>Feature sequence01 413 1030 gene locus_tag LOCUS_00010 413 1030 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970322.1 protein_id gnl|my_center|LOCUS_00010 1023 2408 gene locus_tag LOCUS_00020 1023 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3146 2544 gene locus_tag LOCUS_00030 3146 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4192 3143 gene locus_tag LOCUS_00040 4192 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4309 5133 gene locus_tag LOCUS_00050 4309 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5130 6011 gene locus_tag LOCUS_00060 5130 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6101 6430 gene locus_tag LOCUS_00070 6101 6430 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974257.1 protein_id gnl|my_center|LOCUS_00070 6485 9493 gene locus_tag LOCUS_00080 6485 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9490 10203 gene locus_tag LOCUS_00090 9490 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974261.1 protein_id gnl|my_center|LOCUS_00090 11655 10303 gene locus_tag LOCUS_00100 11655 10303 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_00100 13439 11781 gene locus_tag LOCUS_00110 13439 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13884 13495 gene locus_tag LOCUS_00120 13884 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14435 14142 gene locus_tag LOCUS_00130 14435 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16325 14439 gene locus_tag LOCUS_00140 16325 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18422 16833 gene locus_tag LOCUS_00150 18422 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19687 19262 gene locus_tag LOCUS_00160 19687 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20081 20602 gene locus_tag LOCUS_00170 20081 20602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20931 21800 gene locus_tag LOCUS_00180 20931 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21861 23042 gene locus_tag LOCUS_00190 21861 23042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23399 23070 gene locus_tag LOCUS_00200 23399 23070 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968628.1 protein_id gnl|my_center|LOCUS_00200 23683 23399 gene locus_tag LOCUS_00210 23683 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_00210 24054 24524 gene locus_tag LOCUS_00220 24054 24524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24521 25855 gene locus_tag LOCUS_00230 24521 25855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26420 25872 gene locus_tag LOCUS_00240 26420 25872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27227 26688 gene locus_tag LOCUS_00250 27227 26688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28346 27231 gene locus_tag LOCUS_00260 28346 27231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 28626 29027 gene locus_tag LOCUS_00270 28626 29027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29118 31196 gene locus_tag LOCUS_00280 29118 31196 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918848.1 protein_id gnl|my_center|LOCUS_00280 31193 32026 gene locus_tag LOCUS_00290 31193 32026 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918849.1 protein_id gnl|my_center|LOCUS_00290 34131 32101 gene locus_tag LOCUS_00300 34131 32101 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 protein_id gnl|my_center|LOCUS_00300 35159 34245 gene locus_tag LOCUS_00310 35159 34245 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3Y8 protein_id gnl|my_center|LOCUS_00310 36004 35192 gene locus_tag LOCUS_00320 36004 35192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_00320 36567 36031 gene locus_tag LOCUS_00330 36567 36031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037904.1 protein_id gnl|my_center|LOCUS_00330 37322 36579 gene locus_tag LOCUS_00340 37322 36579 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920895.1 protein_id gnl|my_center|LOCUS_00340 38340 37450 gene locus_tag LOCUS_00350 38340 37450 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_00350 39490 38450 gene locus_tag LOCUS_00360 39490 38450 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919229.1 protein_id gnl|my_center|LOCUS_00360 40650 39514 gene locus_tag LOCUS_00370 40650 39514 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888153.1 protein_id gnl|my_center|LOCUS_00370 41501 40722 gene locus_tag LOCUS_00380 41501 40722 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710178.1 protein_id gnl|my_center|LOCUS_00380 43125 41683 gene locus_tag LOCUS_00390 43125 41683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_00390 43431 44318 gene locus_tag LOCUS_00400 43431 44318 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821371.1 protein_id gnl|my_center|LOCUS_00400 45420 44332 gene locus_tag LOCUS_00410 45420 44332 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710078.1 protein_id gnl|my_center|LOCUS_00410 45803 47302 gene locus_tag LOCUS_00420 45803 47302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 47295 47657 gene locus_tag LOCUS_00430 47295 47657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48510 47725 gene locus_tag LOCUS_00440 48510 47725 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4H2 protein_id gnl|my_center|LOCUS_00440 49055 48516 gene locus_tag LOCUS_00450 49055 48516 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920703.1 protein_id gnl|my_center|LOCUS_00450 49378 49052 gene locus_tag LOCUS_00460 49378 49052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49447 50304 gene locus_tag LOCUS_00470 49447 50304 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_00470 51378 50347 gene locus_tag LOCUS_00480 51378 50347 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_00480 51532 52104 gene locus_tag LOCUS_00490 gene efp 51532 52104 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6U8 protein_id gnl|my_center|LOCUS_00490 53392 52610 gene locus_tag LOCUS_00500 53392 52610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 54744 53389 gene locus_tag LOCUS_00510 54744 53389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54964 55566 gene locus_tag LOCUS_00520 54964 55566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 56678 57460 gene locus_tag LOCUS_00530 56678 57460 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921553.1 protein_id gnl|my_center|LOCUS_00530 57542 58555 gene locus_tag LOCUS_00540 57542 58555 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_00540 58669 59538 gene locus_tag LOCUS_00550 58669 59538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60045 59584 gene locus_tag LOCUS_00560 60045 59584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 60554 60156 gene locus_tag LOCUS_00570 60554 60156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 61714 60728 gene locus_tag LOCUS_00580 61714 60728 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265998.1 protein_id gnl|my_center|LOCUS_00580 61911 62477 gene locus_tag LOCUS_00590 61911 62477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 62615 63148 gene locus_tag LOCUS_00600 gene fabA 62615 63148 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 protein_id gnl|my_center|LOCUS_00600 63219 64451 gene locus_tag LOCUS_00610 gene fabB 63219 64451 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 protein_id gnl|my_center|LOCUS_00610 64607 65776 gene locus_tag LOCUS_00620 gene metK2 64607 65776 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_00620 65786 66520 gene locus_tag LOCUS_00630 gene trmB 65786 66520 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX04 protein_id gnl|my_center|LOCUS_00630 66698 67297 gene locus_tag LOCUS_00640 gene rimP 66698 67297 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX01 protein_id gnl|my_center|LOCUS_00640 67294 69000 gene locus_tag LOCUS_00650 gene nusA 67294 69000 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SW5 protein_id gnl|my_center|LOCUS_00650 68969 69718 gene locus_tag LOCUS_00660 68969 69718 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917933.1 protein_id gnl|my_center|LOCUS_00660 69773 72391 gene locus_tag LOCUS_00670 69773 72391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72582 73172 gene locus_tag LOCUS_00680 72582 73172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 73216 73668 gene locus_tag LOCUS_00690 gene rbfA 73216 73668 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWZ3 protein_id gnl|my_center|LOCUS_00690 73676 74716 gene locus_tag LOCUS_00700 73676 74716 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185953.1 protein_id gnl|my_center|LOCUS_00700 76135 74741 gene locus_tag LOCUS_00710 76135 74741 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537057.1 protein_id gnl|my_center|LOCUS_00710 76390 77343 gene locus_tag LOCUS_00720 gene truB 76390 77343 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58063 protein_id gnl|my_center|LOCUS_00720 77360 77629 gene locus_tag LOCUS_00730 gene rpsO 77360 77629 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYT8 protein_id gnl|my_center|LOCUS_00730 77678 79891 gene locus_tag LOCUS_00740 gene pnp 77678 79891 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC32 protein_id gnl|my_center|LOCUS_00740 80052 80261 gene locus_tag LOCUS_00750 80052 80261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00750 80264 81010 gene locus_tag LOCUS_00760 80264 81010 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383432.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00760 81426 81016 gene locus_tag LOCUS_00770 81426 81016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 82363 81542 gene locus_tag LOCUS_00780 82363 81542 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918777.1 protein_id gnl|my_center|LOCUS_00780 82557 83642 gene locus_tag LOCUS_00790 82557 83642 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918776.1 protein_id gnl|my_center|LOCUS_00790 83746 84429 gene locus_tag LOCUS_00800 gene udk 83746 84429 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88WR0 protein_id gnl|my_center|LOCUS_00800 85281 84454 gene locus_tag LOCUS_00810 85281 84454 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 protein_id gnl|my_center|LOCUS_00810 86068 85286 gene locus_tag LOCUS_00820 gene bla 86068 85286 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFY5 protein_id gnl|my_center|LOCUS_00820 86910 86095 gene locus_tag LOCUS_00830 gene fabI 86910 86095 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEH0 protein_id gnl|my_center|LOCUS_00830 87178 89337 gene locus_tag LOCUS_00840 87178 89337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 90005 89442 gene locus_tag LOCUS_00850 gene rimM 90005 89442 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X39 protein_id gnl|my_center|LOCUS_00850 90605 90012 gene locus_tag LOCUS_00860 90605 90012 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921241.1 protein_id gnl|my_center|LOCUS_00860 91146 90679 gene locus_tag LOCUS_00870 91146 90679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 91537 91244 gene locus_tag LOCUS_00880 91537 91244 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709705.1 protein_id gnl|my_center|LOCUS_00880 91834 91541 gene locus_tag LOCUS_00890 91834 91541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 93348 91831 gene locus_tag LOCUS_00900 gene srp 93348 91831 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCF4 protein_id gnl|my_center|LOCUS_00900 93862 95007 gene locus_tag LOCUS_00910 gene hisC 93862 95007 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_00910 95980 95021 gene locus_tag LOCUS_00920 95980 95021 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067691.1 protein_id gnl|my_center|LOCUS_00920 96134 97363 gene locus_tag LOCUS_00930 96134 97363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 97467 97838 gene locus_tag LOCUS_00940 97467 97838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 98492 97860 gene locus_tag LOCUS_00950 98492 97860 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_00950 99357 98611 gene locus_tag LOCUS_00960 99357 98611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 100243 99503 gene locus_tag LOCUS_00970 100243 99503 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 protein_id gnl|my_center|LOCUS_00970 100794 100255 gene locus_tag LOCUS_00980 100794 100255 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919004.1 protein_id gnl|my_center|LOCUS_00980 102436 100781 gene locus_tag LOCUS_00990 102436 100781 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975275.1 protein_id gnl|my_center|LOCUS_00990 103095 102463 gene locus_tag LOCUS_01000 103095 102463 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919008.1 protein_id gnl|my_center|LOCUS_01000 103415 103095 gene locus_tag LOCUS_01010 103415 103095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 104215 103412 gene locus_tag LOCUS_01020 104215 103412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 104387 105328 gene locus_tag LOCUS_01030 104387 105328 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919001.1 protein_id gnl|my_center|LOCUS_01030 105523 108954 gene locus_tag LOCUS_01040 105523 108954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 110221 109037 gene locus_tag LOCUS_01050 110221 109037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 110682 110329 gene locus_tag LOCUS_01060 110682 110329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921491.1 protein_id gnl|my_center|LOCUS_01060 111094 111837 gene locus_tag LOCUS_01070 111094 111837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 111834 112679 gene locus_tag LOCUS_01080 111834 112679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_01080 112679 114553 gene locus_tag LOCUS_01090 112679 114553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_01090 114554 115594 gene locus_tag LOCUS_01100 114554 115594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 116272 115607 gene locus_tag LOCUS_01110 gene chrR 116272 115607 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918533.1 protein_id gnl|my_center|LOCUS_01110 116929 116330 gene locus_tag LOCUS_01120 116929 116330 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_01120 117173 117685 gene locus_tag LOCUS_01130 117173 117685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 119387 117702 gene locus_tag LOCUS_01140 119387 117702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 120021 119389 gene locus_tag LOCUS_01150 120021 119389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390583.1 protein_id gnl|my_center|LOCUS_01150 121150 120041 gene locus_tag LOCUS_01160 gene oprO 121150 120041 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_01160 121417 122589 gene locus_tag LOCUS_01170 gene rlmN 121417 122589 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABT6 protein_id gnl|my_center|LOCUS_01170 122618 123541 gene locus_tag LOCUS_01180 122618 123541 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083373.1 protein_id gnl|my_center|LOCUS_01180 123591 124313 gene locus_tag LOCUS_01190 123591 124313 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_01190 124528 124884 gene locus_tag LOCUS_01200 124528 124884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967147.1 protein_id gnl|my_center|LOCUS_01200 125268 125011 gene locus_tag LOCUS_01210 125268 125011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 126076 125270 gene locus_tag LOCUS_01220 126076 125270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 127382 126159 gene locus_tag LOCUS_01230 127382 126159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 127716 127507 gene locus_tag LOCUS_01240 127716 127507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 127715 128212 gene locus_tag LOCUS_01250 127715 128212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 128607 128233 gene locus_tag LOCUS_01260 128607 128233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 129497 128673 gene locus_tag LOCUS_01270 129497 128673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 129547 130338 gene locus_tag LOCUS_01280 129547 130338 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_01280 130338 131567 gene locus_tag LOCUS_01290 130338 131567 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268944.1 protein_id gnl|my_center|LOCUS_01290 132039 131572 gene locus_tag LOCUS_01300 gene tadA 132039 131572 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C334 protein_id gnl|my_center|LOCUS_01300 132088 132651 gene locus_tag LOCUS_01310 132088 132651 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_01310 133662 132742 gene locus_tag LOCUS_01320 gene pyrF 133662 132742 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_01320 134489 133659 gene locus_tag LOCUS_01330 134489 133659 CDS product endopeptidase DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639887.1 protein_id gnl|my_center|LOCUS_01330 134923 134489 gene locus_tag LOCUS_01340 134923 134489 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918024.1 protein_id gnl|my_center|LOCUS_01340 135543 135127 gene locus_tag LOCUS_01350 135543 135127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 136314 136673 gene locus_tag LOCUS_01360 136314 136673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 137153 136860 gene locus_tag LOCUS_01370 137153 136860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972463.1 protein_id gnl|my_center|LOCUS_01370 138164 137166 gene locus_tag LOCUS_01380 gene gpsA 138164 137166 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58141 protein_id gnl|my_center|LOCUS_01380 138221 138811 gene locus_tag LOCUS_01390 138221 138811 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969408.1 protein_id gnl|my_center|LOCUS_01390 139023 139157 gene locus_tag LOCUS_01400 139023 139157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 140331 139192 gene locus_tag LOCUS_01410 gene tsaD 140331 139192 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAF2 protein_id gnl|my_center|LOCUS_01410 140428 141486 gene locus_tag LOCUS_01420 140428 141486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 141483 142214 gene locus_tag LOCUS_01430 141483 142214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 142272 143864 gene locus_tag LOCUS_01440 142272 143864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 143868 145334 gene locus_tag LOCUS_01450 143868 145334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917964.1 protein_id gnl|my_center|LOCUS_01450 145562 147406 gene locus_tag LOCUS_01460 145562 147406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811975.1 protein_id gnl|my_center|LOCUS_01460 147498 148583 gene locus_tag LOCUS_01470 147498 148583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921516.1 protein_id gnl|my_center|LOCUS_01470 148707 149939 gene locus_tag LOCUS_01480 148707 149939 CDS product L-threonine dehydratase catabolic TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE74 protein_id gnl|my_center|LOCUS_01480 150036 150953 gene locus_tag LOCUS_01490 150036 150953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 152932 150986 gene locus_tag LOCUS_01500 152932 150986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 153927 153268 gene locus_tag LOCUS_01510 153927 153268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 153993 154847 gene locus_tag LOCUS_01520 153993 154847 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918939.1 protein_id gnl|my_center|LOCUS_01520 155614 154844 gene locus_tag LOCUS_01530 155614 154844 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_01530 155699 156877 gene locus_tag LOCUS_01540 155699 156877 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_01540 156874 157965 gene locus_tag LOCUS_01550 156874 157965 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 protein_id gnl|my_center|LOCUS_01550 158185 158604 gene locus_tag LOCUS_01560 gene infC 158185 158604 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H312 protein_id gnl|my_center|LOCUS_01560 158626 159075 gene locus_tag LOCUS_01570 158626 159075 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639995.1 protein_id gnl|my_center|LOCUS_01570 159262 159867 gene locus_tag LOCUS_01580 159262 159867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 159957 160181 gene locus_tag LOCUS_01590 gene rpmI 159957 160181 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCP8 protein_id gnl|my_center|LOCUS_01590 160241 160603 gene locus_tag LOCUS_01600 gene rplT 160241 160603 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8A6 protein_id gnl|my_center|LOCUS_01600 160624 160752 gene locus_tag LOCUS_01610 160624 160752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 160818 161855 gene locus_tag LOCUS_01620 160818 161855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 161949 163088 gene locus_tag LOCUS_01630 gene pheS 161949 163088 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H307 protein_id gnl|my_center|LOCUS_01630 163090 163758 gene locus_tag LOCUS_01640 163090 163758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 163755 164318 gene locus_tag LOCUS_01650 163755 164318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405423.1 protein_id gnl|my_center|LOCUS_01650 164358 166778 gene locus_tag LOCUS_01660 gene pheT 164358 166778 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9E5 protein_id gnl|my_center|LOCUS_01660 166983 167960 gene locus_tag LOCUS_01670 166983 167960 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637668.1 protein_id gnl|my_center|LOCUS_01670 168597 167953 gene locus_tag LOCUS_01680 168597 167953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 168967 168614 gene locus_tag LOCUS_01690 168967 168614 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I69 protein_id gnl|my_center|LOCUS_01690 169244 170764 gene locus_tag LOCUS_01700 gene gpmI 169244 170764 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC2 protein_id gnl|my_center|LOCUS_01700 171006 170773 gene locus_tag LOCUS_01710 171006 170773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 171845 171003 gene locus_tag LOCUS_01720 171845 171003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 172674 172090 gene locus_tag LOCUS_01730 172674 172090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 173294 172671 gene locus_tag LOCUS_01740 173294 172671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 175573 173333 gene locus_tag LOCUS_01750 175573 173333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 175830 176555 gene locus_tag LOCUS_01760 gene cobB 175830 176555 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2S6 protein_id gnl|my_center|LOCUS_01760 177593 176556 gene locus_tag LOCUS_01770 177593 176556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 177740 178495 gene locus_tag LOCUS_01780 177740 178495 CDS product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 protein_id gnl|my_center|LOCUS_01780 178970 178503 gene locus_tag LOCUS_01790 178970 178503 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_01790 180270 178975 gene locus_tag LOCUS_01800 180270 178975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920737.1 protein_id gnl|my_center|LOCUS_01800 180420 180980 gene locus_tag LOCUS_01810 180420 180980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 181003 181503 gene locus_tag LOCUS_01820 181003 181503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 182319 181507 gene locus_tag LOCUS_01830 gene xthA3 182319 181507 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 protein_id gnl|my_center|LOCUS_01830 183478 182657 gene locus_tag LOCUS_01840 183478 182657 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WR1 protein_id gnl|my_center|LOCUS_01840 184226 183558 gene locus_tag LOCUS_01850 184226 183558 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973902.1 protein_id gnl|my_center|LOCUS_01850 186816 184300 gene locus_tag LOCUS_01860 gene ftsK 186816 184300 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A262 protein_id gnl|my_center|LOCUS_01860 188408 187101 gene locus_tag LOCUS_01870 gene amt-2 188408 187101 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_01870 188596 189858 gene locus_tag LOCUS_01880 188596 189858 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 protein_id gnl|my_center|LOCUS_01880 190231 189845 gene locus_tag LOCUS_01890 190231 189845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708243.1 protein_id gnl|my_center|LOCUS_01890 190440 190228 gene locus_tag LOCUS_01900 190440 190228 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9Z9 protein_id gnl|my_center|LOCUS_01900 191096 190437 gene locus_tag LOCUS_01910 191096 190437 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 protein_id gnl|my_center|LOCUS_01910 192096 191200 gene locus_tag LOCUS_01920 192096 191200 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 protein_id gnl|my_center|LOCUS_01920 192730 192203 gene locus_tag LOCUS_01930 192730 192203 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_01930 192886 193653 gene locus_tag LOCUS_01940 192886 193653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918001.1 protein_id gnl|my_center|LOCUS_01940 194763 193729 gene locus_tag LOCUS_01950 194763 193729 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967069.1 protein_id gnl|my_center|LOCUS_01950 195464 194904 gene locus_tag LOCUS_01960 195464 194904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 196789 195482 gene locus_tag LOCUS_01970 gene hslU 196789 195482 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN2 protein_id gnl|my_center|LOCUS_01970 197934 196786 gene locus_tag LOCUS_01980 197934 196786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338941.1 protein_id gnl|my_center|LOCUS_01980 198495 197938 gene locus_tag LOCUS_01990 gene hslV 198495 197938 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBH2 protein_id gnl|my_center|LOCUS_01990 200679 198568 gene locus_tag LOCUS_02000 200679 198568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 200815 201426 gene locus_tag LOCUS_02010 gene hisB 200815 201426 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A232 protein_id gnl|my_center|LOCUS_02010 201458 202102 gene locus_tag LOCUS_02020 gene hisH 201458 202102 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A231 protein_id gnl|my_center|LOCUS_02020 202139 202867 gene locus_tag LOCUS_02030 gene hisA 202139 202867 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBG7 protein_id gnl|my_center|LOCUS_02030 202957 203685 gene locus_tag LOCUS_02040 202957 203685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 203756 204517 gene locus_tag LOCUS_02050 gene hisF 203756 204517 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y413 protein_id gnl|my_center|LOCUS_02050 204553 204909 gene locus_tag LOCUS_02060 gene hisE 204553 204909 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50935 protein_id gnl|my_center|LOCUS_02060 205859 204906 gene locus_tag LOCUS_02070 gene parB 205859 204906 CDS product chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV8 protein_id gnl|my_center|LOCUS_02070 206659 205856 gene locus_tag LOCUS_02080 gene parA 206659 205856 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV7 protein_id gnl|my_center|LOCUS_02080 206853 206656 gene locus_tag LOCUS_02090 206853 206656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 209168 207303 gene locus_tag LOCUS_02100 gene mnmG 209168 207303 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW33 protein_id gnl|my_center|LOCUS_02100 210631 209267 gene locus_tag LOCUS_02110 gene mnmE 210631 209267 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX2 protein_id gnl|my_center|LOCUS_02110 211225 210872 gene locus_tag LOCUS_02120 211225 210872 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036578.1 protein_id gnl|my_center|LOCUS_02120 212531 211242 gene locus_tag LOCUS_02130 gene rho 212531 211242 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KW0 protein_id gnl|my_center|LOCUS_02130 213158 212700 gene locus_tag LOCUS_02140 213158 212700 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_02140 214197 213175 gene locus_tag LOCUS_02150 gene hemH 214197 213175 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57777 protein_id gnl|my_center|LOCUS_02150 215165 214197 gene locus_tag LOCUS_02160 gene hemE 215165 214197 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU9 protein_id gnl|my_center|LOCUS_02160 215606 216421 gene locus_tag LOCUS_02170 215606 216421 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 protein_id gnl|my_center|LOCUS_02170 216418 217023 gene locus_tag LOCUS_02180 216418 217023 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Q9 protein_id gnl|my_center|LOCUS_02180 217020 217850 gene locus_tag LOCUS_02190 gene aroE 217020 217850 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32B68 protein_id gnl|my_center|LOCUS_02190 217847 218467 gene locus_tag LOCUS_02200 gene coaE 217847 218467 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58100 protein_id gnl|my_center|LOCUS_02200 218464 219165 gene locus_tag LOCUS_02210 gene dnaQ 218464 219165 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083467.1 protein_id gnl|my_center|LOCUS_02210 219693 219166 gene locus_tag LOCUS_02220 gene secB 219693 219166 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW20 protein_id gnl|my_center|LOCUS_02220 219831 220430 gene locus_tag LOCUS_02230 219831 220430 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_02230 220676 221668 gene locus_tag LOCUS_02240 220676 221668 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_02240 221896 222231 gene locus_tag LOCUS_02250 221896 222231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 223251 222247 gene locus_tag LOCUS_02260 gene holA 223251 222247 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_02260 223736 223248 gene locus_tag LOCUS_02270 223736 223248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 226318 223736 gene locus_tag LOCUS_02280 gene leuS 226318 223736 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A217 protein_id gnl|my_center|LOCUS_02280 226851 226426 gene locus_tag LOCUS_02290 226851 226426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 227002 228162 gene locus_tag LOCUS_02300 227002 228162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 228269 228733 gene locus_tag LOCUS_02310 228269 228733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 229370 228756 gene locus_tag LOCUS_02320 229370 228756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 229369 230070 gene locus_tag LOCUS_02330 229369 230070 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067402.1 protein_id gnl|my_center|LOCUS_02330 230591 230076 gene locus_tag LOCUS_02340 230591 230076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 protein_id gnl|my_center|LOCUS_02340 230701 231387 gene locus_tag LOCUS_02350 230701 231387 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921570.1 protein_id gnl|my_center|LOCUS_02350 233520 231415 gene locus_tag LOCUS_02360 233520 231415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 234751 233558 gene locus_tag LOCUS_02370 234751 233558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 235201 235127 gene locus_tag LOCUS_t00010 235201 235127 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 236473 235385 gene locus_tag LOCUS_02380 236473 235385 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_02380 237096 236638 gene locus_tag LOCUS_02390 237096 236638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 237478 239394 gene locus_tag LOCUS_02400 gene dnaK 237478 239394 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY0 protein_id gnl|my_center|LOCUS_02400 239552 240688 gene locus_tag LOCUS_02410 gene dnaJ 239552 240688 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50018 protein_id gnl|my_center|LOCUS_02410 240782 241549 gene locus_tag LOCUS_02420 gene dapB 240782 241549 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_02420 241579 243030 gene locus_tag LOCUS_02430 gene amiE 241579 243030 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229130.1 protein_id gnl|my_center|LOCUS_02430 243940 243035 gene locus_tag LOCUS_02440 243940 243035 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_02440 244407 243940 gene locus_tag LOCUS_02450 244407 243940 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_02450 244924 244454 gene locus_tag LOCUS_02460 244924 244454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 245459 244971 gene locus_tag LOCUS_02470 245459 244971 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921557.1 protein_id gnl|my_center|LOCUS_02470 245583 246269 gene locus_tag LOCUS_02480 gene nth 245583 246269 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T20 protein_id gnl|my_center|LOCUS_02480 247165 246284 gene locus_tag LOCUS_02490 247165 246284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_02490 247271 248269 gene locus_tag LOCUS_02500 247271 248269 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921560.1 protein_id gnl|my_center|LOCUS_02500 248859 248266 gene locus_tag LOCUS_02510 248859 248266 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_02510 248944 249354 gene locus_tag LOCUS_02520 248944 249354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 249916 249329 gene locus_tag LOCUS_02530 gene grpE 249916 249329 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5E2 protein_id gnl|my_center|LOCUS_02530 250979 249909 gene locus_tag LOCUS_02540 gene hrcA 250979 249909 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP3 protein_id gnl|my_center|LOCUS_02540 251137 251868 gene locus_tag LOCUS_02550 gene rph 251137 251868 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP2 protein_id gnl|my_center|LOCUS_02550 251951 252802 gene locus_tag LOCUS_02560 251951 252802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 253065 252820 gene locus_tag LOCUS_02570 253065 252820 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_02570 253625 253089 gene locus_tag LOCUS_02580 253625 253089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 253791 254396 gene locus_tag LOCUS_02590 253791 254396 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_02590 254393 255553 gene locus_tag LOCUS_02600 254393 255553 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 protein_id gnl|my_center|LOCUS_02600 256932 255574 gene locus_tag LOCUS_02610 256932 255574 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083498.1 protein_id gnl|my_center|LOCUS_02610 256926 257891 gene locus_tag LOCUS_02620 gene rsmI 256926 257891 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5A7 protein_id gnl|my_center|LOCUS_02620 257884 258261 gene locus_tag LOCUS_02630 257884 258261 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN09 protein_id gnl|my_center|LOCUS_02630 258388 259155 gene locus_tag LOCUS_02640 258388 259155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 259200 260156 gene locus_tag LOCUS_02650 gene gshB 259200 260156 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABS9 protein_id gnl|my_center|LOCUS_02650 260175 260492 gene locus_tag LOCUS_02660 260175 260492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 260566 262101 gene locus_tag LOCUS_02670 gene chlI 260566 262101 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918029.1 protein_id gnl|my_center|LOCUS_02670 262206 263681 gene locus_tag LOCUS_02680 gene shkA 262206 263681 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918027.1 protein_id gnl|my_center|LOCUS_02680 263678 265393 gene locus_tag LOCUS_02690 263678 265393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 267812 265440 gene locus_tag LOCUS_02700 267812 265440 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 protein_id gnl|my_center|LOCUS_02700 267999 267823 gene locus_tag LOCUS_02710 267999 267823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 268002 270659 gene locus_tag LOCUS_02720 gene mutS 268002 270659 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC54 protein_id gnl|my_center|LOCUS_02720 270714 273539 gene locus_tag LOCUS_02730 gene glnD 270714 273539 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC53 protein_id gnl|my_center|LOCUS_02730 273552 275108 gene locus_tag LOCUS_02740 gene mviN 273552 275108 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4E4 protein_id gnl|my_center|LOCUS_02740 275212 276243 gene locus_tag LOCUS_02750 gene trpS 275212 276243 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC05 protein_id gnl|my_center|LOCUS_02750 276286 276816 gene locus_tag LOCUS_02760 276286 276816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 276911 277948 gene locus_tag LOCUS_02770 276911 277948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 278012 278497 gene locus_tag LOCUS_02780 278012 278497 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 protein_id gnl|my_center|LOCUS_02780 278607 279185 gene locus_tag LOCUS_02790 278607 279185 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639868.1 protein_id gnl|my_center|LOCUS_02790 279222 279896 gene locus_tag LOCUS_02800 279222 279896 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974252.1 protein_id gnl|my_center|LOCUS_02800 279896 280378 gene locus_tag LOCUS_02810 279896 280378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 280432 280839 gene locus_tag LOCUS_02820 280432 280839 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_02820 281126 280851 gene locus_tag LOCUS_02830 281126 280851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 281312 282679 gene locus_tag LOCUS_02840 gene miaB 281312 282679 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U7 protein_id gnl|my_center|LOCUS_02840 282676 283677 gene locus_tag LOCUS_02850 282676 283677 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917945.1 protein_id gnl|my_center|LOCUS_02850 283682 284170 gene locus_tag LOCUS_02860 gene ybeY 283682 284170 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W99 protein_id gnl|my_center|LOCUS_02860 284173 285123 gene locus_tag LOCUS_02870 gene corC 284173 285123 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 protein_id gnl|my_center|LOCUS_02870 285123 286811 gene locus_tag LOCUS_02880 gene lnt 285123 286811 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA1 protein_id gnl|my_center|LOCUS_02880 287010 287468 gene locus_tag LOCUS_02890 287010 287468 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970843.1 protein_id gnl|my_center|LOCUS_02890 287651 288442 gene locus_tag LOCUS_02900 287651 288442 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6P1 protein_id gnl|my_center|LOCUS_02900 288575 290002 gene locus_tag LOCUS_02910 gene qxtA 288575 290002 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339133.1 protein_id gnl|my_center|LOCUS_02910 289995 290996 gene locus_tag LOCUS_02920 289995 290996 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974381.1 protein_id gnl|my_center|LOCUS_02920 290996 291121 gene locus_tag LOCUS_02930 290996 291121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 291919 291185 gene locus_tag LOCUS_02940 291919 291185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 292139 293059 gene locus_tag LOCUS_02950 292139 293059 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123106.1 protein_id gnl|my_center|LOCUS_02950 293567 293920 gene locus_tag LOCUS_02960 293567 293920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 294451 293984 gene locus_tag LOCUS_02970 gene ptpA 294451 293984 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_02970 294810 294448 gene locus_tag LOCUS_02980 294810 294448 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919000.1 protein_id gnl|my_center|LOCUS_02980 294980 295543 gene locus_tag LOCUS_02990 294980 295543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 295853 295614 gene locus_tag LOCUS_03000 295853 295614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 296373 295906 gene locus_tag LOCUS_03010 gene dut 296373 295906 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_03010 296500 297438 gene locus_tag LOCUS_03020 296500 297438 CDS product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338408.1 protein_id gnl|my_center|LOCUS_03020 297586 297798 gene locus_tag LOCUS_03030 297586 297798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 298962 297679 gene locus_tag LOCUS_03040 298962 297679 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921539.1 protein_id gnl|my_center|LOCUS_03040 300060 299017 gene locus_tag LOCUS_03050 300060 299017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090763.1 protein_id gnl|my_center|LOCUS_03050 301671 300106 gene locus_tag LOCUS_03060 301671 300106 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A257 protein_id gnl|my_center|LOCUS_03060 302446 301685 gene locus_tag LOCUS_03070 gene ubiE 302446 301685 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVY5 protein_id gnl|my_center|LOCUS_03070 302532 303377 gene locus_tag LOCUS_03080 gene mutM 302532 303377 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_03080 303526 303789 gene locus_tag LOCUS_03090 gene rpsT 303526 303789 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY9 protein_id gnl|my_center|LOCUS_03090 304347 305867 gene locus_tag LOCUS_03100 gene dnaA 304347 305867 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 protein_id gnl|my_center|LOCUS_03100 306053 307171 gene locus_tag LOCUS_03110 gene dnaN 306053 307171 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP6 protein_id gnl|my_center|LOCUS_03110 307235 308365 gene locus_tag LOCUS_03120 gene recF 307235 308365 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP9 protein_id gnl|my_center|LOCUS_03120 308409 310850 gene locus_tag LOCUS_03130 gene gyrB 308409 310850 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX1 protein_id gnl|my_center|LOCUS_03130 311397 314372 gene locus_tag LOCUS_03140 gene btuB 311397 314372 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037537.1 protein_id gnl|my_center|LOCUS_03140 314475 315464 gene locus_tag LOCUS_03150 314475 315464 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531067.1 protein_id gnl|my_center|LOCUS_03150 315582 316244 gene locus_tag LOCUS_03160 315582 316244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 316265 318154 gene locus_tag LOCUS_03170 316265 318154 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 protein_id gnl|my_center|LOCUS_03170 318200 319285 gene locus_tag LOCUS_03180 318200 319285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_03180 319896 319297 gene locus_tag LOCUS_03190 319896 319297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 319998 320588 gene locus_tag LOCUS_03200 319998 320588 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_03200 320625 321638 gene locus_tag LOCUS_03210 320625 321638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 322274 321642 gene locus_tag LOCUS_03220 322274 321642 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L49 protein_id gnl|my_center|LOCUS_03220 323764 322313 gene locus_tag LOCUS_03230 gene hfsF 323764 322313 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920284.1 protein_id gnl|my_center|LOCUS_03230 324701 323844 gene locus_tag LOCUS_03240 324701 323844 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 protein_id gnl|my_center|LOCUS_03240 326253 324706 gene locus_tag LOCUS_03250 gene ftsY 326253 324706 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHH2 protein_id gnl|my_center|LOCUS_03250 327542 326250 gene locus_tag LOCUS_03260 327542 326250 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921511.1 protein_id gnl|my_center|LOCUS_03260 328136 327612 gene locus_tag LOCUS_03270 328136 327612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 328359 329858 gene locus_tag LOCUS_03280 328359 329858 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973724.1 protein_id gnl|my_center|LOCUS_03280 330685 329876 gene locus_tag LOCUS_03290 gene dapF 330685 329876 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A280 protein_id gnl|my_center|LOCUS_03290 331446 330883 gene locus_tag LOCUS_03300 331446 330883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 331586 333742 gene locus_tag LOCUS_03310 331586 333742 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 protein_id gnl|my_center|LOCUS_03310 333825 334244 gene locus_tag LOCUS_03320 333825 334244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 334373 334975 gene locus_tag LOCUS_03330 334373 334975 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_03330 337544 335088 gene locus_tag LOCUS_03340 337544 335088 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640169.1 protein_id gnl|my_center|LOCUS_03340 337720 337992 gene locus_tag LOCUS_03350 337720 337992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 338713 338003 gene locus_tag LOCUS_03360 338713 338003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 338824 340125 gene locus_tag LOCUS_03370 338824 340125 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_03370 340139 340573 gene locus_tag LOCUS_03380 340139 340573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 340678 341196 gene locus_tag LOCUS_03390 340678 341196 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972294.1 protein_id gnl|my_center|LOCUS_03390 341922 341323 gene locus_tag LOCUS_03400 341922 341323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 342633 342097 gene locus_tag LOCUS_03410 342633 342097 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919410.1 protein_id gnl|my_center|LOCUS_03410 343864 342755 gene locus_tag LOCUS_03420 343864 342755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 344772 343903 gene locus_tag LOCUS_03430 gene tesB 344772 343903 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_03430 344896 346692 gene locus_tag LOCUS_03440 344896 346692 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920158.1 protein_id gnl|my_center|LOCUS_03440 347790 346735 gene locus_tag LOCUS_03450 347790 346735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 348218 349114 gene locus_tag LOCUS_03460 348218 349114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 349248 350201 gene locus_tag LOCUS_03470 349248 350201 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_03470 350234 351733 gene locus_tag LOCUS_03480 350234 351733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 351782 353842 gene locus_tag LOCUS_03490 351782 353842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 <354664 353873 gene locus_tag LOCUS_03500 <354664 353873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971635.1:ferredoxin--NADP(+) reductase >Feature sequence02 212 442 gene locus_tag LOCUS_03510 212 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 587 820 gene locus_tag LOCUS_03520 587 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 817 1227 gene locus_tag LOCUS_03530 817 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_03530 1224 2867 gene locus_tag LOCUS_03540 1224 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3308 3219 gene locus_tag LOCUS_t00020 3308 3219 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4214 3369 gene locus_tag LOCUS_03550 gene rsmA 4214 3369 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA9 protein_id gnl|my_center|LOCUS_03550 5206 4211 gene locus_tag LOCUS_03560 gene pdxA1 5206 4211 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QZ0 protein_id gnl|my_center|LOCUS_03560 6554 5280 gene locus_tag LOCUS_03570 6554 5280 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7N3 protein_id gnl|my_center|LOCUS_03570 8992 6683 gene locus_tag LOCUS_03580 gene lptD 8992 6683 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA88 protein_id gnl|my_center|LOCUS_03580 10082 8976 gene locus_tag LOCUS_03590 10082 8976 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919560.1 protein_id gnl|my_center|LOCUS_03590 11179 10082 gene locus_tag LOCUS_03600 11179 10082 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919561.1 protein_id gnl|my_center|LOCUS_03600 11090 11284 gene locus_tag LOCUS_03610 11090 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 11350 12825 gene locus_tag LOCUS_03620 gene pepA 11350 12825 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8R6 protein_id gnl|my_center|LOCUS_03620 12831 13283 gene locus_tag LOCUS_03630 12831 13283 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919563.1 protein_id gnl|my_center|LOCUS_03630 13338 13805 gene locus_tag LOCUS_03640 gene ndk 13338 13805 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MS3 protein_id gnl|my_center|LOCUS_03640 13882 14217 gene locus_tag LOCUS_03650 13882 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989439.1 protein_id gnl|my_center|LOCUS_03650 14962 14249 gene locus_tag LOCUS_03660 14962 14249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15467 14946 gene locus_tag LOCUS_03670 15467 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 15691 16365 gene locus_tag LOCUS_03680 15691 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 17113 16469 gene locus_tag LOCUS_03690 gene purN 17113 16469 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S7 protein_id gnl|my_center|LOCUS_03690 18152 17118 gene locus_tag LOCUS_03700 gene purM 18152 17118 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C924 protein_id gnl|my_center|LOCUS_03700 18239 19246 gene locus_tag LOCUS_03710 18239 19246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 19246 19968 gene locus_tag LOCUS_03720 gene hdaA 19246 19968 CDS product chromosome replication protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919580.1 protein_id gnl|my_center|LOCUS_03720 19965 22265 gene locus_tag LOCUS_03730 gene ppk1 19965 22265 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7E3 protein_id gnl|my_center|LOCUS_03730 22278 23822 gene locus_tag LOCUS_03740 gene ppx1 22278 23822 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919577.1 protein_id gnl|my_center|LOCUS_03740 24980 23952 gene locus_tag LOCUS_03750 gene mhpE 24980 23952 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 protein_id gnl|my_center|LOCUS_03750 25927 24980 gene locus_tag LOCUS_03760 gene mhpF 25927 24980 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4P2 protein_id gnl|my_center|LOCUS_03760 26745 25945 gene locus_tag LOCUS_03770 gene mhpD 26745 25945 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XEC1 protein_id gnl|my_center|LOCUS_03770 27767 26910 gene locus_tag LOCUS_03780 gene purU 27767 26910 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2D5 protein_id gnl|my_center|LOCUS_03780 27953 29479 gene locus_tag LOCUS_03790 gene phoA 27953 29479 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_03790 29792 30430 gene locus_tag LOCUS_03800 29792 30430 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918657.1 protein_id gnl|my_center|LOCUS_03800 30473 31504 gene locus_tag LOCUS_03810 30473 31504 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918656.1 protein_id gnl|my_center|LOCUS_03810 32398 31517 gene locus_tag LOCUS_03820 32398 31517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 33371 32466 gene locus_tag LOCUS_03830 33371 32466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 34825 33983 gene locus_tag LOCUS_03840 34825 33983 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_03840 36575 34947 gene locus_tag LOCUS_03850 36575 34947 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 protein_id gnl|my_center|LOCUS_03850 37872 36655 gene locus_tag LOCUS_03860 37872 36655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 38998 37982 gene locus_tag LOCUS_03870 38998 37982 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921471.1 protein_id gnl|my_center|LOCUS_03870 39891 39064 gene locus_tag LOCUS_03880 gene cah 39891 39064 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083956.1 protein_id gnl|my_center|LOCUS_03880 40694 40008 gene locus_tag LOCUS_03890 40694 40008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 40783 43284 gene locus_tag LOCUS_03900 40783 43284 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974364.1 protein_id gnl|my_center|LOCUS_03900 43284 43778 gene locus_tag LOCUS_03910 43284 43778 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_03910 44736 43792 gene locus_tag LOCUS_03920 44736 43792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640008.1 protein_id gnl|my_center|LOCUS_03920 45779 44733 gene locus_tag LOCUS_03930 45779 44733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918455.1 protein_id gnl|my_center|LOCUS_03930 47068 45776 gene locus_tag LOCUS_03940 47068 45776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918454.1 protein_id gnl|my_center|LOCUS_03940 48021 47065 gene locus_tag LOCUS_03950 48021 47065 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918453.1 protein_id gnl|my_center|LOCUS_03950 49315 48008 gene locus_tag LOCUS_03960 49315 48008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918452.1 protein_id gnl|my_center|LOCUS_03960 49551 49312 gene locus_tag LOCUS_03970 49551 49312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 50581 50213 gene locus_tag LOCUS_03980 50581 50213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 51480 50560 gene locus_tag LOCUS_03990 51480 50560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 51714 52802 gene locus_tag LOCUS_04000 gene exoA 51714 52802 CDS product succinoglycan biosynthesis protein exoa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887908.1 protein_id gnl|my_center|LOCUS_04000 54002 53007 gene locus_tag LOCUS_04010 54002 53007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 54276 55637 gene locus_tag LOCUS_04020 gene exoQ 54276 55637 CDS product exopolysaccharide production protein ExoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887898.1 protein_id gnl|my_center|LOCUS_04020 55637 56593 gene locus_tag LOCUS_04030 gene exoO 55637 56593 CDS product succinoglycan biosynthesis protein ExoO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887910.1 protein_id gnl|my_center|LOCUS_04030 57026 58222 gene locus_tag LOCUS_04040 57026 58222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639895.1 protein_id gnl|my_center|LOCUS_04040 58289 60553 gene locus_tag LOCUS_04050 58289 60553 CDS product protein-tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_04050 61524 60619 gene locus_tag LOCUS_04060 61524 60619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 62674 61514 gene locus_tag LOCUS_04070 gene fabF 62674 61514 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_04070 62949 62674 gene locus_tag LOCUS_04080 gene acpP-1 62949 62674 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_04080 64186 62978 gene locus_tag LOCUS_04090 64186 62978 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964361.1 protein_id gnl|my_center|LOCUS_04090 65172 64162 gene locus_tag LOCUS_04100 65172 64162 CDS product putative ABC transporter, ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268969.1 protein_id gnl|my_center|LOCUS_04100 65280 66353 gene locus_tag LOCUS_04110 65280 66353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 66516 67949 gene locus_tag LOCUS_04120 66516 67949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384497.1 protein_id gnl|my_center|LOCUS_04120 67953 68894 gene locus_tag LOCUS_04130 67953 68894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708924.1 protein_id gnl|my_center|LOCUS_04130 68900 69706 gene locus_tag LOCUS_04140 68900 69706 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976011.1 protein_id gnl|my_center|LOCUS_04140 69749 70489 gene locus_tag LOCUS_04150 69749 70489 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_04150 70653 71807 gene locus_tag LOCUS_04160 70653 71807 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920587.1 protein_id gnl|my_center|LOCUS_04160 71969 72211 gene locus_tag LOCUS_04170 71969 72211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 74261 72216 gene locus_tag LOCUS_04180 74261 72216 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338564.1 protein_id gnl|my_center|LOCUS_04180 74378 75256 gene locus_tag LOCUS_04190 gene dapA 74378 75256 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A900 protein_id gnl|my_center|LOCUS_04190 75267 75746 gene locus_tag LOCUS_04200 gene smpB 75267 75746 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGL2 protein_id gnl|my_center|LOCUS_04200 75936 75861 gene locus_tag LOCUS_t00030 75936 75861 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 76106 76561 gene locus_tag LOCUS_04210 76106 76561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 77046 76564 gene locus_tag LOCUS_04220 77046 76564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 77178 78899 gene locus_tag LOCUS_04230 gene metG 77178 78899 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5U4 protein_id gnl|my_center|LOCUS_04230 80685 78913 gene locus_tag LOCUS_04240 80685 78913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 81638 80832 gene locus_tag LOCUS_04250 81638 80832 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919119.1 protein_id gnl|my_center|LOCUS_04250 81741 81826 gene locus_tag LOCUS_t00040 81741 81826 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 81946 82962 gene locus_tag LOCUS_04260 gene dusA 81946 82962 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7X0 protein_id gnl|my_center|LOCUS_04260 83518 82964 gene locus_tag LOCUS_04270 83518 82964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 83775 83515 gene locus_tag LOCUS_04280 83775 83515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 84112 85116 gene locus_tag LOCUS_04290 gene cobT 84112 85116 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9W4 protein_id gnl|my_center|LOCUS_04290 85234 85938 gene locus_tag LOCUS_04300 85234 85938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 86191 86565 gene locus_tag LOCUS_04310 gene nuoA 86191 86565 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C814 protein_id gnl|my_center|LOCUS_04310 86565 87122 gene locus_tag LOCUS_04320 gene nuoB 86565 87122 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWV5 protein_id gnl|my_center|LOCUS_04320 87119 87754 gene locus_tag LOCUS_04330 gene nuoC1 87119 87754 CDS product NADH-quinone oxidoreductase subunit C 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68854 protein_id gnl|my_center|LOCUS_04330 87759 88958 gene locus_tag LOCUS_04340 gene nuoD 87759 88958 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJA9 protein_id gnl|my_center|LOCUS_04340 88955 90169 gene locus_tag LOCUS_04350 88955 90169 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531093.1 protein_id gnl|my_center|LOCUS_04350 90171 90380 gene locus_tag LOCUS_04360 90171 90380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 90380 91687 gene locus_tag LOCUS_04370 gene nuoF 90380 91687 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919813.1 protein_id gnl|my_center|LOCUS_04370 91791 92096 gene locus_tag LOCUS_04380 91791 92096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 92096 94228 gene locus_tag LOCUS_04390 92096 94228 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH89 protein_id gnl|my_center|LOCUS_04390 94239 95321 gene locus_tag LOCUS_04400 gene nuoH 94239 95321 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C802 protein_id gnl|my_center|LOCUS_04400 95338 95826 gene locus_tag LOCUS_04410 gene nuoI1 95338 95826 CDS product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F0 protein_id gnl|my_center|LOCUS_04410 95765 95935 gene locus_tag LOCUS_04420 95765 95935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 95926 96552 gene locus_tag LOCUS_04430 gene nuoJ 95926 96552 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919807.1 protein_id gnl|my_center|LOCUS_04430 96549 96860 gene locus_tag LOCUS_04440 gene nuoK 96549 96860 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KJ8 protein_id gnl|my_center|LOCUS_04440 96881 99127 gene locus_tag LOCUS_04450 gene nuoL 96881 99127 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919805.1 protein_id gnl|my_center|LOCUS_04450 99129 100670 gene locus_tag LOCUS_04460 99129 100670 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_04460 100687 102108 gene locus_tag LOCUS_04470 gene nuoN 100687 102108 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7X8 protein_id gnl|my_center|LOCUS_04470 102530 102889 gene locus_tag LOCUS_04480 102530 102889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04480 102930 103727 gene locus_tag LOCUS_04490 gene coaX 102930 103727 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z1 protein_id gnl|my_center|LOCUS_04490 103724 105388 gene locus_tag LOCUS_04500 103724 105388 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_04500 105426 105842 gene locus_tag LOCUS_04510 105426 105842 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_04510 105861 106568 gene locus_tag LOCUS_04520 105861 106568 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_04520 106577 106843 gene locus_tag LOCUS_04530 106577 106843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 106924 108249 gene locus_tag LOCUS_04540 gene proS 106924 108249 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z5 protein_id gnl|my_center|LOCUS_04540 108254 109609 gene locus_tag LOCUS_04550 108254 109609 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919796.1 protein_id gnl|my_center|LOCUS_04550 109606 110310 gene locus_tag LOCUS_04560 gene lolD 109606 110310 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8R0 protein_id gnl|my_center|LOCUS_04560 110382 113843 gene locus_tag LOCUS_04570 gene dnaE1 110382 113843 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWS6 protein_id gnl|my_center|LOCUS_04570 113978 114835 gene locus_tag LOCUS_04580 gene rpsB 113978 114835 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWS3 protein_id gnl|my_center|LOCUS_04580 114883 115815 gene locus_tag LOCUS_04590 gene tsf 114883 115815 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFM2 protein_id gnl|my_center|LOCUS_04590 115889 116635 gene locus_tag LOCUS_04600 gene pyrH 115889 116635 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A705 protein_id gnl|my_center|LOCUS_04600 116651 117220 gene locus_tag LOCUS_04610 gene frr 116651 117220 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU06 protein_id gnl|my_center|LOCUS_04610 117268 117987 gene locus_tag LOCUS_04620 117268 117987 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU05 protein_id gnl|my_center|LOCUS_04620 118001 118840 gene locus_tag LOCUS_04630 gene cdsA 118001 118840 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KP8 protein_id gnl|my_center|LOCUS_04630 118878 120062 gene locus_tag LOCUS_04640 gene dxr 118878 120062 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_04640 120105 121280 gene locus_tag LOCUS_04650 120105 121280 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z6 protein_id gnl|my_center|LOCUS_04650 121323 123995 gene locus_tag LOCUS_04660 gene bamA 121323 123995 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9L0 protein_id gnl|my_center|LOCUS_04660 124007 124585 gene locus_tag LOCUS_04670 124007 124585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 124621 125619 gene locus_tag LOCUS_04680 gene lpxD 124621 125619 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A713 protein_id gnl|my_center|LOCUS_04680 125679 126470 gene locus_tag LOCUS_04690 gene lpxA 125679 126470 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR1 protein_id gnl|my_center|LOCUS_04690 126449 127339 gene locus_tag LOCUS_04700 gene lpxI 126449 127339 CDS product UDP-2,3-diacylglucosamine pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_04700 127336 128487 gene locus_tag LOCUS_04710 gene lpxB 127336 128487 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919775.1 protein_id gnl|my_center|LOCUS_04710 129849 128545 gene locus_tag LOCUS_04720 gene cisY 129849 128545 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ53 protein_id gnl|my_center|LOCUS_04720 131384 129897 gene locus_tag LOCUS_04730 gene gltX2 131384 129897 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_04730 133099 132779 gene locus_tag LOCUS_04740 133099 132779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 134200 133514 gene locus_tag LOCUS_04750 gene lexA 134200 133514 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A724 protein_id gnl|my_center|LOCUS_04750 135073 134279 gene locus_tag LOCUS_04760 gene trpC 135073 134279 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYF8 protein_id gnl|my_center|LOCUS_04760 136098 135070 gene locus_tag LOCUS_04770 gene trpD 136098 135070 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWP8 protein_id gnl|my_center|LOCUS_04770 136703 136095 gene locus_tag LOCUS_04780 136703 136095 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_04780 138136 136700 gene locus_tag LOCUS_04790 138136 136700 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919761.1 protein_id gnl|my_center|LOCUS_04790 140037 138133 gene locus_tag LOCUS_04800 140037 138133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 140282 140992 gene locus_tag LOCUS_04810 gene tpiA 140282 140992 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9X6 protein_id gnl|my_center|LOCUS_04810 141149 141592 gene locus_tag LOCUS_04820 gene secG 141149 141592 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971746.1 protein_id gnl|my_center|LOCUS_04820 141662 143302 gene locus_tag LOCUS_04830 gene pyrG 141662 143302 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW64 protein_id gnl|my_center|LOCUS_04830 143401 143583 gene locus_tag LOCUS_04840 gene rpmF 143401 143583 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ26 protein_id gnl|my_center|LOCUS_04840 143708 144985 gene locus_tag LOCUS_04850 gene eno 143708 144985 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFH1 protein_id gnl|my_center|LOCUS_04850 145114 145407 gene locus_tag LOCUS_04860 145114 145407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 145611 146576 gene locus_tag LOCUS_04870 gene pdhA 145611 146576 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E8 protein_id gnl|my_center|LOCUS_04870 146581 147975 gene locus_tag LOCUS_04880 146581 147975 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919595.1 protein_id gnl|my_center|LOCUS_04880 148021 149337 gene locus_tag LOCUS_04890 148021 149337 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C893 protein_id gnl|my_center|LOCUS_04890 149370 150788 gene locus_tag LOCUS_04900 149370 150788 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y975 protein_id gnl|my_center|LOCUS_04900 152389 150800 gene locus_tag LOCUS_04910 152389 150800 CDS product acyl-ACP synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919601.1 protein_id gnl|my_center|LOCUS_04910 152545 153504 gene locus_tag LOCUS_04920 gene lipA 152545 153504 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7I8 protein_id gnl|my_center|LOCUS_04920 153571 153987 gene locus_tag LOCUS_04930 153571 153987 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531488.1 protein_id gnl|my_center|LOCUS_04930 154481 153984 gene locus_tag LOCUS_04940 154481 153984 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919605.1 protein_id gnl|my_center|LOCUS_04940 155651 154500 gene locus_tag LOCUS_04950 gene ispDF 155651 154500 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7I5 protein_id gnl|my_center|LOCUS_04950 155782 156792 gene locus_tag LOCUS_04960 gene nifR 155782 156792 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ7 protein_id gnl|my_center|LOCUS_04960 156786 157865 gene locus_tag LOCUS_04970 gene ntrB 156786 157865 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707854.1 protein_id gnl|my_center|LOCUS_04970 157877 159295 gene locus_tag LOCUS_04980 gene ntrC 157877 159295 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919609.1 protein_id gnl|my_center|LOCUS_04980 159364 161598 gene locus_tag LOCUS_04990 159364 161598 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919610.1 protein_id gnl|my_center|LOCUS_04990 161598 162974 gene locus_tag LOCUS_05000 gene ntrX 161598 162974 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919611.1 protein_id gnl|my_center|LOCUS_05000 162998 164374 gene locus_tag LOCUS_05010 gene trkA 162998 164374 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_05010 164453 165802 gene locus_tag LOCUS_05020 gene trkH 164453 165802 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_05020 >Feature sequence03 267 1220 gene locus_tag LOCUS_05030 gene era 267 1220 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58071 protein_id gnl|my_center|LOCUS_05030 1293 1670 gene locus_tag LOCUS_05040 1293 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2908 1676 gene locus_tag LOCUS_05050 2908 1676 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_05050 3722 2823 gene locus_tag LOCUS_05060 3722 2823 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_05060 5062 3719 gene locus_tag LOCUS_05070 5062 3719 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_05070 6529 5090 gene locus_tag LOCUS_05080 gene phrA 6529 5090 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_05080 6710 6495 gene locus_tag LOCUS_05090 6710 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6696 8180 gene locus_tag LOCUS_05100 gene hldE 6696 8180 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY67 protein_id gnl|my_center|LOCUS_05100 9488 8181 gene locus_tag LOCUS_05110 9488 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_05110 9782 10546 gene locus_tag LOCUS_05120 9782 10546 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_05120 12622 10553 gene locus_tag LOCUS_05130 gene recG 12622 10553 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PS7 protein_id gnl|my_center|LOCUS_05130 12754 13461 gene locus_tag LOCUS_05140 12754 13461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13591 13860 gene locus_tag LOCUS_05150 13591 13860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975556.1 protein_id gnl|my_center|LOCUS_05150 13893 17351 gene locus_tag LOCUS_05160 gene mfd 13893 17351 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F5 protein_id gnl|my_center|LOCUS_05160 18170 17358 gene locus_tag LOCUS_05170 18170 17358 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921213.1 protein_id gnl|my_center|LOCUS_05170 18506 20833 gene locus_tag LOCUS_05180 18506 20833 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_05180 21593 20910 gene locus_tag LOCUS_05190 21593 20910 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918223.1 protein_id gnl|my_center|LOCUS_05190 21708 22577 gene locus_tag LOCUS_05200 21708 22577 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 protein_id gnl|my_center|LOCUS_05200 22574 23866 gene locus_tag LOCUS_05210 22574 23866 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_05210 25143 23854 gene locus_tag LOCUS_05220 gene popA 25143 23854 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919708.1 protein_id gnl|my_center|LOCUS_05220 25553 26206 gene locus_tag LOCUS_05230 gene tal 25553 26206 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F0 protein_id gnl|my_center|LOCUS_05230 27284 26232 gene locus_tag LOCUS_05240 gene dgcB 27284 26232 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919716.1 protein_id gnl|my_center|LOCUS_05240 28940 27444 gene locus_tag LOCUS_05250 28940 27444 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919713.1 protein_id gnl|my_center|LOCUS_05250 29320 31257 gene locus_tag LOCUS_05260 29320 31257 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 protein_id gnl|my_center|LOCUS_05260 31283 33217 gene locus_tag LOCUS_05270 31283 33217 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 protein_id gnl|my_center|LOCUS_05270 35232 33253 gene locus_tag LOCUS_05280 gene parE 35232 33253 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54479 protein_id gnl|my_center|LOCUS_05280 36069 35455 gene locus_tag LOCUS_05290 36069 35455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_05290 36673 36191 gene locus_tag LOCUS_05300 36673 36191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 38293 36866 gene locus_tag LOCUS_05310 38293 36866 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6W3 protein_id gnl|my_center|LOCUS_05310 38713 38375 gene locus_tag LOCUS_05320 gene glnB 38713 38375 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919834.1 protein_id gnl|my_center|LOCUS_05320 38987 40534 gene locus_tag LOCUS_05330 38987 40534 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6W7 protein_id gnl|my_center|LOCUS_05330 40632 40716 gene locus_tag LOCUS_t00050 40632 40716 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41618 40776 gene locus_tag LOCUS_05340 41618 40776 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H09 protein_id gnl|my_center|LOCUS_05340 41990 41784 gene locus_tag LOCUS_05350 41990 41784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 43420 42311 gene locus_tag LOCUS_05360 gene adhC 43420 42311 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GY0 protein_id gnl|my_center|LOCUS_05360 43527 44420 gene locus_tag LOCUS_05370 43527 44420 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920374.1 protein_id gnl|my_center|LOCUS_05370 44500 45114 gene locus_tag LOCUS_05380 44500 45114 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061445.1 protein_id gnl|my_center|LOCUS_05380 45200 46039 gene locus_tag LOCUS_05390 gene panB 45200 46039 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVL8 protein_id gnl|my_center|LOCUS_05390 46139 46864 gene locus_tag LOCUS_05400 46139 46864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919525.1 protein_id gnl|my_center|LOCUS_05400 46861 48198 gene locus_tag LOCUS_05410 46861 48198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 48324 49736 gene locus_tag LOCUS_05420 gene der 48324 49736 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R6 protein_id gnl|my_center|LOCUS_05420 51007 50678 gene locus_tag LOCUS_05430 51007 50678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 51822 51607 gene locus_tag LOCUS_05440 51822 51607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 52252 51935 gene locus_tag LOCUS_05450 52252 51935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 52698 53351 gene locus_tag LOCUS_05460 52698 53351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 54110 53403 gene locus_tag LOCUS_05470 54110 53403 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_05470 55177 54137 gene locus_tag LOCUS_05480 55177 54137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 55154 55636 gene locus_tag LOCUS_05490 55154 55636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 56246 55671 gene locus_tag LOCUS_05500 56246 55671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 57622 56252 gene locus_tag LOCUS_05510 gene radA 57622 56252 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R0 protein_id gnl|my_center|LOCUS_05510 58400 57633 gene locus_tag LOCUS_05520 58400 57633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_05520 59178 58402 gene locus_tag LOCUS_05530 59178 58402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921522.1 protein_id gnl|my_center|LOCUS_05530 60299 59184 gene locus_tag LOCUS_05540 gene alr 60299 59184 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KQ05 protein_id gnl|my_center|LOCUS_05540 61864 60386 gene locus_tag LOCUS_05550 61864 60386 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7A8 protein_id gnl|my_center|LOCUS_05550 62606 62016 gene locus_tag LOCUS_05560 gene rplI 62606 62016 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7G4 protein_id gnl|my_center|LOCUS_05560 62880 62620 gene locus_tag LOCUS_05570 gene rpsR 62880 62620 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLI9 protein_id gnl|my_center|LOCUS_05570 63384 62884 gene locus_tag LOCUS_05580 63384 62884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 63540 64493 gene locus_tag LOCUS_05590 63540 64493 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7P6 protein_id gnl|my_center|LOCUS_05590 64516 65256 gene locus_tag LOCUS_05600 64516 65256 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_05600 65372 65605 gene locus_tag LOCUS_05610 gene acpP 65372 65605 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKN9 protein_id gnl|my_center|LOCUS_05610 65634 66920 gene locus_tag LOCUS_05620 65634 66920 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA77 protein_id gnl|my_center|LOCUS_05620 66920 67999 gene locus_tag LOCUS_05630 66920 67999 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 protein_id gnl|my_center|LOCUS_05630 68048 68932 gene locus_tag LOCUS_05640 68048 68932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969071.1 protein_id gnl|my_center|LOCUS_05640 68942 69595 gene locus_tag LOCUS_05650 gene gmk 68942 69595 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_05650 69638 69865 gene locus_tag LOCUS_05660 69638 69865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 70656 71909 gene locus_tag LOCUS_05670 70656 71909 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_05670 72009 72179 gene locus_tag LOCUS_05680 72009 72179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 72185 74428 gene locus_tag LOCUS_05690 72185 74428 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074382.1 protein_id gnl|my_center|LOCUS_05690 74457 74909 gene locus_tag LOCUS_05700 74457 74909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 74984 76624 gene locus_tag LOCUS_05710 74984 76624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 77249 76977 gene locus_tag LOCUS_05720 77249 76977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 77741 77529 gene locus_tag LOCUS_05730 77741 77529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 80470 77741 gene locus_tag LOCUS_05740 80470 77741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 80841 80467 gene locus_tag LOCUS_05750 80841 80467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 81433 80855 gene locus_tag LOCUS_05760 81433 80855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 82186 81551 gene locus_tag LOCUS_05770 82186 81551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 82393 83340 gene locus_tag LOCUS_05780 82393 83340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 85251 83524 gene locus_tag LOCUS_05790 85251 83524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261758.1 protein_id gnl|my_center|LOCUS_05790 86972 85248 gene locus_tag LOCUS_05800 86972 85248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 87381 87506 gene locus_tag LOCUS_05810 87381 87506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 87701 88222 gene locus_tag LOCUS_05820 gene rfaY 87701 88222 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405237.1 protein_id gnl|my_center|LOCUS_05820 88215 88790 gene locus_tag LOCUS_05830 88215 88790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 90235 88970 gene locus_tag LOCUS_05840 gene tyrS 90235 88970 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A756 protein_id gnl|my_center|LOCUS_05840 90903 90526 gene locus_tag LOCUS_05850 90903 90526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 92428 91226 gene locus_tag LOCUS_05860 92428 91226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_05860 92979 92425 gene locus_tag LOCUS_05870 92979 92425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 93684 93022 gene locus_tag LOCUS_05880 93684 93022 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615265.1 protein_id gnl|my_center|LOCUS_05880 93887 94330 gene locus_tag LOCUS_05890 93887 94330 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_05890 94362 95525 gene locus_tag LOCUS_05900 94362 95525 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 protein_id gnl|my_center|LOCUS_05900 95525 97057 gene locus_tag LOCUS_05910 gene sufB 95525 97057 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919730.1 protein_id gnl|my_center|LOCUS_05910 97091 97555 gene locus_tag LOCUS_05920 97091 97555 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_05920 97576 98232 gene locus_tag LOCUS_05930 97576 98232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 98317 99084 gene locus_tag LOCUS_05940 gene sufC 98317 99084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_05940 99084 100295 gene locus_tag LOCUS_05950 gene sufD 99084 100295 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919727.1 protein_id gnl|my_center|LOCUS_05950 100295 101512 gene locus_tag LOCUS_05960 100295 101512 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A766 protein_id gnl|my_center|LOCUS_05960 101524 101913 gene locus_tag LOCUS_05970 101524 101913 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 protein_id gnl|my_center|LOCUS_05970 101943 102308 gene locus_tag LOCUS_05980 101943 102308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_05980 102348 102920 gene locus_tag LOCUS_05990 102348 102920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 103212 106094 gene locus_tag LOCUS_06000 103212 106094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 106206 108851 gene locus_tag LOCUS_06010 gene fecA 106206 108851 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_06010 109150 109317 gene locus_tag LOCUS_06020 109150 109317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 109284 110270 gene locus_tag LOCUS_06030 109284 110270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 110295 112295 gene locus_tag LOCUS_06040 gene pulD 110295 112295 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 protein_id gnl|my_center|LOCUS_06040 112314 113822 gene locus_tag LOCUS_06050 gene xcsE 112314 113822 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038522.1 protein_id gnl|my_center|LOCUS_06050 113809 115014 gene locus_tag LOCUS_06060 gene xcsF 113809 115014 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038521.1 protein_id gnl|my_center|LOCUS_06060 115011 115508 gene locus_tag LOCUS_06070 gene xcsG 115011 115508 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038520.1 protein_id gnl|my_center|LOCUS_06070 115505 116047 gene locus_tag LOCUS_06080 115505 116047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 116049 116453 gene locus_tag LOCUS_06090 116049 116453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 116437 117069 gene locus_tag LOCUS_06100 gene xcsJ 116437 117069 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038517.1 protein_id gnl|my_center|LOCUS_06100 117069 118064 gene locus_tag LOCUS_06110 gene xcsK 117069 118064 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5C3 protein_id gnl|my_center|LOCUS_06110 118064 119224 gene locus_tag LOCUS_06120 gene xcpY 118064 119224 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25060 protein_id gnl|my_center|LOCUS_06120 119221 119688 gene locus_tag LOCUS_06130 119221 119688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 119694 120488 gene locus_tag LOCUS_06140 119694 120488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 120478 121005 gene locus_tag LOCUS_06150 120478 121005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 121138 121214 gene locus_tag LOCUS_t00060 121138 121214 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 122845 121412 gene locus_tag LOCUS_06160 122845 121412 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 protein_id gnl|my_center|LOCUS_06160 123954 123067 gene locus_tag LOCUS_06170 123954 123067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 126847 124046 gene locus_tag LOCUS_06180 126847 124046 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920997.1 protein_id gnl|my_center|LOCUS_06180 127550 127068 gene locus_tag LOCUS_06190 127550 127068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 127880 127656 gene locus_tag LOCUS_06200 127880 127656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 128438 129595 gene locus_tag LOCUS_06210 128438 129595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 129792 130877 gene locus_tag LOCUS_06220 129792 130877 CDS product exopolyphosphatase GppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265726.1 protein_id gnl|my_center|LOCUS_06220 130867 131595 gene locus_tag LOCUS_06230 gene rlmE 130867 131595 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THI2 protein_id gnl|my_center|LOCUS_06230 131649 133115 gene locus_tag LOCUS_06240 gene guaB 131649 133115 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N70 protein_id gnl|my_center|LOCUS_06240 133303 133875 gene locus_tag LOCUS_06250 133303 133875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 133938 134447 gene locus_tag LOCUS_06260 133938 134447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 134440 135747 gene locus_tag LOCUS_06270 134440 135747 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919493.1 protein_id gnl|my_center|LOCUS_06270 136909 135755 gene locus_tag LOCUS_06280 136909 135755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 137044 138621 gene locus_tag LOCUS_06290 gene guaA 137044 138621 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N53 protein_id gnl|my_center|LOCUS_06290 138916 140172 gene locus_tag LOCUS_06300 138916 140172 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530374.1 protein_id gnl|my_center|LOCUS_06300 140429 140292 gene locus_tag LOCUS_06310 140429 140292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 140870 140475 gene locus_tag LOCUS_06320 140870 140475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 141047 141391 gene locus_tag LOCUS_06330 141047 141391 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084590.1 protein_id gnl|my_center|LOCUS_06330 141388 141735 gene locus_tag LOCUS_06340 141388 141735 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622996.1 protein_id gnl|my_center|LOCUS_06340 141775 143331 gene locus_tag LOCUS_06350 141775 143331 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971015.1 protein_id gnl|my_center|LOCUS_06350 143691 143548 gene locus_tag LOCUS_06360 143691 143548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06360 144241 143807 gene locus_tag LOCUS_06370 144241 143807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 147462 144238 gene locus_tag LOCUS_06380 147462 144238 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886969.1 protein_id gnl|my_center|LOCUS_06380 149136 147472 gene locus_tag LOCUS_06390 149136 147472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 150539 149328 gene locus_tag LOCUS_06400 150539 149328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 150813 150622 gene locus_tag LOCUS_06410 150813 150622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 151370 151095 gene locus_tag LOCUS_06420 151370 151095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 protein_id gnl|my_center|LOCUS_06420 152007 151564 gene locus_tag LOCUS_06430 152007 151564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06430 152887 152327 gene locus_tag LOCUS_06440 152887 152327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_06440 153082 154362 gene locus_tag LOCUS_06450 153082 154362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 155735 154404 gene locus_tag LOCUS_06460 155735 154404 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_06460 156314 155763 gene locus_tag LOCUS_06470 156314 155763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 158479 156434 gene locus_tag LOCUS_06480 158479 156434 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_06480 158525 158755 gene locus_tag LOCUS_06490 158525 158755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 158933 158772 gene locus_tag LOCUS_06500 158933 158772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 159826 159158 gene locus_tag LOCUS_06510 159826 159158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 160163 160426 gene locus_tag LOCUS_06520 160163 160426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 161122 160670 gene locus_tag LOCUS_06530 161122 160670 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_06530 161763 161119 gene locus_tag LOCUS_06540 161763 161119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 161853 162311 gene locus_tag LOCUS_06550 161853 162311 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence04 2410 920 gene locus_tag LOCUS_06560 gene fdsB 2410 920 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709577.1 protein_id gnl|my_center|LOCUS_06560 2832 2407 gene locus_tag LOCUS_06570 gene fdsG 2832 2407 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709578.1 protein_id gnl|my_center|LOCUS_06570 3992 2937 gene locus_tag LOCUS_06580 gene rkpQ 3992 2937 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887054.1 protein_id gnl|my_center|LOCUS_06580 6238 4013 gene locus_tag LOCUS_06590 6238 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 6389 6874 gene locus_tag LOCUS_06600 6389 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 6871 7872 gene locus_tag LOCUS_06610 6871 7872 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_06610 8856 7864 gene locus_tag LOCUS_06620 8856 7864 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_06620 9690 8860 gene locus_tag LOCUS_06630 9690 8860 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462198.1 protein_id gnl|my_center|LOCUS_06630 10461 9703 gene locus_tag LOCUS_06640 gene fabG 10461 9703 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_06640 10886 10458 gene locus_tag LOCUS_06650 10886 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 12481 10883 gene locus_tag LOCUS_06660 12481 10883 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085504.1 protein_id gnl|my_center|LOCUS_06660 12957 12487 gene locus_tag LOCUS_06670 gene fabZ 12957 12487 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94584 protein_id gnl|my_center|LOCUS_06670 13231 12992 gene locus_tag LOCUS_06680 13231 12992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 13424 14593 gene locus_tag LOCUS_06690 13424 14593 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 protein_id gnl|my_center|LOCUS_06690 14571 15797 gene locus_tag LOCUS_06700 14571 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 protein_id gnl|my_center|LOCUS_06700 17097 15781 gene locus_tag LOCUS_06710 17097 15781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17430 19901 gene locus_tag LOCUS_06720 gene glgP 17430 19901 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG13 protein_id gnl|my_center|LOCUS_06720 19898 22057 gene locus_tag LOCUS_06730 gene glgB 19898 22057 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNQ2 protein_id gnl|my_center|LOCUS_06730 22102 23367 gene locus_tag LOCUS_06740 gene glgC 22102 23367 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8L5 protein_id gnl|my_center|LOCUS_06740 23371 24891 gene locus_tag LOCUS_06750 gene glgA 23371 24891 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNQ0 protein_id gnl|my_center|LOCUS_06750 24813 26744 gene locus_tag LOCUS_06760 gene glgX 24813 26744 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG12 protein_id gnl|my_center|LOCUS_06760 26874 28514 gene locus_tag LOCUS_06770 26874 28514 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920146.1 protein_id gnl|my_center|LOCUS_06770 29912 28701 gene locus_tag LOCUS_06780 gene rtcB 29912 28701 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P433 protein_id gnl|my_center|LOCUS_06780 31373 30243 gene locus_tag LOCUS_06790 31373 30243 CDS product exopolysaccharide production protein ExoZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103955.1 protein_id gnl|my_center|LOCUS_06790 31583 31834 gene locus_tag LOCUS_06800 31583 31834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 32639 32058 gene locus_tag LOCUS_06810 gene atpF 32639 32058 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T930 protein_id gnl|my_center|LOCUS_06810 33176 32646 gene locus_tag LOCUS_06820 gene atpF 33176 32646 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T931 protein_id gnl|my_center|LOCUS_06820 33484 33260 gene locus_tag LOCUS_06830 33484 33260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 34360 33578 gene locus_tag LOCUS_06840 gene atpB 34360 33578 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 protein_id gnl|my_center|LOCUS_06840 34699 34373 gene locus_tag LOCUS_06850 34699 34373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 38337 34864 gene locus_tag LOCUS_06860 gene smc 38337 34864 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C7H0 protein_id gnl|my_center|LOCUS_06860 39107 38367 gene locus_tag LOCUS_06870 39107 38367 CDS product disulfide bond formation protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309853.1 protein_id gnl|my_center|LOCUS_06870 39738 39190 gene locus_tag LOCUS_06880 39738 39190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390998.1 protein_id gnl|my_center|LOCUS_06880 39788 40834 gene locus_tag LOCUS_06890 gene mutY 39788 40834 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971157.1 protein_id gnl|my_center|LOCUS_06890 41919 40831 gene locus_tag LOCUS_06900 gene ccrMIM 41919 40831 CDS product modification methylase CcrMI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZ33 protein_id gnl|my_center|LOCUS_06900 43296 42136 gene locus_tag LOCUS_06910 43296 42136 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971096.1 protein_id gnl|my_center|LOCUS_06910 43977 43369 gene locus_tag LOCUS_06920 43977 43369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_06920 44660 43980 gene locus_tag LOCUS_06930 gene wcaA 44660 43980 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124718.1 protein_id gnl|my_center|LOCUS_06930 44843 46519 gene locus_tag LOCUS_06940 44843 46519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 47150 46575 gene locus_tag LOCUS_06950 47150 46575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 47249 47404 gene locus_tag LOCUS_06960 47249 47404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 47492 49174 gene locus_tag LOCUS_06970 gene fzeA 47492 49174 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 protein_id gnl|my_center|LOCUS_06970 49235 49405 gene locus_tag LOCUS_06980 49235 49405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 49454 51529 gene locus_tag LOCUS_06990 49454 51529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 51593 53332 gene locus_tag LOCUS_07000 51593 53332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919212.1 protein_id gnl|my_center|LOCUS_07000 53329 54234 gene locus_tag LOCUS_07010 gene ispE 53329 54234 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHC4 protein_id gnl|my_center|LOCUS_07010 54238 55302 gene locus_tag LOCUS_07020 54238 55302 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_07020 57290 55320 gene locus_tag LOCUS_07030 gene asnB 57290 55320 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_07030 58415 57321 gene locus_tag LOCUS_07040 gene pyrB 58415 57321 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 protein_id gnl|my_center|LOCUS_07040 59960 58533 gene locus_tag LOCUS_07050 gene dur3 59960 58533 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_07050 60375 59950 gene locus_tag LOCUS_07060 60375 59950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 60914 62803 gene locus_tag LOCUS_07070 60914 62803 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388247.1 protein_id gnl|my_center|LOCUS_07070 62889 63650 gene locus_tag LOCUS_07080 62889 63650 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919074.1 protein_id gnl|my_center|LOCUS_07080 63647 64633 gene locus_tag LOCUS_07090 63647 64633 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_07090 64626 65399 gene locus_tag LOCUS_07100 64626 65399 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_07100 65539 65745 gene locus_tag LOCUS_07110 65539 65745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 65748 66287 gene locus_tag LOCUS_07120 gene nusG 65748 66287 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QI2 protein_id gnl|my_center|LOCUS_07120 66437 66865 gene locus_tag LOCUS_07130 gene rplK 66437 66865 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QI1 protein_id gnl|my_center|LOCUS_07130 66870 67574 gene locus_tag LOCUS_07140 gene rplA 66870 67574 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0P3 protein_id gnl|my_center|LOCUS_07140 67903 68418 gene locus_tag LOCUS_07150 gene rplJ 67903 68418 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58060 protein_id gnl|my_center|LOCUS_07150 68490 68867 gene locus_tag LOCUS_07160 gene rplL 68490 68867 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV2 protein_id gnl|my_center|LOCUS_07160 69054 73166 gene locus_tag LOCUS_07170 gene rpoB 69054 73166 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAU2 protein_id gnl|my_center|LOCUS_07170 73260 77456 gene locus_tag LOCUS_07180 gene rpoC 73260 77456 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4W8 protein_id gnl|my_center|LOCUS_07180 77840 78211 gene locus_tag LOCUS_07190 gene rpsL 77840 78211 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3K2 protein_id gnl|my_center|LOCUS_07190 78222 78692 gene locus_tag LOCUS_07200 gene rpsG 78222 78692 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5E1 protein_id gnl|my_center|LOCUS_07200 78736 80814 gene locus_tag LOCUS_07210 gene fusA 78736 80814 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX7 protein_id gnl|my_center|LOCUS_07210 80880 82073 gene locus_tag LOCUS_07220 80880 82073 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_420053.1 protein_id gnl|my_center|LOCUS_07220 82467 82820 gene locus_tag LOCUS_07230 gene rpsJ 82467 82820 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_07230 82823 83794 gene locus_tag LOCUS_07240 82823 83794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 83794 84726 gene locus_tag LOCUS_07250 83794 84726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 84730 85029 gene locus_tag LOCUS_07260 gene rplW 84730 85029 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC6 protein_id gnl|my_center|LOCUS_07260 85049 85876 gene locus_tag LOCUS_07270 gene rplB 85049 85876 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D4 protein_id gnl|my_center|LOCUS_07270 85892 86170 gene locus_tag LOCUS_07280 gene rpsS 85892 86170 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U863 protein_id gnl|my_center|LOCUS_07280 86175 86576 gene locus_tag LOCUS_07290 gene rplV 86175 86576 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R7 protein_id gnl|my_center|LOCUS_07290 86576 87346 gene locus_tag LOCUS_07300 gene rpsC 86576 87346 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE24 protein_id gnl|my_center|LOCUS_07300 87360 87773 gene locus_tag LOCUS_07310 gene rplP 87360 87773 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R5 protein_id gnl|my_center|LOCUS_07310 87790 87996 gene locus_tag LOCUS_07320 gene rpmC 87790 87996 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD2 protein_id gnl|my_center|LOCUS_07320 88032 88262 gene locus_tag LOCUS_07330 gene rpsQ 88032 88262 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U4 protein_id gnl|my_center|LOCUS_07330 88259 88627 gene locus_tag LOCUS_07340 gene rplN 88259 88627 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J94 protein_id gnl|my_center|LOCUS_07340 88630 88947 gene locus_tag LOCUS_07350 gene rplX 88630 88947 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_07350 88940 89500 gene locus_tag LOCUS_07360 gene rplE 88940 89500 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E6 protein_id gnl|my_center|LOCUS_07360 89519 89824 gene locus_tag LOCUS_07370 gene rpsN 89519 89824 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U0 protein_id gnl|my_center|LOCUS_07370 89840 90235 gene locus_tag LOCUS_07380 gene rpsH 89840 90235 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E8 protein_id gnl|my_center|LOCUS_07380 90253 90789 gene locus_tag LOCUS_07390 gene rplF 90253 90789 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD9 protein_id gnl|my_center|LOCUS_07390 90793 91155 gene locus_tag LOCUS_07400 gene rplR 90793 91155 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME0 protein_id gnl|my_center|LOCUS_07400 91168 91746 gene locus_tag LOCUS_07410 gene rpsE 91168 91746 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T6 protein_id gnl|my_center|LOCUS_07410 91774 91962 gene locus_tag LOCUS_07420 gene rpmD 91774 91962 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T5 protein_id gnl|my_center|LOCUS_07420 92020 92493 gene locus_tag LOCUS_07430 gene rplO 92020 92493 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q3 protein_id gnl|my_center|LOCUS_07430 92631 94004 gene locus_tag LOCUS_07440 gene secY 92631 94004 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 protein_id gnl|my_center|LOCUS_07440 94001 94567 gene locus_tag LOCUS_07450 gene adk 94001 94567 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F5 protein_id gnl|my_center|LOCUS_07450 94742 95122 gene locus_tag LOCUS_07460 gene rpsM 94742 95122 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T1 protein_id gnl|my_center|LOCUS_07460 95137 95526 gene locus_tag LOCUS_07470 gene rpsK 95137 95526 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 protein_id gnl|my_center|LOCUS_07470 95597 96625 gene locus_tag LOCUS_07480 gene rpoA 95597 96625 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8S9 protein_id gnl|my_center|LOCUS_07480 96671 97096 gene locus_tag LOCUS_07490 gene rplQ 96671 97096 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA8 protein_id gnl|my_center|LOCUS_07490 97694 97206 gene locus_tag LOCUS_07500 97694 97206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976177.1 protein_id gnl|my_center|LOCUS_07500 97948 99420 gene locus_tag LOCUS_07510 97948 99420 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_07510 99529 100386 gene locus_tag LOCUS_07520 99529 100386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 100513 100677 gene locus_tag LOCUS_07530 100513 100677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 100865 102100 gene locus_tag LOCUS_07540 100865 102100 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919162.1 protein_id gnl|my_center|LOCUS_07540 102691 102071 gene locus_tag LOCUS_07550 102691 102071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 102898 103608 gene locus_tag LOCUS_07560 102898 103608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 103617 104000 gene locus_tag LOCUS_07570 gene crcB 103617 104000 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6V2 protein_id gnl|my_center|LOCUS_07570 103997 105037 gene locus_tag LOCUS_07580 103997 105037 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U892 protein_id gnl|my_center|LOCUS_07580 105052 105729 gene locus_tag LOCUS_07590 105052 105729 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_07590 105729 106454 gene locus_tag LOCUS_07600 105729 106454 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919843.1 protein_id gnl|my_center|LOCUS_07600 106491 106760 gene locus_tag LOCUS_07610 106491 106760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 107201 106767 gene locus_tag LOCUS_07620 107201 106767 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_07620 107415 108737 gene locus_tag LOCUS_07630 gene glyA 107415 108737 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_07630 108761 109240 gene locus_tag LOCUS_07640 gene nrdR 108761 109240 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J5 protein_id gnl|my_center|LOCUS_07640 109237 109944 gene locus_tag LOCUS_07650 109237 109944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 109951 110571 gene locus_tag LOCUS_07660 109951 110571 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_07660 110572 111696 gene locus_tag LOCUS_07670 gene ribBA 110572 111696 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZU9 protein_id gnl|my_center|LOCUS_07670 111702 112151 gene locus_tag LOCUS_07680 gene ribH 111702 112151 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG70 protein_id gnl|my_center|LOCUS_07680 112144 112641 gene locus_tag LOCUS_07690 gene nusB 112144 112641 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H535 protein_id gnl|my_center|LOCUS_07690 112638 113606 gene locus_tag LOCUS_07700 gene thiL 112638 113606 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9B8 protein_id gnl|my_center|LOCUS_07700 113692 114141 gene locus_tag LOCUS_07710 113692 114141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 114669 114199 gene locus_tag LOCUS_07720 gene bamE 114669 114199 CDS product SmpA/OmlA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640219.1 protein_id gnl|my_center|LOCUS_07720 114738 115277 gene locus_tag LOCUS_07730 114738 115277 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_07730 115385 116464 gene locus_tag LOCUS_07740 gene plsX 115385 116464 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7B8 protein_id gnl|my_center|LOCUS_07740 116421 117452 gene locus_tag LOCUS_07750 gene fabH 116421 117452 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K89 protein_id gnl|my_center|LOCUS_07750 117559 117882 gene locus_tag LOCUS_07760 gene ihfA 117559 117882 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 protein_id gnl|my_center|LOCUS_07760 117879 118454 gene locus_tag LOCUS_07770 117879 118454 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919248.1 protein_id gnl|my_center|LOCUS_07770 118574 118651 gene locus_tag LOCUS_t00070 118574 118651 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 118778 118948 gene locus_tag LOCUS_07780 118778 118948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 118948 120285 gene locus_tag LOCUS_07790 gene tig 118948 120285 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX0 protein_id gnl|my_center|LOCUS_07790 120481 121080 gene locus_tag LOCUS_07800 gene clpP 120481 121080 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGD9 protein_id gnl|my_center|LOCUS_07800 121314 122582 gene locus_tag LOCUS_07810 gene clpX 121314 122582 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA45 protein_id gnl|my_center|LOCUS_07810 122841 125252 gene locus_tag LOCUS_07820 gene lon 122841 125252 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW0 protein_id gnl|my_center|LOCUS_07820 125377 125452 gene locus_tag LOCUS_t00080 125377 125452 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 127118 125694 gene locus_tag LOCUS_07830 gene davD 127118 125694 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_07830 128301 127183 gene locus_tag LOCUS_07840 128301 127183 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970240.1 protein_id gnl|my_center|LOCUS_07840 129670 128675 gene locus_tag LOCUS_07850 129670 128675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 130713 129964 gene locus_tag LOCUS_07860 130713 129964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 131916 130954 gene locus_tag LOCUS_07870 gene exoM 131916 130954 CDS product succinoglycan biosynthesis protein exom inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337571.1 protein_id gnl|my_center|LOCUS_07870 131948 132181 gene locus_tag LOCUS_07880 131948 132181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 132483 133184 gene locus_tag LOCUS_07890 132483 133184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 133518 133291 gene locus_tag LOCUS_07900 133518 133291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 135474 133807 gene locus_tag LOCUS_07910 135474 133807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 136918 135770 gene locus_tag LOCUS_07920 136918 135770 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390458.1 protein_id gnl|my_center|LOCUS_07920 137904 136990 gene locus_tag LOCUS_07930 137904 136990 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061858.1 protein_id gnl|my_center|LOCUS_07930 138330 138257 gene locus_tag LOCUS_t00090 138330 138257 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 139114 138467 gene locus_tag LOCUS_07940 139114 138467 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_07940 139445 139520 gene locus_tag LOCUS_t00100 139445 139520 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 139902 140921 gene locus_tag LOCUS_07950 139902 140921 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_07950 142328 140922 gene locus_tag LOCUS_07960 gene trmFO 142328 140922 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A566 protein_id gnl|my_center|LOCUS_07960 142454 143332 gene locus_tag LOCUS_07970 142454 143332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 146330 143355 gene locus_tag LOCUS_07980 gene uvrA 146330 143355 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CB72 protein_id gnl|my_center|LOCUS_07980 146679 147155 gene locus_tag LOCUS_07990 gene ssb 146679 147155 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A894 protein_id gnl|my_center|LOCUS_07990 147333 150194 gene locus_tag LOCUS_08000 gene gyrA 147333 150194 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y8 protein_id gnl|my_center|LOCUS_08000 150270 150758 gene locus_tag LOCUS_08010 gene coaD 150270 150758 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58103 protein_id gnl|my_center|LOCUS_08010 150785 151630 gene locus_tag LOCUS_08020 150785 151630 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640279.1 protein_id gnl|my_center|LOCUS_08020 151652 152113 gene locus_tag LOCUS_08030 151652 152113 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y5 protein_id gnl|my_center|LOCUS_08030 152758 152129 gene locus_tag LOCUS_08040 152758 152129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 152914 152989 gene locus_tag LOCUS_t00110 152914 152989 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 537 1118 gene locus_tag LOCUS_08050 537 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1124 2107 gene locus_tag LOCUS_08060 1124 2107 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C809 protein_id gnl|my_center|LOCUS_08060 2266 4239 gene locus_tag LOCUS_08070 2266 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5853 4267 gene locus_tag LOCUS_08080 5853 4267 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089493.1 protein_id gnl|my_center|LOCUS_08080 7166 5856 gene locus_tag LOCUS_08090 7166 5856 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59348 protein_id gnl|my_center|LOCUS_08090 9139 7202 gene locus_tag LOCUS_08100 9139 7202 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089495.1 protein_id gnl|my_center|LOCUS_08100 10426 9734 gene locus_tag LOCUS_08110 gene pgl 10426 9734 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S1 protein_id gnl|my_center|LOCUS_08110 11297 10416 gene locus_tag LOCUS_08120 11297 10416 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969533.1 protein_id gnl|my_center|LOCUS_08120 11441 12358 gene locus_tag LOCUS_08130 11441 12358 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_08130 12492 14351 gene locus_tag LOCUS_08140 12492 14351 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_08140 14361 15137 gene locus_tag LOCUS_08150 gene ate 14361 15137 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVD8 protein_id gnl|my_center|LOCUS_08150 15185 16363 gene locus_tag LOCUS_08160 15185 16363 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_08160 16379 17062 gene locus_tag LOCUS_08170 16379 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 17059 18648 gene locus_tag LOCUS_08180 17059 18648 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337993.1 protein_id gnl|my_center|LOCUS_08180 19280 18645 gene locus_tag LOCUS_08190 19280 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 19977 19417 gene locus_tag LOCUS_08200 19977 19417 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_08200 21410 20130 gene locus_tag LOCUS_08210 21410 20130 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640195.1 protein_id gnl|my_center|LOCUS_08210 23743 21485 gene locus_tag LOCUS_08220 gene parC 23743 21485 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54478 protein_id gnl|my_center|LOCUS_08220 24160 24864 gene locus_tag LOCUS_08230 24160 24864 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140539.1 protein_id gnl|my_center|LOCUS_08230 25722 24970 gene locus_tag LOCUS_08240 gene recO 25722 24970 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A802 protein_id gnl|my_center|LOCUS_08240 25817 26818 gene locus_tag LOCUS_08250 25817 26818 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061348.1 protein_id gnl|my_center|LOCUS_08250 26928 27368 gene locus_tag LOCUS_08260 26928 27368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 28076 27390 gene locus_tag LOCUS_08270 28076 27390 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919853.1 protein_id gnl|my_center|LOCUS_08270 28141 28728 gene locus_tag LOCUS_08280 28141 28728 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTI5 protein_id gnl|my_center|LOCUS_08280 31485 28906 gene locus_tag LOCUS_08290 31485 28906 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_08290 31866 31519 gene locus_tag LOCUS_08300 31866 31519 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919858.1 protein_id gnl|my_center|LOCUS_08300 33163 32009 gene locus_tag LOCUS_08310 33163 32009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 33866 33192 gene locus_tag LOCUS_08320 gene pcm 33866 33192 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH7 protein_id gnl|my_center|LOCUS_08320 34651 33863 gene locus_tag LOCUS_08330 gene surE 34651 33863 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T5 protein_id gnl|my_center|LOCUS_08330 34917 35534 gene locus_tag LOCUS_08340 34917 35534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 36416 35640 gene locus_tag LOCUS_08350 36416 35640 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_08350 36770 36507 gene locus_tag LOCUS_08360 36770 36507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_08360 36902 37306 gene locus_tag LOCUS_08370 36902 37306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 38902 37319 gene locus_tag LOCUS_08380 gene pgi 38902 37319 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABK5 protein_id gnl|my_center|LOCUS_08380 39207 39001 gene locus_tag LOCUS_08390 39207 39001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 39095 39553 gene locus_tag LOCUS_08400 39095 39553 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919092.1 protein_id gnl|my_center|LOCUS_08400 40279 39572 gene locus_tag LOCUS_08410 40279 39572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 40435 41202 gene locus_tag LOCUS_08420 gene nadK 40435 41202 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7K4 protein_id gnl|my_center|LOCUS_08420 41352 41855 gene locus_tag LOCUS_08430 41352 41855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265683.1 protein_id gnl|my_center|LOCUS_08430 42115 42807 gene locus_tag LOCUS_08440 42115 42807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 43645 42851 gene locus_tag LOCUS_08450 43645 42851 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919717.1 protein_id gnl|my_center|LOCUS_08450 43829 44275 gene locus_tag LOCUS_08460 gene rnhA 43829 44275 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T805 protein_id gnl|my_center|LOCUS_08460 44785 44321 gene locus_tag LOCUS_08470 44785 44321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454539.1 protein_id gnl|my_center|LOCUS_08470 45787 44819 gene locus_tag LOCUS_08480 45787 44819 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923262.1 protein_id gnl|my_center|LOCUS_08480 46411 45929 gene locus_tag LOCUS_08490 46411 45929 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_08490 46622 47179 gene locus_tag LOCUS_08500 46622 47179 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5C6 protein_id gnl|my_center|LOCUS_08500 47273 47662 gene locus_tag LOCUS_08510 47273 47662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529398.1 protein_id gnl|my_center|LOCUS_08510 48278 47700 gene locus_tag LOCUS_08520 48278 47700 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084104.1 protein_id gnl|my_center|LOCUS_08520 49345 48278 gene locus_tag LOCUS_08530 49345 48278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 50710 49436 gene locus_tag LOCUS_08540 50710 49436 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921227.1 protein_id gnl|my_center|LOCUS_08540 52092 50707 gene locus_tag LOCUS_08550 52092 50707 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974738.1 protein_id gnl|my_center|LOCUS_08550 52819 52112 gene locus_tag LOCUS_08560 52819 52112 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6V2 protein_id gnl|my_center|LOCUS_08560 53196 52825 gene locus_tag LOCUS_08570 53196 52825 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 protein_id gnl|my_center|LOCUS_08570 54135 53227 gene locus_tag LOCUS_08580 gene coxC 54135 53227 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921231.1 protein_id gnl|my_center|LOCUS_08580 54770 54198 gene locus_tag LOCUS_08590 gene ctaG 54770 54198 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBS6 protein_id gnl|my_center|LOCUS_08590 55048 54767 gene locus_tag LOCUS_08600 55048 54767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 56034 55045 gene locus_tag LOCUS_08610 gene coxE 56034 55045 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDA3 protein_id gnl|my_center|LOCUS_08610 57844 56171 gene locus_tag LOCUS_08620 57844 56171 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A300 protein_id gnl|my_center|LOCUS_08620 58780 57869 gene locus_tag LOCUS_08630 58780 57869 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6U4 protein_id gnl|my_center|LOCUS_08630 59164 60558 gene locus_tag LOCUS_08640 59164 60558 CDS product Zn-dependent protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265953.1 protein_id gnl|my_center|LOCUS_08640 61057 60689 gene locus_tag LOCUS_08650 61057 60689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 62046 61165 gene locus_tag LOCUS_08660 62046 61165 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_08660 62429 62070 gene locus_tag LOCUS_08670 62429 62070 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_08670 63476 62610 gene locus_tag LOCUS_08680 63476 62610 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_08680 64567 63974 gene locus_tag LOCUS_08690 64567 63974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 66043 64670 gene locus_tag LOCUS_08700 66043 64670 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_08700 66179 67006 gene locus_tag LOCUS_08710 66179 67006 CDS product pilus assembly protein TadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920775.1 protein_id gnl|my_center|LOCUS_08710 67454 67035 gene locus_tag LOCUS_08720 gene vapC 67454 67035 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK03 protein_id gnl|my_center|LOCUS_08720 67703 67464 gene locus_tag LOCUS_08730 67703 67464 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_08730 68951 68016 gene locus_tag LOCUS_08740 68951 68016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 69180 69953 gene locus_tag LOCUS_08750 69180 69953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 71077 70025 gene locus_tag LOCUS_08760 71077 70025 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 protein_id gnl|my_center|LOCUS_08760 72079 71090 gene locus_tag LOCUS_08770 72079 71090 CDS product secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920778.1 protein_id gnl|my_center|LOCUS_08770 73449 72076 gene locus_tag LOCUS_08780 gene cpaF 73449 72076 CDS product pilus assembly protein CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920779.1 protein_id gnl|my_center|LOCUS_08780 73421 73582 gene locus_tag LOCUS_08790 73421 73582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 75933 73588 gene locus_tag LOCUS_08800 75933 73588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 76610 75960 gene locus_tag LOCUS_08810 76610 75960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 78229 76625 gene locus_tag LOCUS_08820 gene cpaC 78229 76625 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920782.1 protein_id gnl|my_center|LOCUS_08820 79215 78244 gene locus_tag LOCUS_08830 gene cpaB 79215 78244 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920783.1 protein_id gnl|my_center|LOCUS_08830 79809 79294 gene locus_tag LOCUS_08840 gene cpaA 79809 79294 CDS product pilus assembly protein CpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920784.1 protein_id gnl|my_center|LOCUS_08840 80304 80077 gene locus_tag LOCUS_08850 80304 80077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 80725 81153 gene locus_tag LOCUS_08860 80725 81153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 81446 81922 gene locus_tag LOCUS_08870 gene tadG2 81446 81922 CDS product pilus assembly protein TadG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887967.1 protein_id gnl|my_center|LOCUS_08870 81922 83325 gene locus_tag LOCUS_08880 81922 83325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 85498 83345 gene locus_tag LOCUS_08890 85498 83345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 86949 85585 gene locus_tag LOCUS_08900 86949 85585 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_08900 87636 87043 gene locus_tag LOCUS_08910 87636 87043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918166.1 protein_id gnl|my_center|LOCUS_08910 88711 87731 gene locus_tag LOCUS_08920 88711 87731 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_08920 88787 89143 gene locus_tag LOCUS_08930 88787 89143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 91553 89205 gene locus_tag LOCUS_08940 91553 89205 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921265.1 protein_id gnl|my_center|LOCUS_08940 93259 91820 gene locus_tag LOCUS_08950 gene amn 93259 91820 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABG3 protein_id gnl|my_center|LOCUS_08950 94583 93360 gene locus_tag LOCUS_08960 94583 93360 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804939.1 protein_id gnl|my_center|LOCUS_08960 94874 95386 gene locus_tag LOCUS_08970 94874 95386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 96556 95525 gene locus_tag LOCUS_08980 96556 95525 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4U9 protein_id gnl|my_center|LOCUS_08980 96793 97191 gene locus_tag LOCUS_08990 96793 97191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 98312 97212 gene locus_tag LOCUS_09000 98312 97212 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_09000 99342 98413 gene locus_tag LOCUS_09010 gene hslO 99342 98413 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58097 protein_id gnl|my_center|LOCUS_09010 99497 100411 gene locus_tag LOCUS_09020 99497 100411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 100495 100875 gene locus_tag LOCUS_09030 100495 100875 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640517.1 protein_id gnl|my_center|LOCUS_09030 101545 100964 gene locus_tag LOCUS_09040 101545 100964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 102576 101719 gene locus_tag LOCUS_09050 gene prmC 102576 101719 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2B7 protein_id gnl|my_center|LOCUS_09050 103357 102569 gene locus_tag LOCUS_09060 103357 102569 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918757.1 protein_id gnl|my_center|LOCUS_09060 104443 103364 gene locus_tag LOCUS_09070 gene prfA 104443 103364 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5V3 protein_id gnl|my_center|LOCUS_09070 104627 106831 gene locus_tag LOCUS_09080 104627 106831 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918742.1 protein_id gnl|my_center|LOCUS_09080 107250 106828 gene locus_tag LOCUS_09090 107250 106828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_09090 108605 107250 gene locus_tag LOCUS_09100 108605 107250 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_09100 108764 110047 gene locus_tag LOCUS_09110 gene purD 108764 110047 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP5 protein_id gnl|my_center|LOCUS_09110 110135 110728 gene locus_tag LOCUS_09120 gene rnhB 110135 110728 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_09120 110878 113808 gene locus_tag LOCUS_09130 110878 113808 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_09130 113900 114964 gene locus_tag LOCUS_09140 113900 114964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 117725 115044 gene locus_tag LOCUS_09150 gene alaS 117725 115044 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5C1 protein_id gnl|my_center|LOCUS_09150 118982 117894 gene locus_tag LOCUS_09160 gene recA 118982 117894 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TG98 protein_id gnl|my_center|LOCUS_09160 121740 119176 gene locus_tag LOCUS_09170 gene cckA 121740 119176 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918962.1 protein_id gnl|my_center|LOCUS_09170 122913 121843 gene locus_tag LOCUS_09180 gene flhB 122913 121843 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918961.1 protein_id gnl|my_center|LOCUS_09180 123683 122928 gene locus_tag LOCUS_09190 gene fliR 123683 122928 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45975 protein_id gnl|my_center|LOCUS_09190 123956 123693 gene locus_tag LOCUS_09200 gene fliQ 123956 123693 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45974 protein_id gnl|my_center|LOCUS_09200 124105 126009 gene locus_tag LOCUS_09210 124105 126009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_09210 126298 129108 gene locus_tag LOCUS_09220 126298 129108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 129259 129759 gene locus_tag LOCUS_09230 129259 129759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 129828 130682 gene locus_tag LOCUS_09240 129828 130682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_09240 132013 130934 gene locus_tag LOCUS_09250 132013 130934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 135049 132365 gene locus_tag LOCUS_09260 135049 132365 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640245.1 protein_id gnl|my_center|LOCUS_09260 137413 135086 gene locus_tag LOCUS_09270 gene glyS 137413 135086 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8L1 protein_id gnl|my_center|LOCUS_09270 137936 137448 gene locus_tag LOCUS_09280 137936 137448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 138861 137929 gene locus_tag LOCUS_09290 gene glyQ 138861 137929 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8L2 protein_id gnl|my_center|LOCUS_09290 139417 138914 gene locus_tag LOCUS_09300 139417 138914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 139874 139440 gene locus_tag LOCUS_09310 139874 139440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 140691 140530 gene locus_tag LOCUS_09320 140691 140530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 141437 140691 gene locus_tag LOCUS_09330 141437 140691 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919975.1 protein_id gnl|my_center|LOCUS_09330 141650 141444 gene locus_tag LOCUS_09340 141650 141444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 141808 142830 gene locus_tag LOCUS_09350 141808 142830 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919974.1 protein_id gnl|my_center|LOCUS_09350 142913 143290 gene locus_tag LOCUS_09360 142913 143290 CDS product rhodanese-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700875.1 protein_id gnl|my_center|LOCUS_09360 145182 143374 gene locus_tag LOCUS_09370 145182 143374 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 protein_id gnl|my_center|LOCUS_09370 145514 146515 gene locus_tag LOCUS_09380 145514 146515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 147896 146520 gene locus_tag LOCUS_09390 gene gsh1 147896 146520 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence06 2207 1167 gene locus_tag LOCUS_09400 2207 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4577 2304 gene locus_tag LOCUS_09410 gene ptsP 4577 2304 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 protein_id gnl|my_center|LOCUS_09410 5875 4625 gene locus_tag LOCUS_09420 5875 4625 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9W8 protein_id gnl|my_center|LOCUS_09420 6137 6829 gene locus_tag LOCUS_09430 gene ubiG 6137 6829 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MK1 protein_id gnl|my_center|LOCUS_09430 6857 7534 gene locus_tag LOCUS_09440 6857 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_09440 7797 7531 gene locus_tag LOCUS_09450 7797 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 7920 8447 gene locus_tag LOCUS_09460 7920 8447 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194993.1 protein_id gnl|my_center|LOCUS_09460 8567 9025 gene locus_tag LOCUS_09470 8567 9025 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 protein_id gnl|my_center|LOCUS_09470 9829 9026 gene locus_tag LOCUS_09480 9829 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 10462 9956 gene locus_tag LOCUS_09490 10462 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 protein_id gnl|my_center|LOCUS_09490 10700 10434 gene locus_tag LOCUS_09500 10700 10434 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529449.1 protein_id gnl|my_center|LOCUS_09500 11508 10720 gene locus_tag LOCUS_09510 11508 10720 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918715.1 protein_id gnl|my_center|LOCUS_09510 11557 12471 gene locus_tag LOCUS_09520 gene bioC 11557 12471 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_09520 12718 12473 gene locus_tag LOCUS_09530 12718 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 13119 12688 gene locus_tag LOCUS_09540 13119 12688 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388152.1 protein_id gnl|my_center|LOCUS_09540 14401 13160 gene locus_tag LOCUS_09550 gene argJ 14401 13160 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 protein_id gnl|my_center|LOCUS_09550 15382 14402 gene locus_tag LOCUS_09560 15382 14402 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE5 protein_id gnl|my_center|LOCUS_09560 15589 18285 gene locus_tag LOCUS_09570 gene secA 15589 18285 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW7 protein_id gnl|my_center|LOCUS_09570 18536 19270 gene locus_tag LOCUS_09580 gene SspA 18536 19270 CDS product salt-stress induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338463.1 protein_id gnl|my_center|LOCUS_09580 19447 20190 gene locus_tag LOCUS_09590 gene SspA 19447 20190 CDS product salt-stress induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338463.1 protein_id gnl|my_center|LOCUS_09590 20278 21642 gene locus_tag LOCUS_09600 20278 21642 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314722.1 protein_id gnl|my_center|LOCUS_09600 22634 21669 gene locus_tag LOCUS_09610 gene accA 22634 21669 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2N7 protein_id gnl|my_center|LOCUS_09610 23886 22726 gene locus_tag LOCUS_09620 23886 22726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918557.1 protein_id gnl|my_center|LOCUS_09620 25834 23867 gene locus_tag LOCUS_09630 25834 23867 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_09630 26860 25874 gene locus_tag LOCUS_09640 26860 25874 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920857.1 protein_id gnl|my_center|LOCUS_09640 27660 26998 gene locus_tag LOCUS_09650 27660 26998 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_09650 27701 27979 gene locus_tag LOCUS_09660 27701 27979 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709226.1 protein_id gnl|my_center|LOCUS_09660 28741 28001 gene locus_tag LOCUS_09670 28741 28001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 30164 28890 gene locus_tag LOCUS_09680 30164 28890 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640633.1 protein_id gnl|my_center|LOCUS_09680 31296 30169 gene locus_tag LOCUS_09690 gene aroB 31296 30169 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_09690 31871 31293 gene locus_tag LOCUS_09700 gene aroK 31871 31293 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW7 protein_id gnl|my_center|LOCUS_09700 31975 32115 gene locus_tag LOCUS_09710 31975 32115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 32099 33847 gene locus_tag LOCUS_09720 32099 33847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 33851 34774 gene locus_tag LOCUS_09730 gene xerD 33851 34774 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A437 protein_id gnl|my_center|LOCUS_09730 34857 36881 gene locus_tag LOCUS_09740 34857 36881 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921550.1 protein_id gnl|my_center|LOCUS_09740 37417 36896 gene locus_tag LOCUS_09750 37417 36896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 37557 38615 gene locus_tag LOCUS_09760 37557 38615 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265893.1 protein_id gnl|my_center|LOCUS_09760 38705 39499 gene locus_tag LOCUS_09770 38705 39499 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920330.1 protein_id gnl|my_center|LOCUS_09770 41687 39504 gene locus_tag LOCUS_09780 41687 39504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 42117 41833 gene locus_tag LOCUS_09790 gene rpmB 42117 41833 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0R5 protein_id gnl|my_center|LOCUS_09790 42490 43458 gene locus_tag LOCUS_09800 42490 43458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 43662 46433 gene locus_tag LOCUS_09810 43662 46433 CDS product phosphonate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640026.1 protein_id gnl|my_center|LOCUS_09810 46728 46564 gene locus_tag LOCUS_09820 46728 46564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 46914 47210 gene locus_tag LOCUS_09830 46914 47210 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918542.1 protein_id gnl|my_center|LOCUS_09830 47317 47661 gene locus_tag LOCUS_09840 47317 47661 CDS product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918540.1 protein_id gnl|my_center|LOCUS_09840 48040 48444 gene locus_tag LOCUS_09850 48040 48444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 48769 48578 gene locus_tag LOCUS_09860 48769 48578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 48686 49510 gene locus_tag LOCUS_09870 gene rpoH2 48686 49510 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720768.1 protein_id gnl|my_center|LOCUS_09870 50255 49515 gene locus_tag LOCUS_09880 50255 49515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 50493 52244 gene locus_tag LOCUS_09890 50493 52244 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640285.1 protein_id gnl|my_center|LOCUS_09890 52244 56446 gene locus_tag LOCUS_09900 52244 56446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919478.1 protein_id gnl|my_center|LOCUS_09900 56999 56541 gene locus_tag LOCUS_09910 gene dps 56999 56541 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658301.1 protein_id gnl|my_center|LOCUS_09910 58343 57135 gene locus_tag LOCUS_09920 58343 57135 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A830 protein_id gnl|my_center|LOCUS_09920 58674 58946 gene locus_tag LOCUS_09930 58674 58946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 59280 59558 gene locus_tag LOCUS_09940 59280 59558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 60073 59567 gene locus_tag LOCUS_09950 60073 59567 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_09950 60703 60209 gene locus_tag LOCUS_09960 60703 60209 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640218.1 protein_id gnl|my_center|LOCUS_09960 60972 62753 gene locus_tag LOCUS_09970 gene uvrC 60972 62753 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF6 protein_id gnl|my_center|LOCUS_09970 63218 62790 gene locus_tag LOCUS_09980 63218 62790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 63590 63267 gene locus_tag LOCUS_09990 63590 63267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 64450 64127 gene locus_tag LOCUS_10000 gene fliE 64450 64127 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8E1 protein_id gnl|my_center|LOCUS_10000 64917 64501 gene locus_tag LOCUS_10010 gene flgC 64917 64501 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89F26 protein_id gnl|my_center|LOCUS_10010 65375 64941 gene locus_tag LOCUS_10020 gene flgB 65375 64941 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6X7 protein_id gnl|my_center|LOCUS_10020 65576 65878 gene locus_tag LOCUS_10030 65576 65878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 65875 66624 gene locus_tag LOCUS_10040 gene fliP 65875 66624 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C588 protein_id gnl|my_center|LOCUS_10040 66705 67151 gene locus_tag LOCUS_10050 66705 67151 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770293.1 protein_id gnl|my_center|LOCUS_10050 67207 67800 gene locus_tag LOCUS_10060 67207 67800 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_10060 68299 67943 gene locus_tag LOCUS_10070 68299 67943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 68529 69425 gene locus_tag LOCUS_10080 gene ttcA 68529 69425 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFD9 protein_id gnl|my_center|LOCUS_10080 71271 69487 gene locus_tag LOCUS_10090 71271 69487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 72555 71356 gene locus_tag LOCUS_10100 72555 71356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66504 protein_id gnl|my_center|LOCUS_10100 72871 72662 gene locus_tag LOCUS_10110 72871 72662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 73269 72865 gene locus_tag LOCUS_10120 73269 72865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920094.1 protein_id gnl|my_center|LOCUS_10120 73484 73269 gene locus_tag LOCUS_10130 73484 73269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 73659 73877 gene locus_tag LOCUS_10140 73659 73877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973278.1 protein_id gnl|my_center|LOCUS_10140 74895 73993 gene locus_tag LOCUS_10150 74895 73993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072756.1 protein_id gnl|my_center|LOCUS_10150 76007 75051 gene locus_tag LOCUS_10160 76007 75051 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529388.1 protein_id gnl|my_center|LOCUS_10160 77098 76004 gene locus_tag LOCUS_10170 gene hisC 77098 76004 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9W3 protein_id gnl|my_center|LOCUS_10170 77941 77147 gene locus_tag LOCUS_10180 77941 77147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 78087 79265 gene locus_tag LOCUS_10190 gene metX 78087 79265 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J1 protein_id gnl|my_center|LOCUS_10190 79276 79908 gene locus_tag LOCUS_10200 79276 79908 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_10200 80378 80034 gene locus_tag LOCUS_10210 gene glnC 80378 80034 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918409.1 protein_id gnl|my_center|LOCUS_10210 81187 80450 gene locus_tag LOCUS_10220 81187 80450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 81334 82119 gene locus_tag LOCUS_10230 gene gloB 81334 82119 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCK2 protein_id gnl|my_center|LOCUS_10230 82913 82134 gene locus_tag LOCUS_10240 82913 82134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 83750 83028 gene locus_tag LOCUS_10250 83750 83028 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720931.1 protein_id gnl|my_center|LOCUS_10250 84038 84715 gene locus_tag LOCUS_10260 84038 84715 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 protein_id gnl|my_center|LOCUS_10260 84772 85059 gene locus_tag LOCUS_10270 84772 85059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 85437 85063 gene locus_tag LOCUS_10280 85437 85063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918395.1 protein_id gnl|my_center|LOCUS_10280 86135 85560 gene locus_tag LOCUS_10290 86135 85560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918358.1 protein_id gnl|my_center|LOCUS_10290 86996 86193 gene locus_tag LOCUS_10300 86996 86193 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 protein_id gnl|my_center|LOCUS_10300 87153 89096 gene locus_tag LOCUS_10310 87153 89096 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_10310 90106 89159 gene locus_tag LOCUS_10320 90106 89159 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 protein_id gnl|my_center|LOCUS_10320 91356 90106 gene locus_tag LOCUS_10330 91356 90106 CDS product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920160.1 protein_id gnl|my_center|LOCUS_10330 93402 91462 gene locus_tag LOCUS_10340 gene thrS 93402 91462 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_10340 93967 94404 gene locus_tag LOCUS_10350 93967 94404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 94401 95012 gene locus_tag LOCUS_10360 94401 95012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 95385 95029 gene locus_tag LOCUS_10370 95385 95029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 95548 95904 gene locus_tag LOCUS_10380 95548 95904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 96076 96723 gene locus_tag LOCUS_10390 96076 96723 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333546.1 protein_id gnl|my_center|LOCUS_10390 96765 97445 gene locus_tag LOCUS_10400 gene rluA 96765 97445 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSW3 protein_id gnl|my_center|LOCUS_10400 97900 97442 gene locus_tag LOCUS_10410 gene nifU 97900 97442 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 protein_id gnl|my_center|LOCUS_10410 98894 97959 gene locus_tag LOCUS_10420 98894 97959 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404392.1 protein_id gnl|my_center|LOCUS_10420 99621 98881 gene locus_tag LOCUS_10430 99621 98881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 100563 99643 gene locus_tag LOCUS_10440 100563 99643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 100637 100948 gene locus_tag LOCUS_10450 100637 100948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 101278 100949 gene locus_tag LOCUS_10460 101278 100949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_10460 101502 101278 gene locus_tag LOCUS_10470 101502 101278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_10470 103213 101828 gene locus_tag LOCUS_10480 gene cysS 103213 101828 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY2 protein_id gnl|my_center|LOCUS_10480 103433 104044 gene locus_tag LOCUS_10490 gene folE 103433 104044 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T6 protein_id gnl|my_center|LOCUS_10490 104365 104541 gene locus_tag LOCUS_10500 104365 104541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 105191 104667 gene locus_tag LOCUS_10510 105191 104667 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703350.1 protein_id gnl|my_center|LOCUS_10510 105491 105240 gene locus_tag LOCUS_10520 105491 105240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 106553 105495 gene locus_tag LOCUS_10530 gene moaA 106553 105495 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y5 protein_id gnl|my_center|LOCUS_10530 107203 106583 gene locus_tag LOCUS_10540 gene mobA 107203 106583 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZX0 protein_id gnl|my_center|LOCUS_10540 107699 107196 gene locus_tag LOCUS_10550 gene moaC 107699 107196 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC52 protein_id gnl|my_center|LOCUS_10550 108267 107704 gene locus_tag LOCUS_10560 108267 107704 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC51 protein_id gnl|my_center|LOCUS_10560 108752 108264 gene locus_tag LOCUS_10570 gene moaE 108752 108264 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX97 protein_id gnl|my_center|LOCUS_10570 108937 110181 gene locus_tag LOCUS_10580 108937 110181 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_10580 110616 110194 gene locus_tag LOCUS_10590 110616 110194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 111086 110700 gene locus_tag LOCUS_10600 111086 110700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 112243 111134 gene locus_tag LOCUS_10610 112243 111134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921483.1 protein_id gnl|my_center|LOCUS_10610 112751 112404 gene locus_tag LOCUS_10620 gene arsC 112751 112404 CDS product putative arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44589 protein_id gnl|my_center|LOCUS_10620 113317 113165 gene locus_tag LOCUS_10630 113317 113165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 114278 113400 gene locus_tag LOCUS_10640 gene citE 114278 113400 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_10640 114391 114882 gene locus_tag LOCUS_10650 114391 114882 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_10650 114879 115718 gene locus_tag LOCUS_10660 114879 115718 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABH1 protein_id gnl|my_center|LOCUS_10660 115790 116938 gene locus_tag LOCUS_10670 115790 116938 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_10670 117596 116946 gene locus_tag LOCUS_10680 117596 116946 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974692.1 protein_id gnl|my_center|LOCUS_10680 119273 117720 gene locus_tag LOCUS_10690 119273 117720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 121236 119863 gene locus_tag LOCUS_10700 121236 119863 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974841.1 protein_id gnl|my_center|LOCUS_10700 121925 121233 gene locus_tag LOCUS_10710 121925 121233 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527354.1 protein_id gnl|my_center|LOCUS_10710 122178 121948 gene locus_tag LOCUS_10720 122178 121948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 122231 122752 gene locus_tag LOCUS_10730 122231 122752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 122788 125499 gene locus_tag LOCUS_10740 122788 125499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 125670 125594 gene locus_tag LOCUS_t00120 125670 125594 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 126482 125808 gene locus_tag LOCUS_10750 126482 125808 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_10750 126563 127348 gene locus_tag LOCUS_10760 126563 127348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113852.1 protein_id gnl|my_center|LOCUS_10760 130931 127485 gene locus_tag LOCUS_10770 130931 127485 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640689.1 protein_id gnl|my_center|LOCUS_10770 131064 131564 gene locus_tag LOCUS_10780 131064 131564 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265921.1 protein_id gnl|my_center|LOCUS_10780 132834 131653 gene locus_tag LOCUS_10790 132834 131653 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_10790 133338 133042 gene locus_tag LOCUS_10800 133338 133042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 133556 134167 gene locus_tag LOCUS_10810 133556 134167 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710111.1 protein_id gnl|my_center|LOCUS_10810 135062 134160 gene locus_tag LOCUS_10820 135062 134160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 135257 136126 gene locus_tag LOCUS_10830 135257 136126 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973164.1 protein_id gnl|my_center|LOCUS_10830 137729 136521 gene locus_tag LOCUS_10840 gene mnmA 137729 136521 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6U5 protein_id gnl|my_center|LOCUS_10840 >Feature sequence07 2702 3178 gene locus_tag LOCUS_10850 2702 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3517 4629 gene locus_tag LOCUS_10860 3517 4629 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919738.1 protein_id gnl|my_center|LOCUS_10860 4613 5098 gene locus_tag LOCUS_10870 gene bacA 4613 5098 CDS product cell shape determination protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919739.1 protein_id gnl|my_center|LOCUS_10870 6557 5187 gene locus_tag LOCUS_10880 6557 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 7293 6643 gene locus_tag LOCUS_10890 gene pcm 7293 6643 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 protein_id gnl|my_center|LOCUS_10890 7428 7501 gene locus_tag LOCUS_t00130 7428 7501 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7850 7925 gene locus_tag LOCUS_t00140 7850 7925 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8388 7969 gene locus_tag LOCUS_10900 8388 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 8822 8463 gene locus_tag LOCUS_10910 8822 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_10910 8943 9251 gene locus_tag LOCUS_10920 8943 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 9396 10319 gene locus_tag LOCUS_10930 9396 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918948.1 protein_id gnl|my_center|LOCUS_10930 11585 10335 gene locus_tag LOCUS_10940 11585 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 11788 12804 gene locus_tag LOCUS_10950 11788 12804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 12877 13311 gene locus_tag LOCUS_10960 gene sufE 12877 13311 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 protein_id gnl|my_center|LOCUS_10960 14055 13327 gene locus_tag LOCUS_10970 14055 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 14396 14052 gene locus_tag LOCUS_10980 14396 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 15051 14557 gene locus_tag LOCUS_10990 15051 14557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 15690 15208 gene locus_tag LOCUS_11000 15690 15208 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085852.1 protein_id gnl|my_center|LOCUS_11000 17536 15767 gene locus_tag LOCUS_11010 17536 15767 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_11010 17889 17536 gene locus_tag LOCUS_11020 17889 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 19394 17886 gene locus_tag LOCUS_11030 19394 17886 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_11030 20935 19391 gene locus_tag LOCUS_11040 20935 19391 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_11040 21729 20938 gene locus_tag LOCUS_11050 21729 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 22794 21733 gene locus_tag LOCUS_11060 22794 21733 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599366.1 protein_id gnl|my_center|LOCUS_11060 23177 22800 gene locus_tag LOCUS_11070 23177 22800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 23457 23170 gene locus_tag LOCUS_11080 23457 23170 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_11080 23940 23461 gene locus_tag LOCUS_11090 23940 23461 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_11090 25355 24141 gene locus_tag LOCUS_11100 25355 24141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 protein_id gnl|my_center|LOCUS_11100 25892 25461 gene locus_tag LOCUS_11110 25892 25461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 26135 27541 gene locus_tag LOCUS_11120 26135 27541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 27612 28661 gene locus_tag LOCUS_11130 27612 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 28771 29181 gene locus_tag LOCUS_11140 28771 29181 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389660.1 protein_id gnl|my_center|LOCUS_11140 29375 29163 gene locus_tag LOCUS_11150 29375 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 29374 31503 gene locus_tag LOCUS_11160 gene ptrB 29374 31503 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707320.1 protein_id gnl|my_center|LOCUS_11160 31577 32098 gene locus_tag LOCUS_11170 31577 32098 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140415.1 protein_id gnl|my_center|LOCUS_11170 32205 33530 gene locus_tag LOCUS_11180 32205 33530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11180 33446 33772 gene locus_tag LOCUS_11190 33446 33772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11190 35317 33881 gene locus_tag LOCUS_11200 35317 33881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 36286 35621 gene locus_tag LOCUS_11210 36286 35621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 36702 36298 gene locus_tag LOCUS_11220 36702 36298 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_11220 37122 36721 gene locus_tag LOCUS_11230 37122 36721 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_11230 37636 37115 gene locus_tag LOCUS_11240 gene exbB 37636 37115 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_11240 39042 37678 gene locus_tag LOCUS_11250 39042 37678 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_11250 39858 39067 gene locus_tag LOCUS_11260 39858 39067 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_11260 40606 40532 gene locus_tag LOCUS_t00150 40606 40532 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 40727 40803 gene locus_tag LOCUS_t00160 40727 40803 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41010 42779 gene locus_tag LOCUS_11270 41010 42779 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9P7 protein_id gnl|my_center|LOCUS_11270 42796 43158 gene locus_tag LOCUS_11280 42796 43158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 44869 43250 gene locus_tag LOCUS_11290 44869 43250 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_11290 45858 44953 gene locus_tag LOCUS_11300 45858 44953 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_11300 46808 45858 gene locus_tag LOCUS_11310 46808 45858 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_11310 46949 47371 gene locus_tag LOCUS_11320 46949 47371 CDS product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_11320 47576 48502 gene locus_tag LOCUS_11330 47576 48502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 48566 49462 gene locus_tag LOCUS_11340 48566 49462 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_11340 49538 50143 gene locus_tag LOCUS_11350 49538 50143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 51091 50153 gene locus_tag LOCUS_11360 51091 50153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 52853 51156 gene locus_tag LOCUS_11370 52853 51156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11370 52930 53928 gene locus_tag LOCUS_11380 52930 53928 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_11380 53985 54194 gene locus_tag LOCUS_11390 53985 54194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 55553 54123 gene locus_tag LOCUS_11400 55553 54123 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968876.1 protein_id gnl|my_center|LOCUS_11400 56029 55589 gene locus_tag LOCUS_11410 56029 55589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 56384 56779 gene locus_tag LOCUS_11420 56384 56779 CDS product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921205.1 protein_id gnl|my_center|LOCUS_11420 57937 57077 gene locus_tag LOCUS_11430 57937 57077 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 protein_id gnl|my_center|LOCUS_11430 59265 57934 gene locus_tag LOCUS_11440 59265 57934 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5S1 protein_id gnl|my_center|LOCUS_11440 59448 60278 gene locus_tag LOCUS_11450 gene gcvT 59448 60278 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971363.1 protein_id gnl|my_center|LOCUS_11450 60441 62492 gene locus_tag LOCUS_11460 60441 62492 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 protein_id gnl|my_center|LOCUS_11460 62602 63183 gene locus_tag LOCUS_11470 62602 63183 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918270.1 protein_id gnl|my_center|LOCUS_11470 63183 63380 gene locus_tag LOCUS_11480 63183 63380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 63381 63578 gene locus_tag LOCUS_11490 63381 63578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 63846 63697 gene locus_tag LOCUS_11500 63846 63697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 64119 64685 gene locus_tag LOCUS_11510 64119 64685 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971362.1 protein_id gnl|my_center|LOCUS_11510 64712 65257 gene locus_tag LOCUS_11520 64712 65257 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531123.1 protein_id gnl|my_center|LOCUS_11520 65254 66207 gene locus_tag LOCUS_11530 65254 66207 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919326.1 protein_id gnl|my_center|LOCUS_11530 66519 67676 gene locus_tag LOCUS_11540 gene nadA 66519 67676 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4C4 protein_id gnl|my_center|LOCUS_11540 67780 68244 gene locus_tag LOCUS_11550 67780 68244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 68241 68771 gene locus_tag LOCUS_11560 68241 68771 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAE4 protein_id gnl|my_center|LOCUS_11560 68768 70327 gene locus_tag LOCUS_11570 68768 70327 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920751.1 protein_id gnl|my_center|LOCUS_11570 70351 71208 gene locus_tag LOCUS_11580 gene nadC 70351 71208 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040506.1 protein_id gnl|my_center|LOCUS_11580 71665 71363 gene locus_tag LOCUS_11590 71665 71363 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969264.1 protein_id gnl|my_center|LOCUS_11590 72188 71991 gene locus_tag LOCUS_11600 72188 71991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 72105 72539 gene locus_tag LOCUS_11610 72105 72539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 73259 72609 gene locus_tag LOCUS_11620 73259 72609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 74199 73252 gene locus_tag LOCUS_11630 74199 73252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 74643 74275 gene locus_tag LOCUS_11640 74643 74275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 76219 74804 gene locus_tag LOCUS_11650 76219 74804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 76308 76790 gene locus_tag LOCUS_11660 76308 76790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 76869 77198 gene locus_tag LOCUS_11670 76869 77198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 77541 77212 gene locus_tag LOCUS_11680 gene qacF 77541 77212 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_11680 78923 77592 gene locus_tag LOCUS_11690 78923 77592 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 protein_id gnl|my_center|LOCUS_11690 80692 78920 gene locus_tag LOCUS_11700 80692 78920 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533172.1 protein_id gnl|my_center|LOCUS_11700 82107 80962 gene locus_tag LOCUS_11710 82107 80962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 82646 82095 gene locus_tag LOCUS_11720 82646 82095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 84191 82656 gene locus_tag LOCUS_11730 84191 82656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 85202 84210 gene locus_tag LOCUS_11740 85202 84210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 85575 85279 gene locus_tag LOCUS_11750 85575 85279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 85968 85618 gene locus_tag LOCUS_11760 85968 85618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 87100 86144 gene locus_tag LOCUS_11770 87100 86144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 88098 87178 gene locus_tag LOCUS_11780 88098 87178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 89086 88151 gene locus_tag LOCUS_11790 89086 88151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 90509 89091 gene locus_tag LOCUS_11800 90509 89091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 91590 90571 gene locus_tag LOCUS_11810 91590 90571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 92140 92054 gene locus_tag LOCUS_t00170 92140 92054 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 92957 92196 gene locus_tag LOCUS_11820 92957 92196 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 protein_id gnl|my_center|LOCUS_11820 93070 93912 gene locus_tag LOCUS_11830 93070 93912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 94070 94909 gene locus_tag LOCUS_11840 gene map1 94070 94909 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PL7 protein_id gnl|my_center|LOCUS_11840 94977 95744 gene locus_tag LOCUS_11850 94977 95744 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ6 protein_id gnl|my_center|LOCUS_11850 96824 95853 gene locus_tag LOCUS_11860 96824 95853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 97200 98504 gene locus_tag LOCUS_11870 gene purB 97200 98504 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IE9 protein_id gnl|my_center|LOCUS_11870 98656 98967 gene locus_tag LOCUS_11880 98656 98967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 99480 99049 gene locus_tag LOCUS_11890 99480 99049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 100010 99687 gene locus_tag LOCUS_11900 100010 99687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_11900 100246 101025 gene locus_tag LOCUS_11910 gene purC 100246 101025 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L2 protein_id gnl|my_center|LOCUS_11910 101025 101267 gene locus_tag LOCUS_11920 gene purS 101025 101267 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_11920 101639 101271 gene locus_tag LOCUS_11930 101639 101271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532871.1 protein_id gnl|my_center|LOCUS_11930 103255 101732 gene locus_tag LOCUS_11940 103255 101732 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969871.1 protein_id gnl|my_center|LOCUS_11940 104371 103394 gene locus_tag LOCUS_11950 104371 103394 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708834.1 protein_id gnl|my_center|LOCUS_11950 104639 104493 gene locus_tag LOCUS_11960 104639 104493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 104864 104715 gene locus_tag LOCUS_11970 104864 104715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 105203 104994 gene locus_tag LOCUS_11980 105203 104994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 105396 106073 gene locus_tag LOCUS_11990 gene purQ 105396 106073 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3S5 protein_id gnl|my_center|LOCUS_11990 106113 107315 gene locus_tag LOCUS_12000 106113 107315 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_12000 107429 108037 gene locus_tag LOCUS_12010 107429 108037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 108256 109161 gene locus_tag LOCUS_12020 108256 109161 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537841.1 protein_id gnl|my_center|LOCUS_12020 110331 109180 gene locus_tag LOCUS_12030 110331 109180 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 protein_id gnl|my_center|LOCUS_12030 110588 112834 gene locus_tag LOCUS_12040 gene purL 110588 112834 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA58 protein_id gnl|my_center|LOCUS_12040 113729 112929 gene locus_tag LOCUS_12050 113729 112929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 114765 113917 gene locus_tag LOCUS_12060 114765 113917 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399742.1 protein_id gnl|my_center|LOCUS_12060 115803 114838 gene locus_tag LOCUS_12070 115803 114838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 116939 115803 gene locus_tag LOCUS_12080 116939 115803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_12080 117110 117817 gene locus_tag LOCUS_12090 117110 117817 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 protein_id gnl|my_center|LOCUS_12090 118189 117824 gene locus_tag LOCUS_12100 118189 117824 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975848.1 protein_id gnl|my_center|LOCUS_12100 118392 120263 gene locus_tag LOCUS_12110 118392 120263 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence08 1841 516 gene locus_tag LOCUS_12120 1841 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2611 1841 gene locus_tag LOCUS_12130 2611 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2733 3548 gene locus_tag LOCUS_12140 2733 3548 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766263.1 protein_id gnl|my_center|LOCUS_12140 4090 3545 gene locus_tag LOCUS_12150 4090 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 5330 4077 gene locus_tag LOCUS_12160 5330 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 6103 5327 gene locus_tag LOCUS_12170 6103 5327 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731410.1 protein_id gnl|my_center|LOCUS_12170 7269 6100 gene locus_tag LOCUS_12180 7269 6100 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_12180 8069 7266 gene locus_tag LOCUS_12190 8069 7266 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766263.1 protein_id gnl|my_center|LOCUS_12190 8899 8075 gene locus_tag LOCUS_12200 8899 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 9288 8902 gene locus_tag LOCUS_12210 9288 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 10176 9313 gene locus_tag LOCUS_12220 10176 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 10962 10210 gene locus_tag LOCUS_12230 10962 10210 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_12230 11474 10968 gene locus_tag LOCUS_12240 11474 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 12260 11487 gene locus_tag LOCUS_12250 12260 11487 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_12250 12420 13691 gene locus_tag LOCUS_12260 12420 13691 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_12260 13713 14030 gene locus_tag LOCUS_12270 13713 14030 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887716.1 protein_id gnl|my_center|LOCUS_12270 14033 14410 gene locus_tag LOCUS_12280 14033 14410 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728534.1 protein_id gnl|my_center|LOCUS_12280 14413 15435 gene locus_tag LOCUS_12290 14413 15435 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 protein_id gnl|my_center|LOCUS_12290 16138 15446 gene locus_tag LOCUS_12300 16138 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 16232 17155 gene locus_tag LOCUS_12310 16232 17155 CDS product Rieske iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205380.1 protein_id gnl|my_center|LOCUS_12310 17175 18239 gene locus_tag LOCUS_12320 17175 18239 CDS product oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544967.1 protein_id gnl|my_center|LOCUS_12320 18236 19294 gene locus_tag LOCUS_12330 18236 19294 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 protein_id gnl|my_center|LOCUS_12330 20166 19303 gene locus_tag LOCUS_12340 20166 19303 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_12340 20566 20159 gene locus_tag LOCUS_12350 20566 20159 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_12350 22219 20567 gene locus_tag LOCUS_12360 22219 20567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085507.1 protein_id gnl|my_center|LOCUS_12360 22666 22223 gene locus_tag LOCUS_12370 22666 22223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 23056 22670 gene locus_tag LOCUS_12380 23056 22670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 23208 24476 gene locus_tag LOCUS_12390 23208 24476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_12390 24479 25630 gene locus_tag LOCUS_12400 24479 25630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 25633 26448 gene locus_tag LOCUS_12410 25633 26448 CDS product putative short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45219 protein_id gnl|my_center|LOCUS_12410 27434 26514 gene locus_tag LOCUS_12420 27434 26514 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727097.1 protein_id gnl|my_center|LOCUS_12420 28087 27491 gene locus_tag LOCUS_12430 28087 27491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 30425 28080 gene locus_tag LOCUS_12440 gene fbiC 30425 28080 CDS product FO synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228669.1 protein_id gnl|my_center|LOCUS_12440 31426 30425 gene locus_tag LOCUS_12450 31426 30425 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_12450 33061 31442 gene locus_tag LOCUS_12460 gene atsA 33061 31442 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_12460 36058 33377 gene locus_tag LOCUS_12470 36058 33377 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 protein_id gnl|my_center|LOCUS_12470 36270 37433 gene locus_tag LOCUS_12480 36270 37433 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064691.1 protein_id gnl|my_center|LOCUS_12480 37453 38454 gene locus_tag LOCUS_12490 37453 38454 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_12490 38451 39230 gene locus_tag LOCUS_12500 gene rhlG 38451 39230 CDS product rhamnolipids biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RPT1 protein_id gnl|my_center|LOCUS_12500 39325 41010 gene locus_tag LOCUS_12510 39325 41010 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729480.1 protein_id gnl|my_center|LOCUS_12510 41021 41794 gene locus_tag LOCUS_12520 41021 41794 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_12520 41817 42656 gene locus_tag LOCUS_12530 41817 42656 CDS product 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706479.1 protein_id gnl|my_center|LOCUS_12530 42707 43642 gene locus_tag LOCUS_12540 42707 43642 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706480.1 protein_id gnl|my_center|LOCUS_12540 43646 44371 gene locus_tag LOCUS_12550 43646 44371 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089354.1 protein_id gnl|my_center|LOCUS_12550 44371 45135 gene locus_tag LOCUS_12560 gene kduD 44371 45135 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_12560 45270 46433 gene locus_tag LOCUS_12570 45270 46433 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878464.1 protein_id gnl|my_center|LOCUS_12570 46444 46899 gene locus_tag LOCUS_12580 46444 46899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 46896 47291 gene locus_tag LOCUS_12590 46896 47291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 47309 47860 gene locus_tag LOCUS_12600 47309 47860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 47862 48710 gene locus_tag LOCUS_12610 47862 48710 CDS product putative hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702781.1 protein_id gnl|my_center|LOCUS_12610 48707 49459 gene locus_tag LOCUS_12620 48707 49459 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172504.1 protein_id gnl|my_center|LOCUS_12620 49476 49847 gene locus_tag LOCUS_12630 49476 49847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 49903 50328 gene locus_tag LOCUS_12640 49903 50328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 50330 50962 gene locus_tag LOCUS_12650 50330 50962 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_12650 51555 51025 gene locus_tag LOCUS_12660 51555 51025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 51743 52198 gene locus_tag LOCUS_12670 51743 52198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65054 protein_id gnl|my_center|LOCUS_12670 52195 52971 gene locus_tag LOCUS_12680 52195 52971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 52999 55350 gene locus_tag LOCUS_12690 gene gcd 52999 55350 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973588.1 protein_id gnl|my_center|LOCUS_12690 55354 56187 gene locus_tag LOCUS_12700 55354 56187 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_12700 56194 56973 gene locus_tag LOCUS_12710 56194 56973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 58240 57026 gene locus_tag LOCUS_12720 58240 57026 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_12720 58384 58755 gene locus_tag LOCUS_12730 58384 58755 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088576.1 protein_id gnl|my_center|LOCUS_12730 59929 58766 gene locus_tag LOCUS_12740 59929 58766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 61041 59926 gene locus_tag LOCUS_12750 61041 59926 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730899.1 protein_id gnl|my_center|LOCUS_12750 61159 61932 gene locus_tag LOCUS_12760 61159 61932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 61995 63539 gene locus_tag LOCUS_12770 61995 63539 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918829.1 protein_id gnl|my_center|LOCUS_12770 63539 65029 gene locus_tag LOCUS_12780 63539 65029 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228971.1 protein_id gnl|my_center|LOCUS_12780 65044 65508 gene locus_tag LOCUS_12790 65044 65508 CDS product bile-acid 7-alpha-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727083.1 protein_id gnl|my_center|LOCUS_12790 65531 65830 gene locus_tag LOCUS_12800 65531 65830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 66749 65844 gene locus_tag LOCUS_12810 66749 65844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 67525 67611 gene locus_tag LOCUS_t00180 67525 67611 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67800 68987 gene locus_tag LOCUS_12820 67800 68987 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_12820 69029 69709 gene locus_tag LOCUS_12830 69029 69709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 69874 70092 gene locus_tag LOCUS_12840 69874 70092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 70560 71675 gene locus_tag LOCUS_12850 70560 71675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 73845 71764 gene locus_tag LOCUS_12860 73845 71764 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBQ0 protein_id gnl|my_center|LOCUS_12860 74480 73842 gene locus_tag LOCUS_12870 74480 73842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 78414 75496 gene locus_tag LOCUS_12880 78414 75496 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_12880 81311 78414 gene locus_tag LOCUS_12890 81311 78414 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387995.1 protein_id gnl|my_center|LOCUS_12890 81867 82232 gene locus_tag LOCUS_12900 81867 82232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 82882 82709 gene locus_tag LOCUS_12910 82882 82709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 83075 84121 gene locus_tag LOCUS_12920 83075 84121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 84389 85387 gene locus_tag LOCUS_12930 84389 85387 CDS product antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 protein_id gnl|my_center|LOCUS_12930 85454 87223 gene locus_tag LOCUS_12940 85454 87223 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533280.1 protein_id gnl|my_center|LOCUS_12940 87699 88022 gene locus_tag LOCUS_12950 87699 88022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533279.1 protein_id gnl|my_center|LOCUS_12950 88268 89074 gene locus_tag LOCUS_12960 88268 89074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 89198 89455 gene locus_tag LOCUS_12970 89198 89455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 90426 92129 gene locus_tag LOCUS_12980 90426 92129 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 protein_id gnl|my_center|LOCUS_12980 92230 92472 gene locus_tag LOCUS_12990 92230 92472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 92631 94622 gene locus_tag LOCUS_13000 92631 94622 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_13000 94633 95052 gene locus_tag LOCUS_13010 94633 95052 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082874.1 protein_id gnl|my_center|LOCUS_13010 96207 97394 gene locus_tag LOCUS_13020 96207 97394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 97391 99244 gene locus_tag LOCUS_13030 97391 99244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 99247 100161 gene locus_tag LOCUS_13040 99247 100161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 100714 102474 gene locus_tag LOCUS_13050 100714 102474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 protein_id gnl|my_center|LOCUS_13050 102474 103922 gene locus_tag LOCUS_13060 102474 103922 CDS product nuclease PIN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942012.1 protein_id gnl|my_center|LOCUS_13060 105890 103983 gene locus_tag LOCUS_13070 105890 103983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 <107674 105814 gene locus_tag LOCUS_13080 <107674 105814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087403.1:ATP-dependent endonuclease >Feature sequence09 167 400 gene locus_tag LOCUS_13090 167 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 666 1121 gene locus_tag LOCUS_13100 666 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1808 1200 gene locus_tag LOCUS_13110 1808 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3231 1909 gene locus_tag LOCUS_13120 3231 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3506 3979 gene locus_tag LOCUS_13130 3506 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4260 5663 gene locus_tag LOCUS_13140 gene fumC 4260 5663 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9S6 protein_id gnl|my_center|LOCUS_13140 5947 7722 gene locus_tag LOCUS_13150 5947 7722 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_13150 8988 7813 gene locus_tag LOCUS_13160 gene wcaG 8988 7813 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537490.1 protein_id gnl|my_center|LOCUS_13160 9263 11014 gene locus_tag LOCUS_13170 9263 11014 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921222.1 protein_id gnl|my_center|LOCUS_13170 11045 11380 gene locus_tag LOCUS_13180 11045 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 11547 11726 gene locus_tag LOCUS_13190 11547 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 11924 12850 gene locus_tag LOCUS_13200 gene prmA 11924 12850 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A838 protein_id gnl|my_center|LOCUS_13200 12912 14726 gene locus_tag LOCUS_13210 12912 14726 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 protein_id gnl|my_center|LOCUS_13210 17105 14721 gene locus_tag LOCUS_13220 gene ligA 17105 14721 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5Y7 protein_id gnl|my_center|LOCUS_13220 18830 17127 gene locus_tag LOCUS_13230 18830 17127 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6V0 protein_id gnl|my_center|LOCUS_13230 19722 18919 gene locus_tag LOCUS_13240 gene bamD 19722 18919 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6U9 protein_id gnl|my_center|LOCUS_13240 20806 19865 gene locus_tag LOCUS_13250 gene lpxC 20806 19865 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F2 protein_id gnl|my_center|LOCUS_13250 22582 21062 gene locus_tag LOCUS_13260 gene ftsZ 22582 21062 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAU9 protein_id gnl|my_center|LOCUS_13260 23926 22754 gene locus_tag LOCUS_13270 gene ftsA 23926 22754 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A331 protein_id gnl|my_center|LOCUS_13270 24904 24050 gene locus_tag LOCUS_13280 24904 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 25800 24892 gene locus_tag LOCUS_13290 gene ddl 25800 24892 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L8 protein_id gnl|my_center|LOCUS_13290 26552 26022 gene locus_tag LOCUS_13300 26552 26022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 26888 27361 gene locus_tag LOCUS_13310 26888 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 28122 27382 gene locus_tag LOCUS_13320 gene arsH 28122 27382 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926640.1 protein_id gnl|my_center|LOCUS_13320 28571 28119 gene locus_tag LOCUS_13330 28571 28119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 29569 28604 gene locus_tag LOCUS_13340 29569 28604 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087810.1 protein_id gnl|my_center|LOCUS_13340 30597 29701 gene locus_tag LOCUS_13350 gene murB 30597 29701 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 protein_id gnl|my_center|LOCUS_13350 31462 30791 gene locus_tag LOCUS_13360 31462 30791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 32365 31580 gene locus_tag LOCUS_13370 32365 31580 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N1 protein_id gnl|my_center|LOCUS_13370 32593 33138 gene locus_tag LOCUS_13380 32593 33138 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815287.1 protein_id gnl|my_center|LOCUS_13380 33632 33147 gene locus_tag LOCUS_13390 33632 33147 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_13390 34538 33669 gene locus_tag LOCUS_13400 34538 33669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 35657 34695 gene locus_tag LOCUS_13410 35657 34695 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_13410 35805 36494 gene locus_tag LOCUS_13420 35805 36494 CDS product Zn-dependent hydrolase glyoxalase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 protein_id gnl|my_center|LOCUS_13420 37038 36511 gene locus_tag LOCUS_13430 37038 36511 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_13430 37653 37159 gene locus_tag LOCUS_13440 37653 37159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 38113 41430 gene locus_tag LOCUS_13450 38113 41430 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 protein_id gnl|my_center|LOCUS_13450 41475 41948 gene locus_tag LOCUS_13460 gene greA 41475 41948 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB1 protein_id gnl|my_center|LOCUS_13460 41981 43024 gene locus_tag LOCUS_13470 41981 43024 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920689.1 protein_id gnl|my_center|LOCUS_13470 43140 43295 gene locus_tag LOCUS_13480 43140 43295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 43307 44164 gene locus_tag LOCUS_13490 gene zitB 43307 44164 CDS product cation efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 protein_id gnl|my_center|LOCUS_13490 44331 45305 gene locus_tag LOCUS_13500 44331 45305 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF0 protein_id gnl|my_center|LOCUS_13500 45423 46322 gene locus_tag LOCUS_13510 45423 46322 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_13510 46647 47021 gene locus_tag LOCUS_13520 46647 47021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 47107 47955 gene locus_tag LOCUS_13530 47107 47955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208554.1 protein_id gnl|my_center|LOCUS_13530 48048 49793 gene locus_tag LOCUS_13540 48048 49793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_13540 50723 49857 gene locus_tag LOCUS_13550 50723 49857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 52785 50809 gene locus_tag LOCUS_13560 52785 50809 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920917.1 protein_id gnl|my_center|LOCUS_13560 52939 54744 gene locus_tag LOCUS_13570 52939 54744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 54844 56613 gene locus_tag LOCUS_13580 54844 56613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 protein_id gnl|my_center|LOCUS_13580 57359 56622 gene locus_tag LOCUS_13590 gene phoB 57359 56622 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_13590 58047 57343 gene locus_tag LOCUS_13600 gene phoU 58047 57343 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV9 protein_id gnl|my_center|LOCUS_13600 59486 58152 gene locus_tag LOCUS_13610 gene phoR 59486 58152 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918178.1 protein_id gnl|my_center|LOCUS_13610 59851 61281 gene locus_tag LOCUS_13620 59851 61281 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_13620 61278 62693 gene locus_tag LOCUS_13630 61278 62693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 62693 65890 gene locus_tag LOCUS_13640 62693 65890 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_13640 65982 68180 gene locus_tag LOCUS_13650 65982 68180 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705124.1 protein_id gnl|my_center|LOCUS_13650 69311 68223 gene locus_tag LOCUS_13660 69311 68223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 70387 69383 gene locus_tag LOCUS_13670 gene ldhA 70387 69383 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973390.1 protein_id gnl|my_center|LOCUS_13670 70807 71427 gene locus_tag LOCUS_13680 70807 71427 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917971.1 protein_id gnl|my_center|LOCUS_13680 72234 71431 gene locus_tag LOCUS_13690 72234 71431 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945820.1 protein_id gnl|my_center|LOCUS_13690 72796 72320 gene locus_tag LOCUS_13700 72796 72320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 74688 73078 gene locus_tag LOCUS_13710 gene lysS 74688 73078 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C6 protein_id gnl|my_center|LOCUS_13710 75314 74772 gene locus_tag LOCUS_13720 75314 74772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 75397 76041 gene locus_tag LOCUS_13730 75397 76041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 76918 76181 gene locus_tag LOCUS_13740 76918 76181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 77150 77347 gene locus_tag LOCUS_13750 77150 77347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 77455 77937 gene locus_tag LOCUS_13760 77455 77937 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L47 protein_id gnl|my_center|LOCUS_13760 78063 78758 gene locus_tag LOCUS_13770 gene pgsA 78063 78758 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_13770 79418 79663 gene locus_tag LOCUS_13780 79418 79663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 79811 80437 gene locus_tag LOCUS_13790 79811 80437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 80575 82026 gene locus_tag LOCUS_13800 gene rimK 80575 82026 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_13800 82118 83443 gene locus_tag LOCUS_13810 82118 83443 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268576.1 protein_id gnl|my_center|LOCUS_13810 83982 83575 gene locus_tag LOCUS_13820 83982 83575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 85384 83993 gene locus_tag LOCUS_13830 gene fliI 85384 83993 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H363 protein_id gnl|my_center|LOCUS_13830 85624 86340 gene locus_tag LOCUS_13840 gene ctrA 85624 86340 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314973.1 protein_id gnl|my_center|LOCUS_13840 86894 86406 gene locus_tag LOCUS_13850 86894 86406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 86987 87340 gene locus_tag LOCUS_13860 gene ybaA 86987 87340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AAQ6 protein_id gnl|my_center|LOCUS_13860 87363 88013 gene locus_tag LOCUS_13870 87363 88013 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920739.1 protein_id gnl|my_center|LOCUS_13870 88494 88030 gene locus_tag LOCUS_13880 88494 88030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 89181 88552 gene locus_tag LOCUS_13890 gene ruvA 89181 88552 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3G7 protein_id gnl|my_center|LOCUS_13890 89732 89178 gene locus_tag LOCUS_13900 gene ruvC 89732 89178 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3G6 protein_id gnl|my_center|LOCUS_13900 89881 90654 gene locus_tag LOCUS_13910 89881 90654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 91151 90681 gene locus_tag LOCUS_13920 91151 90681 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_13920 91658 91158 gene locus_tag LOCUS_13930 91658 91158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085349.1 protein_id gnl|my_center|LOCUS_13930 91845 92462 gene locus_tag LOCUS_13940 91845 92462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 92719 94254 gene locus_tag LOCUS_13950 92719 94254 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920125.1 protein_id gnl|my_center|LOCUS_13950 94311 95621 gene locus_tag LOCUS_13960 94311 95621 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920240.1 protein_id gnl|my_center|LOCUS_13960 96013 96990 gene locus_tag LOCUS_13970 96013 96990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 97044 98306 gene locus_tag LOCUS_13980 97044 98306 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707074.1 protein_id gnl|my_center|LOCUS_13980 98373 99038 gene locus_tag LOCUS_13990 98373 99038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 99625 99035 gene locus_tag LOCUS_14000 gene tdk 99625 99035 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI10 protein_id gnl|my_center|LOCUS_14000 99754 100746 gene locus_tag LOCUS_14010 99754 100746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence10 <1 1936 gene locus_tag LOCUS_14020 <1 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974090.1:formate dehydrogenase subunit alpha 1933 2154 gene locus_tag LOCUS_14030 1933 2154 CDS product NAD-dependent formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085918.1 protein_id gnl|my_center|LOCUS_14030 2151 2951 gene locus_tag LOCUS_14040 gene fdhD 2151 2951 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 protein_id gnl|my_center|LOCUS_14040 3737 2958 gene locus_tag LOCUS_14050 3737 2958 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_14050 5226 3853 gene locus_tag LOCUS_14060 5226 3853 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_14060 8342 5226 gene locus_tag LOCUS_14070 8342 5226 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972023.1 protein_id gnl|my_center|LOCUS_14070 9337 8339 gene locus_tag LOCUS_14080 9337 8339 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529678.1 protein_id gnl|my_center|LOCUS_14080 10749 9736 gene locus_tag LOCUS_14090 gene modD 10749 9736 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4U7 protein_id gnl|my_center|LOCUS_14090 11494 10817 gene locus_tag LOCUS_14100 gene modB 11494 10817 CDS product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_14100 12264 11491 gene locus_tag LOCUS_14110 gene modA 12264 11491 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_14110 13451 12255 gene locus_tag LOCUS_14120 gene moeA 13451 12255 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_14120 14207 13650 gene locus_tag LOCUS_14130 gene tdcF 14207 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368469.1 protein_id gnl|my_center|LOCUS_14130 14691 14230 gene locus_tag LOCUS_14140 14691 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 16262 14688 gene locus_tag LOCUS_14150 16262 14688 CDS product flavin monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368471.1 protein_id gnl|my_center|LOCUS_14150 16558 18255 gene locus_tag LOCUS_14160 16558 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 18252 19223 gene locus_tag LOCUS_14170 18252 19223 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707234.1 protein_id gnl|my_center|LOCUS_14170 19309 20280 gene locus_tag LOCUS_14180 19309 20280 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920827.1 protein_id gnl|my_center|LOCUS_14180 20502 21764 gene locus_tag LOCUS_14190 20502 21764 CDS product macrolide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969680.1 protein_id gnl|my_center|LOCUS_14190 21766 23715 gene locus_tag LOCUS_14200 gene macB 21766 23715 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPB4 protein_id gnl|my_center|LOCUS_14200 23715 25070 gene locus_tag LOCUS_14210 23715 25070 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390985.1 protein_id gnl|my_center|LOCUS_14210 25385 26620 gene locus_tag LOCUS_14220 25385 26620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_14220 26628 27272 gene locus_tag LOCUS_14230 26628 27272 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061461.1 protein_id gnl|my_center|LOCUS_14230 27283 28527 gene locus_tag LOCUS_14240 27283 28527 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_14240 29297 28536 gene locus_tag LOCUS_14250 29297 28536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 31986 29302 gene locus_tag LOCUS_14260 gene narB 31986 29302 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 protein_id gnl|my_center|LOCUS_14260 32328 31990 gene locus_tag LOCUS_14270 gene nirD 32328 31990 CDS product tRNA-(guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003519747.1 protein_id gnl|my_center|LOCUS_14270 34766 32328 gene locus_tag LOCUS_14280 gene nirB 34766 32328 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973414.1 protein_id gnl|my_center|LOCUS_14280 35706 34777 gene locus_tag LOCUS_14290 35706 34777 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087597.1 protein_id gnl|my_center|LOCUS_14290 37457 35718 gene locus_tag LOCUS_14300 37457 35718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 38593 37475 gene locus_tag LOCUS_14310 38593 37475 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_14310 40192 38699 gene locus_tag LOCUS_14320 40192 38699 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_14320 40848 42842 gene locus_tag LOCUS_14330 gene hmuA 40848 42842 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_14330 42941 43612 gene locus_tag LOCUS_14340 42941 43612 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_14340 43602 43979 gene locus_tag LOCUS_14350 43602 43979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 43976 44359 gene locus_tag LOCUS_14360 43976 44359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 44356 45162 gene locus_tag LOCUS_14370 44356 45162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 45830 45273 gene locus_tag LOCUS_14380 45830 45273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 46675 45872 gene locus_tag LOCUS_14390 46675 45872 CDS product nickel transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640432.1 protein_id gnl|my_center|LOCUS_14390 47500 46820 gene locus_tag LOCUS_14400 47500 46820 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888427.1 protein_id gnl|my_center|LOCUS_14400 48993 47497 gene locus_tag LOCUS_14410 48993 47497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 50072 49311 gene locus_tag LOCUS_14420 50072 49311 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090528.1 protein_id gnl|my_center|LOCUS_14420 50263 50898 gene locus_tag LOCUS_14430 50263 50898 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040681.1 protein_id gnl|my_center|LOCUS_14430 51908 50988 gene locus_tag LOCUS_14440 gene fbp 51908 50988 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE96 protein_id gnl|my_center|LOCUS_14440 52310 54604 gene locus_tag LOCUS_14450 gene fyuA 52310 54604 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_14450 54642 55652 gene locus_tag LOCUS_14460 54642 55652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 56327 55728 gene locus_tag LOCUS_14470 56327 55728 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AA17 protein_id gnl|my_center|LOCUS_14470 57302 56379 gene locus_tag LOCUS_14480 57302 56379 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706480.1 protein_id gnl|my_center|LOCUS_14480 58322 57363 gene locus_tag LOCUS_14490 gene mhpB 58322 57363 CDS product 2,3-dihydroxyphenylpropionate/2,3-dihydroxicinnamic acid 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABR9 protein_id gnl|my_center|LOCUS_14490 59216 58350 gene locus_tag LOCUS_14500 59216 58350 CDS product 2-hydroxy-6-ketonona-2,4-dienedioic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730147.1 protein_id gnl|my_center|LOCUS_14500 59404 60036 gene locus_tag LOCUS_14510 59404 60036 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870392.1 protein_id gnl|my_center|LOCUS_14510 61921 60071 gene locus_tag LOCUS_14520 61921 60071 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_14520 62153 62899 gene locus_tag LOCUS_14530 62153 62899 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035638.1 protein_id gnl|my_center|LOCUS_14530 63371 62928 gene locus_tag LOCUS_14540 63371 62928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 63762 65981 gene locus_tag LOCUS_14550 63762 65981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14550 65983 66369 gene locus_tag LOCUS_14560 65983 66369 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_14560 66366 67178 gene locus_tag LOCUS_14570 66366 67178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 68456 67305 gene locus_tag LOCUS_14580 68456 67305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920182.1 protein_id gnl|my_center|LOCUS_14580 69364 68576 gene locus_tag LOCUS_14590 69364 68576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 69723 70148 gene locus_tag LOCUS_14600 69723 70148 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920110.1 protein_id gnl|my_center|LOCUS_14600 71370 70141 gene locus_tag LOCUS_14610 gene thiO 71370 70141 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403986.1 protein_id gnl|my_center|LOCUS_14610 71497 71940 gene locus_tag LOCUS_14620 71497 71940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 72449 72120 gene locus_tag LOCUS_14630 72449 72120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 73637 72600 gene locus_tag LOCUS_14640 73637 72600 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919943.1 protein_id gnl|my_center|LOCUS_14640 74926 73760 gene locus_tag LOCUS_14650 74926 73760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 75954 75043 gene locus_tag LOCUS_14660 75954 75043 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919944.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 76607 76023 gene locus_tag LOCUS_14670 76607 76023 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_14670 76705 78486 gene locus_tag LOCUS_14680 76705 78486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_14680 78814 79023 gene locus_tag LOCUS_14690 78814 79023 CDS product putative cold shock protein y4cH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55390 protein_id gnl|my_center|LOCUS_14690 79099 80292 gene locus_tag LOCUS_14700 79099 80292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 82115 80289 gene locus_tag LOCUS_14710 82115 80289 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5G5 protein_id gnl|my_center|LOCUS_14710 82378 82112 gene locus_tag LOCUS_14720 82378 82112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 82542 83309 gene locus_tag LOCUS_14730 82542 83309 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088008.1 protein_id gnl|my_center|LOCUS_14730 83473 84507 gene locus_tag LOCUS_14740 83473 84507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 84494 85906 gene locus_tag LOCUS_14750 84494 85906 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379730.1 protein_id gnl|my_center|LOCUS_14750 86331 85924 gene locus_tag LOCUS_14760 86331 85924 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528644.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence11 721 945 gene locus_tag LOCUS_14770 721 945 CDS product addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_14770 942 1331 gene locus_tag LOCUS_14780 942 1331 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_14780 1328 1693 gene locus_tag LOCUS_14790 1328 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_14790 1806 2879 gene locus_tag LOCUS_14800 1806 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3386 2880 gene locus_tag LOCUS_14810 3386 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639548.2 protein_id gnl|my_center|LOCUS_14810 3548 4189 gene locus_tag LOCUS_14820 3548 4189 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_14820 5242 4184 gene locus_tag LOCUS_14830 5242 4184 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 protein_id gnl|my_center|LOCUS_14830 6128 5322 gene locus_tag LOCUS_14840 6128 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 6530 6189 gene locus_tag LOCUS_14850 6530 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 6757 7914 gene locus_tag LOCUS_14860 6757 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 8017 8505 gene locus_tag LOCUS_14870 8017 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 9085 8663 gene locus_tag LOCUS_14880 9085 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 9550 10146 gene locus_tag LOCUS_14890 9550 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 10143 12122 gene locus_tag LOCUS_14900 gene thiC 10143 12122 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KNV0 protein_id gnl|my_center|LOCUS_14900 14182 12497 gene locus_tag LOCUS_14910 14182 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 14576 14337 gene locus_tag LOCUS_14920 14576 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 14848 15024 gene locus_tag LOCUS_14930 gene slyX 14848 15024 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SJ8 protein_id gnl|my_center|LOCUS_14930 15197 15811 gene locus_tag LOCUS_14940 15197 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 16345 15947 gene locus_tag LOCUS_14950 16345 15947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 17012 16470 gene locus_tag LOCUS_14960 17012 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 17383 17189 gene locus_tag LOCUS_14970 17383 17189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 17822 18034 gene locus_tag LOCUS_14980 gene cspA 17822 18034 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_14980 18195 18031 gene locus_tag LOCUS_14990 18195 18031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 18385 18185 gene locus_tag LOCUS_15000 18385 18185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 18479 19684 gene locus_tag LOCUS_15010 gene hisC 18479 19684 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJC5 protein_id gnl|my_center|LOCUS_15010 20365 19712 gene locus_tag LOCUS_15020 20365 19712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 20984 20457 gene locus_tag LOCUS_15030 20984 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 21777 21085 gene locus_tag LOCUS_15040 21777 21085 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_15040 22491 21862 gene locus_tag LOCUS_15050 22491 21862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 22741 23520 gene locus_tag LOCUS_15060 22741 23520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 23876 23550 gene locus_tag LOCUS_15070 23876 23550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 25043 23967 gene locus_tag LOCUS_15080 25043 23967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 25850 25230 gene locus_tag LOCUS_15090 25850 25230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 26555 25977 gene locus_tag LOCUS_15100 26555 25977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 26979 26482 gene locus_tag LOCUS_15110 26979 26482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707537.1 protein_id gnl|my_center|LOCUS_15110 27527 26976 gene locus_tag LOCUS_15120 27527 26976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 28088 27540 gene locus_tag LOCUS_15130 28088 27540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 28333 28085 gene locus_tag LOCUS_15140 28333 28085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 28596 29921 gene locus_tag LOCUS_15150 28596 29921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 30564 29968 gene locus_tag LOCUS_15160 30564 29968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_15160 31228 30485 gene locus_tag LOCUS_15170 31228 30485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_15170 31671 31423 gene locus_tag LOCUS_15180 31671 31423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 32165 31812 gene locus_tag LOCUS_15190 32165 31812 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_15190 32475 32155 gene locus_tag LOCUS_15200 32475 32155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 32663 35059 gene locus_tag LOCUS_15210 32663 35059 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A836 protein_id gnl|my_center|LOCUS_15210 36079 35066 gene locus_tag LOCUS_15220 36079 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 36337 36696 gene locus_tag LOCUS_15230 36337 36696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 36896 37078 gene locus_tag LOCUS_15240 36896 37078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 37361 37059 gene locus_tag LOCUS_15250 37361 37059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 37526 38362 gene locus_tag LOCUS_15260 37526 38362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 38522 39085 gene locus_tag LOCUS_15270 38522 39085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 39239 39493 gene locus_tag LOCUS_15280 39239 39493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 39701 40012 gene locus_tag LOCUS_15290 39701 40012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 40525 41280 gene locus_tag LOCUS_15300 40525 41280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 44124 41326 gene locus_tag LOCUS_15310 44124 41326 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921293.1 protein_id gnl|my_center|LOCUS_15310 44352 45905 gene locus_tag LOCUS_15320 44352 45905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 45902 46276 gene locus_tag LOCUS_15330 45902 46276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 47702 46290 gene locus_tag LOCUS_15340 47702 46290 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_15340 48772 47699 gene locus_tag LOCUS_15350 48772 47699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 50046 48892 gene locus_tag LOCUS_15360 50046 48892 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2D4 protein_id gnl|my_center|LOCUS_15360 50172 50705 gene locus_tag LOCUS_15370 50172 50705 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_15370 52276 50765 gene locus_tag LOCUS_15380 gene katA 52276 50765 CDS product catalase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95631 protein_id gnl|my_center|LOCUS_15380 53152 52421 gene locus_tag LOCUS_15390 gene mtgA 53152 52421 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B7 protein_id gnl|my_center|LOCUS_15390 53913 53236 gene locus_tag LOCUS_15400 gene fzlA 53913 53236 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921466.1 protein_id gnl|my_center|LOCUS_15400 54976 53999 gene locus_tag LOCUS_15410 54976 53999 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921468.1 protein_id gnl|my_center|LOCUS_15410 55674 55147 gene locus_tag LOCUS_15420 55674 55147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918014.1 protein_id gnl|my_center|LOCUS_15420 57331 55820 gene locus_tag LOCUS_15430 57331 55820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 protein_id gnl|my_center|LOCUS_15430 57475 57705 gene locus_tag LOCUS_15440 57475 57705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 57763 58884 gene locus_tag LOCUS_15450 57763 58884 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917978.1 protein_id gnl|my_center|LOCUS_15450 59225 59914 gene locus_tag LOCUS_15460 gene yijF 59225 59914 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648011.1 protein_id gnl|my_center|LOCUS_15460 60132 64961 gene locus_tag LOCUS_15470 gene gdhZ 60132 64961 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917977.1 protein_id gnl|my_center|LOCUS_15470 64999 65523 gene locus_tag LOCUS_15480 64999 65523 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 protein_id gnl|my_center|LOCUS_15480 65615 66391 gene locus_tag LOCUS_15490 65615 66391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 66468 67022 gene locus_tag LOCUS_15500 66468 67022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 67622 67098 gene locus_tag LOCUS_15510 67622 67098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 67810 68958 gene locus_tag LOCUS_15520 67810 68958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 69548 69054 gene locus_tag LOCUS_15530 69548 69054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 69770 71599 gene locus_tag LOCUS_15540 gene lepA 69770 71599 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2Z7 protein_id gnl|my_center|LOCUS_15540 71868 71605 gene locus_tag LOCUS_15550 71868 71605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 71761 72054 gene locus_tag LOCUS_15560 71761 72054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 72899 72036 gene locus_tag LOCUS_15570 72899 72036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 73088 73753 gene locus_tag LOCUS_15580 73088 73753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 74662 73763 gene locus_tag LOCUS_15590 74662 73763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115327.1 protein_id gnl|my_center|LOCUS_15590 74997 76055 gene locus_tag LOCUS_15600 74997 76055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 76173 77030 gene locus_tag LOCUS_15610 76173 77030 CDS product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708369.1 protein_id gnl|my_center|LOCUS_15610 77198 77037 gene locus_tag LOCUS_15620 77198 77037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 77282 78106 gene locus_tag LOCUS_15630 gene hetN 77282 78106 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_15630 78728 78135 gene locus_tag LOCUS_15640 78728 78135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 79195 78944 gene locus_tag LOCUS_15650 79195 78944 CDS product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917992.1 protein_id gnl|my_center|LOCUS_15650 79360 80196 gene locus_tag LOCUS_15660 gene htpX 79360 80196 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL09 protein_id gnl|my_center|LOCUS_15660 80352 81581 gene locus_tag LOCUS_15670 gene sun 80352 81581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_15670 81680 82189 gene locus_tag LOCUS_15680 81680 82189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 82267 82938 gene locus_tag LOCUS_15690 82267 82938 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 protein_id gnl|my_center|LOCUS_15690 83008 84744 gene locus_tag LOCUS_15700 83008 84744 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529012.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence12 2731 1601 gene locus_tag LOCUS_15710 2731 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3061 2903 gene locus_tag LOCUS_15720 3061 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 3365 4357 gene locus_tag LOCUS_15730 3365 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4341 5384 gene locus_tag LOCUS_15740 4341 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 5498 7885 gene locus_tag LOCUS_15750 5498 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 8539 7889 gene locus_tag LOCUS_15760 8539 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8694 9824 gene locus_tag LOCUS_15770 8694 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 11184 10237 gene locus_tag LOCUS_15780 11184 10237 CDS product GDP-6-deoxy-D-lyxo-4-hexulose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771489.1 protein_id gnl|my_center|LOCUS_15780 12164 11184 gene locus_tag LOCUS_15790 gene gmd 12164 11184 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C7I0 protein_id gnl|my_center|LOCUS_15790 14386 12275 gene locus_tag LOCUS_15800 14386 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 14837 14379 gene locus_tag LOCUS_15810 14837 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 15301 16161 gene locus_tag LOCUS_15820 15301 16161 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731237.1 protein_id gnl|my_center|LOCUS_15820 16168 18912 gene locus_tag LOCUS_15830 16168 18912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 18954 19940 gene locus_tag LOCUS_15840 18954 19940 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_15840 20321 22459 gene locus_tag LOCUS_15850 20321 22459 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532683.1 protein_id gnl|my_center|LOCUS_15850 23427 22474 gene locus_tag LOCUS_15860 23427 22474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 protein_id gnl|my_center|LOCUS_15860 23650 25002 gene locus_tag LOCUS_15870 gene glmM 23650 25002 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXK7 protein_id gnl|my_center|LOCUS_15870 25076 25282 gene locus_tag LOCUS_15880 25076 25282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 25349 26794 gene locus_tag LOCUS_15890 25349 26794 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_15890 27905 26808 gene locus_tag LOCUS_15900 27905 26808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 27995 28903 gene locus_tag LOCUS_15910 gene cysD 27995 28903 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4V5 protein_id gnl|my_center|LOCUS_15910 28903 30867 gene locus_tag LOCUS_15920 28903 30867 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385211.1 protein_id gnl|my_center|LOCUS_15920 30880 31620 gene locus_tag LOCUS_15930 30880 31620 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_15930 33064 31700 gene locus_tag LOCUS_15940 33064 31700 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_15940 33396 33941 gene locus_tag LOCUS_15950 33396 33941 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918293.1 protein_id gnl|my_center|LOCUS_15950 35952 33907 gene locus_tag LOCUS_15960 35952 33907 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085249.1 protein_id gnl|my_center|LOCUS_15960 38750 35949 gene locus_tag LOCUS_15970 38750 35949 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708854.1 protein_id gnl|my_center|LOCUS_15970 39616 38750 gene locus_tag LOCUS_15980 39616 38750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972177.1 protein_id gnl|my_center|LOCUS_15980 40670 39621 gene locus_tag LOCUS_15990 40670 39621 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976402.1 protein_id gnl|my_center|LOCUS_15990 40705 41313 gene locus_tag LOCUS_16000 40705 41313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_16000 41314 41958 gene locus_tag LOCUS_16010 41314 41958 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972174.1 protein_id gnl|my_center|LOCUS_16010 41989 42360 gene locus_tag LOCUS_16020 41989 42360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 42362 43627 gene locus_tag LOCUS_16030 42362 43627 CDS product poly(A) polymerase/tRNA-nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265544.1 protein_id gnl|my_center|LOCUS_16030 43884 43642 gene locus_tag LOCUS_16040 43884 43642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 44811 43909 gene locus_tag LOCUS_16050 gene hemF 44811 43909 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAT8 protein_id gnl|my_center|LOCUS_16050 44976 45290 gene locus_tag LOCUS_16060 44976 45290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 46138 45302 gene locus_tag LOCUS_16070 46138 45302 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_16070 46269 47519 gene locus_tag LOCUS_16080 46269 47519 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 protein_id gnl|my_center|LOCUS_16080 48432 47527 gene locus_tag LOCUS_16090 gene rlmJ 48432 47527 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM23 protein_id gnl|my_center|LOCUS_16090 48568 49611 gene locus_tag LOCUS_16100 48568 49611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 50463 49615 gene locus_tag LOCUS_16110 50463 49615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 51236 50589 gene locus_tag LOCUS_16120 gene clpP 51236 50589 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBU1 protein_id gnl|my_center|LOCUS_16120 51465 51875 gene locus_tag LOCUS_16130 51465 51875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 52431 51877 gene locus_tag LOCUS_16140 gene rimJ 52431 51877 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038041.1 protein_id gnl|my_center|LOCUS_16140 52991 52644 gene locus_tag LOCUS_16150 52991 52644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 53778 53128 gene locus_tag LOCUS_16160 53778 53128 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709753.1 protein_id gnl|my_center|LOCUS_16160 54679 53795 gene locus_tag LOCUS_16170 gene mtnP 54679 53795 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH9 protein_id gnl|my_center|LOCUS_16170 54860 55219 gene locus_tag LOCUS_16180 54860 55219 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 protein_id gnl|my_center|LOCUS_16180 56220 55306 gene locus_tag LOCUS_16190 56220 55306 CDS product ubiquinol cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918362.1 protein_id gnl|my_center|LOCUS_16190 57716 56235 gene locus_tag LOCUS_16200 57716 56235 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAW9 protein_id gnl|my_center|LOCUS_16200 58299 57733 gene locus_tag LOCUS_16210 58299 57733 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5K1 protein_id gnl|my_center|LOCUS_16210 58417 58878 gene locus_tag LOCUS_16220 gene trmL 58417 58878 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4U6 protein_id gnl|my_center|LOCUS_16220 58991 59320 gene locus_tag LOCUS_16230 58991 59320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 59317 60807 gene locus_tag LOCUS_16240 59317 60807 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389995.1 protein_id gnl|my_center|LOCUS_16240 61012 60827 gene locus_tag LOCUS_16250 61012 60827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 61083 62021 gene locus_tag LOCUS_16260 61083 62021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 62104 62388 gene locus_tag LOCUS_16270 62104 62388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 63408 62395 gene locus_tag LOCUS_16280 63408 62395 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3Z4 protein_id gnl|my_center|LOCUS_16280 63616 64416 gene locus_tag LOCUS_16290 63616 64416 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_16290 64517 65503 gene locus_tag LOCUS_16300 64517 65503 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067744.1 protein_id gnl|my_center|LOCUS_16300 66160 65579 gene locus_tag LOCUS_16310 66160 65579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 66841 66380 gene locus_tag LOCUS_16320 66841 66380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 68681 67104 gene locus_tag LOCUS_16330 68681 67104 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCT7 protein_id gnl|my_center|LOCUS_16330 69917 68754 gene locus_tag LOCUS_16340 gene serC 69917 68754 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 protein_id gnl|my_center|LOCUS_16340 70168 71298 gene locus_tag LOCUS_16350 70168 71298 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_16350 71405 72580 gene locus_tag LOCUS_16360 71405 72580 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532210.1 protein_id gnl|my_center|LOCUS_16360 73392 72577 gene locus_tag LOCUS_16370 73392 72577 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921054.1 protein_id gnl|my_center|LOCUS_16370 73486 73944 gene locus_tag LOCUS_16380 73486 73944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 protein_id gnl|my_center|LOCUS_16380 74780 73941 gene locus_tag LOCUS_16390 74780 73941 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_16390 75829 74777 gene locus_tag LOCUS_16400 75829 74777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 76528 76004 gene locus_tag LOCUS_16410 76528 76004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920106.1 protein_id gnl|my_center|LOCUS_16410 76774 77637 gene locus_tag LOCUS_16420 76774 77637 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A651 protein_id gnl|my_center|LOCUS_16420 77740 78924 gene locus_tag LOCUS_16430 gene argD 77740 78924 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB6 protein_id gnl|my_center|LOCUS_16430 78926 79852 gene locus_tag LOCUS_16440 gene arcB 78926 79852 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAE2 protein_id gnl|my_center|LOCUS_16440 79834 80256 gene locus_tag LOCUS_16450 79834 80256 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829969.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence13 317 1411 gene locus_tag LOCUS_16460 317 1411 CDS product dolichol monophosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_16460 1487 2146 gene locus_tag LOCUS_16470 gene thiE 1487 2146 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_16470 2292 4430 gene locus_tag LOCUS_16480 2292 4430 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_16480 4536 5345 gene locus_tag LOCUS_16490 gene suhB 4536 5345 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084333.1 protein_id gnl|my_center|LOCUS_16490 6496 5342 gene locus_tag LOCUS_16500 6496 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 8417 6591 gene locus_tag LOCUS_16510 8417 6591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923241.1 protein_id gnl|my_center|LOCUS_16510 8509 8736 gene locus_tag LOCUS_16520 gene rpmE 8509 8736 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3C9 protein_id gnl|my_center|LOCUS_16520 9395 8847 gene locus_tag LOCUS_16530 gene rcdA 9395 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 protein_id gnl|my_center|LOCUS_16530 9667 9491 gene locus_tag LOCUS_16540 9667 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9778 10752 gene locus_tag LOCUS_16550 9778 10752 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_16550 10910 11617 gene locus_tag LOCUS_16560 10910 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923245.1 protein_id gnl|my_center|LOCUS_16560 12416 11622 gene locus_tag LOCUS_16570 12416 11622 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720866.1 protein_id gnl|my_center|LOCUS_16570 12935 12465 gene locus_tag LOCUS_16580 12935 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 13273 13106 gene locus_tag LOCUS_16590 13273 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 13581 13802 gene locus_tag LOCUS_16600 13581 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 14580 13837 gene locus_tag LOCUS_16610 gene dgcA 14580 13837 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_16610 14887 15405 gene locus_tag LOCUS_16620 gene purE 14887 15405 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ4 protein_id gnl|my_center|LOCUS_16620 15402 16496 gene locus_tag LOCUS_16630 gene purK 15402 16496 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3C1 protein_id gnl|my_center|LOCUS_16630 17166 16516 gene locus_tag LOCUS_16640 17166 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 protein_id gnl|my_center|LOCUS_16640 17396 17554 gene locus_tag LOCUS_16650 17396 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 18045 17728 gene locus_tag LOCUS_16660 18045 17728 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L8 protein_id gnl|my_center|LOCUS_16660 18566 18156 gene locus_tag LOCUS_16670 18566 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 19413 18649 gene locus_tag LOCUS_16680 19413 18649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_16680 19505 20983 gene locus_tag LOCUS_16690 gene creD 19505 20983 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_16690 22250 21072 gene locus_tag LOCUS_16700 22250 21072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 23307 22363 gene locus_tag LOCUS_16710 23307 22363 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265975.1 protein_id gnl|my_center|LOCUS_16710 23597 24025 gene locus_tag LOCUS_16720 23597 24025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 24134 24775 gene locus_tag LOCUS_16730 24134 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 24871 25995 gene locus_tag LOCUS_16740 24871 25995 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_16740 26944 26030 gene locus_tag LOCUS_16750 26944 26030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 27205 28167 gene locus_tag LOCUS_16760 gene mdh 27205 28167 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2B1 protein_id gnl|my_center|LOCUS_16760 28289 29695 gene locus_tag LOCUS_16770 28289 29695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 29798 30400 gene locus_tag LOCUS_16780 29798 30400 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705438.1 protein_id gnl|my_center|LOCUS_16780 31200 30403 gene locus_tag LOCUS_16790 31200 30403 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_16790 33326 31269 gene locus_tag LOCUS_16800 33326 31269 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918113.1 protein_id gnl|my_center|LOCUS_16800 33527 33769 gene locus_tag LOCUS_16810 33527 33769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 33931 35223 gene locus_tag LOCUS_16820 33931 35223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_16820 36017 35244 gene locus_tag LOCUS_16830 36017 35244 CDS product LytTr DNA-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265527.1 protein_id gnl|my_center|LOCUS_16830 36286 36729 gene locus_tag LOCUS_16840 36286 36729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 36866 38032 gene locus_tag LOCUS_16850 36866 38032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 38296 39492 gene locus_tag LOCUS_16860 gene sucC 38296 39492 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EYG9 protein_id gnl|my_center|LOCUS_16860 39498 40400 gene locus_tag LOCUS_16870 39498 40400 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDP1 protein_id gnl|my_center|LOCUS_16870 40491 43496 gene locus_tag LOCUS_16880 gene odhA 40491 43496 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918228.1 protein_id gnl|my_center|LOCUS_16880 43547 44923 gene locus_tag LOCUS_16890 gene sucB 43547 44923 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 protein_id gnl|my_center|LOCUS_16890 44933 45052 gene locus_tag LOCUS_16900 44933 45052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16900 46103 45120 gene locus_tag LOCUS_16910 46103 45120 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090081.1 protein_id gnl|my_center|LOCUS_16910 49751 46194 gene locus_tag LOCUS_16920 49751 46194 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923305.1 protein_id gnl|my_center|LOCUS_16920 52828 49748 gene locus_tag LOCUS_16930 52828 49748 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921366.1 protein_id gnl|my_center|LOCUS_16930 53577 52828 gene locus_tag LOCUS_16940 53577 52828 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921365.1 protein_id gnl|my_center|LOCUS_16940 54639 53605 gene locus_tag LOCUS_16950 54639 53605 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 protein_id gnl|my_center|LOCUS_16950 55144 54677 gene locus_tag LOCUS_16960 55144 54677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16960 55254 55574 gene locus_tag LOCUS_16970 55254 55574 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_16970 55609 55887 gene locus_tag LOCUS_16980 55609 55887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 56336 57958 gene locus_tag LOCUS_16990 56336 57958 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920687.1 protein_id gnl|my_center|LOCUS_16990 58534 57986 gene locus_tag LOCUS_17000 gene rluE 58534 57986 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 protein_id gnl|my_center|LOCUS_17000 59259 58531 gene locus_tag LOCUS_17010 59259 58531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 61149 59338 gene locus_tag LOCUS_17020 gene opgH 61149 59338 CDS product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FA52 protein_id gnl|my_center|LOCUS_17020 61411 61211 gene locus_tag LOCUS_17030 61411 61211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 63080 61395 gene locus_tag LOCUS_17040 gene opgG 63080 61395 CDS product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FA54 protein_id gnl|my_center|LOCUS_17040 64327 63470 gene locus_tag LOCUS_17050 64327 63470 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_17050 66184 64409 gene locus_tag LOCUS_17060 gene flbA 66184 64409 CDS product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919333.1 protein_id gnl|my_center|LOCUS_17060 66369 66809 gene locus_tag LOCUS_17070 gene flbT 66369 66809 CDS product putative flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5S2 protein_id gnl|my_center|LOCUS_17070 66757 67170 gene locus_tag LOCUS_17080 gene flaF 66757 67170 CDS product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 protein_id gnl|my_center|LOCUS_17080 67334 68293 gene locus_tag LOCUS_17090 67334 68293 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265914.1 protein_id gnl|my_center|LOCUS_17090 68966 68298 gene locus_tag LOCUS_17100 68966 68298 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708983.1 protein_id gnl|my_center|LOCUS_17100 69234 70064 gene locus_tag LOCUS_17110 gene fljJ 69234 70064 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 protein_id gnl|my_center|LOCUS_17110 70464 71285 gene locus_tag LOCUS_17120 gene fljK 70464 71285 CDS product flagellin FljK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18913 protein_id gnl|my_center|LOCUS_17120 71699 72520 gene locus_tag LOCUS_17130 gene fljN 71699 72520 CDS product flagellin FljN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52530 protein_id gnl|my_center|LOCUS_17130 72639 72980 gene locus_tag LOCUS_17140 72639 72980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 73133 73966 gene locus_tag LOCUS_17150 gene fljJ 73133 73966 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 protein_id gnl|my_center|LOCUS_17150 74155 74562 gene locus_tag LOCUS_17160 74155 74562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918012.1 protein_id gnl|my_center|LOCUS_17160 75618 74602 gene locus_tag LOCUS_17170 75618 74602 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102005.1 protein_id gnl|my_center|LOCUS_17170 75903 76187 gene locus_tag LOCUS_17180 75903 76187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 77095 76265 gene locus_tag LOCUS_17190 77095 76265 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 protein_id gnl|my_center|LOCUS_17190 78087 77095 gene locus_tag LOCUS_17200 78087 77095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 <80164 78221 gene locus_tag LOCUS_17210 <80164 78221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918794.1:flagellar biosynthesis protein FlhA >Feature sequence14 2 685 gene locus_tag LOCUS_17220 2 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1038 751 gene locus_tag LOCUS_17230 1038 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1180 1461 gene locus_tag LOCUS_17240 1180 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1525 2091 gene locus_tag LOCUS_17250 1525 2091 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_17250 2554 2105 gene locus_tag LOCUS_17260 2554 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2725 3429 gene locus_tag LOCUS_17270 2725 3429 CDS product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58113 protein_id gnl|my_center|LOCUS_17270 3835 3551 gene locus_tag LOCUS_17280 3835 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5636 4344 gene locus_tag LOCUS_17290 gene purA 5636 4344 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3U9 protein_id gnl|my_center|LOCUS_17290 5979 5803 gene locus_tag LOCUS_17300 5979 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 8143 6020 gene locus_tag LOCUS_17310 8143 6020 CDS product thio:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918106.1 protein_id gnl|my_center|LOCUS_17310 9450 8317 gene locus_tag LOCUS_17320 9450 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 9561 11459 gene locus_tag LOCUS_17330 9561 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 11583 13304 gene locus_tag LOCUS_17340 11583 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708361.1 protein_id gnl|my_center|LOCUS_17340 13721 13329 gene locus_tag LOCUS_17350 13721 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 14235 13888 gene locus_tag LOCUS_17360 14235 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 14523 14885 gene locus_tag LOCUS_17370 14523 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 14915 15526 gene locus_tag LOCUS_17380 14915 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 16062 15532 gene locus_tag LOCUS_17390 16062 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 16126 16788 gene locus_tag LOCUS_17400 16126 16788 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975554.1 protein_id gnl|my_center|LOCUS_17400 18557 16776 gene locus_tag LOCUS_17410 18557 16776 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918194.1 protein_id gnl|my_center|LOCUS_17410 19814 18630 gene locus_tag LOCUS_17420 19814 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 21141 19801 gene locus_tag LOCUS_17430 21141 19801 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918198.1 protein_id gnl|my_center|LOCUS_17430 21848 21264 gene locus_tag LOCUS_17440 21848 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 21966 23336 gene locus_tag LOCUS_17450 21966 23336 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_17450 25020 23365 gene locus_tag LOCUS_17460 25020 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 25458 25171 gene locus_tag LOCUS_17470 25458 25171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 26225 25563 gene locus_tag LOCUS_17480 gene ctpA 26225 25563 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_17480 26374 27138 gene locus_tag LOCUS_17490 26374 27138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_17490 27158 28438 gene locus_tag LOCUS_17500 27158 28438 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918191.1 protein_id gnl|my_center|LOCUS_17500 28431 29438 gene locus_tag LOCUS_17510 gene lpxK 28431 29438 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYH3 protein_id gnl|my_center|LOCUS_17510 29435 30436 gene locus_tag LOCUS_17520 29435 30436 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_17520 30543 32834 gene locus_tag LOCUS_17530 30543 32834 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_17530 32941 33633 gene locus_tag LOCUS_17540 32941 33633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 34077 33658 gene locus_tag LOCUS_17550 34077 33658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 35023 34049 gene locus_tag LOCUS_17560 35023 34049 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_17560 35272 35054 gene locus_tag LOCUS_17570 35272 35054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 37083 35377 gene locus_tag LOCUS_17580 gene xseA 37083 35377 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DD2 protein_id gnl|my_center|LOCUS_17580 37552 37124 gene locus_tag LOCUS_17590 37552 37124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 37755 38306 gene locus_tag LOCUS_17600 37755 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 39730 38303 gene locus_tag LOCUS_17610 gene murC 39730 38303 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9A4 protein_id gnl|my_center|LOCUS_17610 40881 39742 gene locus_tag LOCUS_17620 gene murG 40881 39742 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5A1 protein_id gnl|my_center|LOCUS_17620 42014 40878 gene locus_tag LOCUS_17630 42014 40878 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920409.1 protein_id gnl|my_center|LOCUS_17630 43476 42052 gene locus_tag LOCUS_17640 gene murD 43476 42052 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H096 protein_id gnl|my_center|LOCUS_17640 44686 43484 gene locus_tag LOCUS_17650 gene mraY 44686 43484 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDM5 protein_id gnl|my_center|LOCUS_17650 46126 44687 gene locus_tag LOCUS_17660 gene murF 46126 44687 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9K8 protein_id gnl|my_center|LOCUS_17660 47585 46119 gene locus_tag LOCUS_17670 gene murE 47585 46119 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU2 protein_id gnl|my_center|LOCUS_17670 49255 47582 gene locus_tag LOCUS_17680 gene ftsI 49255 47582 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719253.1 protein_id gnl|my_center|LOCUS_17680 49575 49252 gene locus_tag LOCUS_17690 49575 49252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 50588 49572 gene locus_tag LOCUS_17700 gene rsmH 50588 49572 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0A2 protein_id gnl|my_center|LOCUS_17700 51067 50585 gene locus_tag LOCUS_17710 gene mraZ 51067 50585 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A594 protein_id gnl|my_center|LOCUS_17710 52869 52030 gene locus_tag LOCUS_17720 52869 52030 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089351.1 protein_id gnl|my_center|LOCUS_17720 53612 52893 gene locus_tag LOCUS_17730 53612 52893 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_17730 53970 53641 gene locus_tag LOCUS_17740 53970 53641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 54750 54025 gene locus_tag LOCUS_17750 54750 54025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 55751 54855 gene locus_tag LOCUS_17760 55751 54855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 56051 55776 gene locus_tag LOCUS_17770 56051 55776 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258305.1 protein_id gnl|my_center|LOCUS_17770 56696 56163 gene locus_tag LOCUS_17780 56696 56163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 58034 56724 gene locus_tag LOCUS_17790 58034 56724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 60717 58054 gene locus_tag LOCUS_17800 60717 58054 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919998.1 protein_id gnl|my_center|LOCUS_17800 60955 60722 gene locus_tag LOCUS_17810 60955 60722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 61385 60948 gene locus_tag LOCUS_17820 61385 60948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 62452 61388 gene locus_tag LOCUS_17830 62452 61388 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919999.1 protein_id gnl|my_center|LOCUS_17830 62903 62457 gene locus_tag LOCUS_17840 62903 62457 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 protein_id gnl|my_center|LOCUS_17840 63766 62900 gene locus_tag LOCUS_17850 63766 62900 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU65 protein_id gnl|my_center|LOCUS_17850 64770 63763 gene locus_tag LOCUS_17860 64770 63763 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920002.1 protein_id gnl|my_center|LOCUS_17860 65128 64928 gene locus_tag LOCUS_17870 65128 64928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 65262 65978 gene locus_tag LOCUS_17880 65262 65978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE54 protein_id gnl|my_center|LOCUS_17880 66021 66686 gene locus_tag LOCUS_17890 66021 66686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 66841 68628 gene locus_tag LOCUS_17900 66841 68628 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_17900 69237 68635 gene locus_tag LOCUS_17910 69237 68635 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931185.1 protein_id gnl|my_center|LOCUS_17910 70164 69382 gene locus_tag LOCUS_17920 70164 69382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 72045 70378 gene locus_tag LOCUS_17930 72045 70378 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920009.1 protein_id gnl|my_center|LOCUS_17930 72249 73574 gene locus_tag LOCUS_17940 72249 73574 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_17940 74245 73571 gene locus_tag LOCUS_17950 gene bioD 74245 73571 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z2 protein_id gnl|my_center|LOCUS_17950 75381 74251 gene locus_tag LOCUS_17960 gene bioF 75381 74251 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE2 protein_id gnl|my_center|LOCUS_17960 75498 76781 gene locus_tag LOCUS_17970 gene bioA 75498 76781 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930773.1 protein_id gnl|my_center|LOCUS_17970 77311 76760 gene locus_tag LOCUS_17980 77311 76760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 78456 77572 gene locus_tag LOCUS_17990 78456 77572 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923328.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence15 440 1354 gene locus_tag LOCUS_18000 440 1354 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067076.1 protein_id gnl|my_center|LOCUS_18000 1898 1401 gene locus_tag LOCUS_18010 1898 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2711 2028 gene locus_tag LOCUS_18020 2711 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3490 2819 gene locus_tag LOCUS_18030 3490 2819 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_18030 5133 4402 gene locus_tag LOCUS_18040 5133 4402 CDS product RNA pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918740.1 protein_id gnl|my_center|LOCUS_18040 5417 6199 gene locus_tag LOCUS_18050 5417 6199 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A321 protein_id gnl|my_center|LOCUS_18050 6212 7045 gene locus_tag LOCUS_18060 6212 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_18060 7042 7446 gene locus_tag LOCUS_18070 7042 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528796.1 protein_id gnl|my_center|LOCUS_18070 8715 7450 gene locus_tag LOCUS_18080 8715 7450 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_18080 10190 8712 gene locus_tag LOCUS_18090 10190 8712 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 protein_id gnl|my_center|LOCUS_18090 11252 10308 gene locus_tag LOCUS_18100 11252 10308 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A316 protein_id gnl|my_center|LOCUS_18100 12496 11258 gene locus_tag LOCUS_18110 12496 11258 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921220.1 protein_id gnl|my_center|LOCUS_18110 13226 12582 gene locus_tag LOCUS_18120 13226 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 14098 13352 gene locus_tag LOCUS_18130 14098 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 14359 15417 gene locus_tag LOCUS_18140 14359 15417 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923333.1 protein_id gnl|my_center|LOCUS_18140 15414 15890 gene locus_tag LOCUS_18150 15414 15890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 15918 16157 gene locus_tag LOCUS_18160 15918 16157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 16267 18507 gene locus_tag LOCUS_18170 16267 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 18552 18704 gene locus_tag LOCUS_18180 18552 18704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 19604 18915 gene locus_tag LOCUS_18190 19604 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 19869 20234 gene locus_tag LOCUS_18200 19869 20234 CDS product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531477.1 protein_id gnl|my_center|LOCUS_18200 20353 21300 gene locus_tag LOCUS_18210 20353 21300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 22448 21309 gene locus_tag LOCUS_18220 22448 21309 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_18220 24265 22553 gene locus_tag LOCUS_18230 gene ilvD 24265 22553 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKA4 protein_id gnl|my_center|LOCUS_18230 24535 25593 gene locus_tag LOCUS_18240 24535 25593 CDS product zinc metallohydrolase glyoxalase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 protein_id gnl|my_center|LOCUS_18240 25670 25975 gene locus_tag LOCUS_18250 25670 25975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 25982 26296 gene locus_tag LOCUS_18260 25982 26296 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_18260 26293 27207 gene locus_tag LOCUS_18270 26293 27207 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ5 protein_id gnl|my_center|LOCUS_18270 27348 28478 gene locus_tag LOCUS_18280 27348 28478 CDS product polysaccharide biosynthesis protein CelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640455.1 protein_id gnl|my_center|LOCUS_18280 28595 29209 gene locus_tag LOCUS_18290 28595 29209 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919932.1 protein_id gnl|my_center|LOCUS_18290 29321 29539 gene locus_tag LOCUS_18300 gene xseB 29321 29539 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RW0 protein_id gnl|my_center|LOCUS_18300 29536 30453 gene locus_tag LOCUS_18310 29536 30453 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919930.1 protein_id gnl|my_center|LOCUS_18310 30492 32408 gene locus_tag LOCUS_18320 gene dxs 30492 32408 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M5 protein_id gnl|my_center|LOCUS_18320 32499 34265 gene locus_tag LOCUS_18330 32499 34265 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_18330 34219 34914 gene locus_tag LOCUS_18340 34219 34914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530328.1 protein_id gnl|my_center|LOCUS_18340 37193 34977 gene locus_tag LOCUS_18350 37193 34977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 38176 37337 gene locus_tag LOCUS_18360 38176 37337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 38941 38474 gene locus_tag LOCUS_18370 gene sodC 38941 38474 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20379 protein_id gnl|my_center|LOCUS_18370 38910 39059 gene locus_tag LOCUS_18380 38910 39059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 39164 39910 gene locus_tag LOCUS_18390 39164 39910 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919201.1 protein_id gnl|my_center|LOCUS_18390 40662 40039 gene locus_tag LOCUS_18400 40662 40039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 40864 41964 gene locus_tag LOCUS_18410 40864 41964 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919204.1 protein_id gnl|my_center|LOCUS_18410 42517 41984 gene locus_tag LOCUS_18420 42517 41984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 43692 42514 gene locus_tag LOCUS_18430 gene aroC 43692 42514 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3W7 protein_id gnl|my_center|LOCUS_18430 44118 43753 gene locus_tag LOCUS_18440 44118 43753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 44888 44229 gene locus_tag LOCUS_18450 44888 44229 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_18450 45002 45688 gene locus_tag LOCUS_18460 gene pdxH 45002 45688 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H292 protein_id gnl|my_center|LOCUS_18460 46622 45801 gene locus_tag LOCUS_18470 46622 45801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 47093 46857 gene locus_tag LOCUS_18480 47093 46857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 48302 47190 gene locus_tag LOCUS_18490 gene ald 48302 47190 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_18490 50050 48449 gene locus_tag LOCUS_18500 50050 48449 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531870.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18500 49946 50194 gene locus_tag LOCUS_18510 49946 50194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 51054 50410 gene locus_tag LOCUS_18520 51054 50410 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_18520 52023 51373 gene locus_tag LOCUS_18530 52023 51373 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707822.1 protein_id gnl|my_center|LOCUS_18530 52149 52751 gene locus_tag LOCUS_18540 52149 52751 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_18540 52784 53614 gene locus_tag LOCUS_18550 52784 53614 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920503.1 protein_id gnl|my_center|LOCUS_18550 53801 54004 gene locus_tag LOCUS_18560 53801 54004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 protein_id gnl|my_center|LOCUS_18560 55301 54018 gene locus_tag LOCUS_18570 55301 54018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 55952 55323 gene locus_tag LOCUS_18580 55952 55323 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971421.1 protein_id gnl|my_center|LOCUS_18580 58968 56056 gene locus_tag LOCUS_18590 58968 56056 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_18590 59150 59755 gene locus_tag LOCUS_18600 59150 59755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 60509 59733 gene locus_tag LOCUS_18610 60509 59733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 60737 61765 gene locus_tag LOCUS_18620 60737 61765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 61917 62597 gene locus_tag LOCUS_18630 61917 62597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 63473 62658 gene locus_tag LOCUS_18640 63473 62658 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920496.1 protein_id gnl|my_center|LOCUS_18640 63819 64349 gene locus_tag LOCUS_18650 63819 64349 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_18650 64400 64894 gene locus_tag LOCUS_18660 64400 64894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 64957 65229 gene locus_tag LOCUS_18670 64957 65229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337654.1 protein_id gnl|my_center|LOCUS_18670 65825 65226 gene locus_tag LOCUS_18680 65825 65226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 66322 65843 gene locus_tag LOCUS_18690 66322 65843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 66569 68236 gene locus_tag LOCUS_18700 66569 68236 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_18700 68800 68258 gene locus_tag LOCUS_18710 68800 68258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 68984 69925 gene locus_tag LOCUS_18720 68984 69925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 70059 70571 gene locus_tag LOCUS_18730 70059 70571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 70564 72081 gene locus_tag LOCUS_18740 70564 72081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 73441 72188 gene locus_tag LOCUS_18750 73441 72188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 74518 73511 gene locus_tag LOCUS_18760 gene hfaB 74518 73511 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920482.1 protein_id gnl|my_center|LOCUS_18760 74945 74511 gene locus_tag LOCUS_18770 gene hfaA 74945 74511 CDS product holdfast attachment protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920481.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence16 1174 242 gene locus_tag LOCUS_18780 1174 242 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 protein_id gnl|my_center|LOCUS_18780 2124 1171 gene locus_tag LOCUS_18790 2124 1171 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528657.1 protein_id gnl|my_center|LOCUS_18790 2908 2327 gene locus_tag LOCUS_18800 2908 2327 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920198.1 protein_id gnl|my_center|LOCUS_18800 2993 4042 gene locus_tag LOCUS_18810 2993 4042 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973327.1 protein_id gnl|my_center|LOCUS_18810 4048 7107 gene locus_tag LOCUS_18820 gene acrB5 4048 7107 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_18820 7625 7104 gene locus_tag LOCUS_18830 gene ogt 7625 7104 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN39 protein_id gnl|my_center|LOCUS_18830 7784 9235 gene locus_tag LOCUS_18840 7784 9235 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_18840 9363 10739 gene locus_tag LOCUS_18850 9363 10739 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970545.1 protein_id gnl|my_center|LOCUS_18850 10793 11617 gene locus_tag LOCUS_18860 10793 11617 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 protein_id gnl|my_center|LOCUS_18860 11804 12562 gene locus_tag LOCUS_18870 11804 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 12737 14272 gene locus_tag LOCUS_18880 12737 14272 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919841.1 protein_id gnl|my_center|LOCUS_18880 14316 14903 gene locus_tag LOCUS_18890 14316 14903 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 protein_id gnl|my_center|LOCUS_18890 15178 14909 gene locus_tag LOCUS_18900 15178 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 15684 15256 gene locus_tag LOCUS_18910 15684 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 16220 18223 gene locus_tag LOCUS_18920 16220 18223 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920040.1 protein_id gnl|my_center|LOCUS_18920 18962 18282 gene locus_tag LOCUS_18930 gene lipB 18962 18282 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6B8 protein_id gnl|my_center|LOCUS_18930 19058 19312 gene locus_tag LOCUS_18940 19058 19312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920036.1 protein_id gnl|my_center|LOCUS_18940 19416 19500 gene locus_tag LOCUS_t00190 19416 19500 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19568 20962 gene locus_tag LOCUS_18950 19568 20962 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA6 protein_id gnl|my_center|LOCUS_18950 21079 22482 gene locus_tag LOCUS_18960 gene rsaFb 21079 22482 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_18960 22580 23203 gene locus_tag LOCUS_18970 gene popZ 22580 23203 CDS product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 protein_id gnl|my_center|LOCUS_18970 23712 23236 gene locus_tag LOCUS_18980 23712 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 23917 26844 gene locus_tag LOCUS_18990 gene valS 23917 26844 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8N3 protein_id gnl|my_center|LOCUS_18990 26862 27911 gene locus_tag LOCUS_19000 gene asg 26862 27911 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405465.1 protein_id gnl|my_center|LOCUS_19000 27951 28943 gene locus_tag LOCUS_19010 27951 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_19010 29085 29477 gene locus_tag LOCUS_19020 29085 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 29909 29478 gene locus_tag LOCUS_19030 29909 29478 CDS product zinc-finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537578.1 protein_id gnl|my_center|LOCUS_19030 30685 29906 gene locus_tag LOCUS_19040 30685 29906 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919877.1 protein_id gnl|my_center|LOCUS_19040 33390 30748 gene locus_tag LOCUS_19050 33390 30748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 33855 34745 gene locus_tag LOCUS_19060 33855 34745 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918057.1 protein_id gnl|my_center|LOCUS_19060 34778 35728 gene locus_tag LOCUS_19070 34778 35728 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268653.1 protein_id gnl|my_center|LOCUS_19070 36916 35729 gene locus_tag LOCUS_19080 36916 35729 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919300.1 protein_id gnl|my_center|LOCUS_19080 37804 36929 gene locus_tag LOCUS_19090 37804 36929 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_19090 38812 37808 gene locus_tag LOCUS_19100 38812 37808 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919302.1 protein_id gnl|my_center|LOCUS_19100 38860 39768 gene locus_tag LOCUS_19110 38860 39768 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975520.1 protein_id gnl|my_center|LOCUS_19110 40149 39781 gene locus_tag LOCUS_19120 40149 39781 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338003.1 protein_id gnl|my_center|LOCUS_19120 40344 40168 gene locus_tag LOCUS_19130 40344 40168 CDS product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_19130 41713 40376 gene locus_tag LOCUS_19140 41713 40376 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531119.1 protein_id gnl|my_center|LOCUS_19140 42064 43218 gene locus_tag LOCUS_19150 42064 43218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088375.1 protein_id gnl|my_center|LOCUS_19150 43285 44190 gene locus_tag LOCUS_19160 43285 44190 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921475.1 protein_id gnl|my_center|LOCUS_19160 44647 44315 gene locus_tag LOCUS_19170 44647 44315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 44967 46835 gene locus_tag LOCUS_19180 44967 46835 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921294.1 protein_id gnl|my_center|LOCUS_19180 46935 47150 gene locus_tag LOCUS_19190 46935 47150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097345.1 protein_id gnl|my_center|LOCUS_19190 53956 47240 gene locus_tag LOCUS_19200 53956 47240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 54480 60203 gene locus_tag LOCUS_19210 54480 60203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 60436 61152 gene locus_tag LOCUS_19220 60436 61152 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531782.1 protein_id gnl|my_center|LOCUS_19220 61389 61162 gene locus_tag LOCUS_19230 61389 61162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 62861 61386 gene locus_tag LOCUS_19240 62861 61386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 62984 64012 gene locus_tag LOCUS_19250 62984 64012 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J428 protein_id gnl|my_center|LOCUS_19250 64146 66497 gene locus_tag LOCUS_19260 64146 66497 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918626.1 protein_id gnl|my_center|LOCUS_19260 67271 66498 gene locus_tag LOCUS_19270 67271 66498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 68917 67283 gene locus_tag LOCUS_19280 68917 67283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 69516 71489 gene locus_tag LOCUS_19290 69516 71489 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975430.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence17 597 1502 gene locus_tag LOCUS_19300 597 1502 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 protein_id gnl|my_center|LOCUS_19300 1610 2599 gene locus_tag LOCUS_19310 1610 2599 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_19310 2930 4534 gene locus_tag LOCUS_19320 2930 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4513 5790 gene locus_tag LOCUS_19330 4513 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 6847 5783 gene locus_tag LOCUS_19340 6847 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 6983 7954 gene locus_tag LOCUS_19350 6983 7954 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142189.1 protein_id gnl|my_center|LOCUS_19350 7951 8721 gene locus_tag LOCUS_19360 gene gcd1 7951 8721 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_19360 8726 9766 gene locus_tag LOCUS_19370 8726 9766 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435695.1 protein_id gnl|my_center|LOCUS_19370 9780 11027 gene locus_tag LOCUS_19380 9780 11027 CDS product NDP-hexose 3-C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_19380 12079 11042 gene locus_tag LOCUS_19390 12079 11042 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975518.1 protein_id gnl|my_center|LOCUS_19390 13416 12205 gene locus_tag LOCUS_19400 13416 12205 CDS product NDP-hexose methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975523.1 protein_id gnl|my_center|LOCUS_19400 14382 15242 gene locus_tag LOCUS_19410 14382 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 16475 15465 gene locus_tag LOCUS_19420 16475 15465 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 protein_id gnl|my_center|LOCUS_19420 16652 17647 gene locus_tag LOCUS_19430 16652 17647 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976376.1 protein_id gnl|my_center|LOCUS_19430 18538 17648 gene locus_tag LOCUS_19440 18538 17648 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_19440 19155 18541 gene locus_tag LOCUS_19450 19155 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 19347 20222 gene locus_tag LOCUS_19460 gene panC 19347 20222 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6C8 protein_id gnl|my_center|LOCUS_19460 20664 20227 gene locus_tag LOCUS_19470 20664 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389917.1 protein_id gnl|my_center|LOCUS_19470 21447 20686 gene locus_tag LOCUS_19480 21447 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 22385 21447 gene locus_tag LOCUS_19490 22385 21447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920137.1 protein_id gnl|my_center|LOCUS_19490 23269 22475 gene locus_tag LOCUS_19500 23269 22475 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920030.1 protein_id gnl|my_center|LOCUS_19500 23394 23828 gene locus_tag LOCUS_19510 23394 23828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 23923 25692 gene locus_tag LOCUS_19520 23923 25692 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920032.1 protein_id gnl|my_center|LOCUS_19520 26217 25729 gene locus_tag LOCUS_19530 gene actI 26217 25729 CDS product 4-hydroxyphenylacetate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972383.1 protein_id gnl|my_center|LOCUS_19530 26355 26783 gene locus_tag LOCUS_19540 26355 26783 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 protein_id gnl|my_center|LOCUS_19540 26794 27519 gene locus_tag LOCUS_19550 26794 27519 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_19550 28665 27520 gene locus_tag LOCUS_19560 28665 27520 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_19560 29051 28839 gene locus_tag LOCUS_19570 29051 28839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 29163 30551 gene locus_tag LOCUS_19580 gene hcaE 29163 30551 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808134.1 protein_id gnl|my_center|LOCUS_19580 30506 31153 gene locus_tag LOCUS_19590 30506 31153 CDS product hypothetical biphenyl dioxygenase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705092.1 protein_id gnl|my_center|LOCUS_19590 31159 32325 gene locus_tag LOCUS_19600 31159 32325 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_19600 32322 33137 gene locus_tag LOCUS_19610 32322 33137 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225669.1 protein_id gnl|my_center|LOCUS_19610 33134 33757 gene locus_tag LOCUS_19620 33134 33757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 33777 35006 gene locus_tag LOCUS_19630 33777 35006 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_19630 35806 35000 gene locus_tag LOCUS_19640 35806 35000 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_19640 36397 35828 gene locus_tag LOCUS_19650 36397 35828 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63LX2 protein_id gnl|my_center|LOCUS_19650 37617 36397 gene locus_tag LOCUS_19660 37617 36397 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_19660 37881 39167 gene locus_tag LOCUS_19670 gene cypX 37881 39167 CDS product pulcherriminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34926 protein_id gnl|my_center|LOCUS_19670 39216 39866 gene locus_tag LOCUS_19680 39216 39866 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_19680 39870 40625 gene locus_tag LOCUS_19690 39870 40625 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_19690 40622 41551 gene locus_tag LOCUS_19700 40622 41551 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_19700 42746 41589 gene locus_tag LOCUS_19710 42746 41589 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 protein_id gnl|my_center|LOCUS_19710 44902 42752 gene locus_tag LOCUS_19720 44902 42752 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_19720 46124 44919 gene locus_tag LOCUS_19730 46124 44919 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_19730 47096 46230 gene locus_tag LOCUS_19740 47096 46230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 47682 50087 gene locus_tag LOCUS_19750 47682 50087 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_19750 50405 51346 gene locus_tag LOCUS_19760 gene aes 50405 51346 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_19760 51346 52209 gene locus_tag LOCUS_19770 51346 52209 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808214.1 protein_id gnl|my_center|LOCUS_19770 52684 52262 gene locus_tag LOCUS_19780 52684 52262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 53114 52755 gene locus_tag LOCUS_19790 53114 52755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 54524 53214 gene locus_tag LOCUS_19800 gene vanK 54524 53214 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206166.1 protein_id gnl|my_center|LOCUS_19800 55996 54587 gene locus_tag LOCUS_19810 55996 54587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 57179 56049 gene locus_tag LOCUS_19820 57179 56049 CDS product putative phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705205.1 protein_id gnl|my_center|LOCUS_19820 58258 57182 gene locus_tag LOCUS_19830 58258 57182 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728253.1 protein_id gnl|my_center|LOCUS_19830 58367 58861 gene locus_tag LOCUS_19840 58367 58861 CDS product bile-acid 7-alpha-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 protein_id gnl|my_center|LOCUS_19840 60081 58867 gene locus_tag LOCUS_19850 gene cyp127A1 60081 58867 CDS product putative cytochrome P450 127A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53215 protein_id gnl|my_center|LOCUS_19850 61491 60094 gene locus_tag LOCUS_19860 61491 60094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 61430 62305 gene locus_tag LOCUS_19870 61430 62305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 62330 63364 gene locus_tag LOCUS_19880 62330 63364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 <64482 63428 gene locus_tag LOCUS_19890 <64482 63428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140397.1:beta-carotene ketolase >Feature sequence18 924 526 gene locus_tag LOCUS_19900 924 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1036 2586 gene locus_tag LOCUS_19910 1036 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2604 3008 gene locus_tag LOCUS_19920 2604 3008 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_19920 3187 4674 gene locus_tag LOCUS_19930 gene hisS 3187 4674 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2P3 protein_id gnl|my_center|LOCUS_19930 4671 5792 gene locus_tag LOCUS_19940 4671 5792 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921341.1 protein_id gnl|my_center|LOCUS_19940 5789 6736 gene locus_tag LOCUS_19950 gene hisG 5789 6736 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2P5 protein_id gnl|my_center|LOCUS_19950 7054 7296 gene locus_tag LOCUS_19960 7054 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920516.1 protein_id gnl|my_center|LOCUS_19960 7799 7317 gene locus_tag LOCUS_19970 7799 7317 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_19970 8487 8005 gene locus_tag LOCUS_19980 8487 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 8836 10209 gene locus_tag LOCUS_19990 8836 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 12036 10387 gene locus_tag LOCUS_20000 gene groL4 12036 10387 CDS product 60 kDa chaperonin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ZQ4 protein_id gnl|my_center|LOCUS_20000 12381 12094 gene locus_tag LOCUS_20010 gene groS5 12381 12094 CDS product 10 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35474 protein_id gnl|my_center|LOCUS_20010 12918 12547 gene locus_tag LOCUS_20020 12918 12547 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086810.1 protein_id gnl|my_center|LOCUS_20020 14670 13006 gene locus_tag LOCUS_20030 14670 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870224.1 protein_id gnl|my_center|LOCUS_20030 14782 15654 gene locus_tag LOCUS_20040 14782 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 15861 16901 gene locus_tag LOCUS_20050 15861 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 17320 18615 gene locus_tag LOCUS_20060 gene tipF 17320 18615 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 protein_id gnl|my_center|LOCUS_20060 18608 19483 gene locus_tag LOCUS_20070 18608 19483 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918591.1 protein_id gnl|my_center|LOCUS_20070 20383 19706 gene locus_tag LOCUS_20080 20383 19706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 20815 20429 gene locus_tag LOCUS_20090 20815 20429 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_20090 20957 21382 gene locus_tag LOCUS_20100 20957 21382 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_20100 21450 22370 gene locus_tag LOCUS_20110 21450 22370 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_20110 22561 23199 gene locus_tag LOCUS_20120 22561 23199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20120 23159 25555 gene locus_tag LOCUS_20130 gene ileS 23159 25555 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAA5 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20130 25940 26548 gene locus_tag LOCUS_20140 gene lspA 25940 26548 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAA6 protein_id gnl|my_center|LOCUS_20140 26621 27112 gene locus_tag LOCUS_20150 gene bamF 26621 27112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640037.1 protein_id gnl|my_center|LOCUS_20150 27142 27549 gene locus_tag LOCUS_20160 27142 27549 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532088.1 protein_id gnl|my_center|LOCUS_20160 27601 29529 gene locus_tag LOCUS_20170 gene mutL 27601 29529 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H173 protein_id gnl|my_center|LOCUS_20170 30928 29636 gene locus_tag LOCUS_20180 30928 29636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 32585 31302 gene locus_tag LOCUS_20190 32585 31302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_20190 33188 32706 gene locus_tag LOCUS_20200 33188 32706 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337239.1 protein_id gnl|my_center|LOCUS_20200 34129 33308 gene locus_tag LOCUS_20210 34129 33308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 34948 34148 gene locus_tag LOCUS_20220 34948 34148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 36339 35116 gene locus_tag LOCUS_20230 36339 35116 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9I5 protein_id gnl|my_center|LOCUS_20230 36625 37623 gene locus_tag LOCUS_20240 36625 37623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 37684 37893 gene locus_tag LOCUS_20250 37684 37893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 37952 38704 gene locus_tag LOCUS_20260 37952 38704 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640515.1 protein_id gnl|my_center|LOCUS_20260 39344 38658 gene locus_tag LOCUS_20270 39344 38658 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974565.1 protein_id gnl|my_center|LOCUS_20270 39580 39401 gene locus_tag LOCUS_20280 39580 39401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 39920 40537 gene locus_tag LOCUS_20290 gene rpsD 39920 40537 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H053 protein_id gnl|my_center|LOCUS_20290 40822 41031 gene locus_tag LOCUS_20300 gene cspA 40822 41031 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719178.1 protein_id gnl|my_center|LOCUS_20300 43138 41141 gene locus_tag LOCUS_20310 43138 41141 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 protein_id gnl|my_center|LOCUS_20310 43622 43284 gene locus_tag LOCUS_20320 43622 43284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 44175 44681 gene locus_tag LOCUS_20330 44175 44681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 46715 44703 gene locus_tag LOCUS_20340 46715 44703 CDS product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 protein_id gnl|my_center|LOCUS_20340 46918 47748 gene locus_tag LOCUS_20350 46918 47748 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_20350 49623 47749 gene locus_tag LOCUS_20360 49623 47749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 49805 50788 gene locus_tag LOCUS_20370 49805 50788 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_20370 51552 53342 gene locus_tag LOCUS_20380 51552 53342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 54708 53350 gene locus_tag LOCUS_20390 gene rimO 54708 53350 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8T1 protein_id gnl|my_center|LOCUS_20390 55096 54752 gene locus_tag LOCUS_20400 55096 54752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 55575 55240 gene locus_tag LOCUS_20410 gene grlA 55575 55240 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CYD6 protein_id gnl|my_center|LOCUS_20410 56175 55645 gene locus_tag LOCUS_20420 56175 55645 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886775.1 protein_id gnl|my_center|LOCUS_20420 57058 56147 gene locus_tag LOCUS_20430 57058 56147 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224955.1 protein_id gnl|my_center|LOCUS_20430 57297 57055 gene locus_tag LOCUS_20440 57297 57055 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337874.1 protein_id gnl|my_center|LOCUS_20440 58215 57448 gene locus_tag LOCUS_20450 58215 57448 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384112.1 protein_id gnl|my_center|LOCUS_20450 60071 58488 gene locus_tag LOCUS_20460 60071 58488 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920757.1 protein_id gnl|my_center|LOCUS_20460 60829 60215 gene locus_tag LOCUS_20470 60829 60215 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_20470 62482 61037 gene locus_tag LOCUS_20480 62482 61037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 <64261 62527 gene locus_tag LOCUS_20490 <64261 62527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920378.1:hybrid sensor histidine kinase/response regulator >Feature sequence19 481 2673 gene locus_tag LOCUS_20500 481 2673 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 protein_id gnl|my_center|LOCUS_20500 2689 3387 gene locus_tag LOCUS_20510 2689 3387 CDS product type I-C CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384678.1 protein_id gnl|my_center|LOCUS_20510 3384 5132 gene locus_tag LOCUS_20520 3384 5132 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_20520 5129 6082 gene locus_tag LOCUS_20530 gene csd2 5129 6082 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384680.1 protein_id gnl|my_center|LOCUS_20530 6088 6765 gene locus_tag LOCUS_20540 6088 6765 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388587.1 protein_id gnl|my_center|LOCUS_20540 6762 7802 gene locus_tag LOCUS_20550 gene cas1-2 6762 7802 CDS product CRISPR-associated endonuclease Cas1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RW61 protein_id gnl|my_center|LOCUS_20550 7807 8097 gene locus_tag LOCUS_20560 gene cas 7807 8097 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8P1 protein_id gnl|my_center|LOCUS_20560 8330 9283 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcctcctgcacggaggcgtggatagaaac 9731 10177 gene locus_tag LOCUS_20570 9731 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 10406 11641 gene locus_tag LOCUS_20580 10406 11641 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_20580 11720 13060 gene locus_tag LOCUS_20590 gene hcaE 11720 13060 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83K39 protein_id gnl|my_center|LOCUS_20590 13096 13662 gene locus_tag LOCUS_20600 13096 13662 CDS product hypothetical biphenyl dioxygenase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705092.1 protein_id gnl|my_center|LOCUS_20600 13695 14915 gene locus_tag LOCUS_20610 13695 14915 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_20610 15044 16333 gene locus_tag LOCUS_20620 gene cypX 15044 16333 CDS product pulcherriminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34926 protein_id gnl|my_center|LOCUS_20620 17372 17172 gene locus_tag LOCUS_20630 17372 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 17280 17771 gene locus_tag LOCUS_20640 17280 17771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20640 17935 18408 gene locus_tag LOCUS_20650 17935 18408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 20092 18485 gene locus_tag LOCUS_20660 20092 18485 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105841.1 protein_id gnl|my_center|LOCUS_20660 20438 22903 gene locus_tag LOCUS_20670 20438 22903 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_20670 23020 24996 gene locus_tag LOCUS_20680 23020 24996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_20680 25017 25496 gene locus_tag LOCUS_20690 25017 25496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 26568 25525 gene locus_tag LOCUS_20700 26568 25525 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920098.1 protein_id gnl|my_center|LOCUS_20700 26639 27844 gene locus_tag LOCUS_20710 gene metZ 26639 27844 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S95 protein_id gnl|my_center|LOCUS_20710 27869 28291 gene locus_tag LOCUS_20720 gene apaG 27869 28291 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS0 protein_id gnl|my_center|LOCUS_20720 28394 29866 gene locus_tag LOCUS_20730 28394 29866 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW6 protein_id gnl|my_center|LOCUS_20730 30664 29942 gene locus_tag LOCUS_20740 30664 29942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 32867 30999 gene locus_tag LOCUS_20750 32867 30999 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2R4 protein_id gnl|my_center|LOCUS_20750 33806 33306 gene locus_tag LOCUS_20760 33806 33306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_20760 33978 34484 gene locus_tag LOCUS_20770 33978 34484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 34565 35527 gene locus_tag LOCUS_20780 34565 35527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 35738 35574 gene locus_tag LOCUS_20790 35738 35574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 35985 39308 gene locus_tag LOCUS_20800 35985 39308 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918983.1 protein_id gnl|my_center|LOCUS_20800 39438 41447 gene locus_tag LOCUS_20810 39438 41447 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921550.1 protein_id gnl|my_center|LOCUS_20810 42177 41521 gene locus_tag LOCUS_20820 gene msrA 42177 41521 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_20820 42321 42410 gene locus_tag LOCUS_t00200 42321 42410 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 42856 42704 gene locus_tag LOCUS_20830 42856 42704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 45081 42853 gene locus_tag LOCUS_20840 gene fixI 45081 42853 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919283.1 protein_id gnl|my_center|LOCUS_20840 45578 45078 gene locus_tag LOCUS_20850 45578 45078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 47035 45578 gene locus_tag LOCUS_20860 gene fixG 47035 45578 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_20860 47929 47045 gene locus_tag LOCUS_20870 47929 47045 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8F0 protein_id gnl|my_center|LOCUS_20870 48083 47922 gene locus_tag LOCUS_20880 48083 47922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 48869 48099 gene locus_tag LOCUS_20890 48869 48099 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970734.1 protein_id gnl|my_center|LOCUS_20890 50555 48882 gene locus_tag LOCUS_20900 50555 48882 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919277.1 protein_id gnl|my_center|LOCUS_20900 50963 52105 gene locus_tag LOCUS_20910 50963 52105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 52102 52728 gene locus_tag LOCUS_20920 gene fixJ 52102 52728 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970952.1 protein_id gnl|my_center|LOCUS_20920 52847 53227 gene locus_tag LOCUS_20930 52847 53227 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085543.1 protein_id gnl|my_center|LOCUS_20930 53224 53382 gene locus_tag LOCUS_20940 53224 53382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 54776 53469 gene locus_tag LOCUS_20950 gene rsaFb 54776 53469 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_20950 58063 54779 gene locus_tag LOCUS_20960 58063 54779 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933702.1 protein_id gnl|my_center|LOCUS_20960 59172 58063 gene locus_tag LOCUS_20970 59172 58063 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_20970 59728 59177 gene locus_tag LOCUS_20980 59728 59177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 60059 60331 gene locus_tag LOCUS_20990 60059 60331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 60722 60573 gene locus_tag LOCUS_21000 60722 60573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence20 791 129 gene locus_tag LOCUS_21010 791 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2661 826 gene locus_tag LOCUS_21020 gene glmS 2661 826 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3H1 protein_id gnl|my_center|LOCUS_21020 3266 4708 gene locus_tag LOCUS_21030 3266 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 5723 4758 gene locus_tag LOCUS_21040 5723 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_21040 6155 5808 gene locus_tag LOCUS_21050 6155 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084105.1 protein_id gnl|my_center|LOCUS_21050 7050 6187 gene locus_tag LOCUS_21060 gene kdsA 7050 6187 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5A9 protein_id gnl|my_center|LOCUS_21060 7447 7157 gene locus_tag LOCUS_21070 7447 7157 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970381.1 protein_id gnl|my_center|LOCUS_21070 7498 7737 gene locus_tag LOCUS_21080 7498 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 7897 8706 gene locus_tag LOCUS_21090 7897 8706 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787574.1 protein_id gnl|my_center|LOCUS_21090 8710 9336 gene locus_tag LOCUS_21100 8710 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 10043 9333 gene locus_tag LOCUS_21110 10043 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 10193 10396 gene locus_tag LOCUS_21120 10193 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 11021 11974 gene locus_tag LOCUS_21130 11021 11974 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 protein_id gnl|my_center|LOCUS_21130 12019 13038 gene locus_tag LOCUS_21140 12019 13038 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103810.1 protein_id gnl|my_center|LOCUS_21140 13461 14267 gene locus_tag LOCUS_21150 13461 14267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 14500 14279 gene locus_tag LOCUS_21160 14500 14279 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_21160 14937 14500 gene locus_tag LOCUS_21170 14937 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 17749 15176 gene locus_tag LOCUS_21180 17749 15176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 18135 17746 gene locus_tag LOCUS_21190 18135 17746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 18357 19448 gene locus_tag LOCUS_21200 18357 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 19600 20226 gene locus_tag LOCUS_21210 gene rplY 19600 20226 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV8 protein_id gnl|my_center|LOCUS_21210 20349 20975 gene locus_tag LOCUS_21220 gene pth 20349 20975 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV9 protein_id gnl|my_center|LOCUS_21220 20953 21732 gene locus_tag LOCUS_21230 20953 21732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 21767 22138 gene locus_tag LOCUS_21240 21767 22138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 22611 22252 gene locus_tag LOCUS_21250 gene exsF 22611 22252 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038770.1 protein_id gnl|my_center|LOCUS_21250 22614 22823 gene locus_tag LOCUS_21260 22614 22823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 23541 22768 gene locus_tag LOCUS_21270 gene etrA 23541 22768 CDS product electron transport regulator A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46148 protein_id gnl|my_center|LOCUS_21270 24027 24338 gene locus_tag LOCUS_21280 24027 24338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 24720 25823 gene locus_tag LOCUS_21290 gene ychF 24720 25823 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAW3 protein_id gnl|my_center|LOCUS_21290 25962 27521 gene locus_tag LOCUS_21300 gene glgA 25962 27521 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KR43 protein_id gnl|my_center|LOCUS_21300 27777 27535 gene locus_tag LOCUS_21310 27777 27535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104887.1 protein_id gnl|my_center|LOCUS_21310 27907 28302 gene locus_tag LOCUS_21320 gene hisI 27907 28302 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZS0 protein_id gnl|my_center|LOCUS_21320 28413 29552 gene locus_tag LOCUS_21330 28413 29552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 31349 29592 gene locus_tag LOCUS_21340 31349 29592 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 protein_id gnl|my_center|LOCUS_21340 32082 31711 gene locus_tag LOCUS_21350 32082 31711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 32128 32673 gene locus_tag LOCUS_21360 32128 32673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 32764 33855 gene locus_tag LOCUS_21370 32764 33855 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T0 protein_id gnl|my_center|LOCUS_21370 34195 35079 gene locus_tag LOCUS_21380 gene rpoH 34195 35079 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3C3 protein_id gnl|my_center|LOCUS_21380 35264 36022 gene locus_tag LOCUS_21390 gene csgA 35264 36022 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 protein_id gnl|my_center|LOCUS_21390 35973 36812 gene locus_tag LOCUS_21400 35973 36812 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529912.1 protein_id gnl|my_center|LOCUS_21400 36886 38268 gene locus_tag LOCUS_21410 36886 38268 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 protein_id gnl|my_center|LOCUS_21410 38471 39733 gene locus_tag LOCUS_21420 38471 39733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 40894 39803 gene locus_tag LOCUS_21430 40894 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 42874 40937 gene locus_tag LOCUS_21440 42874 40937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919568.1 protein_id gnl|my_center|LOCUS_21440 43999 42935 gene locus_tag LOCUS_21450 43999 42935 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140099.1 protein_id gnl|my_center|LOCUS_21450 45683 44211 gene locus_tag LOCUS_21460 45683 44211 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532574.1 protein_id gnl|my_center|LOCUS_21460 46171 45680 gene locus_tag LOCUS_21470 46171 45680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 47645 46257 gene locus_tag LOCUS_21480 gene otsA 47645 46257 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZA3 protein_id gnl|my_center|LOCUS_21480 49564 47774 gene locus_tag LOCUS_21490 49564 47774 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCQ9 protein_id gnl|my_center|LOCUS_21490 50020 49622 gene locus_tag LOCUS_21500 50020 49622 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067168.1 protein_id gnl|my_center|LOCUS_21500 50430 50032 gene locus_tag LOCUS_21510 gene sdhC 50430 50032 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921358.1 protein_id gnl|my_center|LOCUS_21510 50656 51363 gene locus_tag LOCUS_21520 50656 51363 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639954.1 protein_id gnl|my_center|LOCUS_21520 53976 51370 gene locus_tag LOCUS_21530 53976 51370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 54448 54197 gene locus_tag LOCUS_21540 54448 54197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 54724 54640 gene locus_tag LOCUS_t00210 54724 54640 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54935 55528 gene locus_tag LOCUS_21550 54935 55528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312762.1 protein_id gnl|my_center|LOCUS_21550 55668 56123 gene locus_tag LOCUS_21560 55668 56123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 56127 56669 gene locus_tag LOCUS_21570 gene coq7 56127 56669 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A697 protein_id gnl|my_center|LOCUS_21570 57163 56666 gene locus_tag LOCUS_21580 57163 56666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 57925 57362 gene locus_tag LOCUS_21590 57925 57362 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 protein_id gnl|my_center|LOCUS_21590 58222 58611 gene locus_tag LOCUS_21600 58222 58611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 58608 59486 gene locus_tag LOCUS_21610 58608 59486 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066636.1 protein_id gnl|my_center|LOCUS_21610 60102 59500 gene locus_tag LOCUS_21620 60102 59500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence21 2663 1224 gene locus_tag LOCUS_21630 2663 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3025 3327 gene locus_tag LOCUS_21640 3025 3327 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 protein_id gnl|my_center|LOCUS_21640 3366 3644 gene locus_tag LOCUS_21650 3366 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3641 4528 gene locus_tag LOCUS_21660 gene folD 3641 4528 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM48 protein_id gnl|my_center|LOCUS_21660 5124 5729 gene locus_tag LOCUS_21670 5124 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 5834 8245 gene locus_tag LOCUS_21680 5834 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 8245 8679 gene locus_tag LOCUS_21690 8245 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 8747 9568 gene locus_tag LOCUS_21700 8747 9568 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_21700 10893 9565 gene locus_tag LOCUS_21710 10893 9565 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 protein_id gnl|my_center|LOCUS_21710 11786 10899 gene locus_tag LOCUS_21720 gene accD 11786 10899 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L5 protein_id gnl|my_center|LOCUS_21720 12628 11804 gene locus_tag LOCUS_21730 gene trpA 12628 11804 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12291 protein_id gnl|my_center|LOCUS_21730 12955 12638 gene locus_tag LOCUS_21740 gene cutA 12955 12638 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7SIA8 protein_id gnl|my_center|LOCUS_21740 13364 13008 gene locus_tag LOCUS_21750 13364 13008 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972298.1 protein_id gnl|my_center|LOCUS_21750 13773 13381 gene locus_tag LOCUS_21760 13773 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 protein_id gnl|my_center|LOCUS_21760 14241 13804 gene locus_tag LOCUS_21770 14241 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 15576 14353 gene locus_tag LOCUS_21780 gene trpB 15576 14353 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ6 protein_id gnl|my_center|LOCUS_21780 16284 15670 gene locus_tag LOCUS_21790 gene trpF 16284 15670 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE6 protein_id gnl|my_center|LOCUS_21790 16926 16501 gene locus_tag LOCUS_21800 gene mscL 16926 16501 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ8 protein_id gnl|my_center|LOCUS_21800 17301 17050 gene locus_tag LOCUS_21810 gene ihfB 17301 17050 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCQ1 protein_id gnl|my_center|LOCUS_21810 19366 17669 gene locus_tag LOCUS_21820 19366 17669 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCW5 protein_id gnl|my_center|LOCUS_21820 20212 19595 gene locus_tag LOCUS_21830 gene cmk 20212 19595 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E0 protein_id gnl|my_center|LOCUS_21830 21549 20209 gene locus_tag LOCUS_21840 gene aroA 21549 20209 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WF2 protein_id gnl|my_center|LOCUS_21840 21674 22162 gene locus_tag LOCUS_21850 21674 22162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 22286 22361 gene locus_tag LOCUS_t00220 22286 22361 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22972 22415 gene locus_tag LOCUS_21860 22972 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 23585 23043 gene locus_tag LOCUS_21870 23585 23043 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_21870 24141 23563 gene locus_tag LOCUS_21880 24141 23563 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921424.1 protein_id gnl|my_center|LOCUS_21880 25744 24239 gene locus_tag LOCUS_21890 gene rpoN 25744 24239 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03408 protein_id gnl|my_center|LOCUS_21890 26476 25763 gene locus_tag LOCUS_21900 26476 25763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921427.1 protein_id gnl|my_center|LOCUS_21900 27138 26596 gene locus_tag LOCUS_21910 27138 26596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 27835 27185 gene locus_tag LOCUS_21920 27835 27185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 28553 27939 gene locus_tag LOCUS_21930 28553 27939 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921430.1 protein_id gnl|my_center|LOCUS_21930 32170 28712 gene locus_tag LOCUS_21940 32170 28712 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM18 protein_id gnl|my_center|LOCUS_21940 32495 33202 gene locus_tag LOCUS_21950 32495 33202 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083189.1 protein_id gnl|my_center|LOCUS_21950 33583 33218 gene locus_tag LOCUS_21960 33583 33218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 33770 34411 gene locus_tag LOCUS_21970 33770 34411 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H24 protein_id gnl|my_center|LOCUS_21970 35776 34589 gene locus_tag LOCUS_21980 35776 34589 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639918.1 protein_id gnl|my_center|LOCUS_21980 36015 37214 gene locus_tag LOCUS_21990 36015 37214 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639919.1 protein_id gnl|my_center|LOCUS_21990 37302 38906 gene locus_tag LOCUS_22000 37302 38906 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265611.1 protein_id gnl|my_center|LOCUS_22000 40102 38915 gene locus_tag LOCUS_22010 40102 38915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531181.1 protein_id gnl|my_center|LOCUS_22010 40493 40134 gene locus_tag LOCUS_22020 40493 40134 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 protein_id gnl|my_center|LOCUS_22020 40556 41527 gene locus_tag LOCUS_22030 40556 41527 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640054.1 protein_id gnl|my_center|LOCUS_22030 41952 42350 gene locus_tag LOCUS_22040 gene staR 41952 42350 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920112.1 protein_id gnl|my_center|LOCUS_22040 42426 43247 gene locus_tag LOCUS_22050 42426 43247 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 protein_id gnl|my_center|LOCUS_22050 44189 43254 gene locus_tag LOCUS_22060 44189 43254 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920114.1 protein_id gnl|my_center|LOCUS_22060 44502 44200 gene locus_tag LOCUS_22070 44502 44200 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920115.1 protein_id gnl|my_center|LOCUS_22070 45541 44606 gene locus_tag LOCUS_22080 45541 44606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 46588 45638 gene locus_tag LOCUS_22090 46588 45638 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640450.1 protein_id gnl|my_center|LOCUS_22090 46829 47305 gene locus_tag LOCUS_22100 46829 47305 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_22100 48127 47510 gene locus_tag LOCUS_22110 48127 47510 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403296.1 protein_id gnl|my_center|LOCUS_22110 49361 48171 gene locus_tag LOCUS_22120 49361 48171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 49495 50544 gene locus_tag LOCUS_22130 49495 50544 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_22130 51623 50586 gene locus_tag LOCUS_22140 51623 50586 CDS product chemotaxis sensory transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087148.1 protein_id gnl|my_center|LOCUS_22140 52021 53847 gene locus_tag LOCUS_22150 gene typA 52021 53847 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970399.1 protein_id gnl|my_center|LOCUS_22150 54836 53910 gene locus_tag LOCUS_22160 54836 53910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 55309 54857 gene locus_tag LOCUS_22170 55309 54857 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373561.1 protein_id gnl|my_center|LOCUS_22170 55385 55999 gene locus_tag LOCUS_22180 55385 55999 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence22 1870 3579 gene locus_tag LOCUS_22190 1870 3579 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920923.1 protein_id gnl|my_center|LOCUS_22190 4081 3698 gene locus_tag LOCUS_22200 4081 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 4739 4149 gene locus_tag LOCUS_22210 4739 4149 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_22210 5307 4765 gene locus_tag LOCUS_22220 5307 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 5403 5777 gene locus_tag LOCUS_22230 5403 5777 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974579.1 protein_id gnl|my_center|LOCUS_22230 5853 6077 gene locus_tag LOCUS_22240 5853 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 6174 6752 gene locus_tag LOCUS_22250 6174 6752 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_22250 6836 8716 gene locus_tag LOCUS_22260 6836 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_22260 9257 8784 gene locus_tag LOCUS_22270 9257 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 9470 10348 gene locus_tag LOCUS_22280 9470 10348 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918601.1 protein_id gnl|my_center|LOCUS_22280 10507 12984 gene locus_tag LOCUS_22290 10507 12984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 13468 12881 gene locus_tag LOCUS_22300 13468 12881 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920071.1 protein_id gnl|my_center|LOCUS_22300 13514 14911 gene locus_tag LOCUS_22310 gene argH 13514 14911 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY2 protein_id gnl|my_center|LOCUS_22310 14908 15162 gene locus_tag LOCUS_22320 14908 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 15189 16463 gene locus_tag LOCUS_22330 gene lysA 15189 16463 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8H9 protein_id gnl|my_center|LOCUS_22330 16476 19100 gene locus_tag LOCUS_22340 16476 19100 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338443.1 protein_id gnl|my_center|LOCUS_22340 19719 19102 gene locus_tag LOCUS_22350 19719 19102 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556052.1 protein_id gnl|my_center|LOCUS_22350 20394 19774 gene locus_tag LOCUS_22360 20394 19774 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640439.1 protein_id gnl|my_center|LOCUS_22360 21265 20306 gene locus_tag LOCUS_22370 21265 20306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 21375 22100 gene locus_tag LOCUS_22380 gene ftsE 21375 22100 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265777.1 protein_id gnl|my_center|LOCUS_22380 22125 22988 gene locus_tag LOCUS_22390 22125 22988 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_22390 22997 23659 gene locus_tag LOCUS_22400 22997 23659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920079.1 protein_id gnl|my_center|LOCUS_22400 23673 24473 gene locus_tag LOCUS_22410 gene plsC 23673 24473 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 protein_id gnl|my_center|LOCUS_22410 24466 25473 gene locus_tag LOCUS_22420 24466 25473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 25528 26976 gene locus_tag LOCUS_22430 25528 26976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 28446 27052 gene locus_tag LOCUS_22440 gene ahcY 28446 27052 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6C7 protein_id gnl|my_center|LOCUS_22440 28680 29270 gene locus_tag LOCUS_22450 28680 29270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 30412 29444 gene locus_tag LOCUS_22460 gene rarD 30412 29444 CDS product chloramphenicol resistance permease RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941432.1 protein_id gnl|my_center|LOCUS_22460 31549 30509 gene locus_tag LOCUS_22470 gene asd 31549 30509 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X21 protein_id gnl|my_center|LOCUS_22470 31701 32078 gene locus_tag LOCUS_22480 31701 32078 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975812.1 protein_id gnl|my_center|LOCUS_22480 32086 33018 gene locus_tag LOCUS_22490 32086 33018 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919703.1 protein_id gnl|my_center|LOCUS_22490 33024 33746 gene locus_tag LOCUS_22500 33024 33746 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F0 protein_id gnl|my_center|LOCUS_22500 33850 35895 gene locus_tag LOCUS_22510 33850 35895 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_22510 35949 36431 gene locus_tag LOCUS_22520 35949 36431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 36520 37701 gene locus_tag LOCUS_22530 36520 37701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_22530 38152 37715 gene locus_tag LOCUS_22540 38152 37715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 38621 38190 gene locus_tag LOCUS_22550 38621 38190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 38903 39268 gene locus_tag LOCUS_22560 38903 39268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 39778 39332 gene locus_tag LOCUS_22570 39778 39332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 41006 39831 gene locus_tag LOCUS_22580 gene nspC 41006 39831 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A53 protein_id gnl|my_center|LOCUS_22580 41344 41003 gene locus_tag LOCUS_22590 41344 41003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 41601 41341 gene locus_tag LOCUS_22600 gene parD4 41601 41341 CDS product antitoxin ParD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A458 protein_id gnl|my_center|LOCUS_22600 42951 41665 gene locus_tag LOCUS_22610 42951 41665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_22610 43318 43136 gene locus_tag LOCUS_22620 43318 43136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 43763 43413 gene locus_tag LOCUS_22630 43763 43413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 44022 43753 gene locus_tag LOCUS_22640 44022 43753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887113.1 protein_id gnl|my_center|LOCUS_22640 45845 44346 gene locus_tag LOCUS_22650 gene lys1 45845 44346 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_22650 47195 45972 gene locus_tag LOCUS_22660 47195 45972 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_22660 47602 48687 gene locus_tag LOCUS_22670 47602 48687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 49791 48706 gene locus_tag LOCUS_22680 49791 48706 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921174.1 protein_id gnl|my_center|LOCUS_22680 49962 53093 gene locus_tag LOCUS_22690 49962 53093 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AA07 protein_id gnl|my_center|LOCUS_22690 54398 53325 gene locus_tag LOCUS_22700 gene leuB 54398 53325 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABN3 protein_id gnl|my_center|LOCUS_22700 55043 54510 gene locus_tag LOCUS_22710 55043 54510 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_22710 55669 55043 gene locus_tag LOCUS_22720 gene leuD 55669 55043 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABN1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence23 775 581 gene locus_tag LOCUS_22730 775 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1772 1332 gene locus_tag LOCUS_22740 1772 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1864 2391 gene locus_tag LOCUS_22750 1864 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976157.1 protein_id gnl|my_center|LOCUS_22750 2448 3068 gene locus_tag LOCUS_22760 2448 3068 CDS product 2OG-Fe(II) oxygenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_22760 3071 3700 gene locus_tag LOCUS_22770 3071 3700 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 protein_id gnl|my_center|LOCUS_22770 3970 4311 gene locus_tag LOCUS_22780 3970 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_22780 4413 4958 gene locus_tag LOCUS_22790 4413 4958 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB22 protein_id gnl|my_center|LOCUS_22790 5063 6292 gene locus_tag LOCUS_22800 5063 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 7106 6309 gene locus_tag LOCUS_22810 7106 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 8493 7315 gene locus_tag LOCUS_22820 8493 7315 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGX2 protein_id gnl|my_center|LOCUS_22820 8569 9669 gene locus_tag LOCUS_22830 8569 9669 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_22830 9672 10607 gene locus_tag LOCUS_22840 9672 10607 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_22840 10754 12226 gene locus_tag LOCUS_22850 10754 12226 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_22850 12346 13377 gene locus_tag LOCUS_22860 12346 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 14283 13396 gene locus_tag LOCUS_22870 14283 13396 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640406.1 protein_id gnl|my_center|LOCUS_22870 14344 15288 gene locus_tag LOCUS_22880 gene miaA 14344 15288 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G43 protein_id gnl|my_center|LOCUS_22880 15545 15291 gene locus_tag LOCUS_22890 15545 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 15820 15545 gene locus_tag LOCUS_22900 15820 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 16132 15881 gene locus_tag LOCUS_22910 16132 15881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 17525 16122 gene locus_tag LOCUS_22920 17525 16122 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083369.1 protein_id gnl|my_center|LOCUS_22920 18246 17518 gene locus_tag LOCUS_22930 18246 17518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083368.1 protein_id gnl|my_center|LOCUS_22930 19786 18335 gene locus_tag LOCUS_22940 19786 18335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 20799 19777 gene locus_tag LOCUS_22950 gene cmaX 20799 19777 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 protein_id gnl|my_center|LOCUS_22950 21251 23029 gene locus_tag LOCUS_22960 21251 23029 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA17 protein_id gnl|my_center|LOCUS_22960 23044 23622 gene locus_tag LOCUS_22970 23044 23622 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919962.1 protein_id gnl|my_center|LOCUS_22970 23678 24433 gene locus_tag LOCUS_22980 23678 24433 CDS product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530227.1 protein_id gnl|my_center|LOCUS_22980 24499 25515 gene locus_tag LOCUS_22990 gene ilvC 24499 25515 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX71 protein_id gnl|my_center|LOCUS_22990 25699 26040 gene locus_tag LOCUS_23000 25699 26040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 26999 26088 gene locus_tag LOCUS_23010 26999 26088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528220.1 protein_id gnl|my_center|LOCUS_23010 27139 27351 gene locus_tag LOCUS_23020 27139 27351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 28278 27355 gene locus_tag LOCUS_23030 28278 27355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 30096 28411 gene locus_tag LOCUS_23040 30096 28411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 30875 30114 gene locus_tag LOCUS_23050 gene dpm1 30875 30114 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_23050 30964 31284 gene locus_tag LOCUS_23060 30964 31284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 31361 32323 gene locus_tag LOCUS_23070 gene htpX 31361 32323 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H051 protein_id gnl|my_center|LOCUS_23070 32818 32402 gene locus_tag LOCUS_23080 32818 32402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 33756 32977 gene locus_tag LOCUS_23090 33756 32977 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639941.1 protein_id gnl|my_center|LOCUS_23090 34709 33852 gene locus_tag LOCUS_23100 34709 33852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927791.1 protein_id gnl|my_center|LOCUS_23100 34684 35280 gene locus_tag LOCUS_23110 34684 35280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 35341 36057 gene locus_tag LOCUS_23120 gene trmD 35341 36057 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW8 protein_id gnl|my_center|LOCUS_23120 36068 36469 gene locus_tag LOCUS_23130 36068 36469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 37020 36571 gene locus_tag LOCUS_23140 37020 36571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 37393 37067 gene locus_tag LOCUS_23150 37393 37067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 protein_id gnl|my_center|LOCUS_23150 38522 37398 gene locus_tag LOCUS_23160 gene flgI1 38522 37398 CDS product flagellar P-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I01 protein_id gnl|my_center|LOCUS_23160 38701 39144 gene locus_tag LOCUS_23170 gene fliX 38701 39144 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32348 protein_id gnl|my_center|LOCUS_23170 39286 39699 gene locus_tag LOCUS_23180 gene dksA 39286 39699 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAU3 protein_id gnl|my_center|LOCUS_23180 41217 39784 gene locus_tag LOCUS_23190 gene dacB 41217 39784 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_23190 41756 41307 gene locus_tag LOCUS_23200 41756 41307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 42603 41839 gene locus_tag LOCUS_23210 gene flgH1 42603 41839 CDS product flagellar L-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I09 protein_id gnl|my_center|LOCUS_23210 43388 42618 gene locus_tag LOCUS_23220 43388 42618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 44203 43418 gene locus_tag LOCUS_23230 gene flgG 44203 43418 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06172 protein_id gnl|my_center|LOCUS_23230 44998 44228 gene locus_tag LOCUS_23240 gene flgF 44998 44228 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06171 protein_id gnl|my_center|LOCUS_23240 45248 45051 gene locus_tag LOCUS_23250 45248 45051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 45308 45988 gene locus_tag LOCUS_23260 gene fliL 45308 45988 CDS product flagellar FliL protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXB6 protein_id gnl|my_center|LOCUS_23260 46060 47184 gene locus_tag LOCUS_23270 gene fliM 46060 47184 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXB5 protein_id gnl|my_center|LOCUS_23270 47181 47555 gene locus_tag LOCUS_23280 47181 47555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 47566 48303 gene locus_tag LOCUS_23290 47566 48303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 48300 51899 gene locus_tag LOCUS_23300 48300 51899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 52035 53381 gene locus_tag LOCUS_23310 52035 53381 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 protein_id gnl|my_center|LOCUS_23310 53721 53449 gene locus_tag LOCUS_23320 53721 53449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 53800 54006 gene locus_tag LOCUS_23330 53800 54006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence24 1515 319 gene locus_tag LOCUS_23340 1515 319 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_23340 3883 1643 gene locus_tag LOCUS_23350 3883 1643 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_23350 5439 4381 gene locus_tag LOCUS_23360 5439 4381 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_23360 6633 5485 gene locus_tag LOCUS_23370 6633 5485 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_23370 6765 7907 gene locus_tag LOCUS_23380 6765 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 8017 8802 gene locus_tag LOCUS_23390 8017 8802 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926609.1 protein_id gnl|my_center|LOCUS_23390 8833 9996 gene locus_tag LOCUS_23400 8833 9996 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_23400 10023 11210 gene locus_tag LOCUS_23410 10023 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 11298 12470 gene locus_tag LOCUS_23420 11298 12470 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_23420 13253 12474 gene locus_tag LOCUS_23430 13253 12474 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_23430 14520 13366 gene locus_tag LOCUS_23440 14520 13366 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_23440 16647 14548 gene locus_tag LOCUS_23450 16647 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 17461 16664 gene locus_tag LOCUS_23460 17461 16664 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096756.1 protein_id gnl|my_center|LOCUS_23460 19650 17461 gene locus_tag LOCUS_23470 19650 17461 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_23470 19850 21298 gene locus_tag LOCUS_23480 19850 21298 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228923.1 protein_id gnl|my_center|LOCUS_23480 21414 22232 gene locus_tag LOCUS_23490 gene paaG 21414 22232 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_23490 22806 22414 gene locus_tag LOCUS_23500 22806 22414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 23626 22808 gene locus_tag LOCUS_23510 23626 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 24080 23619 gene locus_tag LOCUS_23520 24080 23619 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_23520 24223 25647 gene locus_tag LOCUS_23530 24223 25647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 26579 25662 gene locus_tag LOCUS_23540 26579 25662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 27412 26663 gene locus_tag LOCUS_23550 27412 26663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 27705 29918 gene locus_tag LOCUS_23560 27705 29918 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_23560 29995 30675 gene locus_tag LOCUS_23570 29995 30675 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCU4 protein_id gnl|my_center|LOCUS_23570 30712 31413 gene locus_tag LOCUS_23580 30712 31413 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940072.1 protein_id gnl|my_center|LOCUS_23580 31391 31792 gene locus_tag LOCUS_23590 31391 31792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 31789 32208 gene locus_tag LOCUS_23600 31789 32208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 32205 32978 gene locus_tag LOCUS_23610 32205 32978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 33467 35845 gene locus_tag LOCUS_23620 33467 35845 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246690.1 protein_id gnl|my_center|LOCUS_23620 35947 38913 gene locus_tag LOCUS_23630 35947 38913 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229807.1 protein_id gnl|my_center|LOCUS_23630 40552 39029 gene locus_tag LOCUS_23640 gene gcvPB 40552 39029 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A354 protein_id gnl|my_center|LOCUS_23640 42041 40692 gene locus_tag LOCUS_23650 gene gcvPA 42041 40692 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A353 protein_id gnl|my_center|LOCUS_23650 42476 42102 gene locus_tag LOCUS_23660 gene gcvH 42476 42102 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q10 protein_id gnl|my_center|LOCUS_23660 43665 42481 gene locus_tag LOCUS_23670 gene gcvT2 43665 42481 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I140 protein_id gnl|my_center|LOCUS_23670 43932 43717 gene locus_tag LOCUS_23680 43932 43717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 44263 45258 gene locus_tag LOCUS_23690 44263 45258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 47073 45307 gene locus_tag LOCUS_23700 gene argS 47073 45307 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A347 protein_id gnl|my_center|LOCUS_23700 47544 47095 gene locus_tag LOCUS_23710 47544 47095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 47860 48858 gene locus_tag LOCUS_23720 gene ispH 47860 48858 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5X0 protein_id gnl|my_center|LOCUS_23720 48946 49272 gene locus_tag LOCUS_23730 48946 49272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 49388 50944 gene locus_tag LOCUS_23740 gene yhcX 49388 50944 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_23740 51018 51980 gene locus_tag LOCUS_23750 gene thrB 51018 51980 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK2 protein_id gnl|my_center|LOCUS_23750 53256 52036 gene locus_tag LOCUS_23760 53256 52036 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6H4 protein_id gnl|my_center|LOCUS_23760 >Feature sequence25 192 1505 gene locus_tag LOCUS_23770 gene hflX 192 1505 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7H7 protein_id gnl|my_center|LOCUS_23770 1553 2842 gene locus_tag LOCUS_23780 1553 2842 CDS product sodium dependent nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919950.1 protein_id gnl|my_center|LOCUS_23780 3176 3850 gene locus_tag LOCUS_23790 3176 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 4750 3851 gene locus_tag LOCUS_23800 4750 3851 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 protein_id gnl|my_center|LOCUS_23800 5594 4776 gene locus_tag LOCUS_23810 gene trmH 5594 4776 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970830.1 protein_id gnl|my_center|LOCUS_23810 5815 7209 gene locus_tag LOCUS_23820 5815 7209 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083904.1 protein_id gnl|my_center|LOCUS_23820 7209 8336 gene locus_tag LOCUS_23830 7209 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 9739 8759 gene locus_tag LOCUS_23840 9739 8759 CDS product LAO/AO transport system kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 protein_id gnl|my_center|LOCUS_23840 10227 9736 gene locus_tag LOCUS_23850 10227 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919164.1 protein_id gnl|my_center|LOCUS_23850 10595 10272 gene locus_tag LOCUS_23860 10595 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 12809 10617 gene locus_tag LOCUS_23870 12809 10617 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390232.1 protein_id gnl|my_center|LOCUS_23870 14861 12852 gene locus_tag LOCUS_23880 14861 12852 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_23880 15892 15080 gene locus_tag LOCUS_23890 gene paaG 15892 15080 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227109.1 protein_id gnl|my_center|LOCUS_23890 16176 18137 gene locus_tag LOCUS_23900 gene acsA 16176 18137 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WV5 protein_id gnl|my_center|LOCUS_23900 19041 18202 gene locus_tag LOCUS_23910 19041 18202 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_23910 19660 19058 gene locus_tag LOCUS_23920 19660 19058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 22274 19689 gene locus_tag LOCUS_23930 gene topA 22274 19689 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 protein_id gnl|my_center|LOCUS_23930 23533 22412 gene locus_tag LOCUS_23940 gene smf 23533 22412 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969165.1 protein_id gnl|my_center|LOCUS_23940 24174 23533 gene locus_tag LOCUS_23950 gene plsY 24174 23533 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFU1 protein_id gnl|my_center|LOCUS_23950 25495 24176 gene locus_tag LOCUS_23960 gene pyrC 25495 24176 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K3 protein_id gnl|my_center|LOCUS_23960 26469 25492 gene locus_tag LOCUS_23970 gene pyrB 26469 25492 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFT9 protein_id gnl|my_center|LOCUS_23970 27029 26568 gene locus_tag LOCUS_23980 27029 26568 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Z5 protein_id gnl|my_center|LOCUS_23980 27209 27496 gene locus_tag LOCUS_23990 gene gatC 27209 27496 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K9 protein_id gnl|my_center|LOCUS_23990 27568 29040 gene locus_tag LOCUS_24000 gene gatA 27568 29040 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZJ5 protein_id gnl|my_center|LOCUS_24000 29171 29485 gene locus_tag LOCUS_24010 29171 29485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 29690 30529 gene locus_tag LOCUS_24020 29690 30529 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088005.1 protein_id gnl|my_center|LOCUS_24020 30645 31085 gene locus_tag LOCUS_24030 30645 31085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 31239 32759 gene locus_tag LOCUS_24040 gene gatB 31239 32759 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC0 protein_id gnl|my_center|LOCUS_24040 32875 33078 gene locus_tag LOCUS_24050 32875 33078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_24050 33164 33574 gene locus_tag LOCUS_24060 33164 33574 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_24060 34221 33601 gene locus_tag LOCUS_24070 34221 33601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 34460 35809 gene locus_tag LOCUS_24080 gene norM 34460 35809 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y654 protein_id gnl|my_center|LOCUS_24080 36116 35850 gene locus_tag LOCUS_24090 gene hupB 36116 35850 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_24090 37141 36230 gene locus_tag LOCUS_24100 37141 36230 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919885.1 protein_id gnl|my_center|LOCUS_24100 37404 38321 gene locus_tag LOCUS_24110 37404 38321 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 protein_id gnl|my_center|LOCUS_24110 38334 39521 gene locus_tag LOCUS_24120 38334 39521 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 protein_id gnl|my_center|LOCUS_24120 39620 40621 gene locus_tag LOCUS_24130 39620 40621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 41738 40596 gene locus_tag LOCUS_24140 41738 40596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 41894 42451 gene locus_tag LOCUS_24150 41894 42451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 42406 43785 gene locus_tag LOCUS_24160 42406 43785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 43804 44829 gene locus_tag LOCUS_24170 43804 44829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 44826 45992 gene locus_tag LOCUS_24180 44826 45992 CDS product response regulator receiver modulated metal-depenent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_24180 46026 47708 gene locus_tag LOCUS_24190 gene nadE2 46026 47708 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708228.1 protein_id gnl|my_center|LOCUS_24190 48100 47774 gene locus_tag LOCUS_24200 48100 47774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 48735 51275 gene locus_tag LOCUS_24210 48735 51275 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919028.1 protein_id gnl|my_center|LOCUS_24210 51275 51805 gene locus_tag LOCUS_24220 51275 51805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence26 <1 527 gene locus_tag LOCUS_24230 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074251.1:diguanylate cyclase 1220 756 gene locus_tag LOCUS_24240 1220 756 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_24240 1318 2403 gene locus_tag LOCUS_24250 1318 2403 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 protein_id gnl|my_center|LOCUS_24250 2400 2957 gene locus_tag LOCUS_24260 2400 2957 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_24260 2954 3595 gene locus_tag LOCUS_24270 gene hmgA 2954 3595 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_24270 3610 4638 gene locus_tag LOCUS_24280 3610 4638 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536759.1 protein_id gnl|my_center|LOCUS_24280 4712 6094 gene locus_tag LOCUS_24290 gene sad 4712 6094 CDS product succinate semialdehyde dehydrogenase [NAD(P)+] Sad inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76149 protein_id gnl|my_center|LOCUS_24290 6718 6095 gene locus_tag LOCUS_24300 6718 6095 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_24300 7208 6900 gene locus_tag LOCUS_24310 7208 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 7240 8757 gene locus_tag LOCUS_24320 7240 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_24320 8776 10206 gene locus_tag LOCUS_24330 8776 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_24330 12030 10228 gene locus_tag LOCUS_24340 12030 10228 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_24340 12770 12003 gene locus_tag LOCUS_24350 12770 12003 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUM9 protein_id gnl|my_center|LOCUS_24350 14175 12802 gene locus_tag LOCUS_24360 14175 12802 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_24360 15810 14398 gene locus_tag LOCUS_24370 15810 14398 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268044.1 protein_id gnl|my_center|LOCUS_24370 15484 15576 gene locus_tag LOCUS_t00230 15484 15576 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18941 15807 gene locus_tag LOCUS_24380 gene acrB2 18941 15807 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 protein_id gnl|my_center|LOCUS_24380 20226 18994 gene locus_tag LOCUS_24390 gene acrA 20226 18994 CDS product multidrug efflux pump subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AE06 protein_id gnl|my_center|LOCUS_24390 20337 21014 gene locus_tag LOCUS_24400 20337 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 21789 21715 gene locus_tag LOCUS_t00240 21789 21715 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22104 24146 gene locus_tag LOCUS_24410 22104 24146 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_24410 24158 24688 gene locus_tag LOCUS_24420 24158 24688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 24685 26997 gene locus_tag LOCUS_24430 24685 26997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 26994 27383 gene locus_tag LOCUS_24440 26994 27383 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709916.1 protein_id gnl|my_center|LOCUS_24440 27380 28024 gene locus_tag LOCUS_24450 27380 28024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 28014 29453 gene locus_tag LOCUS_24460 28014 29453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 29675 30979 gene locus_tag LOCUS_24470 29675 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 31173 34046 gene locus_tag LOCUS_24480 31173 34046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 34175 36601 gene locus_tag LOCUS_24490 34175 36601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 36704 37060 gene locus_tag LOCUS_24500 36704 37060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 37280 38338 gene locus_tag LOCUS_24510 37280 38338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 39480 38392 gene locus_tag LOCUS_24520 39480 38392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 39950 39510 gene locus_tag LOCUS_24530 39950 39510 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070884.1 protein_id gnl|my_center|LOCUS_24530 42381 40084 gene locus_tag LOCUS_24540 42381 40084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 42994 43989 gene locus_tag LOCUS_24550 42994 43989 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_24550 44824 44024 gene locus_tag LOCUS_24560 44824 44024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24560 45111 44845 gene locus_tag LOCUS_24570 45111 44845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24570 45267 45491 gene locus_tag LOCUS_24580 45267 45491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 45488 46729 gene locus_tag LOCUS_24590 45488 46729 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614666.1 protein_id gnl|my_center|LOCUS_24590 46739 49816 gene locus_tag LOCUS_24600 46739 49816 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_24600 49750 49980 gene locus_tag LOCUS_24610 49750 49980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence27 1249 395 gene locus_tag LOCUS_24620 1249 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_24620 1889 1260 gene locus_tag LOCUS_24630 1889 1260 CDS product glycoside hydrolase family 24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 protein_id gnl|my_center|LOCUS_24630 2272 1886 gene locus_tag LOCUS_24640 2272 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2462 2250 gene locus_tag LOCUS_24650 2462 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2773 2465 gene locus_tag LOCUS_24660 2773 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3224 2796 gene locus_tag LOCUS_24670 3224 2796 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 protein_id gnl|my_center|LOCUS_24670 3385 3867 gene locus_tag LOCUS_24680 3385 3867 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090095.1 protein_id gnl|my_center|LOCUS_24680 4293 3868 gene locus_tag LOCUS_24690 4293 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 4829 4290 gene locus_tag LOCUS_24700 4829 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4944 5192 gene locus_tag LOCUS_24710 4944 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 5672 5244 gene locus_tag LOCUS_24720 5672 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 6200 5844 gene locus_tag LOCUS_24730 6200 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 6652 6317 gene locus_tag LOCUS_24740 6652 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 8046 6814 gene locus_tag LOCUS_24750 8046 6814 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 protein_id gnl|my_center|LOCUS_24750 8332 8171 gene locus_tag LOCUS_24760 8332 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 8826 8401 gene locus_tag LOCUS_24770 8826 8401 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920627.1 protein_id gnl|my_center|LOCUS_24770 9041 8823 gene locus_tag LOCUS_24780 9041 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 10225 9101 gene locus_tag LOCUS_24790 10225 9101 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920629.1 protein_id gnl|my_center|LOCUS_24790 11616 10360 gene locus_tag LOCUS_24800 11616 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 11866 11597 gene locus_tag LOCUS_24810 11866 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 12143 14152 gene locus_tag LOCUS_24820 gene pbpC 12143 14152 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921109.1 protein_id gnl|my_center|LOCUS_24820 14297 16267 gene locus_tag LOCUS_24830 14297 16267 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918781.1 protein_id gnl|my_center|LOCUS_24830 16346 18172 gene locus_tag LOCUS_24840 16346 18172 CDS product holdfast attachment protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920483.1 protein_id gnl|my_center|LOCUS_24840 18223 18672 gene locus_tag LOCUS_24850 18223 18672 CDS product preprotein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 protein_id gnl|my_center|LOCUS_24850 18775 19884 gene locus_tag LOCUS_24860 18775 19884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640543.1 protein_id gnl|my_center|LOCUS_24860 20172 20489 gene locus_tag LOCUS_24870 20172 20489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 20582 22639 gene locus_tag LOCUS_24880 20582 22639 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084021.1 protein_id gnl|my_center|LOCUS_24880 23975 22734 gene locus_tag LOCUS_24890 23975 22734 CDS product putative MscS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66994 protein_id gnl|my_center|LOCUS_24890 24252 24950 gene locus_tag LOCUS_24900 24252 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897942.1 protein_id gnl|my_center|LOCUS_24900 26612 25008 gene locus_tag LOCUS_24910 gene prfC 26612 25008 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9B9 protein_id gnl|my_center|LOCUS_24910 26763 28712 gene locus_tag LOCUS_24920 26763 28712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 28709 29458 gene locus_tag LOCUS_24930 28709 29458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 29811 29518 gene locus_tag LOCUS_24940 29811 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 30097 29906 gene locus_tag LOCUS_24950 30097 29906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 30904 30503 gene locus_tag LOCUS_24960 30904 30503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 31482 31030 gene locus_tag LOCUS_24970 31482 31030 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 protein_id gnl|my_center|LOCUS_24970 31568 32224 gene locus_tag LOCUS_24980 31568 32224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040262.1 protein_id gnl|my_center|LOCUS_24980 32841 32245 gene locus_tag LOCUS_24990 32841 32245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 33100 34143 gene locus_tag LOCUS_25000 gene ruvB 33100 34143 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3G8 protein_id gnl|my_center|LOCUS_25000 34185 35171 gene locus_tag LOCUS_25010 34185 35171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 35293 36501 gene locus_tag LOCUS_25020 35293 36501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 36545 37003 gene locus_tag LOCUS_25030 36545 37003 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 protein_id gnl|my_center|LOCUS_25030 37202 37987 gene locus_tag LOCUS_25040 gene tolQ 37202 37987 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537914.1 protein_id gnl|my_center|LOCUS_25040 37993 38463 gene locus_tag LOCUS_25050 37993 38463 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066848.1 protein_id gnl|my_center|LOCUS_25050 38470 39363 gene locus_tag LOCUS_25060 38470 39363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 39447 40820 gene locus_tag LOCUS_25070 gene tolB 39447 40820 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_25070 41046 41594 gene locus_tag LOCUS_25080 41046 41594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 41613 42551 gene locus_tag LOCUS_25090 gene ybgF 41613 42551 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921061.1 protein_id gnl|my_center|LOCUS_25090 42638 43216 gene locus_tag LOCUS_25100 42638 43216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 43616 43365 gene locus_tag LOCUS_25110 43616 43365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 43758 44609 gene locus_tag LOCUS_25120 43758 44609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 44724 46643 gene locus_tag LOCUS_25130 gene ftsH 44724 46643 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN14 protein_id gnl|my_center|LOCUS_25130 46929 46729 gene locus_tag LOCUS_25140 46929 46729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 47175 47990 gene locus_tag LOCUS_25150 47175 47990 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3I0 protein_id gnl|my_center|LOCUS_25150 >Feature sequence28 2 181 gene locus_tag LOCUS_25160 2 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 295 678 gene locus_tag LOCUS_25170 295 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 738 1235 gene locus_tag LOCUS_25180 gene aspG 738 1235 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_25180 1309 3396 gene locus_tag LOCUS_25190 1309 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3302 3529 gene locus_tag LOCUS_25200 3302 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3537 3659 gene locus_tag LOCUS_25210 3537 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3930 4457 gene locus_tag LOCUS_25220 3930 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 4459 4962 gene locus_tag LOCUS_25230 4459 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 4946 5674 gene locus_tag LOCUS_25240 4946 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708941.1 protein_id gnl|my_center|LOCUS_25240 5764 5688 gene locus_tag LOCUS_t00250 5764 5688 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6779 5949 gene locus_tag LOCUS_25250 6779 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 protein_id gnl|my_center|LOCUS_25250 6895 7446 gene locus_tag LOCUS_25260 6895 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 9068 7455 gene locus_tag LOCUS_25270 9068 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 10199 9099 gene locus_tag LOCUS_25280 10199 9099 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918623.1 protein_id gnl|my_center|LOCUS_25280 10810 10301 gene locus_tag LOCUS_25290 10810 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 12573 11320 gene locus_tag LOCUS_25300 12573 11320 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920921.1 protein_id gnl|my_center|LOCUS_25300 12782 13321 gene locus_tag LOCUS_25310 12782 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920662.1 protein_id gnl|my_center|LOCUS_25310 13336 14217 gene locus_tag LOCUS_25320 13336 14217 CDS product D-alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339326.1 protein_id gnl|my_center|LOCUS_25320 14301 14864 gene locus_tag LOCUS_25330 14301 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 16376 14889 gene locus_tag LOCUS_25340 16376 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 protein_id gnl|my_center|LOCUS_25340 17365 16373 gene locus_tag LOCUS_25350 17365 16373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_25350 18971 17487 gene locus_tag LOCUS_25360 gene tacA 18971 17487 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 protein_id gnl|my_center|LOCUS_25360 19287 20735 gene locus_tag LOCUS_25370 19287 20735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 20707 22056 gene locus_tag LOCUS_25380 20707 22056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921144.1 protein_id gnl|my_center|LOCUS_25380 22279 22590 gene locus_tag LOCUS_25390 22279 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 22602 23732 gene locus_tag LOCUS_25400 22602 23732 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_25400 23909 24241 gene locus_tag LOCUS_25410 23909 24241 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921136.1 protein_id gnl|my_center|LOCUS_25410 24277 25704 gene locus_tag LOCUS_25420 24277 25704 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3A1 protein_id gnl|my_center|LOCUS_25420 26314 25853 gene locus_tag LOCUS_25430 26314 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 26644 26369 gene locus_tag LOCUS_25440 26644 26369 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EF0 protein_id gnl|my_center|LOCUS_25440 27277 26738 gene locus_tag LOCUS_25450 27277 26738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090279.1 protein_id gnl|my_center|LOCUS_25450 27929 27324 gene locus_tag LOCUS_25460 27929 27324 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 protein_id gnl|my_center|LOCUS_25460 28083 27958 gene locus_tag LOCUS_25470 gene rpmJ 28083 27958 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4S1 protein_id gnl|my_center|LOCUS_25470 28350 29687 gene locus_tag LOCUS_25480 28350 29687 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921153.1 protein_id gnl|my_center|LOCUS_25480 30937 29684 gene locus_tag LOCUS_25490 30937 29684 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918637.1 protein_id gnl|my_center|LOCUS_25490 31375 30995 gene locus_tag LOCUS_25500 31375 30995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 31930 31496 gene locus_tag LOCUS_25510 31930 31496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 31839 32054 gene locus_tag LOCUS_25520 31839 32054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 32154 33041 gene locus_tag LOCUS_25530 gene motA 32154 33041 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_25530 33631 33077 gene locus_tag LOCUS_25540 33631 33077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 33989 35923 gene locus_tag LOCUS_25550 gene mnmC 33989 35923 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4L6 protein_id gnl|my_center|LOCUS_25550 36164 35904 gene locus_tag LOCUS_25560 36164 35904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 36504 36211 gene locus_tag LOCUS_25570 36504 36211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 36826 36560 gene locus_tag LOCUS_25580 36826 36560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 37296 36898 gene locus_tag LOCUS_25590 37296 36898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 37592 37320 gene locus_tag LOCUS_25600 37592 37320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 38269 37592 gene locus_tag LOCUS_25610 38269 37592 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 protein_id gnl|my_center|LOCUS_25610 38439 38302 gene locus_tag LOCUS_25620 38439 38302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 38642 39775 gene locus_tag LOCUS_25630 38642 39775 CDS product PSP operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_25630 39855 40892 gene locus_tag LOCUS_25640 39855 40892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 42221 40857 gene locus_tag LOCUS_25650 42221 40857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 42762 42475 gene locus_tag LOCUS_25660 42762 42475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence29 1086 442 gene locus_tag LOCUS_25670 1086 442 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918015.1 protein_id gnl|my_center|LOCUS_25670 1695 1159 gene locus_tag LOCUS_25680 gene ppa 1695 1159 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKZ2 protein_id gnl|my_center|LOCUS_25680 3068 1824 gene locus_tag LOCUS_25690 gene argG 3068 1824 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABU1 protein_id gnl|my_center|LOCUS_25690 3246 4274 gene locus_tag LOCUS_25700 3246 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 4365 4964 gene locus_tag LOCUS_25710 4365 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 4961 5731 gene locus_tag LOCUS_25720 4961 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 6410 5844 gene locus_tag LOCUS_25730 gene spdR 6410 5844 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918136.1 protein_id gnl|my_center|LOCUS_25730 7919 6507 gene locus_tag LOCUS_25740 7919 6507 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918137.1 protein_id gnl|my_center|LOCUS_25740 8017 8643 gene locus_tag LOCUS_25750 8017 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 10361 8712 gene locus_tag LOCUS_25760 10361 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 10410 11162 gene locus_tag LOCUS_25770 10410 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_25770 11686 11159 gene locus_tag LOCUS_25780 gene ccmG 11686 11159 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171969.1 protein_id gnl|my_center|LOCUS_25780 11823 11683 gene locus_tag LOCUS_25790 11823 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 12551 11826 gene locus_tag LOCUS_25800 12551 11826 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_25800 13245 12577 gene locus_tag LOCUS_25810 gene ccmB 13245 12577 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG05 protein_id gnl|my_center|LOCUS_25810 13895 13245 gene locus_tag LOCUS_25820 gene ccmA 13895 13245 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF0 protein_id gnl|my_center|LOCUS_25820 14032 16719 gene locus_tag LOCUS_25830 14032 16719 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A299 protein_id gnl|my_center|LOCUS_25830 16829 17557 gene locus_tag LOCUS_25840 16829 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265989.1 protein_id gnl|my_center|LOCUS_25840 18121 17579 gene locus_tag LOCUS_25850 18121 17579 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE05 protein_id gnl|my_center|LOCUS_25850 18486 18163 gene locus_tag LOCUS_25860 18486 18163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534939.1 protein_id gnl|my_center|LOCUS_25860 18697 19431 gene locus_tag LOCUS_25870 18697 19431 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923334.1 protein_id gnl|my_center|LOCUS_25870 19917 19549 gene locus_tag LOCUS_25880 19917 19549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 20125 20307 gene locus_tag LOCUS_25890 20125 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 20524 22704 gene locus_tag LOCUS_25900 20524 22704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 23451 22717 gene locus_tag LOCUS_25910 23451 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 24401 23448 gene locus_tag LOCUS_25920 24401 23448 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920179.1 protein_id gnl|my_center|LOCUS_25920 25213 24422 gene locus_tag LOCUS_25930 25213 24422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_25930 26346 25210 gene locus_tag LOCUS_25940 26346 25210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920177.1 protein_id gnl|my_center|LOCUS_25940 27568 26408 gene locus_tag LOCUS_25950 27568 26408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919355.1 protein_id gnl|my_center|LOCUS_25950 27728 28129 gene locus_tag LOCUS_25960 27728 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 28691 28137 gene locus_tag LOCUS_25970 28691 28137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 28873 29847 gene locus_tag LOCUS_25980 28873 29847 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8X1 protein_id gnl|my_center|LOCUS_25980 31286 29880 gene locus_tag LOCUS_25990 31286 29880 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_25990 32521 31373 gene locus_tag LOCUS_26000 gene rodA 32521 31373 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_26000 34485 32521 gene locus_tag LOCUS_26010 gene pbpA 34485 32521 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 protein_id gnl|my_center|LOCUS_26010 34985 34482 gene locus_tag LOCUS_26020 34985 34482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 35884 34982 gene locus_tag LOCUS_26030 35884 34982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 37003 35963 gene locus_tag LOCUS_26040 gene mreB 37003 35963 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919417.1 protein_id gnl|my_center|LOCUS_26040 37357 38598 gene locus_tag LOCUS_26050 37357 38598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972472.1 protein_id gnl|my_center|LOCUS_26050 40201 38666 gene locus_tag LOCUS_26060 gene leuA 40201 38666 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A823 protein_id gnl|my_center|LOCUS_26060 41153 40389 gene locus_tag LOCUS_26070 41153 40389 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919412.1 protein_id gnl|my_center|LOCUS_26070 41264 42253 gene locus_tag LOCUS_26080 41264 42253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence30 118 1761 gene locus_tag LOCUS_26090 118 1761 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975497.1 protein_id gnl|my_center|LOCUS_26090 1835 3055 gene locus_tag LOCUS_26100 1835 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 3069 3614 gene locus_tag LOCUS_26110 gene pi136 3069 3614 CDS product prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905378.1 protein_id gnl|my_center|LOCUS_26110 3605 4756 gene locus_tag LOCUS_26120 3605 4756 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 protein_id gnl|my_center|LOCUS_26120 4808 5389 gene locus_tag LOCUS_26130 4808 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 5637 5407 gene locus_tag LOCUS_26140 5637 5407 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528670.1 protein_id gnl|my_center|LOCUS_26140 5795 6037 gene locus_tag LOCUS_26150 5795 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 6215 6895 gene locus_tag LOCUS_26160 6215 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 7075 7713 gene locus_tag LOCUS_26170 7075 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 7710 7946 gene locus_tag LOCUS_26180 7710 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 8058 9020 gene locus_tag LOCUS_26190 8058 9020 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004234.1 protein_id gnl|my_center|LOCUS_26190 9168 9094 gene locus_tag LOCUS_t00260 9168 9094 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9431 9240 gene locus_tag LOCUS_26200 gene yacG 9431 9240 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UZ9 protein_id gnl|my_center|LOCUS_26200 10510 9431 gene locus_tag LOCUS_26210 10510 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 11124 10507 gene locus_tag LOCUS_26220 11124 10507 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL87 protein_id gnl|my_center|LOCUS_26220 11355 11137 gene locus_tag LOCUS_26230 gene infA 11355 11137 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V4 protein_id gnl|my_center|LOCUS_26230 11891 11427 gene locus_tag LOCUS_26240 11891 11427 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084076.1 protein_id gnl|my_center|LOCUS_26240 12370 11888 gene locus_tag LOCUS_26250 12370 11888 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL90 protein_id gnl|my_center|LOCUS_26250 13676 12363 gene locus_tag LOCUS_26260 gene hisD 13676 12363 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V1 protein_id gnl|my_center|LOCUS_26260 14128 13679 gene locus_tag LOCUS_26270 14128 13679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530200.1 protein_id gnl|my_center|LOCUS_26270 15415 14150 gene locus_tag LOCUS_26280 gene murA 15415 14150 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5U7 protein_id gnl|my_center|LOCUS_26280 15690 15463 gene locus_tag LOCUS_26290 15690 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 15734 15808 gene locus_tag LOCUS_t00270 15734 15808 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16682 15885 gene locus_tag LOCUS_26300 gene thiG 16682 15885 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A746 protein_id gnl|my_center|LOCUS_26300 16882 16682 gene locus_tag LOCUS_26310 gene thiS 16882 16682 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_26310 16993 17439 gene locus_tag LOCUS_26320 gene aroQ 16993 17439 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 protein_id gnl|my_center|LOCUS_26320 17448 17927 gene locus_tag LOCUS_26330 gene accB 17448 17927 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971548.1 protein_id gnl|my_center|LOCUS_26330 17950 19302 gene locus_tag LOCUS_26340 17950 19302 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 protein_id gnl|my_center|LOCUS_26340 19302 19964 gene locus_tag LOCUS_26350 gene aat 19302 19964 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A741 protein_id gnl|my_center|LOCUS_26350 20899 19913 gene locus_tag LOCUS_26360 20899 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 21427 20909 gene locus_tag LOCUS_26370 21427 20909 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921521.1 protein_id gnl|my_center|LOCUS_26370 21821 21420 gene locus_tag LOCUS_26380 21821 21420 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640357.1 protein_id gnl|my_center|LOCUS_26380 22031 24499 gene locus_tag LOCUS_26390 22031 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 24573 25079 gene locus_tag LOCUS_26400 24573 25079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919756.1 protein_id gnl|my_center|LOCUS_26400 25173 26012 gene locus_tag LOCUS_26410 25173 26012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 27946 26129 gene locus_tag LOCUS_26420 gene aspS 27946 26129 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A734 protein_id gnl|my_center|LOCUS_26420 28091 29329 gene locus_tag LOCUS_26430 gene rnd 28091 29329 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAA2 protein_id gnl|my_center|LOCUS_26430 29414 29848 gene locus_tag LOCUS_26440 29414 29848 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152297.1 protein_id gnl|my_center|LOCUS_26440 30152 30508 gene locus_tag LOCUS_26450 30152 30508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 30746 30474 gene locus_tag LOCUS_26460 30746 30474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 31436 30780 gene locus_tag LOCUS_26470 31436 30780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 31820 32047 gene locus_tag LOCUS_26480 31820 32047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 32333 32614 gene locus_tag LOCUS_26490 32333 32614 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 protein_id gnl|my_center|LOCUS_26490 33055 33252 gene locus_tag LOCUS_26500 33055 33252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 35930 33741 gene locus_tag LOCUS_26510 gene uvrB 35930 33741 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A462 protein_id gnl|my_center|LOCUS_26510 36500 36111 gene locus_tag LOCUS_26520 36500 36111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 37217 36774 gene locus_tag LOCUS_26530 37217 36774 CDS product putative REP-associated tyrosine transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43965 protein_id gnl|my_center|LOCUS_26530 >Feature sequence31 3493 866 gene locus_tag LOCUS_26540 gene pepN 3493 866 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37893 protein_id gnl|my_center|LOCUS_26540 4212 3649 gene locus_tag LOCUS_26550 4212 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640507.1 protein_id gnl|my_center|LOCUS_26550 4771 4298 gene locus_tag LOCUS_26560 4771 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 4966 6195 gene locus_tag LOCUS_26570 4966 6195 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_26570 6192 7211 gene locus_tag LOCUS_26580 6192 7211 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919480.1 protein_id gnl|my_center|LOCUS_26580 7193 8674 gene locus_tag LOCUS_26590 gene astD 7193 8674 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LN5 protein_id gnl|my_center|LOCUS_26590 8671 10026 gene locus_tag LOCUS_26600 gene astB 8671 10026 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMV4 protein_id gnl|my_center|LOCUS_26600 10142 10687 gene locus_tag LOCUS_26610 10142 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 10764 12242 gene locus_tag LOCUS_26620 gene glpK1 10764 12242 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_26620 12397 13248 gene locus_tag LOCUS_26630 12397 13248 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_26630 13385 13461 gene locus_tag LOCUS_t00280 13385 13461 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 13598 14554 gene locus_tag LOCUS_26640 13598 14554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 14551 14970 gene locus_tag LOCUS_26650 14551 14970 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 protein_id gnl|my_center|LOCUS_26650 14967 15515 gene locus_tag LOCUS_26660 14967 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 15517 17754 gene locus_tag LOCUS_26670 15517 17754 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707152.1 protein_id gnl|my_center|LOCUS_26670 17735 18967 gene locus_tag LOCUS_26680 17735 18967 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 protein_id gnl|my_center|LOCUS_26680 18985 19608 gene locus_tag LOCUS_26690 18985 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 19605 20765 gene locus_tag LOCUS_26700 19605 20765 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074034.1 protein_id gnl|my_center|LOCUS_26700 20768 21226 gene locus_tag LOCUS_26710 20768 21226 CDS product 3-hydroxylacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105317.1 protein_id gnl|my_center|LOCUS_26710 21223 21960 gene locus_tag LOCUS_26720 gene fabG 21223 21960 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460603.1 protein_id gnl|my_center|LOCUS_26720 21960 23183 gene locus_tag LOCUS_26730 gene fabF 21960 23183 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815698.1 protein_id gnl|my_center|LOCUS_26730 23194 24075 gene locus_tag LOCUS_26740 23194 24075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 24552 24139 gene locus_tag LOCUS_26750 24552 24139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 25269 24703 gene locus_tag LOCUS_26760 25269 24703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 25418 26161 gene locus_tag LOCUS_26770 25418 26161 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105311.1 protein_id gnl|my_center|LOCUS_26770 26428 26156 gene locus_tag LOCUS_26780 26428 26156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 26423 26782 gene locus_tag LOCUS_26790 26423 26782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 26819 27460 gene locus_tag LOCUS_26800 26819 27460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 27448 28326 gene locus_tag LOCUS_26810 27448 28326 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162825.1 protein_id gnl|my_center|LOCUS_26810 28302 28571 gene locus_tag LOCUS_26820 28302 28571 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222118.1 protein_id gnl|my_center|LOCUS_26820 28568 28810 gene locus_tag LOCUS_26830 gene acpP 28568 28810 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NE89 protein_id gnl|my_center|LOCUS_26830 28835 29425 gene locus_tag LOCUS_26840 28835 29425 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074024.1 protein_id gnl|my_center|LOCUS_26840 29422 31077 gene locus_tag LOCUS_26850 29422 31077 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105310.1 protein_id gnl|my_center|LOCUS_26850 31372 32406 gene locus_tag LOCUS_26860 31372 32406 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_26860 32839 32414 gene locus_tag LOCUS_26870 32839 32414 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence32 2259 2453 gene locus_tag LOCUS_26880 2259 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2463 2825 gene locus_tag LOCUS_26890 2463 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_26890 2954 3574 gene locus_tag LOCUS_26900 2954 3574 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084981.1 protein_id gnl|my_center|LOCUS_26900 3790 6504 gene locus_tag LOCUS_26910 gene cheA 3790 6504 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084982.1 protein_id gnl|my_center|LOCUS_26910 6501 6953 gene locus_tag LOCUS_26920 gene cheW 6501 6953 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083224.1 protein_id gnl|my_center|LOCUS_26920 6970 7335 gene locus_tag LOCUS_26930 6970 7335 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921300.1 protein_id gnl|my_center|LOCUS_26930 7370 8476 gene locus_tag LOCUS_26940 gene cheBII 7370 8476 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C477 protein_id gnl|my_center|LOCUS_26940 8473 9309 gene locus_tag LOCUS_26950 8473 9309 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_26950 9540 10100 gene locus_tag LOCUS_26960 gene atpH 9540 10100 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV21 protein_id gnl|my_center|LOCUS_26960 10105 11637 gene locus_tag LOCUS_26970 gene atpA 10105 11637 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S3 protein_id gnl|my_center|LOCUS_26970 11667 12548 gene locus_tag LOCUS_26980 gene atpG 11667 12548 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S2 protein_id gnl|my_center|LOCUS_26980 12572 13999 gene locus_tag LOCUS_26990 gene atpD 12572 13999 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL33 protein_id gnl|my_center|LOCUS_26990 14022 14423 gene locus_tag LOCUS_27000 14022 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 14603 15136 gene locus_tag LOCUS_27010 14603 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 15952 15125 gene locus_tag LOCUS_27020 15952 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 16494 15994 gene locus_tag LOCUS_27030 gene rppH 16494 15994 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV14 protein_id gnl|my_center|LOCUS_27030 17776 16529 gene locus_tag LOCUS_27040 17776 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 19269 17938 gene locus_tag LOCUS_27050 19269 17938 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921264.1 protein_id gnl|my_center|LOCUS_27050 20472 19288 gene locus_tag LOCUS_27060 20472 19288 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_27060 21018 20560 gene locus_tag LOCUS_27070 gene rlmH 21018 20560 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8W4 protein_id gnl|my_center|LOCUS_27070 21475 21056 gene locus_tag LOCUS_27080 gene rsfS 21475 21056 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2X4 protein_id gnl|my_center|LOCUS_27080 22169 21561 gene locus_tag LOCUS_27090 gene nadD 22169 21561 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBV3 protein_id gnl|my_center|LOCUS_27090 23452 22181 gene locus_tag LOCUS_27100 gene proA 23452 22181 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV06 protein_id gnl|my_center|LOCUS_27100 24646 23471 gene locus_tag LOCUS_27110 gene proB 24646 23471 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYI6 protein_id gnl|my_center|LOCUS_27110 25707 24643 gene locus_tag LOCUS_27120 gene obg 25707 24643 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CB41 protein_id gnl|my_center|LOCUS_27120 26342 25740 gene locus_tag LOCUS_27130 26342 25740 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918206.1 protein_id gnl|my_center|LOCUS_27130 26747 26472 gene locus_tag LOCUS_27140 gene rpmA 26747 26472 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBR6 protein_id gnl|my_center|LOCUS_27140 27437 26814 gene locus_tag LOCUS_27150 27437 26814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 28688 27747 gene locus_tag LOCUS_27160 28688 27747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 28964 29053 gene locus_tag LOCUS_t00290 28964 29053 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <33415 29141 gene locus_tag LOCUS_27170 <33415 29141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064383.1:type I secretion C-terminal target domain-containing protein >Feature sequence33 1739 747 gene locus_tag LOCUS_27180 1739 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1966 2544 gene locus_tag LOCUS_27190 1966 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3744 2554 gene locus_tag LOCUS_27200 3744 2554 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730164.1 protein_id gnl|my_center|LOCUS_27200 5110 3731 gene locus_tag LOCUS_27210 5110 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 7555 5369 gene locus_tag LOCUS_27220 gene fyuA 7555 5369 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_27220 9200 7797 gene locus_tag LOCUS_27230 9200 7797 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_27230 9988 9224 gene locus_tag LOCUS_27240 gene fadB 9988 9224 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_27240 11271 10024 gene locus_tag LOCUS_27250 gene bioI 11271 10024 CDS product biotin biosynthesis cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53554 protein_id gnl|my_center|LOCUS_27250 12407 11304 gene locus_tag LOCUS_27260 12407 11304 CDS product aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 protein_id gnl|my_center|LOCUS_27260 13998 12475 gene locus_tag LOCUS_27270 13998 12475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 14578 14159 gene locus_tag LOCUS_27280 14578 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 15650 14589 gene locus_tag LOCUS_27290 15650 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 15987 16199 gene locus_tag LOCUS_27300 15987 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 16469 17089 gene locus_tag LOCUS_27310 16469 17089 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804753.1 protein_id gnl|my_center|LOCUS_27310 17424 17236 gene locus_tag LOCUS_27320 17424 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 21140 17901 gene locus_tag LOCUS_27330 gene dnaE2 21140 17901 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3J3 protein_id gnl|my_center|LOCUS_27330 22570 21137 gene locus_tag LOCUS_27340 gene imuB 22570 21137 CDS product protein ImuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H428 protein_id gnl|my_center|LOCUS_27340 23288 22611 gene locus_tag LOCUS_27350 23288 22611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 23833 23681 gene locus_tag LOCUS_27360 23833 23681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27360 24207 23833 gene locus_tag LOCUS_27370 24207 23833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27370 24718 24224 gene locus_tag LOCUS_27380 24718 24224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 24898 25077 gene locus_tag LOCUS_27390 24898 25077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 26622 25228 gene locus_tag LOCUS_27400 26622 25228 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_27400 26867 26700 gene locus_tag LOCUS_27410 26867 26700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 27088 29406 gene locus_tag LOCUS_27420 27088 29406 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 protein_id gnl|my_center|LOCUS_27420 29581 30846 gene locus_tag LOCUS_27430 29581 30846 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_27430 31142 30852 gene locus_tag LOCUS_27440 31142 30852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 31368 31934 gene locus_tag LOCUS_27450 31368 31934 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHF0 protein_id gnl|my_center|LOCUS_27450 31996 32442 gene locus_tag LOCUS_27460 31996 32442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 <33321 32453 gene locus_tag LOCUS_27470 <33321 32453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV55:3-isopropylmalate dehydratase large subunit >Feature sequence34 588 1169 gene locus_tag LOCUS_27480 588 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1353 2216 gene locus_tag LOCUS_27490 1353 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118825.1 protein_id gnl|my_center|LOCUS_27490 2295 2594 gene locus_tag LOCUS_27500 2295 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3959 2670 gene locus_tag LOCUS_27510 3959 2670 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719586.1 protein_id gnl|my_center|LOCUS_27510 4121 4534 gene locus_tag LOCUS_27520 4121 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969851.1 protein_id gnl|my_center|LOCUS_27520 4646 5470 gene locus_tag LOCUS_27530 4646 5470 CDS product 2,5-didehydrogluconate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921257.1 protein_id gnl|my_center|LOCUS_27530 5719 5564 gene locus_tag LOCUS_27540 5719 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 5838 7505 gene locus_tag LOCUS_27550 5838 7505 CDS product oxacillin resistance-associated protein fmtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640395.1 protein_id gnl|my_center|LOCUS_27550 8464 7532 gene locus_tag LOCUS_27560 gene prs 8464 7532 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDA9 protein_id gnl|my_center|LOCUS_27560 9488 8694 gene locus_tag LOCUS_27570 9488 8694 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J663 protein_id gnl|my_center|LOCUS_27570 10596 9544 gene locus_tag LOCUS_27580 10596 9544 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918379.1 protein_id gnl|my_center|LOCUS_27580 11536 10607 gene locus_tag LOCUS_27590 gene lgt 11536 10607 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBQ4 protein_id gnl|my_center|LOCUS_27590 11674 11922 gene locus_tag LOCUS_27600 11674 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 12071 12574 gene locus_tag LOCUS_27610 12071 12574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_27610 12618 13409 gene locus_tag LOCUS_27620 gene proC 12618 13409 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9V6 protein_id gnl|my_center|LOCUS_27620 13460 14233 gene locus_tag LOCUS_27630 13460 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 15582 14236 gene locus_tag LOCUS_27640 15582 14236 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920769.1 protein_id gnl|my_center|LOCUS_27640 16319 15645 gene locus_tag LOCUS_27650 16319 15645 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920768.1 protein_id gnl|my_center|LOCUS_27650 16726 16316 gene locus_tag LOCUS_27660 16726 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 17110 16913 gene locus_tag LOCUS_27670 17110 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 17024 17845 gene locus_tag LOCUS_27680 17024 17845 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_27680 18071 19054 gene locus_tag LOCUS_27690 18071 19054 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_27690 19089 19850 gene locus_tag LOCUS_27700 19089 19850 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383369.1 protein_id gnl|my_center|LOCUS_27700 19847 20254 gene locus_tag LOCUS_27710 19847 20254 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB18 protein_id gnl|my_center|LOCUS_27710 20791 20282 gene locus_tag LOCUS_27720 gene sixA 20791 20282 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222279.1 protein_id gnl|my_center|LOCUS_27720 21182 23236 gene locus_tag LOCUS_27730 21182 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 23310 24914 gene locus_tag LOCUS_27740 23310 24914 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 protein_id gnl|my_center|LOCUS_27740 24977 25810 gene locus_tag LOCUS_27750 24977 25810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 27000 25807 gene locus_tag LOCUS_27760 27000 25807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 29027 27087 gene locus_tag LOCUS_27770 gene mccA 29027 27087 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973075.1 protein_id gnl|my_center|LOCUS_27770 30917 29322 gene locus_tag LOCUS_27780 30917 29322 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532608.1 protein_id gnl|my_center|LOCUS_27780 31089 32252 gene locus_tag LOCUS_27790 31089 32252 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence35 1527 298 gene locus_tag LOCUS_27800 1527 298 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921028.1 protein_id gnl|my_center|LOCUS_27800 2065 4287 gene locus_tag LOCUS_27810 gene fyuA 2065 4287 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_27810 5520 4360 gene locus_tag LOCUS_27820 5520 4360 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921028.1 protein_id gnl|my_center|LOCUS_27820 5809 6261 gene locus_tag LOCUS_27830 5809 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 6488 8302 gene locus_tag LOCUS_27840 6488 8302 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 protein_id gnl|my_center|LOCUS_27840 8328 9989 gene locus_tag LOCUS_27850 8328 9989 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_27850 9986 10417 gene locus_tag LOCUS_27860 9986 10417 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_27860 10417 11613 gene locus_tag LOCUS_27870 10417 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936116.1 protein_id gnl|my_center|LOCUS_27870 11616 12719 gene locus_tag LOCUS_27880 11616 12719 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198292.1 protein_id gnl|my_center|LOCUS_27880 12795 13967 gene locus_tag LOCUS_27890 12795 13967 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_27890 14424 15314 gene locus_tag LOCUS_27900 gene phhA 14424 15314 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7V7 protein_id gnl|my_center|LOCUS_27900 16711 15371 gene locus_tag LOCUS_27910 16711 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 18297 17143 gene locus_tag LOCUS_27920 18297 17143 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_27920 18664 18344 gene locus_tag LOCUS_27930 18664 18344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_27930 19118 18666 gene locus_tag LOCUS_27940 19118 18666 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923340.1 protein_id gnl|my_center|LOCUS_27940 19237 19082 gene locus_tag LOCUS_27950 19237 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 19349 20176 gene locus_tag LOCUS_27960 19349 20176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974348.1 protein_id gnl|my_center|LOCUS_27960 20949 20179 gene locus_tag LOCUS_27970 20949 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 21405 20995 gene locus_tag LOCUS_27980 21405 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 21752 22144 gene locus_tag LOCUS_27990 21752 22144 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_27990 22200 22982 gene locus_tag LOCUS_28000 22200 22982 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJM7 protein_id gnl|my_center|LOCUS_28000 23186 23602 gene locus_tag LOCUS_28010 23186 23602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 24871 24035 gene locus_tag LOCUS_28020 24871 24035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 25797 24952 gene locus_tag LOCUS_28030 25797 24952 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_28030 26024 26761 gene locus_tag LOCUS_28040 26024 26761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_28040 26767 27870 gene locus_tag LOCUS_28050 26767 27870 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_28050 28811 27882 gene locus_tag LOCUS_28060 28811 27882 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_28060 29340 28867 gene locus_tag LOCUS_28070 29340 28867 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_28070 30413 29433 gene locus_tag LOCUS_28080 30413 29433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 31480 30458 gene locus_tag LOCUS_28090 gene ubiA 31480 30458 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DB8 protein_id gnl|my_center|LOCUS_28090 >Feature sequence36 607 1206 gene locus_tag LOCUS_28100 607 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2773 1277 gene locus_tag LOCUS_28110 2773 1277 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_28110 3873 2839 gene locus_tag LOCUS_28120 3873 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 4879 3890 gene locus_tag LOCUS_28130 gene exoW 4879 3890 CDS product succinoglycan biosynthesis protein exow inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973534.1 protein_id gnl|my_center|LOCUS_28130 6022 5039 gene locus_tag LOCUS_28140 6022 5039 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_28140 6465 6022 gene locus_tag LOCUS_28150 6465 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964366.1 protein_id gnl|my_center|LOCUS_28150 7660 6515 gene locus_tag LOCUS_28160 gene darB 7660 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_28160 8613 7660 gene locus_tag LOCUS_28170 gene darA 8613 7660 CDS product dialkylrecorsinol condensing protein DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_28170 9004 8714 gene locus_tag LOCUS_28180 9004 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 9078 9536 gene locus_tag LOCUS_28190 9078 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 10451 9543 gene locus_tag LOCUS_28200 10451 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 11007 10636 gene locus_tag LOCUS_28210 11007 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919329.1 protein_id gnl|my_center|LOCUS_28210 11879 11034 gene locus_tag LOCUS_28220 11879 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 14302 12092 gene locus_tag LOCUS_28230 14302 12092 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_28230 15523 14318 gene locus_tag LOCUS_28240 15523 14318 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_28240 17412 15631 gene locus_tag LOCUS_28250 17412 15631 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917969.1 protein_id gnl|my_center|LOCUS_28250 18041 17526 gene locus_tag LOCUS_28260 18041 17526 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 protein_id gnl|my_center|LOCUS_28260 18292 22548 gene locus_tag LOCUS_28270 18292 22548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 22707 23618 gene locus_tag LOCUS_28280 22707 23618 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_28280 23615 24400 gene locus_tag LOCUS_28290 23615 24400 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719363.1 protein_id gnl|my_center|LOCUS_28290 24474 25787 gene locus_tag LOCUS_28300 24474 25787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_28300 25976 26641 gene locus_tag LOCUS_28310 25976 26641 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 protein_id gnl|my_center|LOCUS_28310 27470 26709 gene locus_tag LOCUS_28320 27470 26709 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083968.1 protein_id gnl|my_center|LOCUS_28320 27720 28619 gene locus_tag LOCUS_28330 27720 28619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 protein_id gnl|my_center|LOCUS_28330 30064 28766 gene locus_tag LOCUS_28340 gene serS 30064 28766 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L00 protein_id gnl|my_center|LOCUS_28340 >Feature sequence37 774 220 gene locus_tag LOCUS_28350 774 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1967 933 gene locus_tag LOCUS_28360 1967 933 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_28360 5162 2058 gene locus_tag LOCUS_28370 5162 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 5668 5159 gene locus_tag LOCUS_28380 5668 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 5983 7065 gene locus_tag LOCUS_28390 5983 7065 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918900.1 protein_id gnl|my_center|LOCUS_28390 9300 7066 gene locus_tag LOCUS_28400 9300 7066 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532683.1 protein_id gnl|my_center|LOCUS_28400 10332 9496 gene locus_tag LOCUS_28410 gene rfbD 10332 9496 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 protein_id gnl|my_center|LOCUS_28410 11317 10412 gene locus_tag LOCUS_28420 gene rfbA 11317 10412 CDS product glucose-1-phosphate thymidylyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37779 protein_id gnl|my_center|LOCUS_28420 12497 11577 gene locus_tag LOCUS_28430 12497 11577 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_28430 13242 12661 gene locus_tag LOCUS_28440 13242 12661 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921460.1 protein_id gnl|my_center|LOCUS_28440 14246 13215 gene locus_tag LOCUS_28450 14246 13215 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2D6 protein_id gnl|my_center|LOCUS_28450 15355 14384 gene locus_tag LOCUS_28460 gene galE/exoB 15355 14384 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973608.1 protein_id gnl|my_center|LOCUS_28460 16650 15454 gene locus_tag LOCUS_28470 gene exoL 16650 15454 CDS product succinoglycan biosynthesis protein ExoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887907.1 protein_id gnl|my_center|LOCUS_28470 17054 18499 gene locus_tag LOCUS_28480 17054 18499 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_28480 19120 21135 gene locus_tag LOCUS_28490 gene mcpA 19120 21135 CDS product chemoreceptor McpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00986 protein_id gnl|my_center|LOCUS_28490 21139 21405 gene locus_tag LOCUS_28500 21139 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 21402 21767 gene locus_tag LOCUS_28510 gene cheYI 21402 21767 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918320.1 protein_id gnl|my_center|LOCUS_28510 21783 24017 gene locus_tag LOCUS_28520 21783 24017 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974445.1 protein_id gnl|my_center|LOCUS_28520 24022 24477 gene locus_tag LOCUS_28530 gene cheW 24022 24477 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87715 protein_id gnl|my_center|LOCUS_28530 24474 25343 gene locus_tag LOCUS_28540 24474 25343 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6W0 protein_id gnl|my_center|LOCUS_28540 25340 26371 gene locus_tag LOCUS_28550 gene cheB 25340 26371 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85128 protein_id gnl|my_center|LOCUS_28550 26371 26760 gene locus_tag LOCUS_28560 26371 26760 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918325.1 protein_id gnl|my_center|LOCUS_28560 26757 27311 gene locus_tag LOCUS_28570 gene cheD 26757 27311 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG06 protein_id gnl|my_center|LOCUS_28570 27289 27648 gene locus_tag LOCUS_28580 27289 27648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 29018 27747 gene locus_tag LOCUS_28590 29018 27747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 29264 30250 gene locus_tag LOCUS_28600 gene bioB 29264 30250 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFL1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence38 569 249 gene locus_tag LOCUS_28610 569 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 1472 699 gene locus_tag LOCUS_28620 gene phyR 1472 699 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_28620 1644 1844 gene locus_tag LOCUS_28630 1644 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 1851 2459 gene locus_tag LOCUS_28640 gene sigT 1851 2459 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_28640 2462 4156 gene locus_tag LOCUS_28650 gene phyK 2462 4156 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923290.1 protein_id gnl|my_center|LOCUS_28650 4475 4251 gene locus_tag LOCUS_28660 4475 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 5312 4542 gene locus_tag LOCUS_28670 5312 4542 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921385.1 protein_id gnl|my_center|LOCUS_28670 6286 5309 gene locus_tag LOCUS_28680 6286 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 6325 6498 gene locus_tag LOCUS_28690 6325 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 8263 6632 gene locus_tag LOCUS_28700 8263 6632 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_28700 9578 8397 gene locus_tag LOCUS_28710 9578 8397 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_28710 9690 10049 gene locus_tag LOCUS_28720 9690 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338625.1 protein_id gnl|my_center|LOCUS_28720 10049 11137 gene locus_tag LOCUS_28730 10049 11137 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAR8 protein_id gnl|my_center|LOCUS_28730 11250 12188 gene locus_tag LOCUS_28740 11250 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 13574 12207 gene locus_tag LOCUS_28750 13574 12207 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927872.1 protein_id gnl|my_center|LOCUS_28750 14182 13571 gene locus_tag LOCUS_28760 gene leuD 14182 13571 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBR0 protein_id gnl|my_center|LOCUS_28760 15594 14179 gene locus_tag LOCUS_28770 gene leuC1 15594 14179 CDS product 3-isopropylmalate dehydratase large subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X98 protein_id gnl|my_center|LOCUS_28770 15793 16749 gene locus_tag LOCUS_28780 gene hmgCl 15793 16749 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_28780 16746 17432 gene locus_tag LOCUS_28790 16746 17432 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537831.1 protein_id gnl|my_center|LOCUS_28790 17432 18367 gene locus_tag LOCUS_28800 17432 18367 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537829.1 protein_id gnl|my_center|LOCUS_28800 18364 19272 gene locus_tag LOCUS_28810 18364 19272 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384693.1 protein_id gnl|my_center|LOCUS_28810 19433 20632 gene locus_tag LOCUS_28820 19433 20632 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_28820 20690 22114 gene locus_tag LOCUS_28830 20690 22114 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_28830 22111 23154 gene locus_tag LOCUS_28840 22111 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 23151 23429 gene locus_tag LOCUS_28850 23151 23429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 24250 23426 gene locus_tag LOCUS_28860 24250 23426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 25551 24247 gene locus_tag LOCUS_28870 25551 24247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 25724 27100 gene locus_tag LOCUS_28880 25724 27100 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 protein_id gnl|my_center|LOCUS_28880 27931 27200 gene locus_tag LOCUS_28890 gene com1 27931 27200 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958530.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence39 1383 1294 gene locus_tag LOCUS_t00300 1383 1294 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2001 2927 gene locus_tag LOCUS_28900 2001 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919691.1 protein_id gnl|my_center|LOCUS_28900 3096 4178 gene locus_tag LOCUS_28910 3096 4178 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_28910 4183 4815 gene locus_tag LOCUS_28920 gene tmk 4183 4815 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ9 protein_id gnl|my_center|LOCUS_28920 4812 5780 gene locus_tag LOCUS_28930 4812 5780 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919689.1 protein_id gnl|my_center|LOCUS_28930 5790 6572 gene locus_tag LOCUS_28940 5790 6572 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919688.1 protein_id gnl|my_center|LOCUS_28940 6569 7378 gene locus_tag LOCUS_28950 6569 7378 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919687.1 protein_id gnl|my_center|LOCUS_28950 7574 7498 gene locus_tag LOCUS_t00310 7574 7498 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7901 7596 gene locus_tag LOCUS_28960 7901 7596 CDS product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_28960 8688 7966 gene locus_tag LOCUS_28970 8688 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 8797 8721 gene locus_tag LOCUS_t00320 8797 8721 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9369 8878 gene locus_tag LOCUS_28980 9369 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 9935 9432 gene locus_tag LOCUS_28990 gene cspA 9935 9432 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971879.1 protein_id gnl|my_center|LOCUS_28990 10232 10158 gene locus_tag LOCUS_t00330 10232 10158 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12095 10299 gene locus_tag LOCUS_29000 gene recJ 12095 10299 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919262.1 protein_id gnl|my_center|LOCUS_29000 13052 12096 gene locus_tag LOCUS_29010 13052 12096 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H0 protein_id gnl|my_center|LOCUS_29010 14392 13109 gene locus_tag LOCUS_29020 14392 13109 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720567.1 protein_id gnl|my_center|LOCUS_29020 15630 14416 gene locus_tag LOCUS_29030 15630 14416 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H2 protein_id gnl|my_center|LOCUS_29030 16143 15718 gene locus_tag LOCUS_29040 16143 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 16301 17941 gene locus_tag LOCUS_29050 gene phbC 16301 17941 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971735.1 protein_id gnl|my_center|LOCUS_29050 18926 17949 gene locus_tag LOCUS_29060 gene argC 18926 17949 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 protein_id gnl|my_center|LOCUS_29060 19507 19019 gene locus_tag LOCUS_29070 gene rpsI 19507 19019 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H6 protein_id gnl|my_center|LOCUS_29070 19977 19510 gene locus_tag LOCUS_29080 gene rplM 19977 19510 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA33 protein_id gnl|my_center|LOCUS_29080 20018 21025 gene locus_tag LOCUS_29090 20018 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 21889 21026 gene locus_tag LOCUS_29100 gene ctaA 21889 21026 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KD9 protein_id gnl|my_center|LOCUS_29100 22169 22381 gene locus_tag LOCUS_29110 22169 22381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 22723 23085 gene locus_tag LOCUS_29120 22723 23085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 25036 23189 gene locus_tag LOCUS_29130 25036 23189 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919191.1 protein_id gnl|my_center|LOCUS_29130 25146 25706 gene locus_tag LOCUS_29140 25146 25706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 25842 26570 gene locus_tag LOCUS_29150 25842 26570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence40 438 965 gene locus_tag LOCUS_29160 438 965 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_29160 1078 3345 gene locus_tag LOCUS_29170 gene pleC 1078 3345 CDS product non-motile and phage-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37894 protein_id gnl|my_center|LOCUS_29170 4027 3362 gene locus_tag LOCUS_29180 4027 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 4464 3997 gene locus_tag LOCUS_29190 4464 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 5075 4476 gene locus_tag LOCUS_29200 5075 4476 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAU3 protein_id gnl|my_center|LOCUS_29200 5664 5188 gene locus_tag LOCUS_29210 5664 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 8542 5717 gene locus_tag LOCUS_29220 gene glnE 8542 5717 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBN1 protein_id gnl|my_center|LOCUS_29220 9978 8587 gene locus_tag LOCUS_29230 9978 8587 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920596.1 protein_id gnl|my_center|LOCUS_29230 10734 10063 gene locus_tag LOCUS_29240 10734 10063 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532631.1 protein_id gnl|my_center|LOCUS_29240 12320 10770 gene locus_tag LOCUS_29250 gene degP1 12320 10770 CDS product putative periplasmic serine endoprotease DegP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52894 protein_id gnl|my_center|LOCUS_29250 13595 12405 gene locus_tag LOCUS_29260 13595 12405 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887546.1 protein_id gnl|my_center|LOCUS_29260 14101 13679 gene locus_tag LOCUS_29270 14101 13679 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387794.1 protein_id gnl|my_center|LOCUS_29270 16047 14098 gene locus_tag LOCUS_29280 16047 14098 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920601.1 protein_id gnl|my_center|LOCUS_29280 16514 16044 gene locus_tag LOCUS_29290 gene ccmE 16514 16044 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45401 protein_id gnl|my_center|LOCUS_29290 17273 16593 gene locus_tag LOCUS_29300 17273 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 18648 17305 gene locus_tag LOCUS_29310 18648 17305 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_29310 19405 18725 gene locus_tag LOCUS_29320 gene feuP 19405 18725 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527364.1 protein_id gnl|my_center|LOCUS_29320 19930 19547 gene locus_tag LOCUS_29330 19930 19547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 20293 19934 gene locus_tag LOCUS_29340 20293 19934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 21313 20396 gene locus_tag LOCUS_29350 21313 20396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 25171 21464 gene locus_tag LOCUS_29360 25171 21464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence41 1463 345 gene locus_tag LOCUS_29370 1463 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1468 2004 gene locus_tag LOCUS_29380 1468 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2592 2005 gene locus_tag LOCUS_29390 2592 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 4667 2733 gene locus_tag LOCUS_29400 4667 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 5695 5315 gene locus_tag LOCUS_29410 5695 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 6083 5697 gene locus_tag LOCUS_29420 6083 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 6195 6067 gene locus_tag LOCUS_29430 6195 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 6667 6182 gene locus_tag LOCUS_29440 6667 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 7239 6667 gene locus_tag LOCUS_29450 7239 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 7760 7530 gene locus_tag LOCUS_29460 7760 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 8128 7784 gene locus_tag LOCUS_29470 8128 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 11475 8674 gene locus_tag LOCUS_29480 11475 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 11692 11480 gene locus_tag LOCUS_29490 11692 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 12081 11692 gene locus_tag LOCUS_29500 12081 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 12734 12659 gene locus_tag LOCUS_t00340 12734 12659 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13132 13491 gene locus_tag LOCUS_29510 gene panD 13132 13491 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYS2 protein_id gnl|my_center|LOCUS_29510 13941 15008 gene locus_tag LOCUS_29520 13941 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 15760 15101 gene locus_tag LOCUS_29530 15760 15101 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_29530 16008 16083 gene locus_tag LOCUS_t00350 16008 16083 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16299 16856 gene locus_tag LOCUS_29540 16299 16856 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918976.1 protein_id gnl|my_center|LOCUS_29540 18282 16867 gene locus_tag LOCUS_29550 gene dagA 18282 16867 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891501.1 protein_id gnl|my_center|LOCUS_29550 18772 21357 gene locus_tag LOCUS_29560 18772 21357 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918977.1 protein_id gnl|my_center|LOCUS_29560 21423 22409 gene locus_tag LOCUS_29570 21423 22409 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 protein_id gnl|my_center|LOCUS_29570 22441 23607 gene locus_tag LOCUS_29580 22441 23607 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918955.1 protein_id gnl|my_center|LOCUS_29580 23756 25039 gene locus_tag LOCUS_29590 gene amaB 23756 25039 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124142.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence42 1261 2643 gene locus_tag LOCUS_29600 1261 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 2741 3871 gene locus_tag LOCUS_29610 2741 3871 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918237.1 protein_id gnl|my_center|LOCUS_29610 4063 6687 gene locus_tag LOCUS_29620 gene clpB 4063 6687 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9T4 protein_id gnl|my_center|LOCUS_29620 6915 6733 gene locus_tag LOCUS_29630 6915 6733 CDS product DUF1508 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358874.1 protein_id gnl|my_center|LOCUS_29630 8153 7677 gene locus_tag LOCUS_29640 8153 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 12070 8270 gene locus_tag LOCUS_29650 12070 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 12061 13959 gene locus_tag LOCUS_29660 gene cyaK 12061 13959 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976264.1 protein_id gnl|my_center|LOCUS_29660 14119 15891 gene locus_tag LOCUS_29670 14119 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920273.1 protein_id gnl|my_center|LOCUS_29670 15905 17308 gene locus_tag LOCUS_29680 15905 17308 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_29680 17409 18470 gene locus_tag LOCUS_29690 17409 18470 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968509.1 protein_id gnl|my_center|LOCUS_29690 18814 18482 gene locus_tag LOCUS_29700 18814 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 19759 18908 gene locus_tag LOCUS_29710 gene uppP 19759 18908 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SL0 protein_id gnl|my_center|LOCUS_29710 20107 21543 gene locus_tag LOCUS_29720 gene gltD 20107 21543 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence43 2 1678 gene locus_tag LOCUS_29730 2 1678 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_29730 1792 2094 gene locus_tag LOCUS_29740 1792 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 3080 2187 gene locus_tag LOCUS_29750 3080 2187 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_29750 4369 3167 gene locus_tag LOCUS_29760 gene pgk 4369 3167 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4J9 protein_id gnl|my_center|LOCUS_29760 5009 4380 gene locus_tag LOCUS_29770 gene ychE 5009 4380 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_29770 6052 5045 gene locus_tag LOCUS_29780 6052 5045 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIJ0 protein_id gnl|my_center|LOCUS_29780 8112 6136 gene locus_tag LOCUS_29790 8112 6136 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MII9 protein_id gnl|my_center|LOCUS_29790 8233 8523 gene locus_tag LOCUS_29800 8233 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 8562 8891 gene locus_tag LOCUS_29810 8562 8891 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3F7 protein_id gnl|my_center|LOCUS_29810 10579 8915 gene locus_tag LOCUS_29820 10579 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 11968 10673 gene locus_tag LOCUS_29830 11968 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 12135 14864 gene locus_tag LOCUS_29840 gene flaEY 12135 14864 CDS product regulatory protein FlaEY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15345 protein_id gnl|my_center|LOCUS_29840 17459 14994 gene locus_tag LOCUS_29850 gene divL 17459 14994 CDS product sensor protein DivL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQQ9 protein_id gnl|my_center|LOCUS_29850 18097 17585 gene locus_tag LOCUS_29860 18097 17585 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269031.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence44 <1 569 gene locus_tag LOCUS_29870 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CAS2:ribonuclease R 583 1299 gene locus_tag LOCUS_29880 583 1299 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 protein_id gnl|my_center|LOCUS_29880 1759 1277 gene locus_tag LOCUS_29890 1759 1277 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528863.1 protein_id gnl|my_center|LOCUS_29890 2178 1756 gene locus_tag LOCUS_29900 2178 1756 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947687.1 protein_id gnl|my_center|LOCUS_29900 4011 2413 gene locus_tag LOCUS_29910 gene pckA 4011 2413 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBF9 protein_id gnl|my_center|LOCUS_29910 4337 4504 gene locus_tag LOCUS_29920 gene rpmG 4337 4504 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I8 protein_id gnl|my_center|LOCUS_29920 5975 4599 gene locus_tag LOCUS_29930 gene pleD 5975 4599 CDS product response regulator PleD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZM2 protein_id gnl|my_center|LOCUS_29930 6367 5972 gene locus_tag LOCUS_29940 6367 5972 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920321.1 protein_id gnl|my_center|LOCUS_29940 6615 7799 gene locus_tag LOCUS_29950 gene dinB1 6615 7799 CDS product DNA polymerase IV 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFV3 protein_id gnl|my_center|LOCUS_29950 7845 8306 gene locus_tag LOCUS_29960 7845 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_29960 8360 9529 gene locus_tag LOCUS_29970 8360 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640419.1 protein_id gnl|my_center|LOCUS_29970 9604 10038 gene locus_tag LOCUS_29980 9604 10038 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920328.1 protein_id gnl|my_center|LOCUS_29980 10695 10039 gene locus_tag LOCUS_29990 10695 10039 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_29990 11696 10692 gene locus_tag LOCUS_30000 11696 10692 CDS product UPF0176 protein R02887 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LX6 protein_id gnl|my_center|LOCUS_30000 14094 11776 gene locus_tag LOCUS_30010 gene clpA 14094 11776 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920326.1 protein_id gnl|my_center|LOCUS_30010 14433 14104 gene locus_tag LOCUS_30020 gene clpS 14433 14104 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TA15 protein_id gnl|my_center|LOCUS_30020 14822 15787 gene locus_tag LOCUS_30030 14822 15787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 17085 15880 gene locus_tag LOCUS_30040 17085 15880 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 protein_id gnl|my_center|LOCUS_30040 18319 17120 gene locus_tag LOCUS_30050 18319 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence45 1056 1913 gene locus_tag LOCUS_30060 gene pheA 1056 1913 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970653.1 protein_id gnl|my_center|LOCUS_30060 2085 2684 gene locus_tag LOCUS_30070 2085 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 2869 3264 gene locus_tag LOCUS_30080 2869 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_30080 3456 4028 gene locus_tag LOCUS_30090 3456 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 4288 4100 gene locus_tag LOCUS_30100 4288 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30100 5047 4313 gene locus_tag LOCUS_30110 5047 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30110 6267 5296 gene locus_tag LOCUS_30120 6267 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 6430 8385 gene locus_tag LOCUS_30130 6430 8385 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090838.1 protein_id gnl|my_center|LOCUS_30130 8392 8712 gene locus_tag LOCUS_30140 8392 8712 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF9 protein_id gnl|my_center|LOCUS_30140 8729 8962 gene locus_tag LOCUS_30150 8729 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 8965 9564 gene locus_tag LOCUS_30160 gene recR 8965 9564 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 protein_id gnl|my_center|LOCUS_30160 10736 9600 gene locus_tag LOCUS_30170 10736 9600 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975188.1 protein_id gnl|my_center|LOCUS_30170 10887 12482 gene locus_tag LOCUS_30180 10887 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 12520 13041 gene locus_tag LOCUS_30190 gene def 12520 13041 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF5 protein_id gnl|my_center|LOCUS_30190 13086 14030 gene locus_tag LOCUS_30200 gene fmt 13086 14030 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABE9 protein_id gnl|my_center|LOCUS_30200 14027 14824 gene locus_tag LOCUS_30210 gene truA 14027 14824 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP1 protein_id gnl|my_center|LOCUS_30210 15963 14812 gene locus_tag LOCUS_30220 gene dapE 15963 14812 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYE7 protein_id gnl|my_center|LOCUS_30220 16969 16136 gene locus_tag LOCUS_30230 gene dapD 16969 16136 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP4 protein_id gnl|my_center|LOCUS_30230 17724 17014 gene locus_tag LOCUS_30240 17724 17014 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706659.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence46 2103 913 gene locus_tag LOCUS_30250 2103 913 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063811.1 protein_id gnl|my_center|LOCUS_30250 3618 2212 gene locus_tag LOCUS_30260 3618 2212 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 protein_id gnl|my_center|LOCUS_30260 4686 3718 gene locus_tag LOCUS_30270 gene glk 4686 3718 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6N3 protein_id gnl|my_center|LOCUS_30270 6521 4683 gene locus_tag LOCUS_30280 gene edd 6521 4683 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527741.1 protein_id gnl|my_center|LOCUS_30280 8063 6570 gene locus_tag LOCUS_30290 gene zwf 8063 6570 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 protein_id gnl|my_center|LOCUS_30290 9274 8279 gene locus_tag LOCUS_30300 9274 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 9976 9335 gene locus_tag LOCUS_30310 9976 9335 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_30310 10588 10028 gene locus_tag LOCUS_30320 10588 10028 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919424.1 protein_id gnl|my_center|LOCUS_30320 10595 11182 gene locus_tag LOCUS_30330 10595 11182 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919425.1 protein_id gnl|my_center|LOCUS_30330 11265 11615 gene locus_tag LOCUS_30340 gene rpoZ 11265 11615 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58066 protein_id gnl|my_center|LOCUS_30340 11633 13882 gene locus_tag LOCUS_30350 gene spoT 11633 13882 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919427.1 protein_id gnl|my_center|LOCUS_30350 13882 14466 gene locus_tag LOCUS_30360 gene pyrE 13882 14466 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A810 protein_id gnl|my_center|LOCUS_30360 14466 15212 gene locus_tag LOCUS_30370 gene pdxJ 14466 15212 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_30370 15209 15622 gene locus_tag LOCUS_30380 gene acpS 15209 15622 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8S2 protein_id gnl|my_center|LOCUS_30380 >Feature sequence47 2789 576 gene locus_tag LOCUS_30390 gene priA 2789 576 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB85 protein_id gnl|my_center|LOCUS_30390 2909 3451 gene locus_tag LOCUS_30400 gene btuE 2909 3451 CDS product thioredoxin/glutathione peroxidase BtuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJ82 protein_id gnl|my_center|LOCUS_30400 3493 4446 gene locus_tag LOCUS_30410 gene xerC 3493 4446 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB87 protein_id gnl|my_center|LOCUS_30410 6843 4558 gene locus_tag LOCUS_30420 6843 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 7330 8235 gene locus_tag LOCUS_30430 7330 8235 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120175.1 protein_id gnl|my_center|LOCUS_30430 9751 8354 gene locus_tag LOCUS_30440 9751 8354 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3C8 protein_id gnl|my_center|LOCUS_30440 10276 9905 gene locus_tag LOCUS_30450 10276 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 10662 10273 gene locus_tag LOCUS_30460 10662 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 10827 12224 gene locus_tag LOCUS_30470 10827 12224 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706871.1 protein_id gnl|my_center|LOCUS_30470 12694 12230 gene locus_tag LOCUS_30480 12694 12230 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339224.1 protein_id gnl|my_center|LOCUS_30480 12791 13159 gene locus_tag LOCUS_30490 12791 13159 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948237.1 protein_id gnl|my_center|LOCUS_30490 15642 13240 gene locus_tag LOCUS_30500 15642 13240 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence48 185 787 gene locus_tag LOCUS_30510 185 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 1790 870 gene locus_tag LOCUS_30520 1790 870 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEZ8 protein_id gnl|my_center|LOCUS_30520 3924 1810 gene locus_tag LOCUS_30530 gene flaN 3924 1810 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918784.1 protein_id gnl|my_center|LOCUS_30530 5162 4977 gene locus_tag LOCUS_30540 5162 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 5528 5325 gene locus_tag LOCUS_30550 5528 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 5470 6147 gene locus_tag LOCUS_30560 5470 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 6157 6819 gene locus_tag LOCUS_30570 gene flgD 6157 6819 CDS product flagellar hook assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_773637.2 protein_id gnl|my_center|LOCUS_30570 6955 8430 gene locus_tag LOCUS_30580 6955 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 8631 8900 gene locus_tag LOCUS_30590 8631 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529904.1 protein_id gnl|my_center|LOCUS_30590 9120 10838 gene locus_tag LOCUS_30600 gene fliF 9120 10838 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6R7 protein_id gnl|my_center|LOCUS_30600 10835 11923 gene locus_tag LOCUS_30610 gene fliG 10835 11923 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04955 protein_id gnl|my_center|LOCUS_30610 11934 12569 gene locus_tag LOCUS_30620 11934 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 12591 12935 gene locus_tag LOCUS_30630 gene fliN 12591 12935 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C514 protein_id gnl|my_center|LOCUS_30630 13006 14394 gene locus_tag LOCUS_30640 gene flbD 13006 14394 CDS product transcriptional regulatory protein FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17899 protein_id gnl|my_center|LOCUS_30640 >Feature sequence49 697 1584 gene locus_tag LOCUS_30650 697 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1622 2020 gene locus_tag LOCUS_30660 1622 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563264.1 protein_id gnl|my_center|LOCUS_30660 2364 2017 gene locus_tag LOCUS_30670 2364 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 2894 2818 gene locus_tag LOCUS_t00360 2894 2818 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4035 2974 gene locus_tag LOCUS_30680 4035 2974 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920048.1 protein_id gnl|my_center|LOCUS_30680 4073 5917 gene locus_tag LOCUS_30690 4073 5917 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918419.1 protein_id gnl|my_center|LOCUS_30690 7320 5923 gene locus_tag LOCUS_30700 7320 5923 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090818.1 protein_id gnl|my_center|LOCUS_30700 8890 7454 gene locus_tag LOCUS_30710 gene merA1 8890 7454 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_30710 9672 8893 gene locus_tag LOCUS_30720 9672 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30720 10475 9669 gene locus_tag LOCUS_30730 10475 9669 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_30730 11711 10587 gene locus_tag LOCUS_30740 11711 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence50 462 725 gene locus_tag LOCUS_30750 462 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2621 747 gene locus_tag LOCUS_30760 2621 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 2812 2627 gene locus_tag LOCUS_30770 2812 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2775 3152 gene locus_tag LOCUS_30780 2775 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3866 3138 gene locus_tag LOCUS_30790 3866 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 3990 4703 gene locus_tag LOCUS_30800 3990 4703 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_30800 4700 5983 gene locus_tag LOCUS_30810 4700 5983 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_30810 6014 6634 gene locus_tag LOCUS_30820 6014 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 7602 6646 gene locus_tag LOCUS_30830 gene prfB 7602 6646 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWM3 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30830 10873 7871 gene locus_tag LOCUS_30840 10873 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence51 219 704 gene locus_tag LOCUS_30850 219 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 727 1038 gene locus_tag LOCUS_30860 727 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 1114 1776 gene locus_tag LOCUS_30870 1114 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 3075 1975 gene locus_tag LOCUS_30880 3075 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 4150 3287 gene locus_tag LOCUS_30890 4150 3287 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 protein_id gnl|my_center|LOCUS_30890 5208 4147 gene locus_tag LOCUS_30900 5208 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918100.1 protein_id gnl|my_center|LOCUS_30900 8592 5401 gene locus_tag LOCUS_30910 gene oar 8592 5401 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_30910 9028 10605 gene locus_tag LOCUS_30920 9028 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence52 754 1203 gene locus_tag LOCUS_30930 754 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1745 1200 gene locus_tag LOCUS_30940 1745 1200 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_30940 2668 1769 gene locus_tag LOCUS_30950 2668 1769 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917986.1 protein_id gnl|my_center|LOCUS_30950 2764 3759 gene locus_tag LOCUS_30960 2764 3759 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_30960 4043 3765 gene locus_tag LOCUS_30970 4043 3765 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 protein_id gnl|my_center|LOCUS_30970 4473 4069 gene locus_tag LOCUS_30980 4473 4069 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_30980 6175 4532 gene locus_tag LOCUS_30990 gene chvG 6175 4532 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918127.1 protein_id gnl|my_center|LOCUS_30990 6918 6220 gene locus_tag LOCUS_31000 gene chvI 6918 6220 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918126.1 protein_id gnl|my_center|LOCUS_31000 8323 7052 gene locus_tag LOCUS_31010 8323 7052 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence53 2500 314 gene locus_tag LOCUS_31020 2500 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3148 2618 gene locus_tag LOCUS_31030 3148 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 3453 5525 gene locus_tag LOCUS_31040 3453 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 5554 7197 gene locus_tag LOCUS_31050 5554 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 8230 7475 gene locus_tag LOCUS_31060 8230 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31060 8539 8252 gene locus_tag LOCUS_31070 8539 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31070 9060 8671 gene locus_tag LOCUS_31080 9060 8671 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920583.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence54 <1 1489 gene locus_tag LOCUS_31090 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391403.1:polysaccharide biosynthesis protein CapD 1657 3273 gene locus_tag LOCUS_31100 gene purH 1657 3273 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU8 protein_id gnl|my_center|LOCUS_31100 3464 4093 gene locus_tag LOCUS_31110 3464 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639328.2 protein_id gnl|my_center|LOCUS_31110 4567 4115 gene locus_tag LOCUS_31120 4567 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 5135 4632 gene locus_tag LOCUS_31130 5135 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 6069 5239 gene locus_tag LOCUS_31140 6069 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 6148 6606 gene locus_tag LOCUS_31150 6148 6606 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383665.1 protein_id gnl|my_center|LOCUS_31150 7230 6616 gene locus_tag LOCUS_31160 7230 6616 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143162.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence55 1614 3410 gene locus_tag LOCUS_31170 gene yidC 1614 3410 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1E8 protein_id gnl|my_center|LOCUS_31170 3461 4153 gene locus_tag LOCUS_31180 gene engB 3461 4153 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y596 protein_id gnl|my_center|LOCUS_31180 4226 4618 gene locus_tag LOCUS_31190 4226 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 4698 5774 gene locus_tag LOCUS_31200 4698 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_31200 5897 6799 gene locus_tag LOCUS_31210 gene argB 5897 6799 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABE5 protein_id gnl|my_center|LOCUS_31210 >Feature sequence56 4 3069 gene locus_tag LOCUS_31220 4 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3507 3863 gene locus_tag LOCUS_31230 3507 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 4394 3894 gene locus_tag LOCUS_31240 4394 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4557 5039 gene locus_tag LOCUS_31250 4557 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence57 3684 970 gene locus_tag LOCUS_31260 3684 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 4136 5308 gene locus_tag LOCUS_31270 4136 5308 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919742.1 protein_id gnl|my_center|LOCUS_31270 >Feature sequence58 3407 3778 gene locus_tag LOCUS_31280 3407 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence59 1 2274 gene locus_tag LOCUS_31290 1 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529826.1 protein_id gnl|my_center|LOCUS_31290 2271 3164 gene locus_tag LOCUS_31300 2271 3164 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338621.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence60 <3538 156 gene locus_tag LOCUS_31310 <3538 156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338623.1:IMP dehydrogenase >Feature sequence61 <1 880 gene locus_tag LOCUS_31320 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528655.1:mannose-1-phosphate guanyltransferase >Feature sequence62 1596 460 gene locus_tag LOCUS_31330 1596 460 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_31330 >Feature sequence63 <1621 975 gene locus_tag LOCUS_31340 <1621 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037197.1:succinoglycan biosynthesis protein