus_tag LOCUS_48680 3307 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 6068 3846 gene locus_tag LOCUS_48690 6068 3846 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_48690 6519 6959 gene locus_tag LOCUS_48700 6519 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 8877 7255 gene locus_tag LOCUS_48710 8877 7255 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_48710 9595 9047 gene locus_tag LOCUS_48720 gene fae 9595 9047 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 protein_id gnl|my_center|LOCUS_48720 11346 10024 gene locus_tag LOCUS_48730 11346 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 12450 11632 gene locus_tag LOCUS_48740 12450 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 >Feature sequence42 306 1052 gene locus_tag LOCUS_48750 gene recO 306 1052 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USC2 protein_id gnl|my_center|LOCUS_48750 1084 2535 gene locus_tag LOCUS_48760 1084 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 2544 3104 gene locus_tag LOCUS_48770 2544 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 3344 4453 gene locus_tag LOCUS_48780 3344 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 5009 4515 gene locus_tag LOCUS_48790 gene smpB 5009 4515 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH38 protein_id gnl|my_center|LOCUS_48790 5902 5153 gene locus_tag LOCUS_48800 5902 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 6379 9672 gene locus_tag LOCUS_48810 6379 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 9682 11148 gene locus_tag LOCUS_48820 9682 11148 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_48820 >Feature sequence43 2084 222 gene locus_tag LOCUS_48830 2084 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 2819 2172 gene locus_tag LOCUS_48840 gene nccH 2819 2172 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121583.1 protein_id gnl|my_center|LOCUS_48840 4205 7207 gene locus_tag LOCUS_48850 4205 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 7312 8223 gene locus_tag LOCUS_48860 7312 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 >Feature sequence44 515 1462 gene locus_tag LOCUS_48870 515 1462 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_48870 1567 2022 gene locus_tag LOCUS_48880 1567 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117810.1 protein_id gnl|my_center|LOCUS_48880 3225 2038 gene locus_tag LOCUS_48890 gene nagC 3225 2038 CDS product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705421.1 protein_id gnl|my_center|LOCUS_48890 4383 3922 gene locus_tag LOCUS_48900 gene rpiB 4383 3922 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_48900 5722 4532 gene locus_tag LOCUS_48910 5722 4532 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119140.1 protein_id gnl|my_center|LOCUS_48910 >Feature sequence45 2931 295 gene locus_tag LOCUS_48920 2931 295 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108597.1 protein_id gnl|my_center|LOCUS_48920 4127 3258 gene locus_tag LOCUS_48930 4127 3258 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_48930 5104 4604 gene locus_tag LOCUS_48940 5104 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 >Feature sequence46 524 838 gene locus_tag LOCUS_48950 524 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 831 1355 gene locus_tag LOCUS_48960 831 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 2456 1515 gene locus_tag LOCUS_48970 2456 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 2605 2486 gene locus_tag LOCUS_48980 2605 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 4043 2736 gene locus_tag LOCUS_48990 4043 2736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_48990 >Feature sequence47 333 2513 gene locus_tag LOCUS_49000 333 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 2567 2944 gene locus_tag LOCUS_49010 2567 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 >Feature sequence48 1607 699 gene locus_tag LOCUS_49020 gene thyX 1607 699 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJB8 protein_id gnl|my_center|LOCUS_49020 2852 1788 gene locus_tag LOCUS_49030 2852 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 >Feature sequence49 420 1745 gene locus_tag LOCUS_49040 420 1745 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_49040 >Feature sequence50 358 1059 gene locus_tag LOCUS_49050 358 1059 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939913.1 protein_id gnl|my_center|LOCUS_49050 1177 2073 gene locus_tag LOCUS_49060 1177 2073 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_49060 2110 2580 gene locus_tag LOCUS_49070 2110 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 >Feature sequence51 578 270 gene locus_tag LOCUS_49080 578 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 1059 655 gene locus_tag LOCUS_49090 1059 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 1520 1167 gene locus_tag LOCUS_49100 1520 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100