>Feature sequence001 1304 591 gene locus_tag LOCUS_00010 1304 591 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY76 protein_id gnl|my_center|LOCUS_00010 2743 1304 gene locus_tag LOCUS_00020 2743 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3873 3007 gene locus_tag LOCUS_00030 gene motA1 3873 3007 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 protein_id gnl|my_center|LOCUS_00030 4853 3918 gene locus_tag LOCUS_00040 4853 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5005 5865 gene locus_tag LOCUS_00050 gene motB1 5005 5865 CDS product chemotaxis MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003749.1 protein_id gnl|my_center|LOCUS_00050 5911 7215 gene locus_tag LOCUS_00060 gene flgE 5911 7215 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4I1 protein_id gnl|my_center|LOCUS_00060 7244 8692 gene locus_tag LOCUS_00070 gene flgK 7244 8692 CDS product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385165.1 protein_id gnl|my_center|LOCUS_00070 8694 9674 gene locus_tag LOCUS_00080 gene flgL 8694 9674 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4H9 protein_id gnl|my_center|LOCUS_00080 9679 10788 gene locus_tag LOCUS_00090 gene flgI2 9679 10788 CDS product flagellar P-ring protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY97 protein_id gnl|my_center|LOCUS_00090 11946 10837 gene locus_tag LOCUS_00100 gene fliG 11946 10837 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB6 protein_id gnl|my_center|LOCUS_00100 12728 11943 gene locus_tag LOCUS_00110 gene fliP1 12728 11943 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY94 protein_id gnl|my_center|LOCUS_00110 13035 12712 gene locus_tag LOCUS_00120 13035 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13607 13038 gene locus_tag LOCUS_00130 13607 13038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15129 13600 gene locus_tag LOCUS_00140 gene fliF 15129 13600 CDS product flagellar M-ring protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537974.1 protein_id gnl|my_center|LOCUS_00140 15318 15761 gene locus_tag LOCUS_00150 15318 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15763 16281 gene locus_tag LOCUS_00160 15763 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16265 16876 gene locus_tag LOCUS_00170 16265 16876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17048 16899 gene locus_tag LOCUS_00180 17048 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19264 17048 gene locus_tag LOCUS_00190 gene fixI 19264 17048 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919283.1 protein_id gnl|my_center|LOCUS_00190 19773 19261 gene locus_tag LOCUS_00200 19773 19261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21242 19773 gene locus_tag LOCUS_00210 gene fixG 21242 19773 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_00210 22135 21251 gene locus_tag LOCUS_00220 22135 21251 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8F0 protein_id gnl|my_center|LOCUS_00220 22289 22128 gene locus_tag LOCUS_00230 22289 22128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23071 22301 gene locus_tag LOCUS_00240 gene fixO2 23071 22301 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967401.1 protein_id gnl|my_center|LOCUS_00240 24764 23085 gene locus_tag LOCUS_00250 24764 23085 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919277.1 protein_id gnl|my_center|LOCUS_00250 24917 25180 gene locus_tag LOCUS_00260 24917 25180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25200 26372 gene locus_tag LOCUS_00270 25200 26372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26369 26998 gene locus_tag LOCUS_00280 gene fixJ 26369 26998 CDS product transcriptional regulatory protein FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23221 protein_id gnl|my_center|LOCUS_00280 27076 27465 gene locus_tag LOCUS_00290 27076 27465 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085543.1 protein_id gnl|my_center|LOCUS_00290 28814 27576 gene locus_tag LOCUS_00300 28814 27576 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8E3 protein_id gnl|my_center|LOCUS_00300 30015 29005 gene locus_tag LOCUS_00310 30015 29005 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 protein_id gnl|my_center|LOCUS_00310 30247 32175 gene locus_tag LOCUS_00320 30247 32175 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_00320 32172 34625 gene locus_tag LOCUS_00330 gene celD 32172 34625 CDS product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 protein_id gnl|my_center|LOCUS_00330 35792 34638 gene locus_tag LOCUS_00340 35792 34638 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_00340 35963 35799 gene locus_tag LOCUS_00350 35963 35799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36250 36077 gene locus_tag LOCUS_00360 36250 36077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36403 36555 gene locus_tag LOCUS_00370 36403 36555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36818 36606 gene locus_tag LOCUS_00380 36818 36606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 37166 37426 gene locus_tag LOCUS_00390 37166 37426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39189 37495 gene locus_tag LOCUS_00400 gene phyK 39189 37495 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923290.1 protein_id gnl|my_center|LOCUS_00400 39769 39173 gene locus_tag LOCUS_00410 gene sigT 39769 39173 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_00410 39967 39779 gene locus_tag LOCUS_00420 39967 39779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40133 40927 gene locus_tag LOCUS_00430 gene phyR 40133 40927 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_00430 41171 41025 gene locus_tag LOCUS_00440 41171 41025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42019 41198 gene locus_tag LOCUS_00450 42019 41198 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337109.1 protein_id gnl|my_center|LOCUS_00450 42123 42422 gene locus_tag LOCUS_00460 42123 42422 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957759.1 protein_id gnl|my_center|LOCUS_00460 42427 42825 gene locus_tag LOCUS_00470 42427 42825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 42929 43534 gene locus_tag LOCUS_00480 42929 43534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 44185 43541 gene locus_tag LOCUS_00490 44185 43541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 44483 45238 gene locus_tag LOCUS_00500 44483 45238 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090519.1 protein_id gnl|my_center|LOCUS_00500 46138 45260 gene locus_tag LOCUS_00510 46138 45260 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918601.1 protein_id gnl|my_center|LOCUS_00510 >Feature sequence002 1488 1213 gene locus_tag LOCUS_00520 1488 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 1469 1864 gene locus_tag LOCUS_00530 1469 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 2737 2024 gene locus_tag LOCUS_00540 2737 2024 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919843.1 protein_id gnl|my_center|LOCUS_00540 2905 3717 gene locus_tag LOCUS_00550 2905 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 4394 3714 gene locus_tag LOCUS_00560 4394 3714 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_00560 5440 4394 gene locus_tag LOCUS_00570 5440 4394 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9P6 protein_id gnl|my_center|LOCUS_00570 5820 5437 gene locus_tag LOCUS_00580 gene crcB 5820 5437 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6V2 protein_id gnl|my_center|LOCUS_00580 5959 7500 gene locus_tag LOCUS_00590 gene abfA 5959 7500 CDS product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919298.1 protein_id gnl|my_center|LOCUS_00590 7571 7644 gene locus_tag LOCUS_t00010 7571 7644 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8103 7819 gene locus_tag LOCUS_00600 8103 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 9076 8258 gene locus_tag LOCUS_00610 9076 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 9430 9179 gene locus_tag LOCUS_00620 9430 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 10877 10398 gene locus_tag LOCUS_00630 10877 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 11980 10874 gene locus_tag LOCUS_00640 11980 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 12963 11980 gene locus_tag LOCUS_00650 gene xcsK 12963 11980 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5C3 protein_id gnl|my_center|LOCUS_00650 13556 12960 gene locus_tag LOCUS_00660 gene xcsJ 13556 12960 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038517.1 protein_id gnl|my_center|LOCUS_00660 13954 13553 gene locus_tag LOCUS_00670 gene epsI 13954 13553 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45775 protein_id gnl|my_center|LOCUS_00670 14417 13956 gene locus_tag LOCUS_00680 14417 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 14875 14417 gene locus_tag LOCUS_00690 gene xcpT 14875 14417 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_00690 16097 14889 gene locus_tag LOCUS_00700 gene pulF 16097 14889 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918064.1 protein_id gnl|my_center|LOCUS_00700 17583 16084 gene locus_tag LOCUS_00710 gene pulE 17583 16084 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918063.1 protein_id gnl|my_center|LOCUS_00710 19532 17580 gene locus_tag LOCUS_00720 gene pulD 19532 17580 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 protein_id gnl|my_center|LOCUS_00720 20396 19536 gene locus_tag LOCUS_00730 gene xcsC 20396 19536 CDS product type II secretion system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038524.1 protein_id gnl|my_center|LOCUS_00730 23107 20501 gene locus_tag LOCUS_00740 gene fecA 23107 20501 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_00740 26112 23221 gene locus_tag LOCUS_00750 26112 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 27110 26442 gene locus_tag LOCUS_00760 27110 26442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 27713 27315 gene locus_tag LOCUS_00770 27713 27315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 27834 28133 gene locus_tag LOCUS_00780 27834 28133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 29356 28145 gene locus_tag LOCUS_00790 29356 28145 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_00790 30882 29548 gene locus_tag LOCUS_00800 30882 29548 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976239.1 protein_id gnl|my_center|LOCUS_00800 33324 31066 gene locus_tag LOCUS_00810 33324 31066 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_00810 34053 33424 gene locus_tag LOCUS_00820 34053 33424 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968053.1 protein_id gnl|my_center|LOCUS_00820 35416 34199 gene locus_tag LOCUS_00830 gene prfB 35416 34199 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWM3 protein_id gnl|my_center|LOCUS_00830 38054 35403 gene locus_tag LOCUS_00840 38054 35403 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_00840 40072 38156 gene locus_tag LOCUS_00850 40072 38156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 41891 40209 gene locus_tag LOCUS_00860 gene fzeA 41891 40209 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 protein_id gnl|my_center|LOCUS_00860 41985 42773 gene locus_tag LOCUS_00870 41985 42773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 43253 42777 gene locus_tag LOCUS_00880 43253 42777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 43338 44021 gene locus_tag LOCUS_00890 gene wcaA 43338 44021 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124718.1 protein_id gnl|my_center|LOCUS_00890 44021 44632 gene locus_tag LOCUS_00900 44021 44632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727343.1 protein_id gnl|my_center|LOCUS_00900 44703 45110 gene locus_tag LOCUS_00910 44703 45110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 >Feature sequence003 882 487 gene locus_tag LOCUS_00920 gene staR 882 487 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920112.1 protein_id gnl|my_center|LOCUS_00920 775 1098 gene locus_tag LOCUS_00930 775 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 2136 1168 gene locus_tag LOCUS_00940 2136 1168 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640054.1 protein_id gnl|my_center|LOCUS_00940 2260 2619 gene locus_tag LOCUS_00950 gene cpdR 2260 2619 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918630.1 protein_id gnl|my_center|LOCUS_00950 2619 2939 gene locus_tag LOCUS_00960 2619 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 2986 3060 gene locus_tag LOCUS_t00020 2986 3060 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4495 3203 gene locus_tag LOCUS_00970 gene purA 4495 3203 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3C9 protein_id gnl|my_center|LOCUS_00970 6056 4590 gene locus_tag LOCUS_00980 gene hapE 6056 4590 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_00980 6713 6135 gene locus_tag LOCUS_00990 6713 6135 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920940.1 protein_id gnl|my_center|LOCUS_00990 7368 6781 gene locus_tag LOCUS_01000 7368 6781 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_01000 9076 7481 gene locus_tag LOCUS_01010 9076 7481 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3I9 protein_id gnl|my_center|LOCUS_01010 10353 9187 gene locus_tag LOCUS_01020 gene serC 10353 9187 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 protein_id gnl|my_center|LOCUS_01020 10488 11324 gene locus_tag LOCUS_01030 gene tauD 10488 11324 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_01030 11987 11334 gene locus_tag LOCUS_01040 11987 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 12394 11993 gene locus_tag LOCUS_01050 12394 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918012.1 protein_id gnl|my_center|LOCUS_01050 12460 13242 gene locus_tag LOCUS_01060 12460 13242 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_01060 13383 13748 gene locus_tag LOCUS_01070 13383 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537244.1 protein_id gnl|my_center|LOCUS_01070 14613 13852 gene locus_tag LOCUS_01080 14613 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_01080 15755 14862 gene locus_tag LOCUS_01090 15755 14862 CDS product stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_01090 15978 17174 gene locus_tag LOCUS_01100 15978 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 17473 18018 gene locus_tag LOCUS_01110 17473 18018 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 protein_id gnl|my_center|LOCUS_01110 18458 18015 gene locus_tag LOCUS_01120 gene cdd 18458 18015 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336862.1 protein_id gnl|my_center|LOCUS_01120 18566 19435 gene locus_tag LOCUS_01130 gene nuh 18566 19435 CDS product nonspecific ribonucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147076.1 protein_id gnl|my_center|LOCUS_01130 19432 20268 gene locus_tag LOCUS_01140 gene rbsK 19432 20268 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLE4 protein_id gnl|my_center|LOCUS_01140 20354 21142 gene locus_tag LOCUS_01150 20354 21142 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_01150 22740 21253 gene locus_tag LOCUS_01160 gene rpoN 22740 21253 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03408 protein_id gnl|my_center|LOCUS_01160 23496 22762 gene locus_tag LOCUS_01170 23496 22762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921427.1 protein_id gnl|my_center|LOCUS_01170 24138 23596 gene locus_tag LOCUS_01180 24138 23596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 24784 24110 gene locus_tag LOCUS_01190 24784 24110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 25488 24874 gene locus_tag LOCUS_01200 gene rnd1 25488 24874 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 protein_id gnl|my_center|LOCUS_01200 26011 25538 gene locus_tag LOCUS_01210 26011 25538 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 protein_id gnl|my_center|LOCUS_01210 26472 26008 gene locus_tag LOCUS_01220 26472 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 26564 27829 gene locus_tag LOCUS_01230 gene dinB 26564 27829 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ46 protein_id gnl|my_center|LOCUS_01230 27898 28836 gene locus_tag LOCUS_01240 27898 28836 CDS product putative 2-nitropropane dioxygenase, NPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704729.1 protein_id gnl|my_center|LOCUS_01240 28911 31115 gene locus_tag LOCUS_01250 28911 31115 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_01250 31668 31198 gene locus_tag LOCUS_01260 gene ptsN 31668 31198 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310177.1 protein_id gnl|my_center|LOCUS_01260 32285 31692 gene locus_tag LOCUS_01270 32285 31692 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921424.1 protein_id gnl|my_center|LOCUS_01270 32659 34356 gene locus_tag LOCUS_01280 32659 34356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 34411 34770 gene locus_tag LOCUS_01290 34411 34770 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969906.1 protein_id gnl|my_center|LOCUS_01290 35901 34777 gene locus_tag LOCUS_01300 35901 34777 CDS product psp operon transcriptional activator PspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388974.1 protein_id gnl|my_center|LOCUS_01300 36074 36205 gene locus_tag LOCUS_01310 36074 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 >Feature sequence004 363 506 gene locus_tag LOCUS_01320 363 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 681 2831 gene locus_tag LOCUS_01330 681 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 3735 2842 gene locus_tag LOCUS_01340 3735 2842 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706660.1 protein_id gnl|my_center|LOCUS_01340 5306 3765 gene locus_tag LOCUS_01350 gene leuA 5306 3765 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A823 protein_id gnl|my_center|LOCUS_01350 6204 5434 gene locus_tag LOCUS_01360 6204 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 6343 7344 gene locus_tag LOCUS_01370 gene bioB 6343 7344 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H640 protein_id gnl|my_center|LOCUS_01370 8118 7345 gene locus_tag LOCUS_01380 8118 7345 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088716.1 protein_id gnl|my_center|LOCUS_01380 8799 8209 gene locus_tag LOCUS_01390 8799 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 9364 9002 gene locus_tag LOCUS_01400 9364 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 9533 14509 gene locus_tag LOCUS_01410 9533 14509 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921400.1 protein_id gnl|my_center|LOCUS_01410 14513 16570 gene locus_tag LOCUS_01420 gene pbpZ 14513 16570 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923313.1 protein_id gnl|my_center|LOCUS_01420 16730 17383 gene locus_tag LOCUS_01430 gene msrA 16730 17383 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_01430 19098 17380 gene locus_tag LOCUS_01440 19098 17380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_01440 19360 22677 gene locus_tag LOCUS_01450 gene oar 19360 22677 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_01450 22766 23749 gene locus_tag LOCUS_01460 22766 23749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639908.1 protein_id gnl|my_center|LOCUS_01460 23769 24608 gene locus_tag LOCUS_01470 23769 24608 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 protein_id gnl|my_center|LOCUS_01470 25163 24609 gene locus_tag LOCUS_01480 25163 24609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 25363 27813 gene locus_tag LOCUS_01490 gene divL 25363 27813 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921313.1 protein_id gnl|my_center|LOCUS_01490 27931 28803 gene locus_tag LOCUS_01500 27931 28803 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_01500 29601 28810 gene locus_tag LOCUS_01510 29601 28810 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_01510 30598 29627 gene locus_tag LOCUS_01520 30598 29627 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_01520 >Feature sequence005 2210 327 gene locus_tag LOCUS_01530 2210 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 3811 2180 gene locus_tag LOCUS_01540 3811 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01540 4579 4495 gene locus_tag LOCUS_t00030 4579 4495 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4669 5274 gene locus_tag LOCUS_01550 gene exoD 4669 5274 CDS product protein exod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710076.1 protein_id gnl|my_center|LOCUS_01550 5341 5868 gene locus_tag LOCUS_01560 5341 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 6809 5856 gene locus_tag LOCUS_01570 6809 5856 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 protein_id gnl|my_center|LOCUS_01570 6802 7086 gene locus_tag LOCUS_01580 6802 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 7972 7097 gene locus_tag LOCUS_01590 7972 7097 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_01590 8916 8068 gene locus_tag LOCUS_01600 8916 8068 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_01600 9482 8982 gene locus_tag LOCUS_01610 9482 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9785 9525 gene locus_tag LOCUS_01620 9785 9525 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4R9 protein_id gnl|my_center|LOCUS_01620 10790 9840 gene locus_tag LOCUS_01630 10790 9840 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529205.1 protein_id gnl|my_center|LOCUS_01630 11317 10787 gene locus_tag LOCUS_01640 11317 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 11974 11366 gene locus_tag LOCUS_01650 11974 11366 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 protein_id gnl|my_center|LOCUS_01650 12221 12006 gene locus_tag LOCUS_01660 12221 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 12354 13589 gene locus_tag LOCUS_01670 12354 13589 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763248.1 protein_id gnl|my_center|LOCUS_01670 14873 13590 gene locus_tag LOCUS_01680 14873 13590 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265614.1 protein_id gnl|my_center|LOCUS_01680 15082 17349 gene locus_tag LOCUS_01690 15082 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 17349 17957 gene locus_tag LOCUS_01700 17349 17957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 17963 18613 gene locus_tag LOCUS_01710 17963 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 18613 19875 gene locus_tag LOCUS_01720 18613 19875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 20365 19892 gene locus_tag LOCUS_01730 20365 19892 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124170.1 protein_id gnl|my_center|LOCUS_01730 20721 20482 gene locus_tag LOCUS_01740 20721 20482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 21667 20708 gene locus_tag LOCUS_01750 gene tyrC 21667 20708 CDS product cyclohexadienyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973185.1 protein_id gnl|my_center|LOCUS_01750 21961 22338 gene locus_tag LOCUS_01760 21961 22338 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 protein_id gnl|my_center|LOCUS_01760 22696 22352 gene locus_tag LOCUS_01770 gene glnC 22696 22352 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918409.1 protein_id gnl|my_center|LOCUS_01770 23499 22756 gene locus_tag LOCUS_01780 23499 22756 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973187.1 protein_id gnl|my_center|LOCUS_01780 23538 24311 gene locus_tag LOCUS_01790 gene gloB 23538 24311 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_01790 24311 24544 gene locus_tag LOCUS_01800 24311 24544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01800 25563 24751 gene locus_tag LOCUS_01810 25563 24751 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 protein_id gnl|my_center|LOCUS_01810 26840 25560 gene locus_tag LOCUS_01820 26840 25560 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389963.1 protein_id gnl|my_center|LOCUS_01820 28823 26856 gene locus_tag LOCUS_01830 gene thrS 28823 26856 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_01830 29446 29120 gene locus_tag LOCUS_01840 29446 29120 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8C4 protein_id gnl|my_center|LOCUS_01840 29918 29448 gene locus_tag LOCUS_01850 29918 29448 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 protein_id gnl|my_center|LOCUS_01850 <30694 30112 gene locus_tag LOCUS_01860 <30694 30112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9AAY2:cysteine--tRNA ligase >Feature sequence006 3613 317 gene locus_tag LOCUS_01870 3613 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8106 3610 gene locus_tag LOCUS_01880 8106 3610 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973246.1 protein_id gnl|my_center|LOCUS_01880 13123 8156 gene locus_tag LOCUS_01890 13123 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 13728 13459 gene locus_tag LOCUS_01900 13728 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 14297 15775 gene locus_tag LOCUS_01910 14297 15775 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887448.1 protein_id gnl|my_center|LOCUS_01910 16131 16814 gene locus_tag LOCUS_01920 16131 16814 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_01920 16850 21364 gene locus_tag LOCUS_01930 16850 21364 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908855.1 protein_id gnl|my_center|LOCUS_01930 21361 27762 gene locus_tag LOCUS_01940 21361 27762 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031213.1 protein_id gnl|my_center|LOCUS_01940 >Feature sequence007 290 1627 gene locus_tag LOCUS_01950 gene macA 290 1627 CDS product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208368.1 protein_id gnl|my_center|LOCUS_01950 1637 3574 gene locus_tag LOCUS_01960 gene macB 1637 3574 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPB4 protein_id gnl|my_center|LOCUS_01960 3582 4931 gene locus_tag LOCUS_01970 3582 4931 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390985.1 protein_id gnl|my_center|LOCUS_01970 6068 5004 gene locus_tag LOCUS_01980 gene glpQ 6068 5004 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 protein_id gnl|my_center|LOCUS_01980 8583 6136 gene locus_tag LOCUS_01990 8583 6136 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 protein_id gnl|my_center|LOCUS_01990 9173 10300 gene locus_tag LOCUS_02000 9173 10300 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529678.1 protein_id gnl|my_center|LOCUS_02000 10300 13425 gene locus_tag LOCUS_02010 10300 13425 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972023.1 protein_id gnl|my_center|LOCUS_02010 13422 14789 gene locus_tag LOCUS_02020 13422 14789 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_02020 14865 16175 gene locus_tag LOCUS_02030 14865 16175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536011.1 protein_id gnl|my_center|LOCUS_02030 16243 16845 gene locus_tag LOCUS_02040 16243 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 18263 16842 gene locus_tag LOCUS_02050 gene oprM 18263 16842 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037811.1 protein_id gnl|my_center|LOCUS_02050 21394 18260 gene locus_tag LOCUS_02060 21394 18260 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704610.1 protein_id gnl|my_center|LOCUS_02060 22597 21413 gene locus_tag LOCUS_02070 gene acrA 22597 21413 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 protein_id gnl|my_center|LOCUS_02070 22720 23340 gene locus_tag LOCUS_02080 22720 23340 CDS product putative TetR-family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703645.1 protein_id gnl|my_center|LOCUS_02080 23460 25856 gene locus_tag LOCUS_02090 23460 25856 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVE3 protein_id gnl|my_center|LOCUS_02090 25888 26364 gene locus_tag LOCUS_02100 25888 26364 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_02100 27561 26365 gene locus_tag LOCUS_02110 gene proB 27561 26365 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GV5 protein_id gnl|my_center|LOCUS_02110 27653 27835 gene locus_tag LOCUS_02120 27653 27835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 27789 28538 gene locus_tag LOCUS_02130 gene proC 27789 28538 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLB5 protein_id gnl|my_center|LOCUS_02130 >Feature sequence008 <1 952 gene locus_tag LOCUS_02140 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV06:gamma-glutamyl phosphate reductase 1022 2584 gene locus_tag LOCUS_02150 gene opuE 1022 2584 CDS product osmoregulated proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06493 protein_id gnl|my_center|LOCUS_02150 2710 4869 gene locus_tag LOCUS_02160 2710 4869 CDS product xylan alpha-1,2-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4L9 protein_id gnl|my_center|LOCUS_02160 5773 4880 gene locus_tag LOCUS_02170 5773 4880 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092552.1 protein_id gnl|my_center|LOCUS_02170 5874 7370 gene locus_tag LOCUS_02180 5874 7370 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 protein_id gnl|my_center|LOCUS_02180 7378 8151 gene locus_tag LOCUS_02190 7378 8151 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067768.1 protein_id gnl|my_center|LOCUS_02190 8284 9177 gene locus_tag LOCUS_02200 8284 9177 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_02200 9460 11079 gene locus_tag LOCUS_02210 gene opgG 9460 11079 CDS product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSG8 protein_id gnl|my_center|LOCUS_02210 11076 13271 gene locus_tag LOCUS_02220 gene opgH 11076 13271 CDS product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF78 protein_id gnl|my_center|LOCUS_02220 14228 13281 gene locus_tag LOCUS_02230 14228 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 15750 14314 gene locus_tag LOCUS_02240 15750 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 16895 15867 gene locus_tag LOCUS_02250 16895 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 18691 17021 gene locus_tag LOCUS_02260 18691 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 19246 18695 gene locus_tag LOCUS_02270 19246 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 19389 19973 gene locus_tag LOCUS_02280 19389 19973 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_02280 19954 22326 gene locus_tag LOCUS_02290 19954 22326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 23070 22327 gene locus_tag LOCUS_02300 23070 22327 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530346.1 protein_id gnl|my_center|LOCUS_02300 23467 23045 gene locus_tag LOCUS_02310 23467 23045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265559.1 protein_id gnl|my_center|LOCUS_02310 24455 23559 gene locus_tag LOCUS_02320 24455 23559 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 protein_id gnl|my_center|LOCUS_02320 25759 24455 gene locus_tag LOCUS_02330 25759 24455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_02330 <27877 25880 gene locus_tag LOCUS_02340 <27877 25880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918224.1:TonB-dependent receptor >Feature sequence009 2345 1740 gene locus_tag LOCUS_02350 2345 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405423.1 protein_id gnl|my_center|LOCUS_02350 2804 2355 gene locus_tag LOCUS_02360 2804 2355 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 protein_id gnl|my_center|LOCUS_02360 3877 2801 gene locus_tag LOCUS_02370 gene pheS 3877 2801 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 protein_id gnl|my_center|LOCUS_02370 4363 4001 gene locus_tag LOCUS_02380 gene rplT 4363 4001 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M3 protein_id gnl|my_center|LOCUS_02380 4605 4402 gene locus_tag LOCUS_02390 gene rpmI 4605 4402 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H309 protein_id gnl|my_center|LOCUS_02390 4654 4839 gene locus_tag LOCUS_02400 4654 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 5457 5071 gene locus_tag LOCUS_02410 5457 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 5975 5454 gene locus_tag LOCUS_02420 gene infC 5975 5454 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9D9 protein_id gnl|my_center|LOCUS_02420 7171 6128 gene locus_tag LOCUS_02430 7171 6128 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 protein_id gnl|my_center|LOCUS_02430 8349 7189 gene locus_tag LOCUS_02440 8349 7189 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_02440 8406 9161 gene locus_tag LOCUS_02450 8406 9161 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_02450 9307 9885 gene locus_tag LOCUS_02460 9307 9885 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_02460 10804 9947 gene locus_tag LOCUS_02470 10804 9947 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_02470 10866 11543 gene locus_tag LOCUS_02480 10866 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 12908 11544 gene locus_tag LOCUS_02490 12908 11544 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_02490 13027 13965 gene locus_tag LOCUS_02500 13027 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968387.1 protein_id gnl|my_center|LOCUS_02500 14992 13991 gene locus_tag LOCUS_02510 14992 13991 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 protein_id gnl|my_center|LOCUS_02510 16040 15006 gene locus_tag LOCUS_02520 16040 15006 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709941.1 protein_id gnl|my_center|LOCUS_02520 17546 16044 gene locus_tag LOCUS_02530 gene cpaF 17546 16044 CDS product pilus assembly protein CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920779.1 protein_id gnl|my_center|LOCUS_02530 18952 17564 gene locus_tag LOCUS_02540 gene cpaE 18952 17564 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920780.1 protein_id gnl|my_center|LOCUS_02540 19690 18980 gene locus_tag LOCUS_02550 19690 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 21266 19701 gene locus_tag LOCUS_02560 gene cpaC 21266 19701 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920782.1 protein_id gnl|my_center|LOCUS_02560 22108 21269 gene locus_tag LOCUS_02570 gene ctpC 22108 21269 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310067.1 protein_id gnl|my_center|LOCUS_02570 22723 22208 gene locus_tag LOCUS_02580 gene cpaA 22723 22208 CDS product pilus assembly protein CpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920784.1 protein_id gnl|my_center|LOCUS_02580 23021 22860 gene locus_tag LOCUS_02590 23021 22860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 23332 23775 gene locus_tag LOCUS_02600 23332 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 23898 24449 gene locus_tag LOCUS_02610 23898 24449 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 protein_id gnl|my_center|LOCUS_02610 24455 25063 gene locus_tag LOCUS_02620 24455 25063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 26590 25085 gene locus_tag LOCUS_02630 26590 25085 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920791.1 protein_id gnl|my_center|LOCUS_02630 <27546 26683 gene locus_tag LOCUS_02640 <27546 26683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TF55:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence010 804 166 gene locus_tag LOCUS_02650 804 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 915 2159 gene locus_tag LOCUS_02660 915 2159 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 protein_id gnl|my_center|LOCUS_02660 2165 3724 gene locus_tag LOCUS_02670 gene emrB 2165 3724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973887.1 protein_id gnl|my_center|LOCUS_02670 4712 3729 gene locus_tag LOCUS_02680 4712 3729 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975705.1 protein_id gnl|my_center|LOCUS_02680 4800 5924 gene locus_tag LOCUS_02690 4800 5924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920177.1 protein_id gnl|my_center|LOCUS_02690 5921 6685 gene locus_tag LOCUS_02700 5921 6685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_02700 6704 7663 gene locus_tag LOCUS_02710 6704 7663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920179.1 protein_id gnl|my_center|LOCUS_02710 7663 8268 gene locus_tag LOCUS_02720 7663 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 9561 8356 gene locus_tag LOCUS_02730 9561 8356 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_02730 10692 9577 gene locus_tag LOCUS_02740 10692 9577 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640506.1 protein_id gnl|my_center|LOCUS_02740 10913 11506 gene locus_tag LOCUS_02750 10913 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640507.1 protein_id gnl|my_center|LOCUS_02750 11877 11518 gene locus_tag LOCUS_02760 11877 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 11980 14556 gene locus_tag LOCUS_02770 gene pepN 11980 14556 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37893 protein_id gnl|my_center|LOCUS_02770 14669 17047 gene locus_tag LOCUS_02780 gene pleC 14669 17047 CDS product non-motile and phage-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37894 protein_id gnl|my_center|LOCUS_02780 17646 17044 gene locus_tag LOCUS_02790 17646 17044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 18458 17649 gene locus_tag LOCUS_02800 18458 17649 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787574.1 protein_id gnl|my_center|LOCUS_02800 18912 18469 gene locus_tag LOCUS_02810 18912 18469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 21052 19067 gene locus_tag LOCUS_02820 21052 19067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 21411 21049 gene locus_tag LOCUS_02830 21411 21049 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921336.1 protein_id gnl|my_center|LOCUS_02830 21605 22342 gene locus_tag LOCUS_02840 21605 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_02840 22342 23328 gene locus_tag LOCUS_02850 22342 23328 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_02850 23356 25230 gene locus_tag LOCUS_02860 23356 25230 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_02860 25701 25234 gene locus_tag LOCUS_02870 25701 25234 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence011 1187 1621 gene locus_tag LOCUS_02880 1187 1621 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707597.1 protein_id gnl|my_center|LOCUS_02880 1654 2010 gene locus_tag LOCUS_02890 1654 2010 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_02890 2558 2007 gene locus_tag LOCUS_02900 2558 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 2903 3721 gene locus_tag LOCUS_02910 2903 3721 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8X1 protein_id gnl|my_center|LOCUS_02910 5444 4026 gene locus_tag LOCUS_02920 5444 4026 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_02920 6732 5524 gene locus_tag LOCUS_02930 gene rodA 6732 5524 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_02930 8672 6729 gene locus_tag LOCUS_02940 8672 6729 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_02940 9217 8669 gene locus_tag LOCUS_02950 9217 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 10080 9217 gene locus_tag LOCUS_02960 10080 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 11162 10122 gene locus_tag LOCUS_02970 11162 10122 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 protein_id gnl|my_center|LOCUS_02970 13231 11417 gene locus_tag LOCUS_02980 13231 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 15020 13317 gene locus_tag LOCUS_02990 15020 13317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 15198 16478 gene locus_tag LOCUS_03000 15198 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 17969 16479 gene locus_tag LOCUS_03010 17969 16479 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918886.1 protein_id gnl|my_center|LOCUS_03010 19030 17999 gene locus_tag LOCUS_03020 19030 17999 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918885.1 protein_id gnl|my_center|LOCUS_03020 19788 19054 gene locus_tag LOCUS_03030 19788 19054 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640115.1 protein_id gnl|my_center|LOCUS_03030 23082 19963 gene locus_tag LOCUS_03040 23082 19963 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918883.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence012 <1 905 gene locus_tag LOCUS_03050 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CFJ6:tryptophan synthase beta chain 962 1357 gene locus_tag LOCUS_03060 962 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 protein_id gnl|my_center|LOCUS_03060 1413 1733 gene locus_tag LOCUS_03070 gene cutA 1413 1733 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038658.1 protein_id gnl|my_center|LOCUS_03070 1733 2560 gene locus_tag LOCUS_03080 gene trpA 1733 2560 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBA0 protein_id gnl|my_center|LOCUS_03080 2589 3569 gene locus_tag LOCUS_03090 gene accD 2589 3569 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H660 protein_id gnl|my_center|LOCUS_03090 3566 4819 gene locus_tag LOCUS_03100 3566 4819 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 protein_id gnl|my_center|LOCUS_03100 6057 4825 gene locus_tag LOCUS_03110 6057 4825 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923348.1 protein_id gnl|my_center|LOCUS_03110 7700 6186 gene locus_tag LOCUS_03120 7700 6186 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A257 protein_id gnl|my_center|LOCUS_03120 7782 7955 gene locus_tag LOCUS_03130 7782 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 8768 7968 gene locus_tag LOCUS_03140 gene ubiE 8768 7968 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4E5 protein_id gnl|my_center|LOCUS_03140 8805 9650 gene locus_tag LOCUS_03150 gene mutM 8805 9650 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_03150 10108 9647 gene locus_tag LOCUS_03160 10108 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10623 10249 gene locus_tag LOCUS_03170 10623 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 11595 10645 gene locus_tag LOCUS_03180 gene gshB 11595 10645 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 protein_id gnl|my_center|LOCUS_03180 12327 11644 gene locus_tag LOCUS_03190 12327 11644 CDS product phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815190.1 protein_id gnl|my_center|LOCUS_03190 12591 12926 gene locus_tag LOCUS_03200 12591 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 12933 13397 gene locus_tag LOCUS_03210 gene rlmH 12933 13397 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI5 protein_id gnl|my_center|LOCUS_03210 13568 13404 gene locus_tag LOCUS_03220 13568 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 13713 15008 gene locus_tag LOCUS_03230 13713 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_03230 17765 15066 gene locus_tag LOCUS_03240 gene mutS 17765 15066 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C2I6 protein_id gnl|my_center|LOCUS_03240 17935 20211 gene locus_tag LOCUS_03250 17935 20211 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 protein_id gnl|my_center|LOCUS_03250 20325 21755 gene locus_tag LOCUS_03260 20325 21755 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_03260 21923 22519 gene locus_tag LOCUS_03270 21923 22519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265501.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence013 <1 523 gene locus_tag LOCUS_03280 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RN75:ribosomal RNA small subunit methyltransferase G 510 1322 gene locus_tag LOCUS_03290 gene parA 510 1322 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV7 protein_id gnl|my_center|LOCUS_03290 1328 2242 gene locus_tag LOCUS_03300 gene parB 1328 2242 CDS product chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV8 protein_id gnl|my_center|LOCUS_03300 3280 2246 gene locus_tag LOCUS_03310 3280 2246 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385535.1 protein_id gnl|my_center|LOCUS_03310 3753 3280 gene locus_tag LOCUS_03320 3753 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 6317 3750 gene locus_tag LOCUS_03330 gene leuS 6317 3750 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW27 protein_id gnl|my_center|LOCUS_03330 6785 6360 gene locus_tag LOCUS_03340 6785 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 6892 8073 gene locus_tag LOCUS_03350 6892 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 8151 8603 gene locus_tag LOCUS_03360 8151 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 9130 8600 gene locus_tag LOCUS_03370 9130 8600 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921573.1 protein_id gnl|my_center|LOCUS_03370 9162 9896 gene locus_tag LOCUS_03380 9162 9896 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970578.1 protein_id gnl|my_center|LOCUS_03380 10396 9893 gene locus_tag LOCUS_03390 10396 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 protein_id gnl|my_center|LOCUS_03390 10502 11188 gene locus_tag LOCUS_03400 gene cenR 10502 11188 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266002.1 protein_id gnl|my_center|LOCUS_03400 11985 11170 gene locus_tag LOCUS_03410 11985 11170 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942218.1 protein_id gnl|my_center|LOCUS_03410 12857 12054 gene locus_tag LOCUS_03420 12857 12054 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921533.1 protein_id gnl|my_center|LOCUS_03420 13797 13138 gene locus_tag LOCUS_03430 13797 13138 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHE0 protein_id gnl|my_center|LOCUS_03430 14039 14926 gene locus_tag LOCUS_03440 gene trxA 14039 14926 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_03440 15011 15637 gene locus_tag LOCUS_03450 15011 15637 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 protein_id gnl|my_center|LOCUS_03450 15646 15882 gene locus_tag LOCUS_03460 15646 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 15879 16196 gene locus_tag LOCUS_03470 15879 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314414.1 protein_id gnl|my_center|LOCUS_03470 17431 16193 gene locus_tag LOCUS_03480 17431 16193 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 protein_id gnl|my_center|LOCUS_03480 17359 17628 gene locus_tag LOCUS_03490 17359 17628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 17647 19041 gene locus_tag LOCUS_03500 gene amt-2 17647 19041 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_03500 20154 19153 gene locus_tag LOCUS_03510 20154 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence014 605 276 gene locus_tag LOCUS_03520 605 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967855.1 protein_id gnl|my_center|LOCUS_03520 803 1090 gene locus_tag LOCUS_03530 803 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2139 1087 gene locus_tag LOCUS_03540 2139 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921483.1 protein_id gnl|my_center|LOCUS_03540 2434 2177 gene locus_tag LOCUS_03550 2434 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2887 2540 gene locus_tag LOCUS_03560 2887 2540 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MH6 protein_id gnl|my_center|LOCUS_03560 3785 2943 gene locus_tag LOCUS_03570 3785 2943 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921486.1 protein_id gnl|my_center|LOCUS_03570 3918 5021 gene locus_tag LOCUS_03580 3918 5021 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_03580 5026 5646 gene locus_tag LOCUS_03590 5026 5646 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919879.1 protein_id gnl|my_center|LOCUS_03590 6649 5741 gene locus_tag LOCUS_03600 gene rarD 6649 5741 CDS product chloramphenicol resistance permease RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176139.1 protein_id gnl|my_center|LOCUS_03600 7812 6769 gene locus_tag LOCUS_03610 gene asd 7812 6769 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X21 protein_id gnl|my_center|LOCUS_03610 7936 8307 gene locus_tag LOCUS_03620 7936 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 8313 9113 gene locus_tag LOCUS_03630 8313 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702795.1 protein_id gnl|my_center|LOCUS_03630 10162 9110 gene locus_tag LOCUS_03640 gene leuB 10162 9110 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABN3 protein_id gnl|my_center|LOCUS_03640 10571 10275 gene locus_tag LOCUS_03650 10571 10275 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529770.1 protein_id gnl|my_center|LOCUS_03650 10741 10568 gene locus_tag LOCUS_03660 10741 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 11393 10764 gene locus_tag LOCUS_03670 gene leuD 11393 10764 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV54 protein_id gnl|my_center|LOCUS_03670 12247 11405 gene locus_tag LOCUS_03680 12247 11405 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085618.1 protein_id gnl|my_center|LOCUS_03680 13240 12257 gene locus_tag LOCUS_03690 13240 12257 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 protein_id gnl|my_center|LOCUS_03690 14715 13318 gene locus_tag LOCUS_03700 gene leuC 14715 13318 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GY66 protein_id gnl|my_center|LOCUS_03700 15210 14785 gene locus_tag LOCUS_03710 15210 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 15864 15307 gene locus_tag LOCUS_03720 15864 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 16576 15851 gene locus_tag LOCUS_03730 gene trmD 16576 15851 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ05 protein_id gnl|my_center|LOCUS_03730 16950 16624 gene locus_tag LOCUS_03740 16950 16624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 17044 17223 gene locus_tag LOCUS_03750 17044 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 17263 18009 gene locus_tag LOCUS_03760 gene dpm1 17263 18009 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_03760 19652 18033 gene locus_tag LOCUS_03770 19652 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 20257 19724 gene locus_tag LOCUS_03780 gene rimM 20257 19724 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2B4 protein_id gnl|my_center|LOCUS_03780 21001 20306 gene locus_tag LOCUS_03790 21001 20306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence015 605 1231 gene locus_tag LOCUS_03800 605 1231 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_03800 1240 2073 gene locus_tag LOCUS_03810 1240 2073 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709348.1 protein_id gnl|my_center|LOCUS_03810 2622 2047 gene locus_tag LOCUS_03820 2622 2047 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707849.1 protein_id gnl|my_center|LOCUS_03820 2796 3233 gene locus_tag LOCUS_03830 2796 3233 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972462.1 protein_id gnl|my_center|LOCUS_03830 3375 4196 gene locus_tag LOCUS_03840 3375 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03840 4193 6100 gene locus_tag LOCUS_03850 4193 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 6477 7064 gene locus_tag LOCUS_03860 6477 7064 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 protein_id gnl|my_center|LOCUS_03860 7730 7068 gene locus_tag LOCUS_03870 7730 7068 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706239.1 protein_id gnl|my_center|LOCUS_03870 8948 7767 gene locus_tag LOCUS_03880 gene carA 8948 7767 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CB10 protein_id gnl|my_center|LOCUS_03880 9080 9589 gene locus_tag LOCUS_03890 9080 9589 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_03890 9666 10439 gene locus_tag LOCUS_03900 9666 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 10563 12464 gene locus_tag LOCUS_03910 gene dnaG 10563 12464 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCD7 protein_id gnl|my_center|LOCUS_03910 12538 12720 gene locus_tag LOCUS_03920 12538 12720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 12878 14830 gene locus_tag LOCUS_03930 gene rpoD 12878 14830 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52324 protein_id gnl|my_center|LOCUS_03930 14892 15629 gene locus_tag LOCUS_03940 14892 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338609.1 protein_id gnl|my_center|LOCUS_03940 15688 16071 gene locus_tag LOCUS_03950 15688 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 16201 16995 gene locus_tag LOCUS_03960 16201 16995 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_03960 18433 17144 gene locus_tag LOCUS_03970 18433 17144 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719586.1 protein_id gnl|my_center|LOCUS_03970 19332 18484 gene locus_tag LOCUS_03980 19332 18484 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098225.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence016 581 1543 gene locus_tag LOCUS_03990 581 1543 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 protein_id gnl|my_center|LOCUS_03990 2362 1565 gene locus_tag LOCUS_04000 2362 1565 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_04000 3478 2429 gene locus_tag LOCUS_04010 gene galD 3478 2429 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168055.1 protein_id gnl|my_center|LOCUS_04010 3622 3698 gene locus_tag LOCUS_t00040 3622 3698 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4923 3970 gene locus_tag LOCUS_04020 4923 3970 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_04020 5016 5687 gene locus_tag LOCUS_04030 5016 5687 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083679.1 protein_id gnl|my_center|LOCUS_04030 6541 5684 gene locus_tag LOCUS_04040 6541 5684 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_04040 6752 7813 gene locus_tag LOCUS_04050 6752 7813 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_04050 7817 9067 gene locus_tag LOCUS_04060 7817 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 9999 9049 gene locus_tag LOCUS_04070 9999 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 10779 10060 gene locus_tag LOCUS_04080 10779 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 10669 10899 gene locus_tag LOCUS_04090 10669 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 10915 11112 gene locus_tag LOCUS_04100 10915 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 12670 11537 gene locus_tag LOCUS_04110 gene wecB 12670 11537 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM43 protein_id gnl|my_center|LOCUS_04110 14081 12756 gene locus_tag LOCUS_04120 14081 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 14248 14967 gene locus_tag LOCUS_04130 14248 14967 CDS product putative O-antigen/lipopolysaccharide transport integral membrane protein ABC transporter RfbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700955.1 protein_id gnl|my_center|LOCUS_04130 14977 16170 gene locus_tag LOCUS_04140 14977 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 16674 16201 gene locus_tag LOCUS_04150 16674 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 18703 16688 gene locus_tag LOCUS_04160 18703 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 19722 18736 gene locus_tag LOCUS_04170 19722 18736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence017 <1 1782 gene locus_tag LOCUS_04180 <1 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919356.1:adenylyl-sulfate kinase 1901 3415 gene locus_tag LOCUS_04190 1901 3415 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730593.1 protein_id gnl|my_center|LOCUS_04190 4558 3422 gene locus_tag LOCUS_04200 4558 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106912.1 protein_id gnl|my_center|LOCUS_04200 6780 4636 gene locus_tag LOCUS_04210 gene fhuA 6780 4636 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036583.1 protein_id gnl|my_center|LOCUS_04210 6985 7968 gene locus_tag LOCUS_04220 gene gpsA 6985 7968 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58141 protein_id gnl|my_center|LOCUS_04220 7971 9092 gene locus_tag LOCUS_04230 7971 9092 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 protein_id gnl|my_center|LOCUS_04230 10006 9107 gene locus_tag LOCUS_04240 10006 9107 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_04240 11065 10052 gene locus_tag LOCUS_04250 11065 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 11540 11130 gene locus_tag LOCUS_04260 11540 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11753 12646 gene locus_tag LOCUS_04270 11753 12646 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_04270 12646 13557 gene locus_tag LOCUS_04280 12646 13557 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_04280 13678 15120 gene locus_tag LOCUS_04290 gene xanB 13678 15120 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331335.1 protein_id gnl|my_center|LOCUS_04290 15262 16494 gene locus_tag LOCUS_04300 15262 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 17363 16491 gene locus_tag LOCUS_04310 17363 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 17511 18032 gene locus_tag LOCUS_04320 17511 18032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_04320 19664 18039 gene locus_tag LOCUS_04330 19664 18039 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence018 1423 176 gene locus_tag LOCUS_04340 1423 176 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9W8 protein_id gnl|my_center|LOCUS_04340 1517 2293 gene locus_tag LOCUS_04350 gene ubiG 1517 2293 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MK1 protein_id gnl|my_center|LOCUS_04350 2290 2901 gene locus_tag LOCUS_04360 2290 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_04360 4271 2898 gene locus_tag LOCUS_04370 4271 2898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703155.1 protein_id gnl|my_center|LOCUS_04370 4389 5882 gene locus_tag LOCUS_04380 4389 5882 CDS product carboxypeptidase S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265607.1 protein_id gnl|my_center|LOCUS_04380 7303 5978 gene locus_tag LOCUS_04390 7303 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918796.1 protein_id gnl|my_center|LOCUS_04390 7415 8023 gene locus_tag LOCUS_04400 7415 8023 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640088.1 protein_id gnl|my_center|LOCUS_04400 9894 8020 gene locus_tag LOCUS_04410 gene uvrC 9894 8020 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4F3 protein_id gnl|my_center|LOCUS_04410 10330 9935 gene locus_tag LOCUS_04420 10330 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 10477 11688 gene locus_tag LOCUS_04430 10477 11688 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8I0 protein_id gnl|my_center|LOCUS_04430 11790 12254 gene locus_tag LOCUS_04440 gene dps 11790 12254 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658301.1 protein_id gnl|my_center|LOCUS_04440 13465 12557 gene locus_tag LOCUS_04450 13465 12557 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_04450 14515 13535 gene locus_tag LOCUS_04460 14515 13535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 14736 16565 gene locus_tag LOCUS_04470 14736 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 18126 16603 gene locus_tag LOCUS_04480 gene phrB 18126 16603 CDS product (6-4) photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH39 protein_id gnl|my_center|LOCUS_04480 18815 18198 gene locus_tag LOCUS_04490 18815 18198 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706748.1 protein_id gnl|my_center|LOCUS_04490 18893 19627 gene locus_tag LOCUS_04500 18893 19627 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031430.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence019 393 1196 gene locus_tag LOCUS_04510 393 1196 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_04510 2507 1203 gene locus_tag LOCUS_04520 gene hslU 2507 1203 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN2 protein_id gnl|my_center|LOCUS_04520 3120 2563 gene locus_tag LOCUS_04530 gene hslV 3120 2563 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM9 protein_id gnl|my_center|LOCUS_04530 3251 4666 gene locus_tag LOCUS_04540 3251 4666 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABD8 protein_id gnl|my_center|LOCUS_04540 4668 6227 gene locus_tag LOCUS_04550 4668 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6227 7057 gene locus_tag LOCUS_04560 gene pstB 6227 7057 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYG4 protein_id gnl|my_center|LOCUS_04560 7068 7760 gene locus_tag LOCUS_04570 gene phoU 7068 7760 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV9 protein_id gnl|my_center|LOCUS_04570 7771 8472 gene locus_tag LOCUS_04580 gene phoB 7771 8472 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_04580 9173 8469 gene locus_tag LOCUS_04590 9173 8469 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_04590 9313 10236 gene locus_tag LOCUS_04600 9313 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 10909 10277 gene locus_tag LOCUS_04610 10909 10277 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103292.1 protein_id gnl|my_center|LOCUS_04610 11065 12753 gene locus_tag LOCUS_04620 gene phaC1 11065 12753 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_04620 12759 13598 gene locus_tag LOCUS_04630 gene phaD 12759 13598 CDS product poly(3-hydroxyalkanoic acid) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_04630 14207 13599 gene locus_tag LOCUS_04640 14207 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 15019 14255 gene locus_tag LOCUS_04650 gene nadK 15019 14255 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58056 protein_id gnl|my_center|LOCUS_04650 15188 15979 gene locus_tag LOCUS_04660 15188 15979 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z4 protein_id gnl|my_center|LOCUS_04660 16069 17301 gene locus_tag LOCUS_04670 gene hemA 16069 17301 CDS product 5-aminolevulinate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04512 protein_id gnl|my_center|LOCUS_04670 17719 17303 gene locus_tag LOCUS_04680 17719 17303 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640101.1 protein_id gnl|my_center|LOCUS_04680 17942 19249 gene locus_tag LOCUS_04690 gene glyA 17942 19249 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_04690 19256 19732 gene locus_tag LOCUS_04700 gene nrdR 19256 19732 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG74 protein_id gnl|my_center|LOCUS_04700 >Feature sequence020 532 1581 gene locus_tag LOCUS_04710 532 1581 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW76 protein_id gnl|my_center|LOCUS_04710 1803 1639 gene locus_tag LOCUS_04720 1803 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2164 1730 gene locus_tag LOCUS_04730 gene rnhA 2164 1730 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU6 protein_id gnl|my_center|LOCUS_04730 2751 2212 gene locus_tag LOCUS_04740 2751 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3209 2748 gene locus_tag LOCUS_04750 3209 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4216 3236 gene locus_tag LOCUS_04760 gene thrB 4216 3236 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6V4 protein_id gnl|my_center|LOCUS_04760 5705 4227 gene locus_tag LOCUS_04770 5705 4227 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265814.1 protein_id gnl|my_center|LOCUS_04770 7261 5744 gene locus_tag LOCUS_04780 7261 5744 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_04780 8292 7408 gene locus_tag LOCUS_04790 8292 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 8368 9045 gene locus_tag LOCUS_04800 8368 9045 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ND7 protein_id gnl|my_center|LOCUS_04800 9740 9042 gene locus_tag LOCUS_04810 9740 9042 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ6 protein_id gnl|my_center|LOCUS_04810 10569 9745 gene locus_tag LOCUS_04820 gene map 10569 9745 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9H3 protein_id gnl|my_center|LOCUS_04820 11072 10632 gene locus_tag LOCUS_04830 11072 10632 CDS product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528883.1 protein_id gnl|my_center|LOCUS_04830 11257 12615 gene locus_tag LOCUS_04840 11257 12615 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_04840 12639 13409 gene locus_tag LOCUS_04850 12639 13409 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_04850 13409 13897 gene locus_tag LOCUS_04860 13409 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 13970 14752 gene locus_tag LOCUS_04870 13970 14752 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_04870 14762 15973 gene locus_tag LOCUS_04880 14762 15973 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728222.1 protein_id gnl|my_center|LOCUS_04880 16416 15970 gene locus_tag LOCUS_04890 16416 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 16499 16585 gene locus_tag LOCUS_t00050 16499 16585 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16737 16895 gene locus_tag LOCUS_04900 16737 16895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 16931 17467 gene locus_tag LOCUS_04910 16931 17467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921520.1 protein_id gnl|my_center|LOCUS_04910 <19805 17535 gene locus_tag LOCUS_04920 <19805 17535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073389.1:peptidase M16 >Feature sequence021 1270 302 gene locus_tag LOCUS_04930 1270 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1424 2176 gene locus_tag LOCUS_04940 1424 2176 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404822.1 protein_id gnl|my_center|LOCUS_04940 2264 3232 gene locus_tag LOCUS_04950 2264 3232 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918767.1 protein_id gnl|my_center|LOCUS_04950 3335 4141 gene locus_tag LOCUS_04960 3335 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4919 4161 gene locus_tag LOCUS_04970 4919 4161 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975806.1 protein_id gnl|my_center|LOCUS_04970 5024 5455 gene locus_tag LOCUS_04980 5024 5455 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971206.1 protein_id gnl|my_center|LOCUS_04980 6175 5459 gene locus_tag LOCUS_04990 6175 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_04990 6626 6264 gene locus_tag LOCUS_05000 6626 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 protein_id gnl|my_center|LOCUS_05000 6979 6623 gene locus_tag LOCUS_05010 gene yffB 6979 6623 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_05010 7856 7089 gene locus_tag LOCUS_05020 7856 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338722.1 protein_id gnl|my_center|LOCUS_05020 9860 7914 gene locus_tag LOCUS_05030 9860 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_05030 10177 9947 gene locus_tag LOCUS_05040 10177 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 11369 10209 gene locus_tag LOCUS_05050 gene rlmN 11369 10209 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXM4 protein_id gnl|my_center|LOCUS_05050 11544 12194 gene locus_tag LOCUS_05060 11544 12194 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918090.1 protein_id gnl|my_center|LOCUS_05060 12847 12191 gene locus_tag LOCUS_05070 12847 12191 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 protein_id gnl|my_center|LOCUS_05070 13387 12866 gene locus_tag LOCUS_05080 13387 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 13614 14144 gene locus_tag LOCUS_05090 13614 14144 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_05090 14169 14834 gene locus_tag LOCUS_05100 14169 14834 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_05100 15369 14845 gene locus_tag LOCUS_05110 15369 14845 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_05110 15692 15369 gene locus_tag LOCUS_05120 15692 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 16570 15689 gene locus_tag LOCUS_05130 16570 15689 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917986.1 protein_id gnl|my_center|LOCUS_05130 16667 17659 gene locus_tag LOCUS_05140 16667 17659 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_05140 17731 18687 gene locus_tag LOCUS_05150 17731 18687 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLM6 protein_id gnl|my_center|LOCUS_05150 <19546 18761 gene locus_tag LOCUS_05160 <19546 18761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TER2:chaperone protein DnaK >Feature sequence022 1171 179 gene locus_tag LOCUS_05170 1171 179 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390401.1 protein_id gnl|my_center|LOCUS_05170 2103 1168 gene locus_tag LOCUS_05180 gene cobD 2103 1168 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0S7 protein_id gnl|my_center|LOCUS_05180 3602 2115 gene locus_tag LOCUS_05190 gene cobQ 3602 2115 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZR0 protein_id gnl|my_center|LOCUS_05190 4360 3599 gene locus_tag LOCUS_05200 4360 3599 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_05200 5345 4353 gene locus_tag LOCUS_05210 5345 4353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_05210 6079 5342 gene locus_tag LOCUS_05220 6079 5342 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919074.1 protein_id gnl|my_center|LOCUS_05220 8027 6180 gene locus_tag LOCUS_05230 8027 6180 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_05230 9038 8436 gene locus_tag LOCUS_05240 gene cobO 9038 8436 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 protein_id gnl|my_center|LOCUS_05240 9568 9035 gene locus_tag LOCUS_05250 gene gpmB 9568 9035 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424906.1 protein_id gnl|my_center|LOCUS_05250 10326 9559 gene locus_tag LOCUS_05260 gene cobS 10326 9559 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI17 protein_id gnl|my_center|LOCUS_05260 11336 10323 gene locus_tag LOCUS_05270 gene cobT 11336 10323 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WA9 protein_id gnl|my_center|LOCUS_05270 11592 13745 gene locus_tag LOCUS_05280 gene bfrI 11592 13745 CDS product ferrisiderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039372.1 protein_id gnl|my_center|LOCUS_05280 13757 14341 gene locus_tag LOCUS_05290 13757 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 14354 15853 gene locus_tag LOCUS_05300 14354 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 16346 15855 gene locus_tag LOCUS_05310 16346 15855 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_05310 16762 16406 gene locus_tag LOCUS_05320 16762 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 17773 16919 gene locus_tag LOCUS_05330 17773 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919221.1 protein_id gnl|my_center|LOCUS_05330 17842 18444 gene locus_tag LOCUS_05340 17842 18444 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640214.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence023 2793 904 gene locus_tag LOCUS_05350 2793 904 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_05350 4433 2790 gene locus_tag LOCUS_05360 gene fzlC 4433 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917989.1 protein_id gnl|my_center|LOCUS_05360 5210 4542 gene locus_tag LOCUS_05370 5210 4542 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 protein_id gnl|my_center|LOCUS_05370 5764 5282 gene locus_tag LOCUS_05380 gene pcp 5764 5282 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814946.1 protein_id gnl|my_center|LOCUS_05380 7161 5893 gene locus_tag LOCUS_05390 gene rsmB 7161 5893 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917991.1 protein_id gnl|my_center|LOCUS_05390 8073 7177 gene locus_tag LOCUS_05400 gene htpX 8073 7177 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UED6 protein_id gnl|my_center|LOCUS_05400 8164 8379 gene locus_tag LOCUS_05410 8164 8379 CDS product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083407.1 protein_id gnl|my_center|LOCUS_05410 9576 8392 gene locus_tag LOCUS_05420 9576 8392 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_05420 10637 9645 gene locus_tag LOCUS_05430 10637 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 12673 10793 gene locus_tag LOCUS_05440 12673 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_05440 12778 13761 gene locus_tag LOCUS_05450 gene hemC 12778 13761 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND3 protein_id gnl|my_center|LOCUS_05450 13755 14483 gene locus_tag LOCUS_05460 13755 14483 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639872.1 protein_id gnl|my_center|LOCUS_05460 14543 15814 gene locus_tag LOCUS_05470 14543 15814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336797.1 protein_id gnl|my_center|LOCUS_05470 15821 17254 gene locus_tag LOCUS_05480 15821 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917964.1 protein_id gnl|my_center|LOCUS_05480 17349 17424 gene locus_tag LOCUS_t00060 17349 17424 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 1265 12 gene locus_tag LOCUS_05490 1265 12 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920587.1 protein_id gnl|my_center|LOCUS_05490 2221 1487 gene locus_tag LOCUS_05500 2221 1487 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538576.1 protein_id gnl|my_center|LOCUS_05500 3318 2221 gene locus_tag LOCUS_05510 3318 2221 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_05510 3436 4689 gene locus_tag LOCUS_05520 3436 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8147 4686 gene locus_tag LOCUS_05530 gene mfd 8147 4686 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A782 protein_id gnl|my_center|LOCUS_05530 8466 8191 gene locus_tag LOCUS_05540 8466 8191 CDS product Sdh5 family flavination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640346.1 protein_id gnl|my_center|LOCUS_05540 8761 8471 gene locus_tag LOCUS_05550 8761 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 8699 10612 gene locus_tag LOCUS_05560 gene recG 8699 10612 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9B7 protein_id gnl|my_center|LOCUS_05560 11342 10584 gene locus_tag LOCUS_05570 11342 10584 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_05570 11401 12429 gene locus_tag LOCUS_05580 11401 12429 CDS product tyrosine protein kinase:aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_05580 12434 12802 gene locus_tag LOCUS_05590 12434 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 12836 13684 gene locus_tag LOCUS_05600 12836 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 14322 13681 gene locus_tag LOCUS_05610 14322 13681 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947989.1 protein_id gnl|my_center|LOCUS_05610 15635 14319 gene locus_tag LOCUS_05620 gene astB2 15635 14319 CDS product N-succinylarginine dihydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7W1 protein_id gnl|my_center|LOCUS_05620 17104 15650 gene locus_tag LOCUS_05630 gene astD 17104 15650 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C761 protein_id gnl|my_center|LOCUS_05630 18110 17106 gene locus_tag LOCUS_05640 18110 17106 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919480.1 protein_id gnl|my_center|LOCUS_05640 <18763 18145 gene locus_tag LOCUS_05650 <18763 18145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919479.1:acetylornithine deacetylase >Feature sequence025 1 459 gene locus_tag LOCUS_05660 gene greA 1 459 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJ69 protein_id gnl|my_center|LOCUS_05660 460 1539 gene locus_tag LOCUS_05670 460 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_05670 1624 2346 gene locus_tag LOCUS_05680 1624 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2932 2351 gene locus_tag LOCUS_05690 2932 2351 CDS product putative O-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WL55 protein_id gnl|my_center|LOCUS_05690 4094 2910 gene locus_tag LOCUS_05700 gene mnmA 4094 2910 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6U5 protein_id gnl|my_center|LOCUS_05700 5020 4178 gene locus_tag LOCUS_05710 gene cheR1 5020 4178 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_05710 5452 5087 gene locus_tag LOCUS_05720 5452 5087 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921300.1 protein_id gnl|my_center|LOCUS_05720 6183 5542 gene locus_tag LOCUS_05730 6183 5542 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970152.1 protein_id gnl|my_center|LOCUS_05730 6536 6288 gene locus_tag LOCUS_05740 6536 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6919 6572 gene locus_tag LOCUS_05750 6919 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 7168 6944 gene locus_tag LOCUS_05760 7168 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389318.1 protein_id gnl|my_center|LOCUS_05760 10555 7211 gene locus_tag LOCUS_05770 10555 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921380.1 protein_id gnl|my_center|LOCUS_05770 10696 12111 gene locus_tag LOCUS_05780 10696 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 12234 13598 gene locus_tag LOCUS_05790 12234 13598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 16280 13653 gene locus_tag LOCUS_05800 gene clpB 16280 13653 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9T4 protein_id gnl|my_center|LOCUS_05800 17146 16478 gene locus_tag LOCUS_05810 17146 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 18181 17345 gene locus_tag LOCUS_05820 gene prmC 18181 17345 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B2 protein_id gnl|my_center|LOCUS_05820 <18746 18207 gene locus_tag LOCUS_05830 <18746 18207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C5V3:peptide chain release factor 1 >Feature sequence026 434 742 gene locus_tag LOCUS_05840 gene nuoK 434 742 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KJ8 protein_id gnl|my_center|LOCUS_05840 747 2906 gene locus_tag LOCUS_05850 gene nuoL 747 2906 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919805.1 protein_id gnl|my_center|LOCUS_05850 2906 4405 gene locus_tag LOCUS_05860 gene nuoM 2906 4405 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640368.1 protein_id gnl|my_center|LOCUS_05860 4412 5839 gene locus_tag LOCUS_05870 gene nuoN 4412 5839 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 protein_id gnl|my_center|LOCUS_05870 5836 6573 gene locus_tag LOCUS_05880 5836 6573 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_05880 6578 7345 gene locus_tag LOCUS_05890 gene coaX 6578 7345 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A7 protein_id gnl|my_center|LOCUS_05890 7351 9036 gene locus_tag LOCUS_05900 7351 9036 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_05900 9042 9470 gene locus_tag LOCUS_05910 9042 9470 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_05910 9470 9703 gene locus_tag LOCUS_05920 9470 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9755 11074 gene locus_tag LOCUS_05930 gene proS 9755 11074 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z5 protein_id gnl|my_center|LOCUS_05930 11071 12363 gene locus_tag LOCUS_05940 11071 12363 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919796.1 protein_id gnl|my_center|LOCUS_05940 12363 13052 gene locus_tag LOCUS_05950 gene lolD 12363 13052 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8R0 protein_id gnl|my_center|LOCUS_05950 13144 16566 gene locus_tag LOCUS_05960 gene dnaE1 13144 16566 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A700 protein_id gnl|my_center|LOCUS_05960 16712 17512 gene locus_tag LOCUS_05970 gene rpsB 16712 17512 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWS3 protein_id gnl|my_center|LOCUS_05970 17556 18461 gene locus_tag LOCUS_05980 gene tsf 17556 18461 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWS2 protein_id gnl|my_center|LOCUS_05980 >Feature sequence027 1301 828 gene locus_tag LOCUS_05990 1301 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 1605 1680 gene locus_tag LOCUS_t00070 1605 1680 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1725 2717 gene locus_tag LOCUS_06000 1725 2717 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310594.1 protein_id gnl|my_center|LOCUS_06000 2818 3285 gene locus_tag LOCUS_06010 2818 3285 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_06010 3763 3383 gene locus_tag LOCUS_06020 3763 3383 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083612.1 protein_id gnl|my_center|LOCUS_06020 8137 4022 gene locus_tag LOCUS_06030 8137 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919478.1 protein_id gnl|my_center|LOCUS_06030 9825 8137 gene locus_tag LOCUS_06040 9825 8137 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919477.1 protein_id gnl|my_center|LOCUS_06040 10197 11228 gene locus_tag LOCUS_06050 10197 11228 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_06050 11221 11688 gene locus_tag LOCUS_06060 gene queF 11221 11688 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A515 protein_id gnl|my_center|LOCUS_06060 14622 11692 gene locus_tag LOCUS_06070 14622 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 15395 14766 gene locus_tag LOCUS_06080 15395 14766 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534715.1 protein_id gnl|my_center|LOCUS_06080 15529 16230 gene locus_tag LOCUS_06090 15529 16230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 16236 17420 gene locus_tag LOCUS_06100 16236 17420 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence028 663 965 gene locus_tag LOCUS_06110 663 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2347 962 gene locus_tag LOCUS_06120 gene phoR 2347 962 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918178.1 protein_id gnl|my_center|LOCUS_06120 2704 4014 gene locus_tag LOCUS_06130 2704 4014 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198562.1 protein_id gnl|my_center|LOCUS_06130 4033 5310 gene locus_tag LOCUS_06140 4033 5310 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_06140 5307 8528 gene locus_tag LOCUS_06150 5307 8528 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_06150 8605 10821 gene locus_tag LOCUS_06160 8605 10821 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705124.1 protein_id gnl|my_center|LOCUS_06160 10964 11299 gene locus_tag LOCUS_06170 10964 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 11411 11662 gene locus_tag LOCUS_06180 11411 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_06180 11805 12389 gene locus_tag LOCUS_06190 11805 12389 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT82 protein_id gnl|my_center|LOCUS_06190 12527 13708 gene locus_tag LOCUS_06200 12527 13708 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_06200 13717 14787 gene locus_tag LOCUS_06210 13717 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066961.1 protein_id gnl|my_center|LOCUS_06210 15890 14784 gene locus_tag LOCUS_06220 15890 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 16423 15923 gene locus_tag LOCUS_06230 16423 15923 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265921.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence029 2275 260 gene locus_tag LOCUS_06240 2275 260 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918781.1 protein_id gnl|my_center|LOCUS_06240 2439 2702 gene locus_tag LOCUS_06250 2439 2702 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920053.1 protein_id gnl|my_center|LOCUS_06250 2829 3410 gene locus_tag LOCUS_06260 2829 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086823.1 protein_id gnl|my_center|LOCUS_06260 3415 3816 gene locus_tag LOCUS_06270 3415 3816 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088251.1 protein_id gnl|my_center|LOCUS_06270 3887 4723 gene locus_tag LOCUS_06280 gene panB 3887 4723 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R9 protein_id gnl|my_center|LOCUS_06280 4793 5530 gene locus_tag LOCUS_06290 4793 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_06290 5527 6879 gene locus_tag LOCUS_06300 5527 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6935 8515 gene locus_tag LOCUS_06310 gene der 6935 8515 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T938 protein_id gnl|my_center|LOCUS_06310 8592 9656 gene locus_tag LOCUS_06320 8592 9656 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_06320 10094 9660 gene locus_tag LOCUS_06330 10094 9660 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721956.1 protein_id gnl|my_center|LOCUS_06330 10732 10268 gene locus_tag LOCUS_06340 10732 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10628 10873 gene locus_tag LOCUS_06350 10628 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 12058 10955 gene locus_tag LOCUS_06360 12058 10955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 12635 13483 gene locus_tag LOCUS_06370 gene kdsA 12635 13483 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M4 protein_id gnl|my_center|LOCUS_06370 13495 14049 gene locus_tag LOCUS_06380 13495 14049 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_06380 14148 15392 gene locus_tag LOCUS_06390 14148 15392 CDS product putative MscS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66994 protein_id gnl|my_center|LOCUS_06390 16633 15431 gene locus_tag LOCUS_06400 16633 15431 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_06400 <17919 16734 gene locus_tag LOCUS_06410 <17919 16734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537543.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence030 394 47 gene locus_tag LOCUS_06420 394 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 745 473 gene locus_tag LOCUS_06430 745 473 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_06430 777 1400 gene locus_tag LOCUS_06440 777 1400 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_06440 1403 2887 gene locus_tag LOCUS_06450 1403 2887 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCB1 protein_id gnl|my_center|LOCUS_06450 2993 4006 gene locus_tag LOCUS_06460 2993 4006 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968509.1 protein_id gnl|my_center|LOCUS_06460 4867 4013 gene locus_tag LOCUS_06470 gene uppP 4867 4013 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_06470 5099 6544 gene locus_tag LOCUS_06480 gene gltD 5099 6544 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_06480 6549 11093 gene locus_tag LOCUS_06490 gene gltB 6549 11093 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921434.1 protein_id gnl|my_center|LOCUS_06490 12031 11135 gene locus_tag LOCUS_06500 12031 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 12541 12122 gene locus_tag LOCUS_06510 12541 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383284.1 protein_id gnl|my_center|LOCUS_06510 14099 12552 gene locus_tag LOCUS_06520 14099 12552 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_06520 14277 14579 gene locus_tag LOCUS_06530 14277 14579 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_06530 14666 15619 gene locus_tag LOCUS_06540 14666 15619 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920114.1 protein_id gnl|my_center|LOCUS_06540 15641 17104 gene locus_tag LOCUS_06550 15641 17104 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082963.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence031 <1 929 gene locus_tag LOCUS_06560 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389576.1:3,4-dihydroxy-2-butanone-4-phosphate synthase 929 1357 gene locus_tag LOCUS_06570 gene ribH2 929 1357 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I8 protein_id gnl|my_center|LOCUS_06570 1354 1821 gene locus_tag LOCUS_06580 gene nusB 1354 1821 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J3 protein_id gnl|my_center|LOCUS_06580 3296 2127 gene locus_tag LOCUS_06590 3296 2127 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920927.1 protein_id gnl|my_center|LOCUS_06590 3685 3353 gene locus_tag LOCUS_06600 3685 3353 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534548.1 protein_id gnl|my_center|LOCUS_06600 3722 4894 gene locus_tag LOCUS_06610 3722 4894 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG5 protein_id gnl|my_center|LOCUS_06610 5028 5891 gene locus_tag LOCUS_06620 5028 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5891 6934 gene locus_tag LOCUS_06630 5891 6934 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919872.1 protein_id gnl|my_center|LOCUS_06630 6931 7764 gene locus_tag LOCUS_06640 gene scpA 6931 7764 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919871.1 protein_id gnl|my_center|LOCUS_06640 7751 8818 gene locus_tag LOCUS_06650 7751 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 9431 8823 gene locus_tag LOCUS_06660 gene yijF 9431 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32668 protein_id gnl|my_center|LOCUS_06660 10146 9475 gene locus_tag LOCUS_06670 10146 9475 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_06670 11542 10211 gene locus_tag LOCUS_06680 11542 10211 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_06680 12136 11645 gene locus_tag LOCUS_06690 12136 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 12191 12919 gene locus_tag LOCUS_06700 gene nth 12191 12919 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CV04 protein_id gnl|my_center|LOCUS_06700 13041 13808 gene locus_tag LOCUS_06710 13041 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_06710 14608 13805 gene locus_tag LOCUS_06720 14608 13805 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921559.1 protein_id gnl|my_center|LOCUS_06720 14772 15770 gene locus_tag LOCUS_06730 14772 15770 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921560.1 protein_id gnl|my_center|LOCUS_06730 16366 15761 gene locus_tag LOCUS_06740 16366 15761 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_06740 16427 16765 gene locus_tag LOCUS_06750 16427 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence032 342 1166 gene locus_tag LOCUS_06760 342 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1321 4116 gene locus_tag LOCUS_06770 gene gyrA 1321 4116 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8L4 protein_id gnl|my_center|LOCUS_06770 4161 4658 gene locus_tag LOCUS_06780 gene coaD 4161 4658 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58103 protein_id gnl|my_center|LOCUS_06780 4655 5557 gene locus_tag LOCUS_06790 4655 5557 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640279.1 protein_id gnl|my_center|LOCUS_06790 5587 6642 gene locus_tag LOCUS_06800 gene queA 5587 6642 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB05 protein_id gnl|my_center|LOCUS_06800 7180 6701 gene locus_tag LOCUS_06810 7180 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 7548 7177 gene locus_tag LOCUS_06820 7548 7177 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086810.1 protein_id gnl|my_center|LOCUS_06820 8319 7552 gene locus_tag LOCUS_06830 8319 7552 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_06830 10069 8402 gene locus_tag LOCUS_06840 10069 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390093.1 protein_id gnl|my_center|LOCUS_06840 10182 11018 gene locus_tag LOCUS_06850 10182 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 11034 11756 gene locus_tag LOCUS_06860 11034 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 12054 13298 gene locus_tag LOCUS_06870 12054 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 13362 13859 gene locus_tag LOCUS_06880 13362 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 13891 14742 gene locus_tag LOCUS_06890 13891 14742 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918591.1 protein_id gnl|my_center|LOCUS_06890 14801 15232 gene locus_tag LOCUS_06900 14801 15232 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_06900 15232 16146 gene locus_tag LOCUS_06910 15232 16146 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C659 protein_id gnl|my_center|LOCUS_06910 16224 16748 gene locus_tag LOCUS_06920 16224 16748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence033 398 1270 gene locus_tag LOCUS_06930 gene coxC 398 1270 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921231.1 protein_id gnl|my_center|LOCUS_06930 1355 2047 gene locus_tag LOCUS_06940 1355 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2044 3420 gene locus_tag LOCUS_06950 2044 3420 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921228.1 protein_id gnl|my_center|LOCUS_06950 3469 3984 gene locus_tag LOCUS_06960 3469 3984 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383581.1 protein_id gnl|my_center|LOCUS_06960 4004 5032 gene locus_tag LOCUS_06970 4004 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 5593 5033 gene locus_tag LOCUS_06980 5593 5033 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5C6 protein_id gnl|my_center|LOCUS_06980 5717 6199 gene locus_tag LOCUS_06990 5717 6199 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_06990 6342 7259 gene locus_tag LOCUS_07000 6342 7259 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923262.1 protein_id gnl|my_center|LOCUS_07000 7263 7733 gene locus_tag LOCUS_07010 7263 7733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529725.1 protein_id gnl|my_center|LOCUS_07010 9251 7740 gene locus_tag LOCUS_07020 9251 7740 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118742.1 protein_id gnl|my_center|LOCUS_07020 9928 9401 gene locus_tag LOCUS_07030 9928 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 11135 9909 gene locus_tag LOCUS_07040 11135 9909 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919738.1 protein_id gnl|my_center|LOCUS_07040 11806 11342 gene locus_tag LOCUS_07050 11806 11342 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_07050 11906 15289 gene locus_tag LOCUS_07060 11906 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 16536 15286 gene locus_tag LOCUS_07070 gene tyrS 16536 15286 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A756 protein_id gnl|my_center|LOCUS_07070 >Feature sequence034 1319 1963 gene locus_tag LOCUS_07080 1319 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1966 2976 gene locus_tag LOCUS_07090 1966 2976 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 protein_id gnl|my_center|LOCUS_07090 3114 5831 gene locus_tag LOCUS_07100 3114 5831 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_07100 6658 6398 gene locus_tag LOCUS_07110 6658 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7045 7626 gene locus_tag LOCUS_07120 7045 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07120 8486 7647 gene locus_tag LOCUS_07130 8486 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8698 10413 gene locus_tag LOCUS_07140 8698 10413 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090028.1 protein_id gnl|my_center|LOCUS_07140 10471 12885 gene locus_tag LOCUS_07150 10471 12885 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_07150 12916 16206 gene locus_tag LOCUS_07160 12916 16206 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090027.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence035 1560 2633 gene locus_tag LOCUS_07170 1560 2633 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_07170 2998 2657 gene locus_tag LOCUS_07180 2998 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4080 2998 gene locus_tag LOCUS_07190 gene flhB 4080 2998 CDS product flagellar biosynthetic protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385150.1 protein_id gnl|my_center|LOCUS_07190 4840 4088 gene locus_tag LOCUS_07200 gene fliR 4840 4088 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C772 protein_id gnl|my_center|LOCUS_07200 6918 4840 gene locus_tag LOCUS_07210 gene flhA 6918 4840 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385152.1 protein_id gnl|my_center|LOCUS_07210 7189 6926 gene locus_tag LOCUS_07220 gene fliQ 7189 6926 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385143.1 protein_id gnl|my_center|LOCUS_07220 7498 7202 gene locus_tag LOCUS_07230 gene fliE 7498 7202 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385142.1 protein_id gnl|my_center|LOCUS_07230 7890 7510 gene locus_tag LOCUS_07240 7890 7510 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003754.1 protein_id gnl|my_center|LOCUS_07240 8264 7902 gene locus_tag LOCUS_07250 8264 7902 CDS product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338884.1 protein_id gnl|my_center|LOCUS_07250 8347 9678 gene locus_tag LOCUS_07260 8347 9678 CDS product ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338885.1 protein_id gnl|my_center|LOCUS_07260 10517 9681 gene locus_tag LOCUS_07270 gene flgF 10517 9681 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385138.1 protein_id gnl|my_center|LOCUS_07270 10953 10519 gene locus_tag LOCUS_07280 gene flbT 10953 10519 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724687.1 protein_id gnl|my_center|LOCUS_07280 11342 10953 gene locus_tag LOCUS_07290 gene flaF 11342 10953 CDS product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 protein_id gnl|my_center|LOCUS_07290 12986 11409 gene locus_tag LOCUS_07300 12986 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 13510 13127 gene locus_tag LOCUS_07310 13510 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 13823 13503 gene locus_tag LOCUS_07320 13823 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 13936 15324 gene locus_tag LOCUS_07330 13936 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 15337 16005 gene locus_tag LOCUS_07340 15337 16005 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY67 protein_id gnl|my_center|LOCUS_07340 >Feature sequence036 <1 344 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aggttagccgatcaggaagtgtgagccaaccgcaac 910 834 gene locus_tag LOCUS_t00080 910 834 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2143 1151 gene locus_tag LOCUS_07350 2143 1151 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920048.1 protein_id gnl|my_center|LOCUS_07350 2292 4028 gene locus_tag LOCUS_07360 gene ggt 2292 4028 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225268.1 protein_id gnl|my_center|LOCUS_07360 5271 4099 gene locus_tag LOCUS_07370 5271 4099 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528629.1 protein_id gnl|my_center|LOCUS_07370 5885 5268 gene locus_tag LOCUS_07380 5885 5268 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_07380 6011 6532 gene locus_tag LOCUS_07390 6011 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 6544 6783 gene locus_tag LOCUS_07400 6544 6783 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_07400 6784 7173 gene locus_tag LOCUS_07410 6784 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 7216 7710 gene locus_tag LOCUS_07420 7216 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310427.1 protein_id gnl|my_center|LOCUS_07420 7767 8573 gene locus_tag LOCUS_07430 7767 8573 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268548.1 protein_id gnl|my_center|LOCUS_07430 8570 9010 gene locus_tag LOCUS_07440 8570 9010 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970711.1 protein_id gnl|my_center|LOCUS_07440 9740 9015 gene locus_tag LOCUS_07450 gene rph 9740 9015 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP2 protein_id gnl|my_center|LOCUS_07450 9831 11501 gene locus_tag LOCUS_07460 gene fhs 9831 11501 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFQ8 protein_id gnl|my_center|LOCUS_07460 11542 11838 gene locus_tag LOCUS_07470 11542 11838 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265898.1 protein_id gnl|my_center|LOCUS_07470 11835 12548 gene locus_tag LOCUS_07480 11835 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393576.1 protein_id gnl|my_center|LOCUS_07480 12591 13685 gene locus_tag LOCUS_07490 gene hrcA 12591 13685 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP3 protein_id gnl|my_center|LOCUS_07490 13682 14287 gene locus_tag LOCUS_07500 gene grpE 13682 14287 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCN8 protein_id gnl|my_center|LOCUS_07500 15154 14294 gene locus_tag LOCUS_07510 15154 14294 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_07510 15495 15286 gene locus_tag LOCUS_07520 15495 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918044.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence037 907 1197 gene locus_tag LOCUS_07530 907 1197 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919993.1 protein_id gnl|my_center|LOCUS_07530 1213 2436 gene locus_tag LOCUS_07540 1213 2436 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919992.1 protein_id gnl|my_center|LOCUS_07540 2433 3887 gene locus_tag LOCUS_07550 2433 3887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 protein_id gnl|my_center|LOCUS_07550 3956 5377 gene locus_tag LOCUS_07560 3956 5377 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_07560 6655 5396 gene locus_tag LOCUS_07570 6655 5396 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_07570 7557 6712 gene locus_tag LOCUS_07580 gene tauD 7557 6712 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_07580 7617 8927 gene locus_tag LOCUS_07590 7617 8927 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919162.1 protein_id gnl|my_center|LOCUS_07590 8934 9665 gene locus_tag LOCUS_07600 8934 9665 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919163.1 protein_id gnl|my_center|LOCUS_07600 10651 9647 gene locus_tag LOCUS_07610 10651 9647 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391323.1 protein_id gnl|my_center|LOCUS_07610 12531 10759 gene locus_tag LOCUS_07620 gene sppA 12531 10759 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8B4 protein_id gnl|my_center|LOCUS_07620 12735 12809 gene locus_tag LOCUS_t00090 12735 12809 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13220 13987 gene locus_tag LOCUS_07630 13220 13987 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071944.1 protein_id gnl|my_center|LOCUS_07630 14020 15417 gene locus_tag LOCUS_07640 gene ttpC 14020 15417 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence038 58 810 gene locus_tag LOCUS_07650 gene pyrH 58 810 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C997 protein_id gnl|my_center|LOCUS_07650 810 1364 gene locus_tag LOCUS_07660 gene frr 810 1364 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z9 protein_id gnl|my_center|LOCUS_07660 1364 2125 gene locus_tag LOCUS_07670 gene uppS2 1364 2125 CDS product isoprenyl transferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KP7 protein_id gnl|my_center|LOCUS_07670 2125 2949 gene locus_tag LOCUS_07680 2125 2949 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z7 protein_id gnl|my_center|LOCUS_07680 2946 4145 gene locus_tag LOCUS_07690 gene dxr 2946 4145 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_07690 4149 5318 gene locus_tag LOCUS_07700 4149 5318 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL7 protein_id gnl|my_center|LOCUS_07700 5424 7907 gene locus_tag LOCUS_07710 gene bamA 5424 7907 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A711 protein_id gnl|my_center|LOCUS_07710 7938 8528 gene locus_tag LOCUS_07720 7938 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 8544 9560 gene locus_tag LOCUS_07730 gene lpxD 8544 9560 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A713 protein_id gnl|my_center|LOCUS_07730 9604 10395 gene locus_tag LOCUS_07740 gene lpxA 9604 10395 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR1 protein_id gnl|my_center|LOCUS_07740 10445 11245 gene locus_tag LOCUS_07750 gene lpxI 10445 11245 CDS product UDP-2,3-diacylglucosamine pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_07750 11242 12423 gene locus_tag LOCUS_07760 gene lpxB 11242 12423 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919775.1 protein_id gnl|my_center|LOCUS_07760 13325 12420 gene locus_tag LOCUS_07770 13325 12420 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939260.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 14313 13516 gene locus_tag LOCUS_07780 14313 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence039 299 1573 gene locus_tag LOCUS_07790 gene lysA 299 1573 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8H9 protein_id gnl|my_center|LOCUS_07790 1552 4311 gene locus_tag LOCUS_07800 1552 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 4417 6903 gene locus_tag LOCUS_07810 4417 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970745.1 protein_id gnl|my_center|LOCUS_07810 6968 7930 gene locus_tag LOCUS_07820 6968 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 8499 7927 gene locus_tag LOCUS_07830 gene pduO 8499 7927 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_07830 8719 8507 gene locus_tag LOCUS_07840 8719 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 9110 8802 gene locus_tag LOCUS_07850 9110 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 9336 9103 gene locus_tag LOCUS_07860 9336 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 9509 11464 gene locus_tag LOCUS_07870 9509 11464 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MII9 protein_id gnl|my_center|LOCUS_07870 11907 11461 gene locus_tag LOCUS_07880 11907 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 12386 11913 gene locus_tag LOCUS_07890 12386 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083725.1 protein_id gnl|my_center|LOCUS_07890 12573 13460 gene locus_tag LOCUS_07900 12573 13460 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529172.1 protein_id gnl|my_center|LOCUS_07900 14158 13457 gene locus_tag LOCUS_07910 14158 13457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 14334 14410 gene locus_tag LOCUS_t00100 14334 14410 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence040 <1 727 gene locus_tag LOCUS_07920 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920578.1:pilus assembly protein TadG 975 2831 gene locus_tag LOCUS_07930 975 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3857 2856 gene locus_tag LOCUS_07940 gene exsG 3857 2856 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038082.1 protein_id gnl|my_center|LOCUS_07940 3990 5417 gene locus_tag LOCUS_07950 gene xseA 3990 5417 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9G2 protein_id gnl|my_center|LOCUS_07950 5832 5581 gene locus_tag LOCUS_07960 5832 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 7835 5832 gene locus_tag LOCUS_07970 7835 5832 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 protein_id gnl|my_center|LOCUS_07970 8408 8836 gene locus_tag LOCUS_07980 8408 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_07980 9050 8841 gene locus_tag LOCUS_07990 9050 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 protein_id gnl|my_center|LOCUS_07990 11062 9218 gene locus_tag LOCUS_08000 11062 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 12238 11093 gene locus_tag LOCUS_08010 12238 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 12783 12445 gene locus_tag LOCUS_08020 12783 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08020 13257 12835 gene locus_tag LOCUS_08030 13257 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08030 <15164 13333 gene locus_tag LOCUS_08040 <15164 13333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120142.1:acriflavine resistance protein B >Feature sequence041 2 958 gene locus_tag LOCUS_08050 2 958 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 protein_id gnl|my_center|LOCUS_08050 958 1395 gene locus_tag LOCUS_08060 958 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1395 2630 gene locus_tag LOCUS_08070 1395 2630 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921026.1 protein_id gnl|my_center|LOCUS_08070 2627 2887 gene locus_tag LOCUS_08080 2627 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389896.1 protein_id gnl|my_center|LOCUS_08080 2891 3241 gene locus_tag LOCUS_08090 2891 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3741 3238 gene locus_tag LOCUS_08100 3741 3238 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_08100 4235 3741 gene locus_tag LOCUS_08110 4235 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 5127 4330 gene locus_tag LOCUS_08120 5127 4330 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919717.1 protein_id gnl|my_center|LOCUS_08120 5278 6714 gene locus_tag LOCUS_08130 gene calB 5278 6714 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A777 protein_id gnl|my_center|LOCUS_08130 6887 7186 gene locus_tag LOCUS_08140 6887 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7192 7932 gene locus_tag LOCUS_08150 7192 7932 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528748.1 protein_id gnl|my_center|LOCUS_08150 7910 9247 gene locus_tag LOCUS_08160 7910 9247 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707363.1 protein_id gnl|my_center|LOCUS_08160 10845 9244 gene locus_tag LOCUS_08170 10845 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 11724 11116 gene locus_tag LOCUS_08180 11724 11116 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTI5 protein_id gnl|my_center|LOCUS_08180 11789 12436 gene locus_tag LOCUS_08190 11789 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 12855 12433 gene locus_tag LOCUS_08200 12855 12433 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967151.1 protein_id gnl|my_center|LOCUS_08200 12906 13646 gene locus_tag LOCUS_08210 12906 13646 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence042 373 1530 gene locus_tag LOCUS_08220 gene dnaJ 373 1530 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22305 protein_id gnl|my_center|LOCUS_08220 1634 2605 gene locus_tag LOCUS_08230 1634 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3589 2636 gene locus_tag LOCUS_08240 gene oxyR 3589 2636 CDS product hyaluronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036667.1 protein_id gnl|my_center|LOCUS_08240 3702 3872 gene locus_tag LOCUS_08250 3702 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4072 4491 gene locus_tag LOCUS_08260 4072 4491 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388697.1 protein_id gnl|my_center|LOCUS_08260 4577 5572 gene locus_tag LOCUS_08270 4577 5572 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338615.1 protein_id gnl|my_center|LOCUS_08270 5592 6014 gene locus_tag LOCUS_08280 5592 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08280 6272 6099 gene locus_tag LOCUS_08290 6272 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 6379 6780 gene locus_tag LOCUS_08300 gene arsC 6379 6780 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QP0 protein_id gnl|my_center|LOCUS_08300 7197 6796 gene locus_tag LOCUS_08310 7197 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 8627 7383 gene locus_tag LOCUS_08320 8627 7383 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 protein_id gnl|my_center|LOCUS_08320 8813 9787 gene locus_tag LOCUS_08330 8813 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 10921 9860 gene locus_tag LOCUS_08340 10921 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 11068 10934 gene locus_tag LOCUS_08350 11068 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 14021 11202 gene locus_tag LOCUS_08360 14021 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 14920 14120 gene locus_tag LOCUS_08370 14920 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence043 <1 507 gene locus_tag LOCUS_08380 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYU8:bifunctional purine biosynthesis protein PurH 519 1094 gene locus_tag LOCUS_08390 519 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_08390 1415 1711 gene locus_tag LOCUS_08400 1415 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2025 2417 gene locus_tag LOCUS_08410 2025 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 3288 2470 gene locus_tag LOCUS_08420 3288 2470 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921054.1 protein_id gnl|my_center|LOCUS_08420 4189 3374 gene locus_tag LOCUS_08430 4189 3374 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_08430 4844 4194 gene locus_tag LOCUS_08440 gene tal 4844 4194 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK3 protein_id gnl|my_center|LOCUS_08440 6181 4871 gene locus_tag LOCUS_08450 6181 4871 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920240.1 protein_id gnl|my_center|LOCUS_08450 6389 7006 gene locus_tag LOCUS_08460 6389 7006 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 protein_id gnl|my_center|LOCUS_08460 8581 7064 gene locus_tag LOCUS_08470 8581 7064 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920125.1 protein_id gnl|my_center|LOCUS_08470 9468 8752 gene locus_tag LOCUS_08480 9468 8752 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639954.1 protein_id gnl|my_center|LOCUS_08480 10110 9514 gene locus_tag LOCUS_08490 10110 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08490 10305 10135 gene locus_tag LOCUS_08500 10305 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08500 10723 10310 gene locus_tag LOCUS_08510 10723 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 11040 10720 gene locus_tag LOCUS_08520 11040 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 11124 11978 gene locus_tag LOCUS_08530 11124 11978 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_08530 13769 11979 gene locus_tag LOCUS_08540 13769 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 protein_id gnl|my_center|LOCUS_08540 13895 14221 gene locus_tag LOCUS_08550 13895 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 14234 14629 gene locus_tag LOCUS_08560 14234 14629 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709623.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence044 <1 983 gene locus_tag LOCUS_08570 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918343.1:alkaline phosphatase 1745 987 gene locus_tag LOCUS_08580 1745 987 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720866.1 protein_id gnl|my_center|LOCUS_08580 2072 1752 gene locus_tag LOCUS_08590 2072 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2305 2138 gene locus_tag LOCUS_08600 2305 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3107 2424 gene locus_tag LOCUS_08610 gene dgcA 3107 2424 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_08610 3234 3725 gene locus_tag LOCUS_08620 gene purE 3234 3725 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIL3 protein_id gnl|my_center|LOCUS_08620 3722 4801 gene locus_tag LOCUS_08630 gene purK 3722 4801 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J672 protein_id gnl|my_center|LOCUS_08630 4807 5562 gene locus_tag LOCUS_08640 4807 5562 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_08640 5648 6379 gene locus_tag LOCUS_08650 5648 6379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_08650 6376 7131 gene locus_tag LOCUS_08660 6376 7131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_08660 7135 9027 gene locus_tag LOCUS_08670 7135 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_08670 9024 10073 gene locus_tag LOCUS_08680 9024 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 10733 10074 gene locus_tag LOCUS_08690 10733 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528826.1 protein_id gnl|my_center|LOCUS_08690 13614 10843 gene locus_tag LOCUS_08700 13614 10843 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A299 protein_id gnl|my_center|LOCUS_08700 >Feature sequence045 935 1363 gene locus_tag LOCUS_08710 935 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1814 1350 gene locus_tag LOCUS_08720 1814 1350 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820813.1 protein_id gnl|my_center|LOCUS_08720 1910 2293 gene locus_tag LOCUS_08730 1910 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2305 2478 gene locus_tag LOCUS_08740 2305 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 2429 4360 gene locus_tag LOCUS_08750 gene ggt 2429 4360 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_08750 4393 5046 gene locus_tag LOCUS_08760 4393 5046 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919423.1 protein_id gnl|my_center|LOCUS_08760 5051 5464 gene locus_tag LOCUS_08770 5051 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5950 5471 gene locus_tag LOCUS_08780 gene smpB 5950 5471 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H482 protein_id gnl|my_center|LOCUS_08780 6583 5960 gene locus_tag LOCUS_08790 6583 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 6491 6829 gene locus_tag LOCUS_08800 6491 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6944 9361 gene locus_tag LOCUS_08810 6944 9361 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640172.1 protein_id gnl|my_center|LOCUS_08810 9491 9748 gene locus_tag LOCUS_08820 9491 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10280 10570 gene locus_tag LOCUS_08830 10280 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 12477 10603 gene locus_tag LOCUS_08840 12477 10603 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090526.1 protein_id gnl|my_center|LOCUS_08840 13300 12515 gene locus_tag LOCUS_08850 13300 12515 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888251.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence046 2099 1236 gene locus_tag LOCUS_08860 2099 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 8689 2102 gene locus_tag LOCUS_08870 8689 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 13803 8686 gene locus_tag LOCUS_08880 13803 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence047 138 1058 gene locus_tag LOCUS_08890 138 1058 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_08890 1124 1492 gene locus_tag LOCUS_08900 1124 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2142 1513 gene locus_tag LOCUS_08910 2142 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2832 3953 gene locus_tag LOCUS_08920 2832 3953 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN15 protein_id gnl|my_center|LOCUS_08920 5053 4004 gene locus_tag LOCUS_08930 5053 4004 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970096.1 protein_id gnl|my_center|LOCUS_08930 5513 5043 gene locus_tag LOCUS_08940 5513 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 8836 5510 gene locus_tag LOCUS_08950 gene wssE 8836 5510 CDS product cellulose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103390.1 protein_id gnl|my_center|LOCUS_08950 13167 8833 gene locus_tag LOCUS_08960 13167 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence048 1979 1188 gene locus_tag LOCUS_08970 1979 1188 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887421.1 protein_id gnl|my_center|LOCUS_08970 3511 1976 gene locus_tag LOCUS_08980 gene hutH 3511 1976 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31197 protein_id gnl|my_center|LOCUS_08980 4715 3516 gene locus_tag LOCUS_08990 gene hutI 4715 3516 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31196 protein_id gnl|my_center|LOCUS_08990 5043 6161 gene locus_tag LOCUS_09000 gene hutF 5043 6161 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 protein_id gnl|my_center|LOCUS_09000 6158 6850 gene locus_tag LOCUS_09010 gene hutC 6158 6850 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 protein_id gnl|my_center|LOCUS_09010 7029 7451 gene locus_tag LOCUS_09020 7029 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 7444 8454 gene locus_tag LOCUS_09030 7444 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 9016 11760 gene locus_tag LOCUS_09040 gene btuB 9016 11760 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037992.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence049 29 1429 gene locus_tag LOCUS_09050 29 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2783 1449 gene locus_tag LOCUS_09060 2783 1449 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024335.1 protein_id gnl|my_center|LOCUS_09060 3894 2785 gene locus_tag LOCUS_09070 3894 2785 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_09070 5216 3924 gene locus_tag LOCUS_09080 5216 3924 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142201.1 protein_id gnl|my_center|LOCUS_09080 6187 5411 gene locus_tag LOCUS_09090 6187 5411 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722266.1 protein_id gnl|my_center|LOCUS_09090 6299 6844 gene locus_tag LOCUS_09100 6299 6844 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_09100 7085 6852 gene locus_tag LOCUS_09110 7085 6852 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_09110 9073 7088 gene locus_tag LOCUS_09120 9073 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291950.1 protein_id gnl|my_center|LOCUS_09120 9665 9075 gene locus_tag LOCUS_09130 gene cysE 9665 9075 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723512.1 protein_id gnl|my_center|LOCUS_09130 9870 10835 gene locus_tag LOCUS_09140 9870 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 10916 11515 gene locus_tag LOCUS_09150 10916 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 11655 12821 gene locus_tag LOCUS_09160 11655 12821 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089534.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence050 1093 425 gene locus_tag LOCUS_09170 1093 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1246 1782 gene locus_tag LOCUS_09180 1246 1782 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9U0 protein_id gnl|my_center|LOCUS_09180 1850 2758 gene locus_tag LOCUS_09190 1850 2758 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_09190 3965 2772 gene locus_tag LOCUS_09200 3965 2772 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0V6 protein_id gnl|my_center|LOCUS_09200 4049 5179 gene locus_tag LOCUS_09210 4049 5179 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_09210 5179 6069 gene locus_tag LOCUS_09220 5179 6069 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_09220 6088 6285 gene locus_tag LOCUS_09230 6088 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 6367 7824 gene locus_tag LOCUS_09240 6367 7824 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_09240 8810 7860 gene locus_tag LOCUS_09250 8810 7860 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919958.1 protein_id gnl|my_center|LOCUS_09250 8834 9784 gene locus_tag LOCUS_09260 gene miaA 8834 9784 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G43 protein_id gnl|my_center|LOCUS_09260 9958 11736 gene locus_tag LOCUS_09270 9958 11736 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA17 protein_id gnl|my_center|LOCUS_09270 11784 12002 gene locus_tag LOCUS_09280 11784 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 11999 12571 gene locus_tag LOCUS_09290 gene ilvH 11999 12571 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089241.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence051 743 57 gene locus_tag LOCUS_09300 743 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1078 851 gene locus_tag LOCUS_09310 1078 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2428 1220 gene locus_tag LOCUS_09320 2428 1220 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921291.1 protein_id gnl|my_center|LOCUS_09320 4168 2564 gene locus_tag LOCUS_09330 4168 2564 CDS product heme utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088867.1 protein_id gnl|my_center|LOCUS_09330 5388 4240 gene locus_tag LOCUS_09340 5388 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 6115 5555 gene locus_tag LOCUS_09350 6115 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7345 6143 gene locus_tag LOCUS_09360 7345 6143 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969318.1 protein_id gnl|my_center|LOCUS_09360 7495 8118 gene locus_tag LOCUS_09370 7495 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 8188 8751 gene locus_tag LOCUS_09380 8188 8751 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_09380 8748 10463 gene locus_tag LOCUS_09390 8748 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 11243 10467 gene locus_tag LOCUS_09400 gene paaG 11243 10467 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 protein_id gnl|my_center|LOCUS_09400 11964 11260 gene locus_tag LOCUS_09410 11964 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530129.1 protein_id gnl|my_center|LOCUS_09410 12529 11954 gene locus_tag LOCUS_09420 12529 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence052 1377 250 gene locus_tag LOCUS_09430 1377 250 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_09430 2253 1429 gene locus_tag LOCUS_09440 2253 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2891 2289 gene locus_tag LOCUS_09450 2891 2289 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403296.1 protein_id gnl|my_center|LOCUS_09450 3441 3007 gene locus_tag LOCUS_09460 3441 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3683 4588 gene locus_tag LOCUS_09470 3683 4588 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265975.1 protein_id gnl|my_center|LOCUS_09470 4648 5337 gene locus_tag LOCUS_09480 4648 5337 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_09480 6881 5334 gene locus_tag LOCUS_09490 gene yhcX 6881 5334 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_09490 8215 6914 gene locus_tag LOCUS_09500 8215 6914 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_09500 8906 8223 gene locus_tag LOCUS_09510 8906 8223 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 protein_id gnl|my_center|LOCUS_09510 9319 8903 gene locus_tag LOCUS_09520 9319 8903 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338743.1 protein_id gnl|my_center|LOCUS_09520 9426 10310 gene locus_tag LOCUS_09530 9426 10310 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920766.1 protein_id gnl|my_center|LOCUS_09530 10527 10709 gene locus_tag LOCUS_09540 10527 10709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 10709 11746 gene locus_tag LOCUS_09550 10709 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 11810 12265 gene locus_tag LOCUS_09560 gene dut 11810 12265 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_09560 12436 12633 gene locus_tag LOCUS_09570 12436 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence053 1583 705 gene locus_tag LOCUS_09580 1583 705 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921384.1 protein_id gnl|my_center|LOCUS_09580 2173 1652 gene locus_tag LOCUS_09590 2173 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2370 3143 gene locus_tag LOCUS_09600 gene dapB 2370 3143 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU4 protein_id gnl|my_center|LOCUS_09600 3242 3646 gene locus_tag LOCUS_09610 3242 3646 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_09610 3646 3951 gene locus_tag LOCUS_09620 3646 3951 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 protein_id gnl|my_center|LOCUS_09620 4508 6052 gene locus_tag LOCUS_09630 4508 6052 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920331.1 protein_id gnl|my_center|LOCUS_09630 6773 6102 gene locus_tag LOCUS_09640 6773 6102 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_09640 6972 8246 gene locus_tag LOCUS_09650 6972 8246 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405234.1 protein_id gnl|my_center|LOCUS_09650 9003 8278 gene locus_tag LOCUS_09660 9003 8278 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038499.1 protein_id gnl|my_center|LOCUS_09660 9078 10544 gene locus_tag LOCUS_09670 gene clsA 9078 10544 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEI2 protein_id gnl|my_center|LOCUS_09670 11743 10541 gene locus_tag LOCUS_09680 11743 10541 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919107.1 protein_id gnl|my_center|LOCUS_09680 12299 11877 gene locus_tag LOCUS_09690 12299 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence054 <1 860 gene locus_tag LOCUS_09700 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072178.1:isoaspartyl peptidase/L-asparaginase 899 1924 gene locus_tag LOCUS_09710 899 1924 CDS product Galanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074255.1 protein_id gnl|my_center|LOCUS_09710 2033 2398 gene locus_tag LOCUS_09720 2033 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2634 4061 gene locus_tag LOCUS_09730 gene xylE 2634 4061 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 protein_id gnl|my_center|LOCUS_09730 4133 6721 gene locus_tag LOCUS_09740 gene celD 4133 6721 CDS product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 protein_id gnl|my_center|LOCUS_09740 8525 6783 gene locus_tag LOCUS_09750 8525 6783 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920643.1 protein_id gnl|my_center|LOCUS_09750 8645 9769 gene locus_tag LOCUS_09760 8645 9769 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4M7 protein_id gnl|my_center|LOCUS_09760 9909 10967 gene locus_tag LOCUS_09770 gene xylR 9909 10967 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920901.1 protein_id gnl|my_center|LOCUS_09770 11856 10975 gene locus_tag LOCUS_09780 11856 10975 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923249.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence055 783 1679 gene locus_tag LOCUS_09790 783 1679 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_09790 2756 1755 gene locus_tag LOCUS_09800 2756 1755 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388814.1 protein_id gnl|my_center|LOCUS_09800 3332 2823 gene locus_tag LOCUS_09810 3332 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3376 4101 gene locus_tag LOCUS_09820 gene thiE 3376 4101 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD41 protein_id gnl|my_center|LOCUS_09820 4436 4098 gene locus_tag LOCUS_09830 4436 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4627 5193 gene locus_tag LOCUS_09840 gene efp 4627 5193 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_09840 5202 6017 gene locus_tag LOCUS_09850 5202 6017 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640711.1 protein_id gnl|my_center|LOCUS_09850 6116 7612 gene locus_tag LOCUS_09860 6116 7612 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_09860 7685 7849 gene locus_tag LOCUS_09870 7685 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 9687 7855 gene locus_tag LOCUS_09880 9687 7855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921107.1 protein_id gnl|my_center|LOCUS_09880 9858 10076 gene locus_tag LOCUS_09890 gene rpmE 9858 10076 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UB0 protein_id gnl|my_center|LOCUS_09890 10244 10744 gene locus_tag LOCUS_09900 10244 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 10824 11573 gene locus_tag LOCUS_09910 10824 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 12143 11559 gene locus_tag LOCUS_09920 12143 11559 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920071.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence056 990 19 gene locus_tag LOCUS_09930 990 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1185 2456 gene locus_tag LOCUS_09940 gene purB 1185 2456 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IE9 protein_id gnl|my_center|LOCUS_09940 3102 2467 gene locus_tag LOCUS_09950 gene eda 3102 2467 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385800.1 protein_id gnl|my_center|LOCUS_09950 4064 3099 gene locus_tag LOCUS_09960 gene glk 4064 3099 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLD7 protein_id gnl|my_center|LOCUS_09960 5901 4069 gene locus_tag LOCUS_09970 gene edd 5901 4069 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971001.1 protein_id gnl|my_center|LOCUS_09970 6596 5901 gene locus_tag LOCUS_09980 gene pgl 6596 5901 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337699.1 protein_id gnl|my_center|LOCUS_09980 8086 6617 gene locus_tag LOCUS_09990 gene zwf 8086 6617 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S2 protein_id gnl|my_center|LOCUS_09990 8355 9371 gene locus_tag LOCUS_10000 8355 9371 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920145.1 protein_id gnl|my_center|LOCUS_10000 10978 9368 gene locus_tag LOCUS_10010 10978 9368 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640457.1 protein_id gnl|my_center|LOCUS_10010 11151 11076 gene locus_tag LOCUS_t00110 11151 11076 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11223 11765 gene locus_tag LOCUS_10020 11223 11765 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808796.1 protein_id gnl|my_center|LOCUS_10020 <12514 11828 gene locus_tag LOCUS_10030 <12514 11828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001326672.1:elongation factor Tu >Feature sequence057 2313 934 gene locus_tag LOCUS_10040 2313 934 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5Z7 protein_id gnl|my_center|LOCUS_10040 2466 3764 gene locus_tag LOCUS_10050 2466 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 5158 3761 gene locus_tag LOCUS_10060 5158 3761 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920161.1 protein_id gnl|my_center|LOCUS_10060 5915 5208 gene locus_tag LOCUS_10070 gene rpiA 5915 5208 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ0 protein_id gnl|my_center|LOCUS_10070 7285 5915 gene locus_tag LOCUS_10080 gene glmU 7285 5915 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5Z3 protein_id gnl|my_center|LOCUS_10080 7364 8053 gene locus_tag LOCUS_10090 7364 8053 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708236.1 protein_id gnl|my_center|LOCUS_10090 8298 8050 gene locus_tag LOCUS_10100 8298 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8779 8853 gene locus_tag LOCUS_t00120 8779 8853 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9078 9812 gene locus_tag LOCUS_10110 9078 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_10110 9812 11074 gene locus_tag LOCUS_10120 9812 11074 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639932.1 protein_id gnl|my_center|LOCUS_10120 11071 12060 gene locus_tag LOCUS_10130 gene lpxK 11071 12060 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYH3 protein_id gnl|my_center|LOCUS_10130 >Feature sequence058 1388 510 gene locus_tag LOCUS_10140 gene atpG 1388 510 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J432 protein_id gnl|my_center|LOCUS_10140 2961 1426 gene locus_tag LOCUS_10150 gene atpA 2961 1426 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV20 protein_id gnl|my_center|LOCUS_10150 3545 2970 gene locus_tag LOCUS_10160 gene atpH 3545 2970 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2V6 protein_id gnl|my_center|LOCUS_10160 5879 3711 gene locus_tag LOCUS_10170 gene priA 5879 3711 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB85 protein_id gnl|my_center|LOCUS_10170 5982 6965 gene locus_tag LOCUS_10180 5982 6965 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_10180 6973 8322 gene locus_tag LOCUS_10190 6973 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_10190 9809 8406 gene locus_tag LOCUS_10200 9809 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 10197 10006 gene locus_tag LOCUS_10210 10197 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 11492 10866 gene locus_tag LOCUS_10220 11492 10866 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TA7 protein_id gnl|my_center|LOCUS_10220 11918 11502 gene locus_tag LOCUS_10230 11918 11502 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_10230 12347 11931 gene locus_tag LOCUS_10240 12347 11931 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence059 <1 502 gene locus_tag LOCUS_10250 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A354:putative glycine dehydrogenase (decarboxylating) subunit 2 1897 506 gene locus_tag LOCUS_10260 1897 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 2020 2370 gene locus_tag LOCUS_10270 2020 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2544 3914 gene locus_tag LOCUS_10280 2544 3914 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 protein_id gnl|my_center|LOCUS_10280 3911 5182 gene locus_tag LOCUS_10290 3911 5182 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_10290 8609 5205 gene locus_tag LOCUS_10300 8609 5205 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974358.1 protein_id gnl|my_center|LOCUS_10300 8828 9307 gene locus_tag LOCUS_10310 8828 9307 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 protein_id gnl|my_center|LOCUS_10310 9419 11203 gene locus_tag LOCUS_10320 9419 11203 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917969.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence060 1091 1441 gene locus_tag LOCUS_10330 gene rpoZ 1091 1441 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58066 protein_id gnl|my_center|LOCUS_10330 1450 3714 gene locus_tag LOCUS_10340 gene spoT 1450 3714 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919427.1 protein_id gnl|my_center|LOCUS_10340 3704 4285 gene locus_tag LOCUS_10350 gene pyrE 3704 4285 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ9 protein_id gnl|my_center|LOCUS_10350 4285 5040 gene locus_tag LOCUS_10360 gene pdxJ 4285 5040 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_10360 5037 5447 gene locus_tag LOCUS_10370 gene acpS 5037 5447 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A807 protein_id gnl|my_center|LOCUS_10370 5444 6199 gene locus_tag LOCUS_10380 gene rnc 5444 6199 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W1 protein_id gnl|my_center|LOCUS_10380 6196 7143 gene locus_tag LOCUS_10390 gene era 6196 7143 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58071 protein_id gnl|my_center|LOCUS_10390 7140 7871 gene locus_tag LOCUS_10400 gene recO 7140 7871 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVD0 protein_id gnl|my_center|LOCUS_10400 8482 7868 gene locus_tag LOCUS_10410 8482 7868 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 protein_id gnl|my_center|LOCUS_10410 8631 8819 gene locus_tag LOCUS_10420 8631 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 9276 8824 gene locus_tag LOCUS_10430 9276 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10430 9507 9331 gene locus_tag LOCUS_10440 9507 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 9639 11873 gene locus_tag LOCUS_10450 gene parC 9639 11873 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8F5 protein_id gnl|my_center|LOCUS_10450 >Feature sequence061 1778 813 gene locus_tag LOCUS_10460 1778 813 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6U4 protein_id gnl|my_center|LOCUS_10460 1943 2497 gene locus_tag LOCUS_10470 1943 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2555 3958 gene locus_tag LOCUS_10480 2555 3958 CDS product Zn-dependent protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265953.1 protein_id gnl|my_center|LOCUS_10480 4056 4514 gene locus_tag LOCUS_10490 4056 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6187 4592 gene locus_tag LOCUS_10500 gene yhiP 6187 4592 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_10500 7674 6295 gene locus_tag LOCUS_10510 7674 6295 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921243.1 protein_id gnl|my_center|LOCUS_10510 7652 8413 gene locus_tag LOCUS_10520 7652 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 9168 8410 gene locus_tag LOCUS_10530 9168 8410 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2Z1 protein_id gnl|my_center|LOCUS_10530 9234 10607 gene locus_tag LOCUS_10540 9234 10607 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056076.1 protein_id gnl|my_center|LOCUS_10540 10683 11819 gene locus_tag LOCUS_10550 gene ubiA 10683 11819 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBU3 protein_id gnl|my_center|LOCUS_10550 12075 11896 gene locus_tag LOCUS_10560 12075 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence062 1078 1293 gene locus_tag LOCUS_10570 1078 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2165 1290 gene locus_tag LOCUS_10580 2165 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3893 2184 gene locus_tag LOCUS_10590 3893 2184 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919191.1 protein_id gnl|my_center|LOCUS_10590 4165 4728 gene locus_tag LOCUS_10600 4165 4728 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6D2 protein_id gnl|my_center|LOCUS_10600 5737 4748 gene locus_tag LOCUS_10610 gene secF 5737 4748 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33568 protein_id gnl|my_center|LOCUS_10610 7363 5756 gene locus_tag LOCUS_10620 gene secD 7363 5756 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6U2 protein_id gnl|my_center|LOCUS_10620 7783 7412 gene locus_tag LOCUS_10630 gene YajC 7783 7412 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_10630 8529 7876 gene locus_tag LOCUS_10640 gene pcm 8529 7876 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJT8 protein_id gnl|my_center|LOCUS_10640 9278 8517 gene locus_tag LOCUS_10650 gene surE 9278 8517 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T5 protein_id gnl|my_center|LOCUS_10650 9610 9422 gene locus_tag LOCUS_10660 9610 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10660 10708 9629 gene locus_tag LOCUS_10670 gene serS 10708 9629 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5J2 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10670 11626 10796 gene locus_tag LOCUS_10680 gene tatC 11626 10796 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CB23 protein_id gnl|my_center|LOCUS_10680 12048 11623 gene locus_tag LOCUS_10690 12048 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence063 450 2624 gene locus_tag LOCUS_10700 gene ppk1 450 2624 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7E3 protein_id gnl|my_center|LOCUS_10700 2624 4102 gene locus_tag LOCUS_10710 gene ppx1 2624 4102 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919577.1 protein_id gnl|my_center|LOCUS_10710 5278 4112 gene locus_tag LOCUS_10720 gene rnd 5278 4112 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9G5 protein_id gnl|my_center|LOCUS_10720 5376 7208 gene locus_tag LOCUS_10730 5376 7208 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640360.1 protein_id gnl|my_center|LOCUS_10730 7983 7270 gene locus_tag LOCUS_10740 7983 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640359.1 protein_id gnl|my_center|LOCUS_10740 7982 8185 gene locus_tag LOCUS_10750 7982 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 10435 8195 gene locus_tag LOCUS_10760 10435 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 10633 11025 gene locus_tag LOCUS_10770 10633 11025 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640357.1 protein_id gnl|my_center|LOCUS_10770 11018 11566 gene locus_tag LOCUS_10780 11018 11566 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921521.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence064 711 2918 gene locus_tag LOCUS_10790 gene katG 711 2918 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRK1 protein_id gnl|my_center|LOCUS_10790 3816 2974 gene locus_tag LOCUS_10800 gene rsmA 3816 2974 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGD5 protein_id gnl|my_center|LOCUS_10800 4784 3813 gene locus_tag LOCUS_10810 gene pdxA 4784 3813 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8R1 protein_id gnl|my_center|LOCUS_10810 6104 4860 gene locus_tag LOCUS_10820 6104 4860 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8Y4 protein_id gnl|my_center|LOCUS_10820 8484 6265 gene locus_tag LOCUS_10830 gene lptD 8484 6265 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7N2 protein_id gnl|my_center|LOCUS_10830 9719 8613 gene locus_tag LOCUS_10840 gene dprA 9719 8613 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920305.1 protein_id gnl|my_center|LOCUS_10840 10333 9716 gene locus_tag LOCUS_10850 gene plsY 10333 9716 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFU1 protein_id gnl|my_center|LOCUS_10850 11682 10402 gene locus_tag LOCUS_10860 gene pyrC 11682 10402 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAV9 protein_id gnl|my_center|LOCUS_10860 11942 11679 gene locus_tag LOCUS_10870 11942 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence065 <1 539 gene locus_tag LOCUS_10880 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920431.1:enoyl-CoA hydratase 1741 536 gene locus_tag LOCUS_10890 1741 536 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_10890 1898 2596 gene locus_tag LOCUS_10900 1898 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2593 3096 gene locus_tag LOCUS_10910 2593 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 3234 3599 gene locus_tag LOCUS_10920 3234 3599 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888244.1 protein_id gnl|my_center|LOCUS_10920 3599 4645 gene locus_tag LOCUS_10930 3599 4645 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530550.1 protein_id gnl|my_center|LOCUS_10930 4733 5095 gene locus_tag LOCUS_10940 4733 5095 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A861 protein_id gnl|my_center|LOCUS_10940 5247 5585 gene locus_tag LOCUS_10950 5247 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10950 5737 5648 gene locus_tag LOCUS_t00130 5737 5648 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6077 7213 gene locus_tag LOCUS_10960 6077 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 7335 8486 gene locus_tag LOCUS_10970 7335 8486 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_10970 8479 9132 gene locus_tag LOCUS_10980 gene tmk 8479 9132 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9D5 protein_id gnl|my_center|LOCUS_10980 9132 10067 gene locus_tag LOCUS_10990 9132 10067 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919689.1 protein_id gnl|my_center|LOCUS_10990 10077 10850 gene locus_tag LOCUS_11000 10077 10850 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919688.1 protein_id gnl|my_center|LOCUS_11000 10850 11641 gene locus_tag LOCUS_11010 10850 11641 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919687.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence066 364 1644 gene locus_tag LOCUS_11020 gene eno 364 1644 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT60 protein_id gnl|my_center|LOCUS_11020 1715 2014 gene locus_tag LOCUS_11030 1715 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2082 3095 gene locus_tag LOCUS_11040 gene pdhA 2082 3095 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E8 protein_id gnl|my_center|LOCUS_11040 3151 4551 gene locus_tag LOCUS_11050 3151 4551 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919595.1 protein_id gnl|my_center|LOCUS_11050 4561 5904 gene locus_tag LOCUS_11060 4561 5904 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8F0 protein_id gnl|my_center|LOCUS_11060 5901 6287 gene locus_tag LOCUS_11070 5901 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6284 7699 gene locus_tag LOCUS_11080 6284 7699 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y975 protein_id gnl|my_center|LOCUS_11080 7734 8948 gene locus_tag LOCUS_11090 gene mntH 7734 8948 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_11090 8945 9706 gene locus_tag LOCUS_11100 8945 9706 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY19 protein_id gnl|my_center|LOCUS_11100 9703 10332 gene locus_tag LOCUS_11110 9703 10332 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_11110 10329 11264 gene locus_tag LOCUS_11120 10329 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816816.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence067 399 115 gene locus_tag LOCUS_11130 399 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 509 1657 gene locus_tag LOCUS_11140 509 1657 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067711.1 protein_id gnl|my_center|LOCUS_11140 3063 1654 gene locus_tag LOCUS_11150 3063 1654 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923265.1 protein_id gnl|my_center|LOCUS_11150 3683 3060 gene locus_tag LOCUS_11160 3683 3060 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920422.1 protein_id gnl|my_center|LOCUS_11160 4626 3688 gene locus_tag LOCUS_11170 4626 3688 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A316 protein_id gnl|my_center|LOCUS_11170 5866 4676 gene locus_tag LOCUS_11180 5866 4676 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921220.1 protein_id gnl|my_center|LOCUS_11180 6629 5883 gene locus_tag LOCUS_11190 6629 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6754 8526 gene locus_tag LOCUS_11200 6754 8526 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921222.1 protein_id gnl|my_center|LOCUS_11200 9678 8530 gene locus_tag LOCUS_11210 9678 8530 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968228.1 protein_id gnl|my_center|LOCUS_11210 9870 10409 gene locus_tag LOCUS_11220 9870 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence068 548 18 gene locus_tag LOCUS_11230 548 18 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640439.1 protein_id gnl|my_center|LOCUS_11230 1258 545 gene locus_tag LOCUS_11240 1258 545 CDS product MJ0042 family finger-like domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265776.1 protein_id gnl|my_center|LOCUS_11240 1322 2080 gene locus_tag LOCUS_11250 1322 2080 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920077.1 protein_id gnl|my_center|LOCUS_11250 2081 2953 gene locus_tag LOCUS_11260 2081 2953 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537455.1 protein_id gnl|my_center|LOCUS_11260 3001 3540 gene locus_tag LOCUS_11270 3001 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920079.1 protein_id gnl|my_center|LOCUS_11270 3560 4300 gene locus_tag LOCUS_11280 3560 4300 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920080.1 protein_id gnl|my_center|LOCUS_11280 4319 5338 gene locus_tag LOCUS_11290 4319 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 5401 5982 gene locus_tag LOCUS_11300 5401 5982 CDS product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920062.1 protein_id gnl|my_center|LOCUS_11300 6125 6688 gene locus_tag LOCUS_11310 6125 6688 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 protein_id gnl|my_center|LOCUS_11310 6946 7962 gene locus_tag LOCUS_11320 gene desA 6946 7962 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125366.1 protein_id gnl|my_center|LOCUS_11320 8420 7989 gene locus_tag LOCUS_11330 8420 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 9862 8432 gene locus_tag LOCUS_11340 9862 8432 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF6 protein_id gnl|my_center|LOCUS_11340 11208 9943 gene locus_tag LOCUS_11350 11208 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence069 817 1281 gene locus_tag LOCUS_11360 817 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1331 2218 gene locus_tag LOCUS_11370 1331 2218 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_11370 2316 3308 gene locus_tag LOCUS_11380 2316 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039772.1 protein_id gnl|my_center|LOCUS_11380 3356 4498 gene locus_tag LOCUS_11390 gene tgt 3356 4498 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y1 protein_id gnl|my_center|LOCUS_11390 5141 4407 gene locus_tag LOCUS_11400 5141 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919463.1 protein_id gnl|my_center|LOCUS_11400 5281 5356 gene locus_tag LOCUS_t00140 5281 5356 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5527 5925 gene locus_tag LOCUS_11410 5527 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 6037 6294 gene locus_tag LOCUS_11420 6037 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 <11401 6325 gene locus_tag LOCUS_11430 <11401 6325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:polyketide synthase >Feature sequence070 1 504 gene locus_tag LOCUS_11440 1 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 568 1710 gene locus_tag LOCUS_11450 568 1710 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528103.1 protein_id gnl|my_center|LOCUS_11450 1707 2987 gene locus_tag LOCUS_11460 gene hfsI 1707 2987 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 protein_id gnl|my_center|LOCUS_11460 3261 3043 gene locus_tag LOCUS_11470 3261 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4458 3469 gene locus_tag LOCUS_11480 4458 3469 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_11480 5602 4640 gene locus_tag LOCUS_11490 5602 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 7137 5617 gene locus_tag LOCUS_11500 7137 5617 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_11500 8279 7314 gene locus_tag LOCUS_11510 8279 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 9045 8350 gene locus_tag LOCUS_11520 9045 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 9893 9414 gene locus_tag LOCUS_11530 9893 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918058.1 protein_id gnl|my_center|LOCUS_11530 10885 10049 gene locus_tag LOCUS_11540 10885 10049 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918057.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence071 1270 833 gene locus_tag LOCUS_11550 1270 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1483 2709 gene locus_tag LOCUS_11560 1483 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2773 3201 gene locus_tag LOCUS_11570 2773 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3217 4179 gene locus_tag LOCUS_11580 3217 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4203 5537 gene locus_tag LOCUS_11590 4203 5537 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_11590 5551 6882 gene locus_tag LOCUS_11600 5551 6882 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918830.1 protein_id gnl|my_center|LOCUS_11600 6879 7637 gene locus_tag LOCUS_11610 6879 7637 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808069.1 protein_id gnl|my_center|LOCUS_11610 7634 8704 gene locus_tag LOCUS_11620 7634 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_11620 9669 8770 gene locus_tag LOCUS_11630 9669 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 11091 9787 gene locus_tag LOCUS_11640 11091 9787 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_11640 11348 11106 gene locus_tag LOCUS_11650 11348 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence072 <1 1018 gene locus_tag LOCUS_11660 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000230338.1:sodium/hydrogen exchanger 1745 1026 gene locus_tag LOCUS_11670 1745 1026 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083731.1 protein_id gnl|my_center|LOCUS_11670 1815 3431 gene locus_tag LOCUS_11680 1815 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3517 4338 gene locus_tag LOCUS_11690 3517 4338 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_11690 4421 4903 gene locus_tag LOCUS_11700 4421 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4896 7472 gene locus_tag LOCUS_11710 4896 7472 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 protein_id gnl|my_center|LOCUS_11710 8566 7511 gene locus_tag LOCUS_11720 8566 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636161.2 protein_id gnl|my_center|LOCUS_11720 8809 10896 gene locus_tag LOCUS_11730 8809 10896 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089593.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence073 1159 2229 gene locus_tag LOCUS_11740 1159 2229 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919561.1 protein_id gnl|my_center|LOCUS_11740 2229 3350 gene locus_tag LOCUS_11750 2229 3350 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919560.1 protein_id gnl|my_center|LOCUS_11750 3418 6006 gene locus_tag LOCUS_11760 gene topA 3418 6006 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 protein_id gnl|my_center|LOCUS_11760 6065 8353 gene locus_tag LOCUS_11770 gene rnr 6065 8353 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAS2 protein_id gnl|my_center|LOCUS_11770 8358 9101 gene locus_tag LOCUS_11780 8358 9101 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920315.1 protein_id gnl|my_center|LOCUS_11780 9186 9353 gene locus_tag LOCUS_11790 gene rpmG 9186 9353 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I8 protein_id gnl|my_center|LOCUS_11790 10653 9415 gene locus_tag LOCUS_11800 10653 9415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528915.1 protein_id gnl|my_center|LOCUS_11800 <11285 10679 gene locus_tag LOCUS_11810 <11285 10679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GZM2:response regulator PleD >Feature sequence074 106 498 gene locus_tag LOCUS_11820 106 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 625 536 gene locus_tag LOCUS_t00150 625 536 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 854 1795 gene locus_tag LOCUS_11830 854 1795 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 protein_id gnl|my_center|LOCUS_11830 3086 1806 gene locus_tag LOCUS_11840 3086 1806 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123037.1 protein_id gnl|my_center|LOCUS_11840 5088 3169 gene locus_tag LOCUS_11850 5088 3169 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528095.1 protein_id gnl|my_center|LOCUS_11850 5344 6549 gene locus_tag LOCUS_11860 5344 6549 CDS product succinyl-CoA--D-citramalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGE3 protein_id gnl|my_center|LOCUS_11860 7370 6555 gene locus_tag LOCUS_11870 7370 6555 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087150.1 protein_id gnl|my_center|LOCUS_11870 7549 8166 gene locus_tag LOCUS_11880 gene rpsD 7549 8166 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5D9 protein_id gnl|my_center|LOCUS_11880 8243 9070 gene locus_tag LOCUS_11890 8243 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 9720 9067 gene locus_tag LOCUS_11900 9720 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 10667 9744 gene locus_tag LOCUS_11910 10667 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence075 <1 770 gene locus_tag LOCUS_11920 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071759.1:type I polyketide synthase 1013 2218 gene locus_tag LOCUS_11930 1013 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2215 8310 gene locus_tag LOCUS_11940 2215 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 8514 8816 gene locus_tag LOCUS_11950 8514 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11950 8854 9018 gene locus_tag LOCUS_11960 8854 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 9417 9503 gene locus_tag LOCUS_t00160 9417 9503 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9909 10667 gene locus_tag LOCUS_11970 9909 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence076 425 1987 gene locus_tag LOCUS_11980 425 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 3600 2053 gene locus_tag LOCUS_11990 3600 2053 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_11990 4295 3711 gene locus_tag LOCUS_12000 4295 3711 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_12000 4693 4292 gene locus_tag LOCUS_12010 4693 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338370.1 protein_id gnl|my_center|LOCUS_12010 5619 4690 gene locus_tag LOCUS_12020 5619 4690 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531310.1 protein_id gnl|my_center|LOCUS_12020 5801 6712 gene locus_tag LOCUS_12030 5801 6712 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_12030 6719 7687 gene locus_tag LOCUS_12040 gene ephA 6719 7687 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_12040 9207 7708 gene locus_tag LOCUS_12050 9207 7708 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q5 protein_id gnl|my_center|LOCUS_12050 9929 9339 gene locus_tag LOCUS_12060 gene rplI 9929 9339 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q3 protein_id gnl|my_center|LOCUS_12060 10199 9942 gene locus_tag LOCUS_12070 gene rpsR 10199 9942 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLI9 protein_id gnl|my_center|LOCUS_12070 10553 10215 gene locus_tag LOCUS_12080 gene rpsF 10553 10215 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVN6 protein_id gnl|my_center|LOCUS_12080 >Feature sequence077 2071 1016 gene locus_tag LOCUS_12090 2071 1016 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918379.1 protein_id gnl|my_center|LOCUS_12090 3027 2071 gene locus_tag LOCUS_12100 gene lgt 3027 2071 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DJ5 protein_id gnl|my_center|LOCUS_12100 3109 3360 gene locus_tag LOCUS_12110 3109 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 3493 3996 gene locus_tag LOCUS_12120 3493 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918381.1 protein_id gnl|my_center|LOCUS_12120 4061 4828 gene locus_tag LOCUS_12130 gene proC 4061 4828 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DI5 protein_id gnl|my_center|LOCUS_12130 4840 5514 gene locus_tag LOCUS_12140 4840 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 5515 6597 gene locus_tag LOCUS_12150 5515 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 6809 7081 gene locus_tag LOCUS_12160 6809 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_12160 7189 7863 gene locus_tag LOCUS_12170 7189 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7860 8801 gene locus_tag LOCUS_12180 gene fliG 7860 8801 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04955 protein_id gnl|my_center|LOCUS_12180 8801 9202 gene locus_tag LOCUS_12190 8801 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9217 9483 gene locus_tag LOCUS_12200 9217 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 9648 10655 gene locus_tag LOCUS_12210 9648 10655 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence078 2134 1271 gene locus_tag LOCUS_12220 gene corC 2134 1271 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 protein_id gnl|my_center|LOCUS_12220 2597 2148 gene locus_tag LOCUS_12230 gene ybeY 2597 2148 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9E2 protein_id gnl|my_center|LOCUS_12230 3591 2608 gene locus_tag LOCUS_12240 3591 2608 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917945.1 protein_id gnl|my_center|LOCUS_12240 4997 3588 gene locus_tag LOCUS_12250 gene miaB 4997 3588 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U7 protein_id gnl|my_center|LOCUS_12250 5124 6878 gene locus_tag LOCUS_12260 5124 6878 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_12260 7504 7031 gene locus_tag LOCUS_12270 7504 7031 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_12270 7959 7501 gene locus_tag LOCUS_12280 7959 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8897 8013 gene locus_tag LOCUS_12290 8897 8013 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921556.1 protein_id gnl|my_center|LOCUS_12290 9027 9974 gene locus_tag LOCUS_12300 9027 9974 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_12300 10043 10852 gene locus_tag LOCUS_12310 gene hetN 10043 10852 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence079 <1 1353 gene locus_tag LOCUS_12320 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918029.1:ATPase AAA 1391 2878 gene locus_tag LOCUS_12330 gene shkA 1391 2878 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918027.1 protein_id gnl|my_center|LOCUS_12330 2875 4614 gene locus_tag LOCUS_12340 2875 4614 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918026.1 protein_id gnl|my_center|LOCUS_12340 4730 5614 gene locus_tag LOCUS_12350 4730 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5762 6469 gene locus_tag LOCUS_12360 gene djlA 5762 6469 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384971.1 protein_id gnl|my_center|LOCUS_12360 6572 6850 gene locus_tag LOCUS_12370 6572 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 6969 7361 gene locus_tag LOCUS_12380 6969 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 7358 8785 gene locus_tag LOCUS_12390 7358 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 9775 8873 gene locus_tag LOCUS_12400 gene prs 9775 8873 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV6 protein_id gnl|my_center|LOCUS_12400 10669 9899 gene locus_tag LOCUS_12410 10669 9899 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAE0 protein_id gnl|my_center|LOCUS_12410 >Feature sequence080 <1 809 gene locus_tag LOCUS_12420 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088518.1:pyridine nucleotide-disulfide oxidoreductase 819 1277 gene locus_tag LOCUS_12430 819 1277 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_12430 1298 1501 gene locus_tag LOCUS_12440 1298 1501 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_12440 1498 2772 gene locus_tag LOCUS_12450 gene rsaFb 1498 2772 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_12450 2914 3132 gene locus_tag LOCUS_12460 gene infA 2914 3132 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAM1 protein_id gnl|my_center|LOCUS_12460 3135 3719 gene locus_tag LOCUS_12470 3135 3719 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF3 protein_id gnl|my_center|LOCUS_12470 4159 3812 gene locus_tag LOCUS_12480 4159 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4700 4173 gene locus_tag LOCUS_12490 4700 4173 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7S1 protein_id gnl|my_center|LOCUS_12490 5100 4732 gene locus_tag LOCUS_12500 5100 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 5295 5969 gene locus_tag LOCUS_12510 gene ctpA 5295 5969 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_12510 6031 6354 gene locus_tag LOCUS_12520 6031 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 6464 6739 gene locus_tag LOCUS_12530 6464 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 6870 8216 gene locus_tag LOCUS_12540 6870 8216 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918198.1 protein_id gnl|my_center|LOCUS_12540 8203 9327 gene locus_tag LOCUS_12550 8203 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence081 1905 112 gene locus_tag LOCUS_12560 gene recJ 1905 112 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919262.1 protein_id gnl|my_center|LOCUS_12560 2924 1971 gene locus_tag LOCUS_12570 2924 1971 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H0 protein_id gnl|my_center|LOCUS_12570 4264 2981 gene locus_tag LOCUS_12580 4264 2981 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7Y3 protein_id gnl|my_center|LOCUS_12580 5548 4340 gene locus_tag LOCUS_12590 5548 4340 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7C8 protein_id gnl|my_center|LOCUS_12590 5982 5545 gene locus_tag LOCUS_12600 5982 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6055 7890 gene locus_tag LOCUS_12610 6055 7890 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265707.1 protein_id gnl|my_center|LOCUS_12610 8842 7895 gene locus_tag LOCUS_12620 gene argC 8842 7895 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H555 protein_id gnl|my_center|LOCUS_12620 9412 8927 gene locus_tag LOCUS_12630 gene rpsI 9412 8927 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H554 protein_id gnl|my_center|LOCUS_12630 9882 9418 gene locus_tag LOCUS_12640 gene rplM 9882 9418 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7X8 protein_id gnl|my_center|LOCUS_12640 >Feature sequence082 1347 337 gene locus_tag LOCUS_12650 1347 337 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_12650 2865 1354 gene locus_tag LOCUS_12660 2865 1354 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919200.1 protein_id gnl|my_center|LOCUS_12660 3594 2998 gene locus_tag LOCUS_12670 3594 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3664 4404 gene locus_tag LOCUS_12680 3664 4404 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919201.1 protein_id gnl|my_center|LOCUS_12680 5144 4398 gene locus_tag LOCUS_12690 5144 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 5264 6331 gene locus_tag LOCUS_12700 5264 6331 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919204.1 protein_id gnl|my_center|LOCUS_12700 6492 6662 gene locus_tag LOCUS_12710 6492 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 7738 6674 gene locus_tag LOCUS_12720 7738 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_12720 8926 7832 gene locus_tag LOCUS_12730 gene aroC 8926 7832 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P8 protein_id gnl|my_center|LOCUS_12730 9123 9782 gene locus_tag LOCUS_12740 gene pdxH 9123 9782 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9Q6 protein_id gnl|my_center|LOCUS_12740 10256 9807 gene locus_tag LOCUS_12750 10256 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528909.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence083 831 1349 gene locus_tag LOCUS_12760 831 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640509.1 protein_id gnl|my_center|LOCUS_12760 2443 1346 gene locus_tag LOCUS_12770 gene murG 2443 1346 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5A1 protein_id gnl|my_center|LOCUS_12770 3587 2436 gene locus_tag LOCUS_12780 3587 2436 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920409.1 protein_id gnl|my_center|LOCUS_12780 4999 3584 gene locus_tag LOCUS_12790 gene murD 4999 3584 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H096 protein_id gnl|my_center|LOCUS_12790 6203 5010 gene locus_tag LOCUS_12800 gene mraY 6203 5010 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEN2 protein_id gnl|my_center|LOCUS_12800 7636 6203 gene locus_tag LOCUS_12810 gene murF 7636 6203 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9K8 protein_id gnl|my_center|LOCUS_12810 9072 7633 gene locus_tag LOCUS_12820 gene murE 9072 7633 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDM3 protein_id gnl|my_center|LOCUS_12820 <10623 9069 gene locus_tag LOCUS_12830 <10623 9069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719253.1:cell division protein FtsI >Feature sequence084 280 855 gene locus_tag LOCUS_12840 280 855 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265800.1 protein_id gnl|my_center|LOCUS_12840 2589 859 gene locus_tag LOCUS_12850 2589 859 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_12850 3112 2651 gene locus_tag LOCUS_12860 gene tadA 3112 2651 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C334 protein_id gnl|my_center|LOCUS_12860 3164 3724 gene locus_tag LOCUS_12870 3164 3724 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_12870 4725 3721 gene locus_tag LOCUS_12880 4725 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921212.1 protein_id gnl|my_center|LOCUS_12880 4971 5951 gene locus_tag LOCUS_12890 4971 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 5951 6400 gene locus_tag LOCUS_12900 5951 6400 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_12900 6464 7249 gene locus_tag LOCUS_12910 6464 7249 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_12910 7582 7331 gene locus_tag LOCUS_12920 7582 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 8070 7756 gene locus_tag LOCUS_12930 8070 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 8258 9241 gene locus_tag LOCUS_12940 8258 9241 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_12940 10479 9262 gene locus_tag LOCUS_12950 gene yliI 10479 9262 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence085 955 302 gene locus_tag LOCUS_12960 gene hisH 955 302 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA5 protein_id gnl|my_center|LOCUS_12960 1066 2505 gene locus_tag LOCUS_12970 1066 2505 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_12970 3177 2572 gene locus_tag LOCUS_12980 gene hisB 3177 2572 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW12 protein_id gnl|my_center|LOCUS_12980 3294 5054 gene locus_tag LOCUS_12990 3294 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 5576 5040 gene locus_tag LOCUS_13000 5576 5040 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_13000 6013 5585 gene locus_tag LOCUS_13010 6013 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6468 6043 gene locus_tag LOCUS_13020 6468 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7113 6568 gene locus_tag LOCUS_13030 7113 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 8213 7155 gene locus_tag LOCUS_13040 8213 7155 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265893.1 protein_id gnl|my_center|LOCUS_13040 8350 8526 gene locus_tag LOCUS_13050 8350 8526 CDS product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310667.1 protein_id gnl|my_center|LOCUS_13050 8757 8527 gene locus_tag LOCUS_13060 8757 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9766 8849 gene locus_tag LOCUS_13070 gene xerC 9766 8849 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW3 protein_id gnl|my_center|LOCUS_13070 10294 9809 gene locus_tag LOCUS_13080 10294 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence086 1271 1795 gene locus_tag LOCUS_13090 gene dksA 1271 1795 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9J6 protein_id gnl|my_center|LOCUS_13090 2180 3265 gene locus_tag LOCUS_13100 2180 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4286 3273 gene locus_tag LOCUS_13110 4286 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_13110 4991 4344 gene locus_tag LOCUS_13120 4991 4344 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 protein_id gnl|my_center|LOCUS_13120 6808 4994 gene locus_tag LOCUS_13130 6808 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_13130 7073 9664 gene locus_tag LOCUS_13140 7073 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9691 9852 gene locus_tag LOCUS_13150 9691 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 9973 10293 gene locus_tag LOCUS_13160 9973 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971306.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence087 1243 2256 gene locus_tag LOCUS_13170 1243 2256 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530160.1 protein_id gnl|my_center|LOCUS_13170 2268 2873 gene locus_tag LOCUS_13180 2268 2873 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_13180 2990 3754 gene locus_tag LOCUS_13190 2990 3754 CDS product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703705.1 protein_id gnl|my_center|LOCUS_13190 4520 3780 gene locus_tag LOCUS_13200 4520 3780 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090573.1 protein_id gnl|my_center|LOCUS_13200 4612 5337 gene locus_tag LOCUS_13210 4612 5337 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920171.1 protein_id gnl|my_center|LOCUS_13210 5791 5306 gene locus_tag LOCUS_13220 5791 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 6167 5820 gene locus_tag LOCUS_13230 6167 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084105.1 protein_id gnl|my_center|LOCUS_13230 6893 6171 gene locus_tag LOCUS_13240 6893 6171 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 protein_id gnl|my_center|LOCUS_13240 8435 6984 gene locus_tag LOCUS_13250 gene purF 8435 6984 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8U0 protein_id gnl|my_center|LOCUS_13250 9021 8476 gene locus_tag LOCUS_13260 9021 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 <10424 9014 gene locus_tag LOCUS_13270 <10424 9014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TLJ5:DNA repair protein RadA >Feature sequence088 1138 1929 gene locus_tag LOCUS_13280 1138 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921185.1 protein_id gnl|my_center|LOCUS_13280 2473 2850 gene locus_tag LOCUS_13290 2473 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3717 3289 gene locus_tag LOCUS_13300 3717 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6302 3714 gene locus_tag LOCUS_13310 6302 3714 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931042.1 protein_id gnl|my_center|LOCUS_13310 7430 6306 gene locus_tag LOCUS_13320 7430 6306 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931043.1 protein_id gnl|my_center|LOCUS_13320 9624 7522 gene locus_tag LOCUS_13330 9624 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 <10395 9860 gene locus_tag LOCUS_13340 <10395 9860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480579.1:integrase >Feature sequence089 <1 547 gene locus_tag LOCUS_13350 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538096.1:methionine synthase note possible pseudo, internal stop codon 635 2314 gene locus_tag LOCUS_13360 635 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13360 3153 2311 gene locus_tag LOCUS_13370 3153 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3308 4732 gene locus_tag LOCUS_13380 3308 4732 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 protein_id gnl|my_center|LOCUS_13380 5252 4719 gene locus_tag LOCUS_13390 gene perP 5252 4719 CDS product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919184.1 protein_id gnl|my_center|LOCUS_13390 5590 6591 gene locus_tag LOCUS_13400 gene cobT 5590 6591 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDH9 protein_id gnl|my_center|LOCUS_13400 6708 7904 gene locus_tag LOCUS_13410 6708 7904 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_13410 7931 9085 gene locus_tag LOCUS_13420 7931 9085 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence090 <1 2200 gene locus_tag LOCUS_13430 <1 2200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918734.1:phosphoenolpyruvate--protein phosphotransferase 2293 3246 gene locus_tag LOCUS_13440 2293 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3312 4445 gene locus_tag LOCUS_13450 gene ispG 3312 4445 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U8 protein_id gnl|my_center|LOCUS_13450 4544 4996 gene locus_tag LOCUS_13460 4544 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5027 5635 gene locus_tag LOCUS_13470 5027 5635 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724650.1 protein_id gnl|my_center|LOCUS_13470 6812 5598 gene locus_tag LOCUS_13480 6812 5598 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087109.1 protein_id gnl|my_center|LOCUS_13480 6994 7845 gene locus_tag LOCUS_13490 6994 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7910 9232 gene locus_tag LOCUS_13500 7910 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 9252 9680 gene locus_tag LOCUS_13510 9252 9680 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence091 <1 545 gene locus_tag LOCUS_13520 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266167.1:MATE family efflux transporter 861 595 gene locus_tag LOCUS_13530 gene hupB 861 595 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQS9 protein_id gnl|my_center|LOCUS_13530 1872 961 gene locus_tag LOCUS_13540 1872 961 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919885.1 protein_id gnl|my_center|LOCUS_13540 2897 1875 gene locus_tag LOCUS_13550 2897 1875 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 protein_id gnl|my_center|LOCUS_13550 3068 3991 gene locus_tag LOCUS_13560 3068 3991 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 protein_id gnl|my_center|LOCUS_13560 4705 3995 gene locus_tag LOCUS_13570 gene pth 4705 3995 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV9 protein_id gnl|my_center|LOCUS_13570 5367 4702 gene locus_tag LOCUS_13580 gene rplY 5367 4702 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFM1 protein_id gnl|my_center|LOCUS_13580 5778 5996 gene locus_tag LOCUS_13590 5778 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 6118 6384 gene locus_tag LOCUS_13600 6118 6384 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_13600 6389 8164 gene locus_tag LOCUS_13610 6389 8164 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_13610 >Feature sequence092 116 838 gene locus_tag LOCUS_13620 116 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1984 845 gene locus_tag LOCUS_13630 1984 845 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_13630 2996 2022 gene locus_tag LOCUS_13640 2996 2022 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640058.1 protein_id gnl|my_center|LOCUS_13640 4027 2993 gene locus_tag LOCUS_13650 4027 2993 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918656.1 protein_id gnl|my_center|LOCUS_13650 4727 4101 gene locus_tag LOCUS_13660 4727 4101 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265622.1 protein_id gnl|my_center|LOCUS_13660 5476 4787 gene locus_tag LOCUS_13670 5476 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 6243 5551 gene locus_tag LOCUS_13680 6243 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 7606 6275 gene locus_tag LOCUS_13690 7606 6275 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918659.1 protein_id gnl|my_center|LOCUS_13690 7698 8180 gene locus_tag LOCUS_13700 7698 8180 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_13700 8180 8614 gene locus_tag LOCUS_13710 8180 8614 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337310.1 protein_id gnl|my_center|LOCUS_13710 9931 8723 gene locus_tag LOCUS_13720 9931 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence093 85 193 gene locus_tag LOCUS_r00010 85 193 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 356 432 gene locus_tag LOCUS_t00170 356 432 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 978 568 gene locus_tag LOCUS_13730 978 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2880 1060 gene locus_tag LOCUS_13740 gene hfaC 2880 1060 CDS product holdfast attachment protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45978 protein_id gnl|my_center|LOCUS_13740 3137 3304 gene locus_tag LOCUS_13750 3137 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3308 3463 gene locus_tag LOCUS_13760 3308 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4131 3460 gene locus_tag LOCUS_13770 gene rsuA 4131 3460 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 protein_id gnl|my_center|LOCUS_13770 5171 4131 gene locus_tag LOCUS_13780 gene rsmC 5171 4131 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 protein_id gnl|my_center|LOCUS_13780 7218 5212 gene locus_tag LOCUS_13790 gene pbpC 7218 5212 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921109.1 protein_id gnl|my_center|LOCUS_13790 7976 9493 gene locus_tag LOCUS_13800 7976 9493 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919225.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence094 637 80 gene locus_tag LOCUS_13810 637 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 750 1709 gene locus_tag LOCUS_13820 gene ispH 750 1709 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC9 protein_id gnl|my_center|LOCUS_13820 1776 2759 gene locus_tag LOCUS_13830 1776 2759 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U7F8 protein_id gnl|my_center|LOCUS_13830 2752 3153 gene locus_tag LOCUS_13840 2752 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 3150 3818 gene locus_tag LOCUS_13850 3150 3818 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_13850 3886 3962 gene locus_tag LOCUS_t00180 3886 3962 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4295 5671 gene locus_tag LOCUS_13860 4295 5671 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388436.1 protein_id gnl|my_center|LOCUS_13860 5749 6696 gene locus_tag LOCUS_13870 5749 6696 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705616.1 protein_id gnl|my_center|LOCUS_13870 7653 6700 gene locus_tag LOCUS_13880 gene metA 7653 6700 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9X0 protein_id gnl|my_center|LOCUS_13880 8324 7860 gene locus_tag LOCUS_13890 8324 7860 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389456.1 protein_id gnl|my_center|LOCUS_13890 <10049 8464 gene locus_tag LOCUS_13900 <10049 8464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQI0:alanine--tRNA ligase >Feature sequence095 1414 8 gene locus_tag LOCUS_13910 1414 8 CDS product trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTD3 protein_id gnl|my_center|LOCUS_13910 2792 1419 gene locus_tag LOCUS_13920 gene trkA 2792 1419 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_13920 4203 2815 gene locus_tag LOCUS_13930 gene ntrX 4203 2815 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535439.1 protein_id gnl|my_center|LOCUS_13930 6481 4178 gene locus_tag LOCUS_13940 gene ntrY 6481 4178 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640318.1 protein_id gnl|my_center|LOCUS_13940 7966 6590 gene locus_tag LOCUS_13950 gene ntrC 7966 6590 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919609.1 protein_id gnl|my_center|LOCUS_13950 9032 7959 gene locus_tag LOCUS_13960 gene ntrB 9032 7959 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719968.1 protein_id gnl|my_center|LOCUS_13960 <9978 9032 gene locus_tag LOCUS_13970 <9978 9032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A7I4:tRNA-dihydrouridine synthase >Feature sequence096 2159 933 gene locus_tag LOCUS_13980 2159 933 CDS product L-threonine dehydratase catabolic TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE74 protein_id gnl|my_center|LOCUS_13980 3282 2230 gene locus_tag LOCUS_13990 3282 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3944 3294 gene locus_tag LOCUS_14000 3944 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14000 4547 3987 gene locus_tag LOCUS_14010 4547 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14010 4868 4629 gene locus_tag LOCUS_14020 4868 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5168 5093 gene locus_tag LOCUS_t00190 5168 5093 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5721 5215 gene locus_tag LOCUS_14030 5721 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5926 7161 gene locus_tag LOCUS_14040 gene aroA 5926 7161 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WF2 protein_id gnl|my_center|LOCUS_14040 7331 7654 gene locus_tag LOCUS_14050 7331 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14050 7712 8806 gene locus_tag LOCUS_14060 gene yqiG 7712 8806 CDS product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 protein_id gnl|my_center|LOCUS_14060 8849 9487 gene locus_tag LOCUS_14070 gene cmk 8849 9487 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H6A7 protein_id gnl|my_center|LOCUS_14070 >Feature sequence097 185 535 gene locus_tag LOCUS_14080 185 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 990 484 gene locus_tag LOCUS_14090 990 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 973 1881 gene locus_tag LOCUS_14100 973 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1878 3140 gene locus_tag LOCUS_14110 1878 3140 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_14110 3150 6323 gene locus_tag LOCUS_14120 3150 6323 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_14120 6348 7682 gene locus_tag LOCUS_14130 6348 7682 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_14130 7913 8635 gene locus_tag LOCUS_14140 7913 8635 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_14140 8804 9310 gene locus_tag LOCUS_14150 8804 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14150 >Feature sequence098 1041 364 gene locus_tag LOCUS_14160 1041 364 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084129.1 protein_id gnl|my_center|LOCUS_14160 1246 1088 gene locus_tag LOCUS_14170 1246 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1389 2522 gene locus_tag LOCUS_14180 1389 2522 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 protein_id gnl|my_center|LOCUS_14180 2646 3014 gene locus_tag LOCUS_14190 2646 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3401 3018 gene locus_tag LOCUS_14200 3401 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3594 4907 gene locus_tag LOCUS_14210 3594 4907 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265522.1 protein_id gnl|my_center|LOCUS_14210 5563 4904 gene locus_tag LOCUS_14220 5563 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 6584 5718 gene locus_tag LOCUS_14230 6584 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 6686 7369 gene locus_tag LOCUS_14240 6686 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 7366 8061 gene locus_tag LOCUS_14250 7366 8061 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_14250 8058 9326 gene locus_tag LOCUS_14260 8058 9326 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence099 763 278 gene locus_tag LOCUS_14270 gene nuoI 763 278 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Y4 protein_id gnl|my_center|LOCUS_14270 1851 760 gene locus_tag LOCUS_14280 gene nuoH 1851 760 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C802 protein_id gnl|my_center|LOCUS_14280 3961 1862 gene locus_tag LOCUS_14290 gene nuoG 3961 1862 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZL6 protein_id gnl|my_center|LOCUS_14290 5272 3968 gene locus_tag LOCUS_14300 gene nuoF 5272 3968 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919813.1 protein_id gnl|my_center|LOCUS_14300 6373 5276 gene locus_tag LOCUS_14310 gene nuoE 6373 5276 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971510.1 protein_id gnl|my_center|LOCUS_14310 6817 6473 gene locus_tag LOCUS_14320 6817 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919817.1 protein_id gnl|my_center|LOCUS_14320 8019 6814 gene locus_tag LOCUS_14330 gene nuoD 8019 6814 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F8 protein_id gnl|my_center|LOCUS_14330 8645 8019 gene locus_tag LOCUS_14340 gene nuoC 8645 8019 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7W5 protein_id gnl|my_center|LOCUS_14340 9225 8656 gene locus_tag LOCUS_14350 gene nuoB 9225 8656 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWV5 protein_id gnl|my_center|LOCUS_14350 9599 9225 gene locus_tag LOCUS_14360 gene nuoA 9599 9225 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 protein_id gnl|my_center|LOCUS_14360 >Feature sequence100 2220 880 gene locus_tag LOCUS_14370 2220 880 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085731.1 protein_id gnl|my_center|LOCUS_14370 2422 2772 gene locus_tag LOCUS_14380 2422 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2896 3192 gene locus_tag LOCUS_14390 2896 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3348 3962 gene locus_tag LOCUS_14400 3348 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4363 3959 gene locus_tag LOCUS_14410 4363 3959 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_14410 4786 4400 gene locus_tag LOCUS_14420 4786 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_14420 4926 5351 gene locus_tag LOCUS_14430 4926 5351 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537794.1 protein_id gnl|my_center|LOCUS_14430 5406 6035 gene locus_tag LOCUS_14440 5406 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 6098 6829 gene locus_tag LOCUS_14450 6098 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 7815 6838 gene locus_tag LOCUS_14460 7815 6838 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_14460 7927 8661 gene locus_tag LOCUS_14470 7927 8661 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919067.1 protein_id gnl|my_center|LOCUS_14470 8721 9371 gene locus_tag LOCUS_14480 8721 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112773.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence101 83 919 gene locus_tag LOCUS_14490 83 919 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S9 protein_id gnl|my_center|LOCUS_14490 1013 1630 gene locus_tag LOCUS_14500 1013 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3833 1710 gene locus_tag LOCUS_14510 3833 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 4878 3904 gene locus_tag LOCUS_14520 4878 3904 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_14520 6021 5878 gene locus_tag LOCUS_14530 6021 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 7524 6118 gene locus_tag LOCUS_14540 7524 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 9219 8239 gene locus_tag LOCUS_14550 9219 8239 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_14550 9578 9216 gene locus_tag LOCUS_14560 9578 9216 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640021.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence102 <1 1593 gene locus_tag LOCUS_14570 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920040.1:acetyl/propionyl-CoA carboxylase subunit alpha 1744 2256 gene locus_tag LOCUS_14580 1744 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2333 2767 gene locus_tag LOCUS_14590 2333 2767 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_14590 2913 3449 gene locus_tag LOCUS_14600 2913 3449 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265849.1 protein_id gnl|my_center|LOCUS_14600 3473 4276 gene locus_tag LOCUS_14610 3473 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4899 4261 gene locus_tag LOCUS_14620 gene lipB 4899 4261 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA5 protein_id gnl|my_center|LOCUS_14620 4834 5016 gene locus_tag LOCUS_14630 4834 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5057 5141 gene locus_tag LOCUS_t00200 5057 5141 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5644 5195 gene locus_tag LOCUS_14640 5644 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 5702 5959 gene locus_tag LOCUS_14650 5702 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 6231 7613 gene locus_tag LOCUS_14660 6231 7613 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6C0 protein_id gnl|my_center|LOCUS_14660 7734 8912 gene locus_tag LOCUS_14670 gene spmX 7734 8912 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6C1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence103 942 2534 gene locus_tag LOCUS_14680 gene divJ 942 2534 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265663.1 protein_id gnl|my_center|LOCUS_14680 2598 2951 gene locus_tag LOCUS_14690 2598 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_14690 3044 3418 gene locus_tag LOCUS_14700 3044 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3489 5087 gene locus_tag LOCUS_14710 gene prfC 3489 5087 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C769 protein_id gnl|my_center|LOCUS_14710 5577 5143 gene locus_tag LOCUS_14720 5577 5143 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 protein_id gnl|my_center|LOCUS_14720 6250 5819 gene locus_tag LOCUS_14730 6250 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7218 6307 gene locus_tag LOCUS_14740 7218 6307 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087704.1 protein_id gnl|my_center|LOCUS_14740 8272 7463 gene locus_tag LOCUS_14750 8272 7463 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920496.1 protein_id gnl|my_center|LOCUS_14750 8534 9064 gene locus_tag LOCUS_14760 8534 9064 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence104 2650 383 gene locus_tag LOCUS_14770 2650 383 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_14770 3070 2864 gene locus_tag LOCUS_14780 3070 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2969 3523 gene locus_tag LOCUS_14790 2969 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4320 3532 gene locus_tag LOCUS_14800 4320 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 4489 6153 gene locus_tag LOCUS_14810 4489 6153 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920009.1 protein_id gnl|my_center|LOCUS_14810 6304 7449 gene locus_tag LOCUS_14820 6304 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 8831 7458 gene locus_tag LOCUS_14830 8831 7458 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence105 825 163 gene locus_tag LOCUS_14840 825 163 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087077.1 protein_id gnl|my_center|LOCUS_14840 1999 2262 gene locus_tag LOCUS_14850 1999 2262 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970544.1 protein_id gnl|my_center|LOCUS_14850 2274 3149 gene locus_tag LOCUS_14860 2274 3149 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084850.1 protein_id gnl|my_center|LOCUS_14860 3406 3173 gene locus_tag LOCUS_14870 3406 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3930 5516 gene locus_tag LOCUS_14880 3930 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 5533 6309 gene locus_tag LOCUS_14890 5533 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 6405 8342 gene locus_tag LOCUS_14900 6405 8342 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A667 protein_id gnl|my_center|LOCUS_14900 9134 8358 gene locus_tag LOCUS_14910 9134 8358 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919877.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence106 <1 1597 gene locus_tag LOCUS_14920 <1 1597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114080.1:two-component sensor 2229 1594 gene locus_tag LOCUS_14930 2229 1594 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 protein_id gnl|my_center|LOCUS_14930 2415 3707 gene locus_tag LOCUS_14940 2415 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_14940 3723 5696 gene locus_tag LOCUS_14950 gene acsA 3723 5696 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_14950 7492 5888 gene locus_tag LOCUS_14960 gene chvG 7492 5888 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918127.1 protein_id gnl|my_center|LOCUS_14960 7981 7517 gene locus_tag LOCUS_14970 7981 7517 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7Y1 protein_id gnl|my_center|LOCUS_14970 8092 8574 gene locus_tag LOCUS_14980 8092 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528406.1 protein_id gnl|my_center|LOCUS_14980 9148 8516 gene locus_tag LOCUS_14990 9148 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence107 2228 774 gene locus_tag LOCUS_15000 2228 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2341 3153 gene locus_tag LOCUS_15010 gene trmH 2341 3153 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970830.1 protein_id gnl|my_center|LOCUS_15010 3150 4040 gene locus_tag LOCUS_15020 3150 4040 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 protein_id gnl|my_center|LOCUS_15020 4037 5746 gene locus_tag LOCUS_15030 4037 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920658.1 protein_id gnl|my_center|LOCUS_15030 7863 5803 gene locus_tag LOCUS_15040 7863 5803 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921550.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence108 1168 980 gene locus_tag LOCUS_15050 1168 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2177 1743 gene locus_tag LOCUS_15060 2177 1743 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 protein_id gnl|my_center|LOCUS_15060 2966 2268 gene locus_tag LOCUS_15070 2966 2268 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534691.1 protein_id gnl|my_center|LOCUS_15070 3096 3497 gene locus_tag LOCUS_15080 3096 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6119 3579 gene locus_tag LOCUS_15090 6119 3579 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_15090 6526 7077 gene locus_tag LOCUS_15100 6526 7077 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265825.1 protein_id gnl|my_center|LOCUS_15100 8742 7105 gene locus_tag LOCUS_15110 8742 7105 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence109 <1 1218 gene locus_tag LOCUS_15120 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919727.1:Fe-S cluster assembly protein SufD 1215 2438 gene locus_tag LOCUS_15130 1215 2438 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A766 protein_id gnl|my_center|LOCUS_15130 2447 2830 gene locus_tag LOCUS_15140 2447 2830 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 protein_id gnl|my_center|LOCUS_15140 2935 3225 gene locus_tag LOCUS_15150 2935 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919724.1 protein_id gnl|my_center|LOCUS_15150 3254 3748 gene locus_tag LOCUS_15160 3254 3748 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063693.1 protein_id gnl|my_center|LOCUS_15160 3776 4381 gene locus_tag LOCUS_15170 3776 4381 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846890.1 protein_id gnl|my_center|LOCUS_15170 5194 4388 gene locus_tag LOCUS_15180 5194 4388 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 protein_id gnl|my_center|LOCUS_15180 5826 5218 gene locus_tag LOCUS_15190 5826 5218 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919721.1 protein_id gnl|my_center|LOCUS_15190 6255 6010 gene locus_tag LOCUS_15200 gene purS 6255 6010 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5F8 protein_id gnl|my_center|LOCUS_15200 7142 6369 gene locus_tag LOCUS_15210 gene purC 7142 6369 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L2 protein_id gnl|my_center|LOCUS_15210 7317 7640 gene locus_tag LOCUS_15220 7317 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530104.1 protein_id gnl|my_center|LOCUS_15220 8675 7674 gene locus_tag LOCUS_15230 8675 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence110 <1 1003 gene locus_tag LOCUS_15240 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226510.1:mechanosensitive ion channel protein MscS 1683 1012 gene locus_tag LOCUS_15250 1683 1012 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_15250 2039 1761 gene locus_tag LOCUS_15260 2039 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2092 2241 gene locus_tag LOCUS_15270 2092 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2713 2291 gene locus_tag LOCUS_15280 2713 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2921 3898 gene locus_tag LOCUS_15290 2921 3898 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_15290 3967 4473 gene locus_tag LOCUS_15300 3967 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4653 6017 gene locus_tag LOCUS_15310 gene tnaA 4653 6017 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V4 protein_id gnl|my_center|LOCUS_15310 7739 6048 gene locus_tag LOCUS_15320 7739 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 8133 7849 gene locus_tag LOCUS_15330 8133 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence111 248 388 gene locus_tag LOCUS_15340 248 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 944 462 gene locus_tag LOCUS_15350 944 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2453 1026 gene locus_tag LOCUS_15360 gene cenK 2453 1026 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918418.1 protein_id gnl|my_center|LOCUS_15360 3901 2468 gene locus_tag LOCUS_15370 gene merA1 3901 2468 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_15370 4641 3901 gene locus_tag LOCUS_15380 4641 3901 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968582.1 protein_id gnl|my_center|LOCUS_15380 5420 4638 gene locus_tag LOCUS_15390 5420 4638 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948447.1 protein_id gnl|my_center|LOCUS_15390 6718 5531 gene locus_tag LOCUS_15400 6718 5531 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919575.1 protein_id gnl|my_center|LOCUS_15400 6907 7041 gene locus_tag LOCUS_15410 gene rpmH 6907 7041 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66244 protein_id gnl|my_center|LOCUS_15410 7086 7454 gene locus_tag LOCUS_15420 7086 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence112 686 258 gene locus_tag LOCUS_15430 686 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1756 683 gene locus_tag LOCUS_15440 1756 683 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919999.1 protein_id gnl|my_center|LOCUS_15440 2188 1760 gene locus_tag LOCUS_15450 2188 1760 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 protein_id gnl|my_center|LOCUS_15450 3099 2191 gene locus_tag LOCUS_15460 gene metF 3099 2191 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UJ7 protein_id gnl|my_center|LOCUS_15460 3974 3096 gene locus_tag LOCUS_15470 3974 3096 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 protein_id gnl|my_center|LOCUS_15470 4213 4968 gene locus_tag LOCUS_15480 4213 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5002 5631 gene locus_tag LOCUS_15490 5002 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7294 5693 gene locus_tag LOCUS_15500 7294 5693 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918631.1 protein_id gnl|my_center|LOCUS_15500 8271 7414 gene locus_tag LOCUS_15510 8271 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence113 178 1203 gene locus_tag LOCUS_15520 178 1203 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_15520 2765 1323 gene locus_tag LOCUS_15530 2765 1323 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_15530 3923 2766 gene locus_tag LOCUS_15540 3923 2766 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919300.1 protein_id gnl|my_center|LOCUS_15540 4765 3920 gene locus_tag LOCUS_15550 4765 3920 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_15550 5773 4769 gene locus_tag LOCUS_15560 gene cysK2 5773 4769 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708041.1 protein_id gnl|my_center|LOCUS_15560 5935 6495 gene locus_tag LOCUS_15570 5935 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 6492 7160 gene locus_tag LOCUS_15580 6492 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388488.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence114 <1 820 gene locus_tag LOCUS_15590 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920857.1:cobaltochelatase subunit CobS 841 1506 gene locus_tag LOCUS_15600 841 1506 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918366.1 protein_id gnl|my_center|LOCUS_15600 1507 3507 gene locus_tag LOCUS_15610 1507 3507 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_15610 4419 3520 gene locus_tag LOCUS_15620 4419 3520 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_15620 4502 4912 gene locus_tag LOCUS_15630 4502 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4936 5841 gene locus_tag LOCUS_15640 4936 5841 CDS product AttM/AiiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729411.1 protein_id gnl|my_center|LOCUS_15640 5838 6698 gene locus_tag LOCUS_15650 5838 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 8471 6714 gene locus_tag LOCUS_15660 8471 6714 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920923.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence115 <1 1483 gene locus_tag LOCUS_15670 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921450.1:hybrid sensor histidine kinase/response regulator 1564 1932 gene locus_tag LOCUS_15680 1564 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918905.1 protein_id gnl|my_center|LOCUS_15680 2075 2151 gene locus_tag LOCUS_t00210 2075 2151 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2237 2983 gene locus_tag LOCUS_15690 2237 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3970 3002 gene locus_tag LOCUS_15700 gene trxB 3970 3002 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840254.1 protein_id gnl|my_center|LOCUS_15700 4934 4059 gene locus_tag LOCUS_15710 gene zitB 4934 4059 CDS product cation efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 protein_id gnl|my_center|LOCUS_15710 5160 5879 gene locus_tag LOCUS_15720 5160 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082974.1 protein_id gnl|my_center|LOCUS_15720 6644 5952 gene locus_tag LOCUS_15730 6644 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 7157 6813 gene locus_tag LOCUS_15740 7157 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368489.1 protein_id gnl|my_center|LOCUS_15740 7346 7161 gene locus_tag LOCUS_15750 7346 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368443.1 protein_id gnl|my_center|LOCUS_15750 <8760 7532 gene locus_tag LOCUS_15760 <8760 7532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0CAX1:DNA gyrase subunit B >Feature sequence116 1149 760 gene locus_tag LOCUS_15770 gene divK 1149 760 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640499.1 protein_id gnl|my_center|LOCUS_15770 1317 2558 gene locus_tag LOCUS_15780 gene dinB 1317 2558 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAY0 protein_id gnl|my_center|LOCUS_15780 2642 3103 gene locus_tag LOCUS_15790 2642 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_15790 3110 3835 gene locus_tag LOCUS_15800 3110 3835 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920018.1 protein_id gnl|my_center|LOCUS_15800 3845 5011 gene locus_tag LOCUS_15810 3845 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971570.1 protein_id gnl|my_center|LOCUS_15810 5073 5507 gene locus_tag LOCUS_15820 5073 5507 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920328.1 protein_id gnl|my_center|LOCUS_15820 5559 6293 gene locus_tag LOCUS_15830 5559 6293 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084685.1 protein_id gnl|my_center|LOCUS_15830 7814 6303 gene locus_tag LOCUS_15840 gene gatB 7814 6303 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L1 protein_id gnl|my_center|LOCUS_15840 7969 8346 gene locus_tag LOCUS_15850 7969 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence117 2766 1825 gene locus_tag LOCUS_15860 gene thiL 2766 1825 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K82 protein_id gnl|my_center|LOCUS_15860 3752 2793 gene locus_tag LOCUS_15870 gene accA 3752 2793 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2N7 protein_id gnl|my_center|LOCUS_15870 4721 3801 gene locus_tag LOCUS_15880 4721 3801 CDS product type II secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531958.1 protein_id gnl|my_center|LOCUS_15880 5685 4735 gene locus_tag LOCUS_15890 5685 4735 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531959.1 protein_id gnl|my_center|LOCUS_15890 7131 5731 gene locus_tag LOCUS_15900 7131 5731 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531960.1 protein_id gnl|my_center|LOCUS_15900 8342 7128 gene locus_tag LOCUS_15910 8342 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 8611 8342 gene locus_tag LOCUS_15920 8611 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence118 478 1833 gene locus_tag LOCUS_15930 478 1833 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532355.1 protein_id gnl|my_center|LOCUS_15930 1835 3241 gene locus_tag LOCUS_15940 1835 3241 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537967.1 protein_id gnl|my_center|LOCUS_15940 4195 3245 gene locus_tag LOCUS_15950 4195 3245 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919326.1 protein_id gnl|my_center|LOCUS_15950 4812 4192 gene locus_tag LOCUS_15960 4812 4192 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 protein_id gnl|my_center|LOCUS_15960 5270 5419 gene locus_tag LOCUS_15970 5270 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 6576 5455 gene locus_tag LOCUS_15980 6576 5455 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_15980 7009 6701 gene locus_tag LOCUS_15990 7009 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 7590 7006 gene locus_tag LOCUS_16000 7590 7006 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918270.1 protein_id gnl|my_center|LOCUS_16000 8395 7583 gene locus_tag LOCUS_16010 8395 7583 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532568.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence119 2285 1068 gene locus_tag LOCUS_16020 2285 1068 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_16020 2778 2320 gene locus_tag LOCUS_16030 2778 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 4286 2853 gene locus_tag LOCUS_16040 4286 2853 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_16040 4940 4401 gene locus_tag LOCUS_16050 4940 4401 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_16050 5914 4952 gene locus_tag LOCUS_16060 gene mdh 5914 4952 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2B1 protein_id gnl|my_center|LOCUS_16060 6828 6052 gene locus_tag LOCUS_16070 6828 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2A3 protein_id gnl|my_center|LOCUS_16070 7186 7518 gene locus_tag LOCUS_16080 7186 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534939.1 protein_id gnl|my_center|LOCUS_16080 7601 8134 gene locus_tag LOCUS_16090 7601 8134 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2A5 protein_id gnl|my_center|LOCUS_16090 >Feature sequence120 <1 1461 gene locus_tag LOCUS_16100 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533280.1:chromosome partitioning protein ParB 1773 1486 gene locus_tag LOCUS_16110 1773 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1916 2239 gene locus_tag LOCUS_16120 1916 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533279.1 protein_id gnl|my_center|LOCUS_16120 2468 2722 gene locus_tag LOCUS_16130 2468 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3227 2847 gene locus_tag LOCUS_16140 3227 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3371 4414 gene locus_tag LOCUS_16150 3371 4414 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388434.1 protein_id gnl|my_center|LOCUS_16150 5443 5084 gene locus_tag LOCUS_16160 5443 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 5327 6826 gene locus_tag LOCUS_16170 5327 6826 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence121 529 3261 gene locus_tag LOCUS_16180 gene ape1 529 3261 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207265.1 protein_id gnl|my_center|LOCUS_16180 8087 3363 gene locus_tag LOCUS_16190 gene gdhZ 8087 3363 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917977.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence122 <1 608 gene locus_tag LOCUS_16200 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388973.1:phage shock protein PspA 722 976 gene locus_tag LOCUS_16210 722 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 989 1432 gene locus_tag LOCUS_16220 989 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1489 1698 gene locus_tag LOCUS_16230 1489 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 3528 1678 gene locus_tag LOCUS_16240 gene mnmC 3528 1678 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_16240 3676 3846 gene locus_tag LOCUS_16250 3676 3846 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AD9 protein_id gnl|my_center|LOCUS_16250 3955 4242 gene locus_tag LOCUS_16260 3955 4242 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840431.1 protein_id gnl|my_center|LOCUS_16260 4239 4520 gene locus_tag LOCUS_16270 4239 4520 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764805.1 protein_id gnl|my_center|LOCUS_16270 4499 4966 gene locus_tag LOCUS_16280 4499 4966 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW57 protein_id gnl|my_center|LOCUS_16280 5958 4963 gene locus_tag LOCUS_16290 5958 4963 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919001.1 protein_id gnl|my_center|LOCUS_16290 6003 7409 gene locus_tag LOCUS_16300 gene cysG 6003 7409 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL6 protein_id gnl|my_center|LOCUS_16300 7406 7711 gene locus_tag LOCUS_16310 7406 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence123 2641 1433 gene locus_tag LOCUS_16320 2641 1433 CDS product succinyl-CoA--D-citramalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGE3 protein_id gnl|my_center|LOCUS_16320 2811 3461 gene locus_tag LOCUS_16330 2811 3461 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729502.1 protein_id gnl|my_center|LOCUS_16330 4122 3466 gene locus_tag LOCUS_16340 4122 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920931.1 protein_id gnl|my_center|LOCUS_16340 4532 4140 gene locus_tag LOCUS_16350 4532 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920166.1 protein_id gnl|my_center|LOCUS_16350 5893 4565 gene locus_tag LOCUS_16360 5893 4565 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_16360 6756 6043 gene locus_tag LOCUS_16370 6756 6043 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088353.1 protein_id gnl|my_center|LOCUS_16370 7347 6769 gene locus_tag LOCUS_16380 7347 6769 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892027.1 protein_id gnl|my_center|LOCUS_16380 7528 8001 gene locus_tag LOCUS_16390 7528 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 8262 8017 gene locus_tag LOCUS_16400 8262 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence124 3359 1689 gene locus_tag LOCUS_16410 3359 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3443 4360 gene locus_tag LOCUS_16420 3443 4360 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_16420 4467 4763 gene locus_tag LOCUS_16430 4467 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 5387 4818 gene locus_tag LOCUS_16440 5387 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6248 5805 gene locus_tag LOCUS_16450 6248 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_16450 6460 7356 gene locus_tag LOCUS_16460 6460 7356 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_16460 8189 7353 gene locus_tag LOCUS_16470 gene pheA 8189 7353 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence125 480 289 gene locus_tag LOCUS_16480 480 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 764 555 gene locus_tag LOCUS_16490 764 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1151 933 gene locus_tag LOCUS_16500 1151 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1302 2063 gene locus_tag LOCUS_16510 gene hisF 1302 2063 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y413 protein_id gnl|my_center|LOCUS_16510 2907 2095 gene locus_tag LOCUS_16520 2907 2095 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_16520 3020 3367 gene locus_tag LOCUS_16530 gene hisE 3020 3367 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50935 protein_id gnl|my_center|LOCUS_16530 4153 3419 gene locus_tag LOCUS_16540 4153 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918001.1 protein_id gnl|my_center|LOCUS_16540 4212 4709 gene locus_tag LOCUS_16550 4212 4709 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_16550 4748 5764 gene locus_tag LOCUS_16560 gene tas 4748 5764 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023116.1 protein_id gnl|my_center|LOCUS_16560 5769 7421 gene locus_tag LOCUS_16570 gene treA 5769 7421 CDS product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WDG9 protein_id gnl|my_center|LOCUS_16570 <8260 7486 gene locus_tag LOCUS_16580 <8260 7486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538055.1:cell division protein FtsK >Feature sequence126 <1 1003 gene locus_tag LOCUS_16590 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114325.1:acyl-CoA dehydrogenase 1332 1072 gene locus_tag LOCUS_16600 1332 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1515 2579 gene locus_tag LOCUS_16610 1515 2579 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919229.1 protein_id gnl|my_center|LOCUS_16610 2639 3328 gene locus_tag LOCUS_16620 2639 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528793.1 protein_id gnl|my_center|LOCUS_16620 3508 4002 gene locus_tag LOCUS_16630 gene mucS 3508 4002 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_16630 4130 4531 gene locus_tag LOCUS_16640 4130 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263497.1 protein_id gnl|my_center|LOCUS_16640 4580 5269 gene locus_tag LOCUS_16650 4580 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5888 5271 gene locus_tag LOCUS_16660 5888 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 6130 8130 gene locus_tag LOCUS_16670 gene mutL 6130 8130 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV5 protein_id gnl|my_center|LOCUS_16670 >Feature sequence127 201 31 gene locus_tag LOCUS_16680 201 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 217 558 gene locus_tag LOCUS_16690 217 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 701 3124 gene locus_tag LOCUS_16700 701 3124 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_16700 3138 4436 gene locus_tag LOCUS_16710 3138 4436 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_16710 4662 7256 gene locus_tag LOCUS_16720 4662 7256 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407998.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence128 911 276 gene locus_tag LOCUS_16730 911 276 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385520.1 protein_id gnl|my_center|LOCUS_16730 1524 937 gene locus_tag LOCUS_16740 1524 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1674 2615 gene locus_tag LOCUS_16750 1674 2615 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918265.1 protein_id gnl|my_center|LOCUS_16750 2697 3281 gene locus_tag LOCUS_16760 2697 3281 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_16760 3364 5310 gene locus_tag LOCUS_16770 3364 5310 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039172.1 protein_id gnl|my_center|LOCUS_16770 6234 5317 gene locus_tag LOCUS_16780 6234 5317 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_16780 6298 7125 gene locus_tag LOCUS_16790 6298 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 protein_id gnl|my_center|LOCUS_16790 <7803 7166 gene locus_tag LOCUS_16800 <7803 7166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0CAW2:modification methylase CcrMI >Feature sequence129 1487 3283 gene locus_tag LOCUS_16810 1487 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4754 3645 gene locus_tag LOCUS_16820 4754 3645 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 protein_id gnl|my_center|LOCUS_16820 4846 5940 gene locus_tag LOCUS_16830 4846 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6315 6121 gene locus_tag LOCUS_16840 6315 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948594.1 protein_id gnl|my_center|LOCUS_16840 6914 6312 gene locus_tag LOCUS_16850 6914 6312 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886843.1 protein_id gnl|my_center|LOCUS_16850 7223 6927 gene locus_tag LOCUS_16860 7223 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence130 1938 1180 gene locus_tag LOCUS_16870 1938 1180 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_16870 2814 2035 gene locus_tag LOCUS_16880 gene map 2814 2035 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I095 protein_id gnl|my_center|LOCUS_16880 3035 2811 gene locus_tag LOCUS_16890 3035 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192010.1 protein_id gnl|my_center|LOCUS_16890 5163 3109 gene locus_tag LOCUS_16900 5163 3109 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528794.1 protein_id gnl|my_center|LOCUS_16900 5725 5291 gene locus_tag LOCUS_16910 5725 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 6180 5725 gene locus_tag LOCUS_16920 6180 5725 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919964.1 protein_id gnl|my_center|LOCUS_16920 6666 6193 gene locus_tag LOCUS_16930 6666 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969716.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence131 1097 351 gene locus_tag LOCUS_16940 1097 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1927 1340 gene locus_tag LOCUS_16950 1927 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2441 1920 gene locus_tag LOCUS_16960 gene rfaY 2441 1920 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405237.1 protein_id gnl|my_center|LOCUS_16960 2505 3686 gene locus_tag LOCUS_16970 gene tsaD 2505 3686 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABZ9 protein_id gnl|my_center|LOCUS_16970 4539 3925 gene locus_tag LOCUS_16980 4539 3925 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969408.1 protein_id gnl|my_center|LOCUS_16980 4676 4972 gene locus_tag LOCUS_16990 4676 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709695.1 protein_id gnl|my_center|LOCUS_16990 4969 5649 gene locus_tag LOCUS_17000 4969 5649 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 protein_id gnl|my_center|LOCUS_17000 6469 5633 gene locus_tag LOCUS_17010 6469 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 7055 6516 gene locus_tag LOCUS_17020 7055 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 <7756 7109 gene locus_tag LOCUS_17030 <7756 7109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088947.1:quinoprotein ethanol dehydrogenase >Feature sequence132 70 2835 gene locus_tag LOCUS_17040 gene secA 70 2835 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCG8 protein_id gnl|my_center|LOCUS_17040 2841 3353 gene locus_tag LOCUS_17050 2841 3353 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061548.1 protein_id gnl|my_center|LOCUS_17050 3427 3651 gene locus_tag LOCUS_17060 3427 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 3711 4649 gene locus_tag LOCUS_17070 gene murB 3711 4649 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 protein_id gnl|my_center|LOCUS_17070 6712 4646 gene locus_tag LOCUS_17080 6712 4646 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918113.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence133 1315 788 gene locus_tag LOCUS_17090 1315 788 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 protein_id gnl|my_center|LOCUS_17090 1551 3713 gene locus_tag LOCUS_17100 gene fyuA 1551 3713 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_17100 3788 5323 gene locus_tag LOCUS_17110 gene phoD 3788 5323 CDS product alkaline phosphatase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42251 protein_id gnl|my_center|LOCUS_17110 6869 5643 gene locus_tag LOCUS_17120 6869 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence134 629 210 gene locus_tag LOCUS_17130 629 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918221.1 protein_id gnl|my_center|LOCUS_17130 795 1535 gene locus_tag LOCUS_17140 795 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918219.1 protein_id gnl|my_center|LOCUS_17140 1780 1532 gene locus_tag LOCUS_17150 1780 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2664 1777 gene locus_tag LOCUS_17160 gene folD2 2664 1777 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RY3 protein_id gnl|my_center|LOCUS_17160 2942 2661 gene locus_tag LOCUS_17170 2942 2661 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKX3 protein_id gnl|my_center|LOCUS_17170 3239 2946 gene locus_tag LOCUS_17180 3239 2946 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 protein_id gnl|my_center|LOCUS_17180 3400 4644 gene locus_tag LOCUS_17190 3400 4644 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_17190 4733 5218 gene locus_tag LOCUS_17200 4733 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5596 5225 gene locus_tag LOCUS_17210 5596 5225 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974579.1 protein_id gnl|my_center|LOCUS_17210 5827 6063 gene locus_tag LOCUS_17220 5827 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6853 6080 gene locus_tag LOCUS_17230 6853 6080 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_17230 7253 6960 gene locus_tag LOCUS_17240 7253 6960 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABI2 protein_id gnl|my_center|LOCUS_17240 >Feature sequence135 3852 1873 gene locus_tag LOCUS_17250 3852 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 5959 4031 gene locus_tag LOCUS_17260 5959 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6607 6077 gene locus_tag LOCUS_17270 6607 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 <7593 6604 gene locus_tag LOCUS_17280 <7593 6604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T902:phosphoribosylamine--glycine ligase >Feature sequence136 643 1629 gene locus_tag LOCUS_17290 643 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2093 1626 gene locus_tag LOCUS_17300 2093 1626 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970503.1 protein_id gnl|my_center|LOCUS_17300 3051 2107 gene locus_tag LOCUS_17310 3051 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3116 4009 gene locus_tag LOCUS_17320 3116 4009 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920507.1 protein_id gnl|my_center|LOCUS_17320 4181 4858 gene locus_tag LOCUS_17330 4181 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920508.1 protein_id gnl|my_center|LOCUS_17330 5019 5792 gene locus_tag LOCUS_17340 5019 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17340 5802 6845 gene locus_tag LOCUS_17350 5802 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17350 >Feature sequence137 655 1812 gene locus_tag LOCUS_17360 655 1812 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972186.1 protein_id gnl|my_center|LOCUS_17360 1935 3116 gene locus_tag LOCUS_17370 1935 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3258 5036 gene locus_tag LOCUS_17380 3258 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6529 5111 gene locus_tag LOCUS_17390 6529 5111 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW6 protein_id gnl|my_center|LOCUS_17390 >Feature sequence138 <1 1503 gene locus_tag LOCUS_17400 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392815.1:dihydroorotase 1632 2885 gene locus_tag LOCUS_17410 1632 2885 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_17410 3770 2976 gene locus_tag LOCUS_17420 3770 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 6446 3909 gene locus_tag LOCUS_17430 6446 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 7313 6561 gene locus_tag LOCUS_17440 7313 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 7545 7399 gene locus_tag LOCUS_17450 7545 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence139 1804 371 gene locus_tag LOCUS_17460 1804 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384497.1 protein_id gnl|my_center|LOCUS_17460 3661 1895 gene locus_tag LOCUS_17470 3661 1895 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_17470 4392 3658 gene locus_tag LOCUS_17480 gene ostB 4392 3658 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P690 protein_id gnl|my_center|LOCUS_17480 5783 4389 gene locus_tag LOCUS_17490 5783 4389 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_17490 5949 5806 gene locus_tag LOCUS_17500 5949 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 6733 5912 gene locus_tag LOCUS_17510 6733 5912 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808871.1 protein_id gnl|my_center|LOCUS_17510 7473 6730 gene locus_tag LOCUS_17520 7473 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence140 362 943 gene locus_tag LOCUS_17530 362 943 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967613.1 protein_id gnl|my_center|LOCUS_17530 1060 1368 gene locus_tag LOCUS_17540 1060 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1470 1703 gene locus_tag LOCUS_17550 1470 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1774 2589 gene locus_tag LOCUS_17560 1774 2589 CDS product methylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640424.1 protein_id gnl|my_center|LOCUS_17560 2938 2618 gene locus_tag LOCUS_17570 2938 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3076 4014 gene locus_tag LOCUS_17580 3076 4014 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918346.1 protein_id gnl|my_center|LOCUS_17580 3956 5860 gene locus_tag LOCUS_17590 3956 5860 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920029.1 protein_id gnl|my_center|LOCUS_17590 6449 6117 gene locus_tag LOCUS_17600 6449 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 <7516 6633 gene locus_tag LOCUS_17610 <7516 6633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWK3:glutamate--tRNA ligase 1 >Feature sequence141 <1 544 gene locus_tag LOCUS_17620 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CAE2:ornithine carbamoyltransferase, catabolic 1801 548 gene locus_tag LOCUS_17630 1801 548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_17630 1742 1996 gene locus_tag LOCUS_17640 1742 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2087 2737 gene locus_tag LOCUS_17650 2087 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325274.1 protein_id gnl|my_center|LOCUS_17650 2803 3738 gene locus_tag LOCUS_17660 2803 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 3947 3735 gene locus_tag LOCUS_17670 3947 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4291 3944 gene locus_tag LOCUS_17680 4291 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 4465 5397 gene locus_tag LOCUS_17690 gene hslO 4465 5397 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58097 protein_id gnl|my_center|LOCUS_17690 5453 6106 gene locus_tag LOCUS_17700 5453 6106 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920746.1 protein_id gnl|my_center|LOCUS_17700 6971 6498 gene locus_tag LOCUS_17710 6971 6498 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918306.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence142 1962 493 gene locus_tag LOCUS_17720 gene gltX2 1962 493 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_17720 1981 4110 gene locus_tag LOCUS_17730 1981 4110 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919770.1 protein_id gnl|my_center|LOCUS_17730 4790 4107 gene locus_tag LOCUS_17740 gene lexA 4790 4107 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A724 protein_id gnl|my_center|LOCUS_17740 5654 4851 gene locus_tag LOCUS_17750 gene trpC 5654 4851 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9X9 protein_id gnl|my_center|LOCUS_17750 6685 5651 gene locus_tag LOCUS_17760 gene trpD 6685 5651 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_17760 6848 7324 gene locus_tag LOCUS_17770 6848 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719538.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence143 1720 974 gene locus_tag LOCUS_17780 1720 974 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_17780 1862 3163 gene locus_tag LOCUS_17790 1862 3163 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 protein_id gnl|my_center|LOCUS_17790 3375 4643 gene locus_tag LOCUS_17800 3375 4643 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918576.1 protein_id gnl|my_center|LOCUS_17800 5638 4745 gene locus_tag LOCUS_17810 gene ttcA 5638 4745 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CYD2 protein_id gnl|my_center|LOCUS_17810 6162 5701 gene locus_tag LOCUS_17820 6162 5701 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366737.1 protein_id gnl|my_center|LOCUS_17820 6746 6324 gene locus_tag LOCUS_17830 6746 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 <7423 6879 gene locus_tag LOCUS_17840 <7423 6879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B7NIE5:ribonuclease HII >Feature sequence144 804 439 gene locus_tag LOCUS_17850 804 439 CDS product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310664.1 protein_id gnl|my_center|LOCUS_17850 2159 891 gene locus_tag LOCUS_17860 2159 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2658 2308 gene locus_tag LOCUS_17870 2658 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2980 4431 gene locus_tag LOCUS_17880 gene amn 2980 4431 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C461 protein_id gnl|my_center|LOCUS_17880 4444 4926 gene locus_tag LOCUS_17890 4444 4926 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088308.1 protein_id gnl|my_center|LOCUS_17890 5565 5005 gene locus_tag LOCUS_17900 5565 5005 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_17900 5917 5582 gene locus_tag LOCUS_17910 5917 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 5831 6526 gene locus_tag LOCUS_17920 5831 6526 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence145 140 910 gene locus_tag LOCUS_17930 gene thiG 140 910 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A746 protein_id gnl|my_center|LOCUS_17930 2284 911 gene locus_tag LOCUS_17940 2284 911 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_17940 3297 2275 gene locus_tag LOCUS_17950 gene gnl 3297 2275 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039182.1 protein_id gnl|my_center|LOCUS_17950 5660 3294 gene locus_tag LOCUS_17960 5660 3294 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_17960 6665 5772 gene locus_tag LOCUS_17970 6665 5772 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529199.1 protein_id gnl|my_center|LOCUS_17970 6763 7134 gene locus_tag LOCUS_17980 6763 7134 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence146 1058 3046 gene locus_tag LOCUS_17990 1058 3046 CDS product O-antigen acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895699.1 protein_id gnl|my_center|LOCUS_17990 3754 3071 gene locus_tag LOCUS_18000 3754 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4007 5563 gene locus_tag LOCUS_18010 4007 5563 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976239.1 protein_id gnl|my_center|LOCUS_18010 6253 5570 gene locus_tag LOCUS_18020 6253 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence147 921 358 gene locus_tag LOCUS_18030 921 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1543 3084 gene locus_tag LOCUS_18040 1543 3084 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920599.1 protein_id gnl|my_center|LOCUS_18040 3094 3792 gene locus_tag LOCUS_18050 3094 3792 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532631.1 protein_id gnl|my_center|LOCUS_18050 3826 5229 gene locus_tag LOCUS_18060 3826 5229 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920596.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence148 1467 406 gene locus_tag LOCUS_18070 1467 406 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550651.1 protein_id gnl|my_center|LOCUS_18070 1874 1554 gene locus_tag LOCUS_18080 gene nolR 1874 1554 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314636.1 protein_id gnl|my_center|LOCUS_18080 5158 1874 gene locus_tag LOCUS_18090 5158 1874 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088515.1 protein_id gnl|my_center|LOCUS_18090 6146 5163 gene locus_tag LOCUS_18100 6146 5163 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404714.1 protein_id gnl|my_center|LOCUS_18100 6492 6133 gene locus_tag LOCUS_18110 6492 6133 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086585.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence149 592 798 gene locus_tag LOCUS_18120 592 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1295 927 gene locus_tag LOCUS_18130 1295 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3004 1397 gene locus_tag LOCUS_18140 3004 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3555 3118 gene locus_tag LOCUS_18150 3555 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4766 3552 gene locus_tag LOCUS_18160 4766 3552 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602456.1 protein_id gnl|my_center|LOCUS_18160 5215 4757 gene locus_tag LOCUS_18170 5215 4757 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_18170 6473 5208 gene locus_tag LOCUS_18180 6473 5208 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MND0 protein_id gnl|my_center|LOCUS_18180 >Feature sequence150 1222 125 gene locus_tag LOCUS_18190 1222 125 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917978.1 protein_id gnl|my_center|LOCUS_18190 1362 2888 gene locus_tag LOCUS_18200 1362 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974780.1 protein_id gnl|my_center|LOCUS_18200 3842 2922 gene locus_tag LOCUS_18210 3842 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4793 3921 gene locus_tag LOCUS_18220 gene mtnP 4793 3921 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 protein_id gnl|my_center|LOCUS_18220 5290 4790 gene locus_tag LOCUS_18230 5290 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 6253 5303 gene locus_tag LOCUS_18240 6253 5303 CDS product ubiquinol cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918362.1 protein_id gnl|my_center|LOCUS_18240 7002 6271 gene locus_tag LOCUS_18250 7002 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence151 1027 218 gene locus_tag LOCUS_18260 1027 218 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_18260 2340 1024 gene locus_tag LOCUS_18270 2340 1024 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_18270 3794 2337 gene locus_tag LOCUS_18280 3794 2337 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_18280 3954 5414 gene locus_tag LOCUS_18290 gene rfaE 3954 5414 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE81 protein_id gnl|my_center|LOCUS_18290 >Feature sequence152 4746 3238 gene locus_tag LOCUS_18300 4746 3238 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_18300 5014 5214 gene locus_tag LOCUS_18310 5014 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 5230 5757 gene locus_tag LOCUS_18320 5230 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402218.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence153 1513 785 gene locus_tag LOCUS_18330 1513 785 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921365.1 protein_id gnl|my_center|LOCUS_18330 2604 1510 gene locus_tag LOCUS_18340 2604 1510 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 protein_id gnl|my_center|LOCUS_18340 3043 2588 gene locus_tag LOCUS_18350 3043 2588 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 protein_id gnl|my_center|LOCUS_18350 3197 4456 gene locus_tag LOCUS_18360 3197 4456 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_18360 4474 4794 gene locus_tag LOCUS_18370 4474 4794 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_18370 4931 5719 gene locus_tag LOCUS_18380 4931 5719 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920330.1 protein_id gnl|my_center|LOCUS_18380 6652 5726 gene locus_tag LOCUS_18390 6652 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence154 3118 608 gene locus_tag LOCUS_18400 3118 608 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921186.1 protein_id gnl|my_center|LOCUS_18400 3330 4625 gene locus_tag LOCUS_18410 3330 4625 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_18410 5761 4622 gene locus_tag LOCUS_18420 5761 4622 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919227.1 protein_id gnl|my_center|LOCUS_18420 5822 6364 gene locus_tag LOCUS_18430 5822 6364 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095458.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence155 1395 2708 gene locus_tag LOCUS_18440 1395 2708 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_18440 2758 3492 gene locus_tag LOCUS_18450 2758 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3532 4836 gene locus_tag LOCUS_18460 3532 4836 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 protein_id gnl|my_center|LOCUS_18460 5851 4799 gene locus_tag LOCUS_18470 5851 4799 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAR8 protein_id gnl|my_center|LOCUS_18470 6195 5848 gene locus_tag LOCUS_18480 6195 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338625.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence156 <1 539 gene locus_tag LOCUS_18490 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C3N8:tryptophan--tRNA ligase 638 1099 gene locus_tag LOCUS_18500 638 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921331.1 protein_id gnl|my_center|LOCUS_18500 1287 2345 gene locus_tag LOCUS_18510 1287 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2439 3017 gene locus_tag LOCUS_18520 2439 3017 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639868.1 protein_id gnl|my_center|LOCUS_18520 3118 3717 gene locus_tag LOCUS_18530 3118 3717 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58792 protein_id gnl|my_center|LOCUS_18530 3733 4380 gene locus_tag LOCUS_18540 3733 4380 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917948.1 protein_id gnl|my_center|LOCUS_18540 4377 4838 gene locus_tag LOCUS_18550 gene rimI 4377 4838 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_18550 4911 5798 gene locus_tag LOCUS_18560 4911 5798 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302757.1 protein_id gnl|my_center|LOCUS_18560 5921 6292 gene locus_tag LOCUS_18570 5921 6292 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence157 677 540 gene locus_tag LOCUS_18580 677 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1483 755 gene locus_tag LOCUS_18590 1483 755 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919975.1 protein_id gnl|my_center|LOCUS_18590 1689 1483 gene locus_tag LOCUS_18600 1689 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085319.1 protein_id gnl|my_center|LOCUS_18600 2174 1689 gene locus_tag LOCUS_18610 2174 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2341 3354 gene locus_tag LOCUS_18620 gene ispB 2341 3354 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707039.1 protein_id gnl|my_center|LOCUS_18620 4420 3338 gene locus_tag LOCUS_18630 4420 3338 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268559.1 protein_id gnl|my_center|LOCUS_18630 5289 4417 gene locus_tag LOCUS_18640 gene ispE 5289 4417 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_18640 >Feature sequence158 1021 185 gene locus_tag LOCUS_18650 1021 185 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919119.1 protein_id gnl|my_center|LOCUS_18650 1129 1213 gene locus_tag LOCUS_t00220 1129 1213 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1245 1318 gene locus_tag LOCUS_t00230 1245 1318 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1463 3298 gene locus_tag LOCUS_18660 1463 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095767.1 protein_id gnl|my_center|LOCUS_18660 4408 3377 gene locus_tag LOCUS_18670 4408 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 <6560 4499 gene locus_tag LOCUS_18680 <6560 4499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104454.1:TonB-dependent receptor >Feature sequence159 228 1319 gene locus_tag LOCUS_18690 228 1319 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919480.1 protein_id gnl|my_center|LOCUS_18690 1372 2622 gene locus_tag LOCUS_18700 1372 2622 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268483.1 protein_id gnl|my_center|LOCUS_18700 2615 4033 gene locus_tag LOCUS_18710 2615 4033 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067363.1 protein_id gnl|my_center|LOCUS_18710 4030 5463 gene locus_tag LOCUS_18720 gene astD 4030 5463 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C761 protein_id gnl|my_center|LOCUS_18720 6342 5611 gene locus_tag LOCUS_18730 6342 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence160 965 1720 gene locus_tag LOCUS_18740 965 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1756 2682 gene locus_tag LOCUS_18750 1756 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2695 3492 gene locus_tag LOCUS_18760 2695 3492 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090567.1 protein_id gnl|my_center|LOCUS_18760 4515 3646 gene locus_tag LOCUS_18770 4515 3646 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_18770 4915 5301 gene locus_tag LOCUS_18780 gene flbT 4915 5301 CDS product flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21297 protein_id gnl|my_center|LOCUS_18780 5301 5612 gene locus_tag LOCUS_18790 5301 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5622 6269 gene locus_tag LOCUS_18800 5622 6269 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C8 protein_id gnl|my_center|LOCUS_18800 >Feature sequence161 2759 1068 gene locus_tag LOCUS_18810 2759 1068 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV4 protein_id gnl|my_center|LOCUS_18810 4654 2843 gene locus_tag LOCUS_18820 4654 2843 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 protein_id gnl|my_center|LOCUS_18820 4832 5014 gene locus_tag LOCUS_18830 4832 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5934 5023 gene locus_tag LOCUS_18840 gene prmA 5934 5023 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A838 protein_id gnl|my_center|LOCUS_18840 >Feature sequence162 1049 973 gene locus_tag LOCUS_t00240 1049 973 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1679 1137 gene locus_tag LOCUS_18850 gene nusG 1679 1137 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QI2 protein_id gnl|my_center|LOCUS_18850 1934 1719 gene locus_tag LOCUS_18860 1934 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2936 2055 gene locus_tag LOCUS_18870 2936 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3842 2979 gene locus_tag LOCUS_18880 3842 2979 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528598.1 protein_id gnl|my_center|LOCUS_18880 3995 4828 gene locus_tag LOCUS_18890 3995 4828 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_18890 6149 4833 gene locus_tag LOCUS_18900 gene hflX 6149 4833 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7H7 protein_id gnl|my_center|LOCUS_18900 6404 6156 gene locus_tag LOCUS_18910 gene hfq 6404 6156 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW92 protein_id gnl|my_center|LOCUS_18910 >Feature sequence163 1763 1149 gene locus_tag LOCUS_18920 1763 1149 CDS product Tim44-like domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266001.1 protein_id gnl|my_center|LOCUS_18920 1898 2398 gene locus_tag LOCUS_18930 gene secB 1898 2398 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A224 protein_id gnl|my_center|LOCUS_18930 3100 2399 gene locus_tag LOCUS_18940 gene dnaQ 3100 2399 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563276.1 protein_id gnl|my_center|LOCUS_18940 3708 3097 gene locus_tag LOCUS_18950 gene coaE 3708 3097 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58100 protein_id gnl|my_center|LOCUS_18950 4520 3705 gene locus_tag LOCUS_18960 gene aroE 4520 3705 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SZ3 protein_id gnl|my_center|LOCUS_18960 5113 4517 gene locus_tag LOCUS_18970 5113 4517 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN87 protein_id gnl|my_center|LOCUS_18970 6018 5110 gene locus_tag LOCUS_18980 6018 5110 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 protein_id gnl|my_center|LOCUS_18980 >Feature sequence164 1210 269 gene locus_tag LOCUS_18990 1210 269 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090116.1 protein_id gnl|my_center|LOCUS_18990 1297 1875 gene locus_tag LOCUS_19000 1297 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1875 2507 gene locus_tag LOCUS_19010 1875 2507 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086905.1 protein_id gnl|my_center|LOCUS_19010 2613 2539 gene locus_tag LOCUS_t00250 2613 2539 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3926 2889 gene locus_tag LOCUS_19020 3926 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5479 3923 gene locus_tag LOCUS_19030 gene pgi 5479 3923 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABK5 protein_id gnl|my_center|LOCUS_19030 >Feature sequence165 233 664 gene locus_tag LOCUS_19040 233 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 770 2188 gene locus_tag LOCUS_19050 gene qxtA 770 2188 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339133.1 protein_id gnl|my_center|LOCUS_19050 2198 3253 gene locus_tag LOCUS_19060 gene qxtB 2198 3253 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968658.1 protein_id gnl|my_center|LOCUS_19060 3243 3389 gene locus_tag LOCUS_19070 3243 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 5001 3379 gene locus_tag LOCUS_19080 5001 3379 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_19080 <6372 5175 gene locus_tag LOCUS_19090 <6372 5175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0CAT9:60 kDa chaperonin >Feature sequence166 <1 655 gene locus_tag LOCUS_19100 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CEH0:enoyl-[acyl-carrier-protein] reductase [NADH] 658 1434 gene locus_tag LOCUS_19110 658 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2076 1438 gene locus_tag LOCUS_19120 2076 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2364 2621 gene locus_tag LOCUS_19130 2364 2621 CDS product UPF0386 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFS6 protein_id gnl|my_center|LOCUS_19130 2701 3357 gene locus_tag LOCUS_19140 2701 3357 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766140.1 protein_id gnl|my_center|LOCUS_19140 3469 4062 gene locus_tag LOCUS_19150 3469 4062 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 protein_id gnl|my_center|LOCUS_19150 4926 4090 gene locus_tag LOCUS_19160 4926 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5882 4977 gene locus_tag LOCUS_19170 gene lppC 5882 4977 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404190.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence167 811 17 gene locus_tag LOCUS_19180 gene thyA 811 17 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_19180 1094 2554 gene locus_tag LOCUS_19190 1094 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3663 2551 gene locus_tag LOCUS_19200 gene recF 3663 2551 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW1 protein_id gnl|my_center|LOCUS_19200 4812 3691 gene locus_tag LOCUS_19210 gene dnaN 4812 3691 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAU5 protein_id gnl|my_center|LOCUS_19210 <6359 5008 gene locus_tag LOCUS_19220 <6359 5008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IY61:chromosomal replication initiator protein DnaA >Feature sequence168 82 1329 gene locus_tag LOCUS_19230 82 1329 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_19230 1337 3121 gene locus_tag LOCUS_19240 1337 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3284 4138 gene locus_tag LOCUS_19250 3284 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4160 5593 gene locus_tag LOCUS_19260 4160 5593 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891467.1 protein_id gnl|my_center|LOCUS_19260 <6319 5621 gene locus_tag LOCUS_19270 <6319 5621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085241.1:transcriptional regulator >Feature sequence169 996 172 gene locus_tag LOCUS_19280 996 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2398 1109 gene locus_tag LOCUS_19290 gene rsaFb 2398 1109 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_19290 3168 2515 gene locus_tag LOCUS_19300 3168 2515 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_19300 3323 3396 gene locus_tag LOCUS_t00260 3323 3396 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3722 3797 gene locus_tag LOCUS_t00270 3722 3797 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4523 3933 gene locus_tag LOCUS_19310 4523 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5899 4523 gene locus_tag LOCUS_19320 gene sdaA 5899 4523 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence170 3143 1296 gene locus_tag LOCUS_19330 3143 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1517 1591 gene locus_tag LOCUS_t00280 1517 1591 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3534 3169 gene locus_tag LOCUS_19340 3534 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 4024 3743 gene locus_tag LOCUS_19350 4024 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4284 4021 gene locus_tag LOCUS_19360 4284 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 4452 4622 gene locus_tag LOCUS_19370 4452 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 6226 4619 gene locus_tag LOCUS_19380 6226 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence171 315 518 gene locus_tag LOCUS_19390 315 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 767 519 gene locus_tag LOCUS_19400 767 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2726 1569 gene locus_tag LOCUS_19410 2726 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55455 protein_id gnl|my_center|LOCUS_19410 2881 3492 gene locus_tag LOCUS_19420 2881 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19420 3763 5655 gene locus_tag LOCUS_19430 3763 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence172 3580 1958 gene locus_tag LOCUS_19440 3580 1958 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919632.1 protein_id gnl|my_center|LOCUS_19440 5264 3627 gene locus_tag LOCUS_19450 gene aceB 5264 3627 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM57 protein_id gnl|my_center|LOCUS_19450 4747 4662 gene locus_tag LOCUS_t00290 4747 4662 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence173 <1 521 gene locus_tag LOCUS_19460 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89FP0:phosphomethylpyrimidine synthase 518 1126 gene locus_tag LOCUS_19470 518 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1166 2161 gene locus_tag LOCUS_19480 1166 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2363 2142 gene locus_tag LOCUS_19490 2363 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2362 2586 gene locus_tag LOCUS_19500 gene slyX 2362 2586 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SJ8 protein_id gnl|my_center|LOCUS_19500 2794 3408 gene locus_tag LOCUS_19510 2794 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3488 3991 gene locus_tag LOCUS_19520 gene ruvC 3488 3991 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD11 protein_id gnl|my_center|LOCUS_19520 3988 4611 gene locus_tag LOCUS_19530 gene ruvA 3988 4611 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U81 protein_id gnl|my_center|LOCUS_19530 4608 5642 gene locus_tag LOCUS_19540 gene ruvB 4608 5642 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3G8 protein_id gnl|my_center|LOCUS_19540 5748 5990 gene locus_tag LOCUS_19550 5748 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence174 <1 1045 gene locus_tag LOCUS_19560 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89N41:carboxylic ester hydrolase 1477 1010 gene locus_tag LOCUS_19570 1477 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_19570 1621 2424 gene locus_tag LOCUS_19580 1621 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265569.1 protein_id gnl|my_center|LOCUS_19580 2421 3647 gene locus_tag LOCUS_19590 2421 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918452.1 protein_id gnl|my_center|LOCUS_19590 3634 4590 gene locus_tag LOCUS_19600 3634 4590 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918453.1 protein_id gnl|my_center|LOCUS_19600 4587 5900 gene locus_tag LOCUS_19610 4587 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918454.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence175 <1 798 gene locus_tag LOCUS_19620 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001043985.1:serine protease 871 1518 gene locus_tag LOCUS_19630 871 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1608 1976 gene locus_tag LOCUS_19640 1608 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2073 3479 gene locus_tag LOCUS_19650 2073 3479 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3C8 protein_id gnl|my_center|LOCUS_19650 3627 3998 gene locus_tag LOCUS_19660 3627 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4319 4008 gene locus_tag LOCUS_19670 4319 4008 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 protein_id gnl|my_center|LOCUS_19670 4933 4328 gene locus_tag LOCUS_19680 4933 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5816 5058 gene locus_tag LOCUS_19690 5816 5058 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM33 protein_id gnl|my_center|LOCUS_19690 >Feature sequence176 411 2237 gene locus_tag LOCUS_19700 gene glmS 411 2237 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59362 protein_id gnl|my_center|LOCUS_19700 2307 2888 gene locus_tag LOCUS_19710 2307 2888 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_19710 2885 3931 gene locus_tag LOCUS_19720 2885 3931 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ9 protein_id gnl|my_center|LOCUS_19720 3931 4815 gene locus_tag LOCUS_19730 gene rfbD 3931 4815 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 protein_id gnl|my_center|LOCUS_19730 4812 5675 gene locus_tag LOCUS_19740 gene rffH 4812 5675 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z391 protein_id gnl|my_center|LOCUS_19740 >Feature sequence177 2218 470 gene locus_tag LOCUS_19750 2218 470 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_19750 3058 2411 gene locus_tag LOCUS_19760 3058 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3770 3156 gene locus_tag LOCUS_19770 3770 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 5750 3828 gene locus_tag LOCUS_19780 gene dxs 5750 3828 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M5 protein_id gnl|my_center|LOCUS_19780 >Feature sequence178 661 3156 gene locus_tag LOCUS_19790 661 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3129 3527 gene locus_tag LOCUS_19800 3129 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 4719 3538 gene locus_tag LOCUS_19810 gene metK2 4719 3538 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_19810 5604 4750 gene locus_tag LOCUS_19820 gene purU 5604 4750 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJT8 protein_id gnl|my_center|LOCUS_19820 >Feature sequence179 394 984 gene locus_tag LOCUS_19830 394 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1376 1041 gene locus_tag LOCUS_19840 1376 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1570 2103 gene locus_tag LOCUS_19850 1570 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3095 2181 gene locus_tag LOCUS_19860 gene rpoH 3095 2181 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW9 protein_id gnl|my_center|LOCUS_19860 3463 4002 gene locus_tag LOCUS_19870 3463 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 5761 4091 gene locus_tag LOCUS_19880 5761 4091 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence180 559 1272 gene locus_tag LOCUS_19890 559 1272 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066824.1 protein_id gnl|my_center|LOCUS_19890 1382 1987 gene locus_tag LOCUS_19900 gene recR 1382 1987 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF23 protein_id gnl|my_center|LOCUS_19900 3172 2015 gene locus_tag LOCUS_19910 3172 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_19910 <5854 3296 gene locus_tag LOCUS_19920 <5854 3296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919676.1:TonB-dependent receptor >Feature sequence181 3396 1402 gene locus_tag LOCUS_19930 3396 1402 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920917.1 protein_id gnl|my_center|LOCUS_19930 3509 4042 gene locus_tag LOCUS_19940 3509 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4108 4410 gene locus_tag LOCUS_19950 4108 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931770.1 protein_id gnl|my_center|LOCUS_19950 4829 4356 gene locus_tag LOCUS_19960 4829 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 5239 4796 gene locus_tag LOCUS_19970 5239 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19970 >Feature sequence182 118 1998 gene locus_tag LOCUS_19980 118 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3017 2061 gene locus_tag LOCUS_19990 3017 2061 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_19990 5045 3189 gene locus_tag LOCUS_20000 5045 3189 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921167.1 protein_id gnl|my_center|LOCUS_20000 <5770 5137 gene locus_tag LOCUS_20010 <5770 5137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TN17:phosphoglucosamine mutase >Feature sequence183 1603 302 gene locus_tag LOCUS_20020 1603 302 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3K2 protein_id gnl|my_center|LOCUS_20020 3000 1600 gene locus_tag LOCUS_20030 3000 1600 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865090.1 protein_id gnl|my_center|LOCUS_20030 3280 3609 gene locus_tag LOCUS_20040 3280 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972585.1 protein_id gnl|my_center|LOCUS_20040 4382 3606 gene locus_tag LOCUS_20050 gene kdgR 4382 3606 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039141.1 protein_id gnl|my_center|LOCUS_20050 5146 4502 gene locus_tag LOCUS_20060 5146 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence184 1814 915 gene locus_tag LOCUS_20070 1814 915 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 protein_id gnl|my_center|LOCUS_20070 1931 2479 gene locus_tag LOCUS_20080 gene ahpC 1931 2479 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084586.1 protein_id gnl|my_center|LOCUS_20080 2724 3266 gene locus_tag LOCUS_20090 gene ahpD 2724 3266 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKI6 protein_id gnl|my_center|LOCUS_20090 3684 4196 gene locus_tag LOCUS_20100 gene mraZ 3684 4196 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58768 protein_id gnl|my_center|LOCUS_20100 4196 5227 gene locus_tag LOCUS_20110 gene rsmH 4196 5227 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0A2 protein_id gnl|my_center|LOCUS_20110 5224 5565 gene locus_tag LOCUS_20120 5224 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence185 2652 412 gene locus_tag LOCUS_20130 gene fyuA 2652 412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_20130 3329 2757 gene locus_tag LOCUS_20140 gene regA 3329 2757 CDS product photosynthetic apparatus regulatory protein RegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53228 protein_id gnl|my_center|LOCUS_20140 4745 3378 gene locus_tag LOCUS_20150 4745 3378 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 protein_id gnl|my_center|LOCUS_20150 4820 5455 gene locus_tag LOCUS_20160 4820 5455 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence186 201 61 gene locus_tag LOCUS_20170 201 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 327 638 gene locus_tag LOCUS_20180 327 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 641 1048 gene locus_tag LOCUS_20190 641 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1056 1544 gene locus_tag LOCUS_20200 1056 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1670 1918 gene locus_tag LOCUS_20210 1670 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2018 2641 gene locus_tag LOCUS_20220 2018 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 3656 2661 gene locus_tag LOCUS_20230 3656 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4030 3677 gene locus_tag LOCUS_20240 4030 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 <5624 4253 gene locus_tag LOCUS_20250 <5624 4253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339202.1:integrase >Feature sequence187 3417 1879 gene locus_tag LOCUS_20260 3417 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 5554 3557 gene locus_tag LOCUS_20270 gene parE 5554 3557 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBJ0 protein_id gnl|my_center|LOCUS_20270 >Feature sequence188 2462 1437 gene locus_tag LOCUS_20280 2462 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 5491 2702 gene locus_tag LOCUS_20290 5491 2702 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338672.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence189 1991 837 gene locus_tag LOCUS_20300 gene thiO 1991 837 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403986.1 protein_id gnl|my_center|LOCUS_20300 2284 2030 gene locus_tag LOCUS_20310 2284 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2509 3573 gene locus_tag LOCUS_20320 gene idiA 2509 3573 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_20320 3580 5193 gene locus_tag LOCUS_20330 3580 5193 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence190 16 1092 gene locus_tag LOCUS_20340 16 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918832.1 protein_id gnl|my_center|LOCUS_20340 1193 1681 gene locus_tag LOCUS_20350 1193 1681 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_20350 1678 1977 gene locus_tag LOCUS_20360 1678 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1970 2344 gene locus_tag LOCUS_20370 1970 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2344 2988 gene locus_tag LOCUS_20380 2344 2988 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_20380 2985 3437 gene locus_tag LOCUS_20390 2985 3437 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_20390 3441 3956 gene locus_tag LOCUS_20400 3441 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3953 5485 gene locus_tag LOCUS_20410 3953 5485 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence191 <1 705 gene locus_tag LOCUS_20420 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6U766:glutamate-ammonia-ligase adenylyltransferase 761 1237 gene locus_tag LOCUS_20430 761 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1338 1880 gene locus_tag LOCUS_20440 1338 1880 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S9 protein_id gnl|my_center|LOCUS_20440 1877 2323 gene locus_tag LOCUS_20450 1877 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2320 2781 gene locus_tag LOCUS_20460 2320 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2843 4291 gene locus_tag LOCUS_20470 2843 4291 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_20470 4381 4860 gene locus_tag LOCUS_20480 4381 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4862 5266 gene locus_tag LOCUS_20490 4862 5266 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143594.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence192 118 540 gene locus_tag LOCUS_20500 118 540 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_20500 641 1636 gene locus_tag LOCUS_20510 641 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1707 3557 gene locus_tag LOCUS_20520 1707 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3586 4695 gene locus_tag LOCUS_20530 3586 4695 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530947.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence193 971 345 gene locus_tag LOCUS_20540 971 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 1546 1019 gene locus_tag LOCUS_20550 1546 1019 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919960.1 protein_id gnl|my_center|LOCUS_20550 1716 3017 gene locus_tag LOCUS_20560 1716 3017 CDS product sodium dependent nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919950.1 protein_id gnl|my_center|LOCUS_20560 3184 5202 gene locus_tag LOCUS_20570 3184 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence194 573 100 gene locus_tag LOCUS_20580 573 100 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919248.1 protein_id gnl|my_center|LOCUS_20580 884 591 gene locus_tag LOCUS_20590 gene ihfA 884 591 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS7 protein_id gnl|my_center|LOCUS_20590 1959 988 gene locus_tag LOCUS_20600 gene fabH 1959 988 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG62 protein_id gnl|my_center|LOCUS_20600 3016 1982 gene locus_tag LOCUS_20610 gene plsX 3016 1982 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7B8 protein_id gnl|my_center|LOCUS_20610 3647 3114 gene locus_tag LOCUS_20620 3647 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 3739 4215 gene locus_tag LOCUS_20630 gene bamE 3739 4215 CDS product SmpA/OmlA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640219.1 protein_id gnl|my_center|LOCUS_20630 4856 4656 gene locus_tag LOCUS_20640 4856 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence195 401 1411 gene locus_tag LOCUS_20650 gene add 401 1411 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_20650 1746 4166 gene locus_tag LOCUS_20660 1746 4166 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_20660 4918 4286 gene locus_tag LOCUS_20670 4918 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence196 <1 756 gene locus_tag LOCUS_20680 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74A53:carboxynorspermidine/carboxyspermidine decarboxylase 2038 1214 gene locus_tag LOCUS_20690 2038 1214 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_20690 2612 2106 gene locus_tag LOCUS_20700 2612 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2729 3397 gene locus_tag LOCUS_20710 2729 3397 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388998.1 protein_id gnl|my_center|LOCUS_20710 4662 3421 gene locus_tag LOCUS_20720 4662 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 <5395 4650 gene locus_tag LOCUS_20730 <5395 4650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CBT1:acetylornithine aminotransferase >Feature sequence197 1240 1719 gene locus_tag LOCUS_20740 gene ybaO 1240 1719 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 protein_id gnl|my_center|LOCUS_20740 2240 3850 gene locus_tag LOCUS_20750 gene pnbA 2240 3850 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37967 protein_id gnl|my_center|LOCUS_20750 5218 3845 gene locus_tag LOCUS_20760 5218 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence198 464 1195 gene locus_tag LOCUS_20770 464 1195 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_20770 1200 1364 gene locus_tag LOCUS_20780 1200 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 1361 1885 gene locus_tag LOCUS_20790 1361 1885 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921501.1 protein_id gnl|my_center|LOCUS_20790 2594 1902 gene locus_tag LOCUS_20800 2594 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2945 3274 gene locus_tag LOCUS_20810 2945 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3915 3271 gene locus_tag LOCUS_20820 3915 3271 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC06 protein_id gnl|my_center|LOCUS_20820 4891 4031 gene locus_tag LOCUS_20830 4891 4031 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971497.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence199 1622 198 gene locus_tag LOCUS_20840 gene leuC 1622 198 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABN0 protein_id gnl|my_center|LOCUS_20840 1820 2365 gene locus_tag LOCUS_20850 1820 2365 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892027.1 protein_id gnl|my_center|LOCUS_20850 2908 2417 gene locus_tag LOCUS_20860 2908 2417 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262312.1 protein_id gnl|my_center|LOCUS_20860 3106 4242 gene locus_tag LOCUS_20870 3106 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705059.1 protein_id gnl|my_center|LOCUS_20870 4245 5180 gene locus_tag LOCUS_20880 4245 5180 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYH8 protein_id gnl|my_center|LOCUS_20880 >Feature sequence200 476 661 gene locus_tag LOCUS_20890 476 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1098 673 gene locus_tag LOCUS_20900 1098 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3166 1085 gene locus_tag LOCUS_20910 3166 1085 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_20910 3910 3395 gene locus_tag LOCUS_20920 3910 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence201 502 1779 gene locus_tag LOCUS_20930 502 1779 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921511.1 protein_id gnl|my_center|LOCUS_20930 1776 3161 gene locus_tag LOCUS_20940 1776 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3428 3213 gene locus_tag LOCUS_20950 3428 3213 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_20950 3838 3434 gene locus_tag LOCUS_20960 3838 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 <5309 3920 gene locus_tag LOCUS_20970 <5309 3920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921289.1:amidohydrolase >Feature sequence202 1045 416 gene locus_tag LOCUS_20980 gene trpF 1045 416 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS6 protein_id gnl|my_center|LOCUS_20980 1640 1107 gene locus_tag LOCUS_20990 1640 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 3248 1737 gene locus_tag LOCUS_21000 3248 1737 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921551.1 protein_id gnl|my_center|LOCUS_21000 3532 3443 gene locus_tag LOCUS_t00300 3532 3443 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3641 4297 gene locus_tag LOCUS_21010 gene msrA 3641 4297 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W59 protein_id gnl|my_center|LOCUS_21010 >Feature sequence203 821 285 gene locus_tag LOCUS_21020 gene ppa 821 285 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC37 protein_id gnl|my_center|LOCUS_21020 991 1401 gene locus_tag LOCUS_21030 991 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2023 1406 gene locus_tag LOCUS_21040 2023 1406 CDS product 2OG-Fe(II) oxygenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_21040 3055 2120 gene locus_tag LOCUS_21050 3055 2120 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640450.1 protein_id gnl|my_center|LOCUS_21050 3260 3739 gene locus_tag LOCUS_21060 3260 3739 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066931.1 protein_id gnl|my_center|LOCUS_21060 4806 3814 gene locus_tag LOCUS_21070 4806 3814 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence204 1345 401 gene locus_tag LOCUS_21080 1345 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 protein_id gnl|my_center|LOCUS_21080 1396 2622 gene locus_tag LOCUS_21090 gene kynU 1396 2622 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS87 protein_id gnl|my_center|LOCUS_21090 2622 3443 gene locus_tag LOCUS_21100 2622 3443 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 protein_id gnl|my_center|LOCUS_21100 4411 3440 gene locus_tag LOCUS_21110 4411 3440 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_21110 5205 4408 gene locus_tag LOCUS_21120 5205 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence205 1313 345 gene locus_tag LOCUS_21130 1313 345 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_21130 1444 1614 gene locus_tag LOCUS_21140 1444 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1745 2254 gene locus_tag LOCUS_21150 gene rcdA 1745 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 protein_id gnl|my_center|LOCUS_21150 3329 2265 gene locus_tag LOCUS_21160 3329 2265 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090852.1 protein_id gnl|my_center|LOCUS_21160 3986 3387 gene locus_tag LOCUS_21170 3986 3387 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400977.1 protein_id gnl|my_center|LOCUS_21170 4138 4761 gene locus_tag LOCUS_21180 4138 4761 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAR1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence206 <1 609 gene locus_tag LOCUS_21190 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92QQ2:ATP-dependent Clp protease ATP-binding subunit ClpX 2213 810 gene locus_tag LOCUS_21200 gene glnA 2213 810 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIN7 protein_id gnl|my_center|LOCUS_21200 2614 2276 gene locus_tag LOCUS_21210 2614 2276 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_21210 3021 3560 gene locus_tag LOCUS_21220 3021 3560 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 protein_id gnl|my_center|LOCUS_21220 3570 5012 gene locus_tag LOCUS_21230 3570 5012 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9N6 protein_id gnl|my_center|LOCUS_21230 5078 5162 gene locus_tag LOCUS_t00310 5078 5162 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence207 108 1064 gene locus_tag LOCUS_21240 108 1064 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3Y3 protein_id gnl|my_center|LOCUS_21240 1061 2311 gene locus_tag LOCUS_21250 gene argJ 1061 2311 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 protein_id gnl|my_center|LOCUS_21250 2308 2724 gene locus_tag LOCUS_21260 gene mutT 2308 2724 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_21260 2727 2900 gene locus_tag LOCUS_21270 2727 2900 CDS product pilus subunit protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523377.1 protein_id gnl|my_center|LOCUS_21270 3816 2911 gene locus_tag LOCUS_21280 gene bioC 3816 2911 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_21280 3815 4585 gene locus_tag LOCUS_21290 3815 4585 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_21290 4626 4883 gene locus_tag LOCUS_21300 4626 4883 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence208 185 1012 gene locus_tag LOCUS_21310 185 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1871 1029 gene locus_tag LOCUS_21320 1871 1029 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_21320 2288 1896 gene locus_tag LOCUS_21330 2288 1896 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_21330 2417 2896 gene locus_tag LOCUS_21340 2417 2896 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918246.1 protein_id gnl|my_center|LOCUS_21340 2950 3816 gene locus_tag LOCUS_21350 2950 3816 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_21350 5006 3813 gene locus_tag LOCUS_21360 gene aspC 5006 3813 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56114 protein_id gnl|my_center|LOCUS_21360 >Feature sequence209 860 417 gene locus_tag LOCUS_21370 860 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1577 864 gene locus_tag LOCUS_21380 1577 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2294 1833 gene locus_tag LOCUS_21390 2294 1833 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 protein_id gnl|my_center|LOCUS_21390 2880 2326 gene locus_tag LOCUS_21400 gene blc 2880 2326 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038950.1 protein_id gnl|my_center|LOCUS_21400 3947 2943 gene locus_tag LOCUS_21410 3947 2943 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_21410 4766 4011 gene locus_tag LOCUS_21420 4766 4011 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921553.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence210 1267 791 gene locus_tag LOCUS_21430 1267 791 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 protein_id gnl|my_center|LOCUS_21430 1818 1399 gene locus_tag LOCUS_21440 1818 1399 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338748.1 protein_id gnl|my_center|LOCUS_21440 3202 1841 gene locus_tag LOCUS_21450 3202 1841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921144.1 protein_id gnl|my_center|LOCUS_21450 3460 4242 gene locus_tag LOCUS_21460 3460 4242 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_21460 4383 4646 gene locus_tag LOCUS_21470 gene rpsT 4383 4646 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY9 protein_id gnl|my_center|LOCUS_21470 >Feature sequence211 281 1132 gene locus_tag LOCUS_21480 281 1132 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640436.1 protein_id gnl|my_center|LOCUS_21480 1129 2031 gene locus_tag LOCUS_21490 1129 2031 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_21490 2105 3688 gene locus_tag LOCUS_21500 gene phoA 2105 3688 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_21500 3704 4471 gene locus_tag LOCUS_21510 3704 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence212 325 1728 gene locus_tag LOCUS_21520 325 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2112 3323 gene locus_tag LOCUS_21530 gene rtcB 2112 3323 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P433 protein_id gnl|my_center|LOCUS_21530 3596 4651 gene locus_tag LOCUS_21540 3596 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence213 <1 638 gene locus_tag LOCUS_21550 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3M9C8:putative cytosol aminopeptidase 644 1117 gene locus_tag LOCUS_21560 644 1117 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919563.1 protein_id gnl|my_center|LOCUS_21560 1120 1536 gene locus_tag LOCUS_21570 1120 1536 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052499.1 protein_id gnl|my_center|LOCUS_21570 1875 1543 gene locus_tag LOCUS_21580 1875 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_21580 2020 2442 gene locus_tag LOCUS_21590 gene ndk 2020 2442 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MS3 protein_id gnl|my_center|LOCUS_21590 2936 2583 gene locus_tag LOCUS_21600 2936 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3671 3081 gene locus_tag LOCUS_21610 gene purN 3671 3081 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S7 protein_id gnl|my_center|LOCUS_21610 4693 3668 gene locus_tag LOCUS_21620 gene purM 4693 3668 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7L9 protein_id gnl|my_center|LOCUS_21620 >Feature sequence214 <1 1904 gene locus_tag LOCUS_21630 <1 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GZ28:chromosome partition protein Smc 2055 2411 gene locus_tag LOCUS_21640 2055 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2408 3190 gene locus_tag LOCUS_21650 gene atpB 2408 3190 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 protein_id gnl|my_center|LOCUS_21650 3306 3542 gene locus_tag LOCUS_21660 gene atpE 3306 3542 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ13 protein_id gnl|my_center|LOCUS_21660 3631 4182 gene locus_tag LOCUS_21670 gene atpF 3631 4182 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T931 protein_id gnl|my_center|LOCUS_21670 4194 4784 gene locus_tag LOCUS_21680 4194 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence215 43 1296 gene locus_tag LOCUS_21690 43 1296 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_21690 2357 1299 gene locus_tag LOCUS_21700 2357 1299 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_21700 3205 2354 gene locus_tag LOCUS_21710 3205 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3811 4188 gene locus_tag LOCUS_21720 3811 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 <4929 4276 gene locus_tag LOCUS_21730 <4929 4276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CC10:ribonucleoside-diphosphate reductase >Feature sequence216 <4862 2341 gene locus_tag LOCUS_21740 <4862 2341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726922.1:polyketide synthase >Feature sequence217 1666 752 gene locus_tag LOCUS_21750 1666 752 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_21750 2121 1663 gene locus_tag LOCUS_21760 2121 1663 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Z5 protein_id gnl|my_center|LOCUS_21760 2201 2488 gene locus_tag LOCUS_21770 gene gatC 2201 2488 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK8 protein_id gnl|my_center|LOCUS_21770 2851 2492 gene locus_tag LOCUS_21780 2851 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 3379 2909 gene locus_tag LOCUS_21790 3379 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3502 4839 gene locus_tag LOCUS_21800 gene gatA 3502 4839 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L0 protein_id gnl|my_center|LOCUS_21800 >Feature sequence218 581 1294 gene locus_tag LOCUS_21810 581 1294 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_21810 1346 2245 gene locus_tag LOCUS_21820 gene xerC 1346 2245 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV24 protein_id gnl|my_center|LOCUS_21820 2347 2865 gene locus_tag LOCUS_21830 2347 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 3069 3890 gene locus_tag LOCUS_21840 gene mvrA 3069 3890 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971635.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence219 2510 2692 gene locus_tag LOCUS_21850 2510 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2807 3109 gene locus_tag LOCUS_21860 2807 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3736 3206 gene locus_tag LOCUS_21870 gene sixA 3736 3206 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918414.1 protein_id gnl|my_center|LOCUS_21870 3864 4502 gene locus_tag LOCUS_21880 3864 4502 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence220 629 1057 gene locus_tag LOCUS_21890 629 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2266 1130 gene locus_tag LOCUS_21900 2266 1130 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_21900 2586 2263 gene locus_tag LOCUS_21910 2586 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3803 2589 gene locus_tag LOCUS_21920 3803 2589 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_21920 <4809 3927 gene locus_tag LOCUS_21930 <4809 3927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970924.1:glycosyl transferase >Feature sequence221 1134 1757 gene locus_tag LOCUS_21940 gene folE 1134 1757 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T6 protein_id gnl|my_center|LOCUS_21940 2600 1818 gene locus_tag LOCUS_21950 2600 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3139 2624 gene locus_tag LOCUS_21960 gene rppH 3139 2624 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV14 protein_id gnl|my_center|LOCUS_21960 4443 3136 gene locus_tag LOCUS_21970 4443 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence222 315 1382 gene locus_tag LOCUS_21980 315 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2952 1420 gene locus_tag LOCUS_21990 2952 1420 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_21990 3885 2968 gene locus_tag LOCUS_22000 3885 2968 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_22000 3987 4637 gene locus_tag LOCUS_22010 3987 4637 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence223 1609 272 gene locus_tag LOCUS_22020 1609 272 CDS product imidazolonepropionase related amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265753.1 protein_id gnl|my_center|LOCUS_22020 <4726 1685 gene locus_tag LOCUS_22030 <4726 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265653.1:TonB-dependent receptor >Feature sequence224 <1 673 gene locus_tag LOCUS_22040 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A331:cell division protein FtsA 762 2222 gene locus_tag LOCUS_22050 gene ftsZ 762 2222 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAU9 protein_id gnl|my_center|LOCUS_22050 2394 3317 gene locus_tag LOCUS_22060 gene lpxC 2394 3317 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F2 protein_id gnl|my_center|LOCUS_22060 3432 4271 gene locus_tag LOCUS_22070 gene bamD 3432 4271 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8V9 protein_id gnl|my_center|LOCUS_22070 >Feature sequence225 1436 2410 gene locus_tag LOCUS_22080 gene lipA 1436 2410 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7I8 protein_id gnl|my_center|LOCUS_22080 2413 2874 gene locus_tag LOCUS_22090 2413 2874 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210715.1 protein_id gnl|my_center|LOCUS_22090 3328 2867 gene locus_tag LOCUS_22100 3328 2867 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919605.1 protein_id gnl|my_center|LOCUS_22100 4563 3427 gene locus_tag LOCUS_22110 gene ispDF 4563 3427 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7I5 protein_id gnl|my_center|LOCUS_22110 >Feature sequence226 445 1047 gene locus_tag LOCUS_22120 445 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1044 1706 gene locus_tag LOCUS_22130 1044 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1756 2067 gene locus_tag LOCUS_22140 1756 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2104 2787 gene locus_tag LOCUS_22150 2104 2787 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_22150 2813 4246 gene locus_tag LOCUS_22160 2813 4246 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence227 860 288 gene locus_tag LOCUS_22170 860 288 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAX0 protein_id gnl|my_center|LOCUS_22170 1047 1592 gene locus_tag LOCUS_22180 1047 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 1589 1930 gene locus_tag LOCUS_22190 1589 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 2129 2626 gene locus_tag LOCUS_22200 2129 2626 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_22200 3818 2598 gene locus_tag LOCUS_22210 3818 2598 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918296.1 protein_id gnl|my_center|LOCUS_22210 4251 3805 gene locus_tag LOCUS_22220 4251 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence228 1753 851 gene locus_tag LOCUS_22230 1753 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309798.1 protein_id gnl|my_center|LOCUS_22230 2056 2964 gene locus_tag LOCUS_22240 2056 2964 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919944.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22240 3059 3700 gene locus_tag LOCUS_22250 gene clpP 3059 3700 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX16 protein_id gnl|my_center|LOCUS_22250 >Feature sequence229 79 573 gene locus_tag LOCUS_22260 79 573 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT56 protein_id gnl|my_center|LOCUS_22260 622 1686 gene locus_tag LOCUS_22270 622 1686 CDS product zinc metallohydrolase glyoxalase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 protein_id gnl|my_center|LOCUS_22270 1805 2659 gene locus_tag LOCUS_22280 1805 2659 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A806 protein_id gnl|my_center|LOCUS_22280 2788 3390 gene locus_tag LOCUS_22290 2788 3390 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919932.1 protein_id gnl|my_center|LOCUS_22290 3469 3714 gene locus_tag LOCUS_22300 gene xseB 3469 3714 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M3 protein_id gnl|my_center|LOCUS_22300 >Feature sequence230 3208 1697 gene locus_tag LOCUS_22310 3208 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140823.1 protein_id gnl|my_center|LOCUS_22310 3577 3305 gene locus_tag LOCUS_22320 3577 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3904 3638 gene locus_tag LOCUS_22330 3904 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence231 <1 2220 gene locus_tag LOCUS_22340 <1 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A749:ribonuclease E 2769 2305 gene locus_tag LOCUS_22350 2769 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 <4549 2929 gene locus_tag LOCUS_22360 <4549 2929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639873.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence232 1351 677 gene locus_tag LOCUS_22370 gene ate 1351 677 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K72 protein_id gnl|my_center|LOCUS_22370 3299 1455 gene locus_tag LOCUS_22380 3299 1455 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_22380 3977 3342 gene locus_tag LOCUS_22390 3977 3342 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546155.1 protein_id gnl|my_center|LOCUS_22390 3999 4130 gene locus_tag LOCUS_22400 3999 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence233 452 87 gene locus_tag LOCUS_22410 452 87 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921136.1 protein_id gnl|my_center|LOCUS_22410 1525 449 gene locus_tag LOCUS_22420 1525 449 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921137.1 protein_id gnl|my_center|LOCUS_22420 1636 2397 gene locus_tag LOCUS_22430 1636 2397 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_22430 2529 2795 gene locus_tag LOCUS_22440 2529 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2908 3780 gene locus_tag LOCUS_22450 2908 3780 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923328.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence234 152 1990 gene locus_tag LOCUS_22460 152 1990 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_22460 2786 2004 gene locus_tag LOCUS_22470 2786 2004 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708981.1 protein_id gnl|my_center|LOCUS_22470 4135 3233 gene locus_tag LOCUS_22480 4135 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence235 1230 3464 gene locus_tag LOCUS_22490 1230 3464 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 protein_id gnl|my_center|LOCUS_22490 3530 4000 gene locus_tag LOCUS_22500 3530 4000 CDS product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHM4 protein_id gnl|my_center|LOCUS_22500 >Feature sequence236 981 121 gene locus_tag LOCUS_22510 981 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 4126 992 gene locus_tag LOCUS_22520 4126 992 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Q1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence237 534 2525 gene locus_tag LOCUS_22530 534 2525 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237518.1 protein_id gnl|my_center|LOCUS_22530 3419 2562 gene locus_tag LOCUS_22540 3419 2562 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399742.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence238 2543 1644 gene locus_tag LOCUS_22550 gene pyrF 2543 1644 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4V0 protein_id gnl|my_center|LOCUS_22550 3361 2540 gene locus_tag LOCUS_22560 3361 2540 CDS product endopeptidase DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639887.1 protein_id gnl|my_center|LOCUS_22560 3808 3377 gene locus_tag LOCUS_22570 3808 3377 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918024.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence239 2703 2293 gene locus_tag LOCUS_22580 gene msrB 2703 2293 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE61 protein_id gnl|my_center|LOCUS_22580 3312 2857 gene locus_tag LOCUS_22590 3312 2857 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_22590 <4326 3415 gene locus_tag LOCUS_22600 <4326 3415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390788.1:aminotransferase >Feature sequence240 339 578 gene locus_tag LOCUS_22610 339 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 920 582 gene locus_tag LOCUS_22620 gene grlA 920 582 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CYD6 protein_id gnl|my_center|LOCUS_22620 2871 1000 gene locus_tag LOCUS_22630 2871 1000 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_22630 3178 2942 gene locus_tag LOCUS_22640 3178 2942 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640511.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence241 1538 252 gene locus_tag LOCUS_22650 gene proA 1538 252 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF85 protein_id gnl|my_center|LOCUS_22650 1753 3324 gene locus_tag LOCUS_22660 1753 3324 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_22660 3648 3379 gene locus_tag LOCUS_22670 3648 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087843.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence242 925 1707 gene locus_tag LOCUS_22680 gene ktrA 925 1707 CDS product ktr system potassium uptake protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32080 protein_id gnl|my_center|LOCUS_22680 1704 3032 gene locus_tag LOCUS_22690 gene yubG 1704 3032 CDS product Ktr system potassium transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384841.1 protein_id gnl|my_center|LOCUS_22690 3502 3029 gene locus_tag LOCUS_22700 gene ysnE 3502 3029 CDS product putative N-acetyltransferase YsnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94562 protein_id gnl|my_center|LOCUS_22700 <4246 3634 gene locus_tag LOCUS_22710 <4246 3634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y596:putative GTP-binding protein EngB >Feature sequence243 1 1857 gene locus_tag LOCUS_22720 1 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1854 3893 gene locus_tag LOCUS_22730 1854 3893 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085249.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence244 266 2500 gene locus_tag LOCUS_22740 266 2500 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_22740 2931 4037 gene locus_tag LOCUS_22750 2931 4037 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481869.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence245 261 1607 gene locus_tag LOCUS_22760 gene xylA 261 1607 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7C637 protein_id gnl|my_center|LOCUS_22760 1776 2816 gene locus_tag LOCUS_22770 1776 2816 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 protein_id gnl|my_center|LOCUS_22770 2870 3961 gene locus_tag LOCUS_22780 gene hisC 2870 3961 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9W3 protein_id gnl|my_center|LOCUS_22780 >Feature sequence246 170 382 gene locus_tag LOCUS_22790 170 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 382 1275 gene locus_tag LOCUS_22800 382 1275 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_22800 2234 1512 gene locus_tag LOCUS_22810 2234 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2327 3109 gene locus_tag LOCUS_22820 2327 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence247 231 935 gene locus_tag LOCUS_22830 231 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22830 1657 932 gene locus_tag LOCUS_22840 1657 932 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 protein_id gnl|my_center|LOCUS_22840 1808 2386 gene locus_tag LOCUS_22850 1808 2386 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 protein_id gnl|my_center|LOCUS_22850 2919 2449 gene locus_tag LOCUS_22860 2919 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265559.1 protein_id gnl|my_center|LOCUS_22860 3821 3108 gene locus_tag LOCUS_22870 3821 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence248 1420 1725 gene locus_tag LOCUS_22880 1420 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1722 2081 gene locus_tag LOCUS_22890 gene rusA 1722 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919968.1 protein_id gnl|my_center|LOCUS_22890 2614 2099 gene locus_tag LOCUS_22900 2614 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3529 2687 gene locus_tag LOCUS_22910 3529 2687 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEE2 protein_id gnl|my_center|LOCUS_22910 >Feature sequence249 468 1919 gene locus_tag LOCUS_22920 468 1919 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_22920 1963 2628 gene locus_tag LOCUS_22930 gene dsb 1963 2628 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708016.1 protein_id gnl|my_center|LOCUS_22930 3137 2706 gene locus_tag LOCUS_22940 3137 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 <4030 3221 gene locus_tag LOCUS_22950 <4030 3221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV18:ATP synthase subunit beta >Feature sequence250 <1 571 gene locus_tag LOCUS_22960 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C768:inosine-5'-monophosphate dehydrogenase 775 1221 gene locus_tag LOCUS_22970 775 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 1883 1272 gene locus_tag LOCUS_22980 1883 1272 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_22980 2053 3360 gene locus_tag LOCUS_22990 2053 3360 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919493.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence251 729 989 gene locus_tag LOCUS_23000 729 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1927 1001 gene locus_tag LOCUS_23010 1927 1001 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640183.1 protein_id gnl|my_center|LOCUS_23010 2301 2029 gene locus_tag LOCUS_23020 2301 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 protein_id gnl|my_center|LOCUS_23020 2876 2301 gene locus_tag LOCUS_23030 2876 2301 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence252 493 900 gene locus_tag LOCUS_23040 gene rbfA 493 900 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC30 protein_id gnl|my_center|LOCUS_23040 989 1663 gene locus_tag LOCUS_23050 989 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1795 2739 gene locus_tag LOCUS_23060 gene truB 1795 2739 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5T2 protein_id gnl|my_center|LOCUS_23060 >Feature sequence253 1 1119 gene locus_tag LOCUS_23070 gene anmK 1 1119 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A757 protein_id gnl|my_center|LOCUS_23070 1673 1116 gene locus_tag LOCUS_23080 1673 1116 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531477.1 protein_id gnl|my_center|LOCUS_23080 1903 3048 gene locus_tag LOCUS_23090 1903 3048 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence254 <1 1053 gene locus_tag LOCUS_23100 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CFG4:histidine--tRNA ligase 1050 2180 gene locus_tag LOCUS_23110 1050 2180 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339405.1 protein_id gnl|my_center|LOCUS_23110 2177 2887 gene locus_tag LOCUS_23120 2177 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence255 1042 140 gene locus_tag LOCUS_23130 1042 140 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_23130 1234 1875 gene locus_tag LOCUS_23140 1234 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2705 1776 gene locus_tag LOCUS_23150 gene pgk 2705 1776 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4J9 protein_id gnl|my_center|LOCUS_23150 3340 2705 gene locus_tag LOCUS_23160 3340 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence256 1112 2278 gene locus_tag LOCUS_23170 1112 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2704 2291 gene locus_tag LOCUS_23180 2704 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388644.1 protein_id gnl|my_center|LOCUS_23180 2970 3266 gene locus_tag LOCUS_23190 2970 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3721 3263 gene locus_tag LOCUS_23200 3721 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence257 <1 934 gene locus_tag LOCUS_23210 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C7U0:DNA helicase 999 1433 gene locus_tag LOCUS_23220 999 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 3708 1636 gene locus_tag LOCUS_23230 3708 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence258 110 559 gene locus_tag LOCUS_23240 110 559 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 protein_id gnl|my_center|LOCUS_23240 1645 806 gene locus_tag LOCUS_23250 1645 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1866 2465 gene locus_tag LOCUS_23260 1866 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2613 3218 gene locus_tag LOCUS_23270 2613 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence259 1491 169 gene locus_tag LOCUS_23280 1491 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1700 3385 gene locus_tag LOCUS_23290 1700 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence260 1767 1297 gene locus_tag LOCUS_23300 1767 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1840 2025 gene locus_tag LOCUS_23310 1840 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23310 2161 3081 gene locus_tag LOCUS_23320 2161 3081 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23320 3246 3620 gene locus_tag LOCUS_23330 3246 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence261 306 1646 gene locus_tag LOCUS_23340 gene mnmE 306 1646 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX2 protein_id gnl|my_center|LOCUS_23340 1718 3583 gene locus_tag LOCUS_23350 gene mnmG 1718 3583 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW33 protein_id gnl|my_center|LOCUS_23350 >Feature sequence262 972 163 gene locus_tag LOCUS_23360 972 163 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918849.1 protein_id gnl|my_center|LOCUS_23360 2909 969 gene locus_tag LOCUS_23370 gene pcoA 2909 969 CDS product copper resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 protein_id gnl|my_center|LOCUS_23370 3420 3022 gene locus_tag LOCUS_23380 3420 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence263 122 571 gene locus_tag LOCUS_23390 122 571 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919971.1 protein_id gnl|my_center|LOCUS_23390 682 1419 gene locus_tag LOCUS_23400 682 1419 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_23400 1527 3164 gene locus_tag LOCUS_23410 1527 3164 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence264 1810 944 gene locus_tag LOCUS_23420 1810 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_23420 2819 1821 gene locus_tag LOCUS_23430 2819 1821 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969882.1 protein_id gnl|my_center|LOCUS_23430 2879 3481 gene locus_tag LOCUS_23440 2879 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence265 1544 429 gene locus_tag LOCUS_23450 1544 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2597 1743 gene locus_tag LOCUS_23460 2597 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 <3661 2642 gene locus_tag LOCUS_23470 <3661 2642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640581.1:host specificity protein >Feature sequence266 1 504 gene locus_tag LOCUS_23480 1 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920662.1 protein_id gnl|my_center|LOCUS_23480 1708 572 gene locus_tag LOCUS_23490 1708 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919988.1 protein_id gnl|my_center|LOCUS_23490 3360 1738 gene locus_tag LOCUS_23500 3360 1738 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence267 642 115 gene locus_tag LOCUS_23510 gene folK 642 115 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438641.1 protein_id gnl|my_center|LOCUS_23510 1000 635 gene locus_tag LOCUS_23520 gene folB 1000 635 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BX1 protein_id gnl|my_center|LOCUS_23520 1833 997 gene locus_tag LOCUS_23530 gene folP 1833 997 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BX0 protein_id gnl|my_center|LOCUS_23530 3212 2265 gene locus_tag LOCUS_23540 3212 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121324.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence268 818 498 gene locus_tag LOCUS_23550 818 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 945 1625 gene locus_tag LOCUS_23560 945 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 1640 2605 gene locus_tag LOCUS_23570 1640 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 3196 2924 gene locus_tag LOCUS_23580 3196 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 3504 3379 gene locus_tag LOCUS_23590 3504 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence269 462 277 gene locus_tag LOCUS_23600 462 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 554 1531 gene locus_tag LOCUS_23610 554 1531 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_23610 1668 2339 gene locus_tag LOCUS_23620 1668 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923245.1 protein_id gnl|my_center|LOCUS_23620 2433 3026 gene locus_tag LOCUS_23630 gene ylfA 2433 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence270 1862 2593 gene locus_tag LOCUS_23640 1862 2593 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 protein_id gnl|my_center|LOCUS_23640 2976 2623 gene locus_tag LOCUS_23650 2976 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727669.1 protein_id gnl|my_center|LOCUS_23650 <3519 2990 gene locus_tag LOCUS_23660 <3519 2990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920921.1:alcohol dehydrogenase >Feature sequence271 629 102 gene locus_tag LOCUS_23670 gene lspA 629 102 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAA6 protein_id gnl|my_center|LOCUS_23670 <3517 691 gene locus_tag LOCUS_23680 <3517 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C4H2:isoleucine--tRNA ligase >Feature sequence272 <3480 1365 gene locus_tag LOCUS_23690 <3480 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640599.1:TonB-dependent receptor >Feature sequence273 460 140 gene locus_tag LOCUS_23700 460 140 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIV8 protein_id gnl|my_center|LOCUS_23700 1131 517 gene locus_tag LOCUS_23710 1131 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1604 1176 gene locus_tag LOCUS_23720 1604 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 <3471 1728 gene locus_tag LOCUS_23730 <3471 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920232.1:methylmalonyl-CoA mutase >Feature sequence274 3345 2443 gene locus_tag LOCUS_23740 gene sucD 3345 2443 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9T8 protein_id gnl|my_center|LOCUS_23740 >Feature sequence275 1953 1507 gene locus_tag LOCUS_23750 1953 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 <3421 1950 gene locus_tag LOCUS_23760 <3421 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118365.1:cation:proton antiporter >Feature sequence276 153 554 gene locus_tag LOCUS_23770 153 554 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP9 protein_id gnl|my_center|LOCUS_23770 1780 551 gene locus_tag LOCUS_23780 1780 551 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969101.1 protein_id gnl|my_center|LOCUS_23780 2638 1964 gene locus_tag LOCUS_23790 2638 1964 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 protein_id gnl|my_center|LOCUS_23790 3163 2645 gene locus_tag LOCUS_23800 3163 2645 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688008.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence277 370 786 gene locus_tag LOCUS_23810 370 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 929 1417 gene locus_tag LOCUS_23820 gene mopJ 929 1417 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265646.1 protein_id gnl|my_center|LOCUS_23820 1652 1996 gene locus_tag LOCUS_23830 1652 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1997 2641 gene locus_tag LOCUS_23840 1997 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3054 2638 gene locus_tag LOCUS_23850 gene sufE 3054 2638 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence278 553 2646 gene locus_tag LOCUS_23860 553 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 <3383 2825 gene locus_tag LOCUS_23870 <3383 2825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8H0P3:50S ribosomal protein L1 >Feature sequence279 509 183 gene locus_tag LOCUS_23880 509 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2237 645 gene locus_tag LOCUS_23890 gene lysS 2237 645 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C6 protein_id gnl|my_center|LOCUS_23890 2405 2827 gene locus_tag LOCUS_23900 2405 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2831 3058 gene locus_tag LOCUS_23910 2831 3058 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence280 <1 580 gene locus_tag LOCUS_23920 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808209.1:enoyl CoA dehydratase/isomerase 1812 577 gene locus_tag LOCUS_23930 1812 577 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268944.1 protein_id gnl|my_center|LOCUS_23930 2566 1805 gene locus_tag LOCUS_23940 2566 1805 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640515.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence281 <1 1565 gene locus_tag LOCUS_23950 <1 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082991.1:helicase 1562 1849 gene locus_tag LOCUS_23960 1562 1849 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918542.1 protein_id gnl|my_center|LOCUS_23960 1846 2292 gene locus_tag LOCUS_23970 1846 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720534.1 protein_id gnl|my_center|LOCUS_23970 2377 2718 gene locus_tag LOCUS_23980 2377 2718 CDS product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918540.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence282 589 1944 gene locus_tag LOCUS_23990 589 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_23990 1989 2519 gene locus_tag LOCUS_24000 gene def 1989 2519 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF5 protein_id gnl|my_center|LOCUS_24000 2525 2686 gene locus_tag LOCUS_24010 2525 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence283 <1 1178 gene locus_tag LOCUS_24020 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084264.1:RNA helicase 1254 2243 gene locus_tag LOCUS_24030 gene ncd-2 1254 2243 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 protein_id gnl|my_center|LOCUS_24030 2276 2704 gene locus_tag LOCUS_24040 2276 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 <3303 2706 gene locus_tag LOCUS_24050 <3303 2706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IVV9:selenide, water dikinase >Feature sequence284 1652 573 gene locus_tag LOCUS_24060 1652 573 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267457.1 protein_id gnl|my_center|LOCUS_24060 2270 1695 gene locus_tag LOCUS_24070 2270 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence285 <1 1298 gene locus_tag LOCUS_24080 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919880.1:Tat pathway signal protein 1397 3094 gene locus_tag LOCUS_24090 1397 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708361.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence286 401 1234 gene locus_tag LOCUS_24100 401 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1260 1628 gene locus_tag LOCUS_24110 1260 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919329.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence287 127 1146 gene locus_tag LOCUS_24120 gene ilvC 127 1146 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXW2 protein_id gnl|my_center|LOCUS_24120 1870 1220 gene locus_tag LOCUS_24130 gene acm 1870 1220 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823111.1 protein_id gnl|my_center|LOCUS_24130 2068 2622 gene locus_tag LOCUS_24140 2068 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 <3220 2616 gene locus_tag LOCUS_24150 <3220 2616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25001:beta-lactamase HcpA >Feature sequence288 401 66 gene locus_tag LOCUS_24160 401 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383289.1 protein_id gnl|my_center|LOCUS_24160 1287 652 gene locus_tag LOCUS_24170 1287 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_24170 1478 1624 gene locus_tag LOCUS_24180 1478 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24180 1776 2651 gene locus_tag LOCUS_24190 gene htdY 1776 2651 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence289 1277 537 gene locus_tag LOCUS_24200 1277 537 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_24200 2182 1373 gene locus_tag LOCUS_24210 2182 1373 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence290 2396 1380 gene locus_tag LOCUS_24220 2396 1380 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087553.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence291 428 1570 gene locus_tag LOCUS_24230 428 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1600 2436 gene locus_tag LOCUS_24240 1600 2436 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_24240 2455 2835 gene locus_tag LOCUS_24250 2455 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence292 2085 715 gene locus_tag LOCUS_24260 2085 715 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 protein_id gnl|my_center|LOCUS_24260 2566 2087 gene locus_tag LOCUS_24270 2566 2087 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919749.1 protein_id gnl|my_center|LOCUS_24270 3016 2573 gene locus_tag LOCUS_24280 gene aroQ 3016 2573 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A744 protein_id gnl|my_center|LOCUS_24280 >Feature sequence293 218 1342 gene locus_tag LOCUS_24290 218 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1410 2123 gene locus_tag LOCUS_24300 gene gpmA 1410 2123 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A634 protein_id gnl|my_center|LOCUS_24300 2120 2575 gene locus_tag LOCUS_24310 2120 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 <3178 2572 gene locus_tag LOCUS_24320 <3178 2572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390688.1:glycosyl transferase >Feature sequence294 1538 381 gene locus_tag LOCUS_24330 1538 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2321 1566 gene locus_tag LOCUS_24340 2321 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2738 3028 gene locus_tag LOCUS_24350 gene groS5 2738 3028 CDS product 10 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35474 protein_id gnl|my_center|LOCUS_24350 >Feature sequence295 289 1149 gene locus_tag LOCUS_24360 289 1149 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_24360 1155 2156 gene locus_tag LOCUS_24370 1155 2156 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence296 740 1024 gene locus_tag LOCUS_24380 gene rpmB 740 1024 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAE1 protein_id gnl|my_center|LOCUS_24380 1151 2818 gene locus_tag LOCUS_24390 1151 2818 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918544.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence297 305 931 gene locus_tag LOCUS_24400 305 931 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142599.1 protein_id gnl|my_center|LOCUS_24400 2144 972 gene locus_tag LOCUS_24410 2144 972 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920187.1 protein_id gnl|my_center|LOCUS_24410 <3138 2213 gene locus_tag LOCUS_24420 <3138 2213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920443.1:ABC transporter ATP-binding protein >Feature sequence298 373 53 gene locus_tag LOCUS_24430 373 53 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_24430 3078 433 gene locus_tag LOCUS_24440 3078 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence299 905 354 gene locus_tag LOCUS_24450 gene pal 905 354 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921062.1 protein_id gnl|my_center|LOCUS_24450 1075 950 gene locus_tag LOCUS_24460 1075 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2497 1142 gene locus_tag LOCUS_24470 gene tolB 2497 1142 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_24470 >Feature sequence300 <1 601 gene locus_tag LOCUS_24480 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919348.1:pirin-like protein 677 1165 gene locus_tag LOCUS_24490 677 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1649 1230 gene locus_tag LOCUS_24500 1649 1230 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P4 protein_id gnl|my_center|LOCUS_24500 2492 1785 gene locus_tag LOCUS_24510 gene queC 2492 1785 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P2 protein_id gnl|my_center|LOCUS_24510 >Feature sequence301 <3055 787 gene locus_tag LOCUS_24520 <3055 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921366.1:double-strand break repair protein AddB >Feature sequence302 <1 1475 gene locus_tag LOCUS_24530 <1 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975275.1:sulfite reductase 1462 1950 gene locus_tag LOCUS_24540 1462 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_24540 1956 2699 gene locus_tag LOCUS_24550 1956 2699 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 protein_id gnl|my_center|LOCUS_24550 >Feature sequence303 2860 677 gene locus_tag LOCUS_24560 2860 677 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence304 818 1234 gene locus_tag LOCUS_24570 818 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2218 1307 gene locus_tag LOCUS_24580 2218 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 <2965 2322 gene locus_tag LOCUS_24590 <2965 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T764:dihydroxy-acid dehydratase >Feature sequence305 324 725 gene locus_tag LOCUS_24600 324 725 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_24600 1233 742 gene locus_tag LOCUS_24610 1233 742 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085246.1 protein_id gnl|my_center|LOCUS_24610 1946 1299 gene locus_tag LOCUS_24620 1946 1299 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_24620 <2948 1995 gene locus_tag LOCUS_24630 <2948 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918106.1:thio:disulfide interchange protein >Feature sequence306 873 445 gene locus_tag LOCUS_24640 873 445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_24640 1955 873 gene locus_tag LOCUS_24650 gene hemH 1955 873 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW40 protein_id gnl|my_center|LOCUS_24650 <2905 1961 gene locus_tag LOCUS_24660 <2905 1961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RN85:uroporphyrinogen decarboxylase >Feature sequence307 868 119 gene locus_tag LOCUS_24670 gene cobB1 868 119 CDS product NAD-dependent protein deacetylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LY4 protein_id gnl|my_center|LOCUS_24670 1673 972 gene locus_tag LOCUS_24680 1673 972 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_24680 1824 2387 gene locus_tag LOCUS_24690 1824 2387 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_24690 2424 2747 gene locus_tag LOCUS_24700 2424 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence308 123 551 gene locus_tag LOCUS_24710 123 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 <2836 728 gene locus_tag LOCUS_24720 <2836 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071943.1:TonB-dependent receptor >Feature sequence309 3 1571 gene locus_tag LOCUS_24730 3 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1585 2343 gene locus_tag LOCUS_24740 1585 2343 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083968.1 protein_id gnl|my_center|LOCUS_24740 >Feature sequence310 <1 643 gene locus_tag LOCUS_24750 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705412.1:alpha-L-glutamate ligase-like protein 1382 651 gene locus_tag LOCUS_24760 1382 651 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_24760 2216 1416 gene locus_tag LOCUS_24770 2216 1416 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976011.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence311 443 865 gene locus_tag LOCUS_24780 gene hipB 443 865 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639864.1 protein_id gnl|my_center|LOCUS_24780 899 1597 gene locus_tag LOCUS_24790 gene trmB 899 1597 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX04 protein_id gnl|my_center|LOCUS_24790 1784 1993 gene locus_tag LOCUS_24800 gene cspA2 1784 1993 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533862.1 protein_id gnl|my_center|LOCUS_24800 2182 2781 gene locus_tag LOCUS_24810 gene rimP 2182 2781 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y659 protein_id gnl|my_center|LOCUS_24810 >Feature sequence312 59 241 gene locus_tag LOCUS_24820 59 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 274 1104 gene locus_tag LOCUS_24830 274 1104 CDS product insertion element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_24830 2636 1659 gene locus_tag LOCUS_24840 2636 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2794 2672 gene locus_tag LOCUS_24850 2794 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence313 668 1474 gene locus_tag LOCUS_24860 668 1474 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence314 1802 834 gene locus_tag LOCUS_24870 1802 834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_24870 2496 2194 gene locus_tag LOCUS_24880 2496 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence315 1 1005 gene locus_tag LOCUS_24890 1 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 1145 2311 gene locus_tag LOCUS_24900 1145 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920182.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence316 19 1212 gene locus_tag LOCUS_24910 19 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1272 1742 gene locus_tag LOCUS_24920 1272 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2194 1763 gene locus_tag LOCUS_24930 2194 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 <2755 2246 gene locus_tag LOCUS_24940 <2755 2246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KGL4:pseudouridine synthase >Feature sequence317 38 1135 gene locus_tag LOCUS_24950 gene ychF 38 1135 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C709 protein_id gnl|my_center|LOCUS_24950 2249 1185 gene locus_tag LOCUS_24960 2249 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 >Feature sequence318 756 217 gene locus_tag LOCUS_24970 756 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1063 761 gene locus_tag LOCUS_24980 1063 761 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_24980 1528 1677 gene locus_tag LOCUS_24990 1528 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 <2709 2157 gene locus_tag LOCUS_25000 <2709 2157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MAJ3:argininosuccinate synthase >Feature sequence319 457 1707 gene locus_tag LOCUS_25010 457 1707 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence320 287 823 gene locus_tag LOCUS_25020 gene gcrA 287 823 CDS product cell cycle regulatory protein GcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265783.1 protein_id gnl|my_center|LOCUS_25020 957 2300 gene locus_tag LOCUS_25030 957 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2407 2613 gene locus_tag LOCUS_25040 2407 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence321 <1 747 gene locus_tag LOCUS_25050 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921061.1:tol-pal system protein YbgF 766 1791 gene locus_tag LOCUS_25060 gene tilS 766 1791 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XBG6 protein_id gnl|my_center|LOCUS_25060 >Feature sequence322 2599 995 gene locus_tag LOCUS_25070 2599 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence323 753 70 gene locus_tag LOCUS_25080 753 70 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061344.1 protein_id gnl|my_center|LOCUS_25080 1654 872 gene locus_tag LOCUS_25090 1654 872 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N1 protein_id gnl|my_center|LOCUS_25090 <2596 1675 gene locus_tag LOCUS_25100 <2596 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CCQ9:succinate dehydrogenase flavoprotein subunit >Feature sequence324 614 366 gene locus_tag LOCUS_25110 614 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 <2587 729 gene locus_tag LOCUS_25120 <2587 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C4W8:DNA-directed RNA polymerase subunit beta' >Feature sequence325 1073 1513 gene locus_tag LOCUS_25130 1073 1513 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067130.1 protein_id gnl|my_center|LOCUS_25130 <2574 1559 gene locus_tag LOCUS_25140 <2574 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072585.1:leucine dehydrogenase >Feature sequence326 2 1519 gene locus_tag LOCUS_25150 2 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 2200 1583 gene locus_tag LOCUS_25160 2200 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence327 2412 1111 gene locus_tag LOCUS_25170 2412 1111 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence328 <1 844 gene locus_tag LOCUS_25180 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CAE1:methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO 847 1602 gene locus_tag LOCUS_25190 847 1602 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_25190 <2521 1646 gene locus_tag LOCUS_25200 <2521 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815626.1:exogenous ferric siderophore receptor >Feature sequence329 <1 2380 gene locus_tag LOCUS_25210 <1 2380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZN8:carbamoyl-phosphate synthase large chain >Feature sequence330 1408 497 gene locus_tag LOCUS_25220 1408 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085509.1 protein_id gnl|my_center|LOCUS_25220 <2515 1464 gene locus_tag LOCUS_25230 <2515 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228033.1:MFS transporter >Feature sequence331 337 47 gene locus_tag LOCUS_25240 337 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 891 535 gene locus_tag LOCUS_25250 gene panD 891 535 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYS2 protein_id gnl|my_center|LOCUS_25250 1170 1835 gene locus_tag LOCUS_25260 1170 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 2260 1841 gene locus_tag LOCUS_25270 2260 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976348.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence332 764 192 gene locus_tag LOCUS_25280 gene aroK 764 192 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H331 protein_id gnl|my_center|LOCUS_25280 >Feature sequence333 442 1329 gene locus_tag LOCUS_25290 442 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence334 420 1448 gene locus_tag LOCUS_25300 420 1448 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 protein_id gnl|my_center|LOCUS_25300 1420 1812 gene locus_tag LOCUS_25310 1420 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708831.1 protein_id gnl|my_center|LOCUS_25310 <2452 1809 gene locus_tag LOCUS_25320 <2452 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971096.1:radical SAM protein >Feature sequence335 1744 1145 gene locus_tag LOCUS_25330 1744 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 <2429 1792 gene locus_tag LOCUS_25340 <2429 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920865.1:alcohol dehydrogenase >Feature sequence336 302 991 gene locus_tag LOCUS_25350 302 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 <2427 1077 gene locus_tag LOCUS_25360 <2427 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UEY5:CTP synthase >Feature sequence337 <1 1392 gene locus_tag LOCUS_25370 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337993.1:C4-dicarboxylate ABC transporter >Feature sequence338 1583 990 gene locus_tag LOCUS_25380 1583 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2138 1587 gene locus_tag LOCUS_25390 2138 1587 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence339 530 1513 gene locus_tag LOCUS_25400 530 1513 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970033.1 protein_id gnl|my_center|LOCUS_25400 1510 1854 gene locus_tag LOCUS_25410 1510 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2335 1859 gene locus_tag LOCUS_25420 2335 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence340 709 215 gene locus_tag LOCUS_25430 709 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence341 1217 348 gene locus_tag LOCUS_25440 1217 348 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186174.1 protein_id gnl|my_center|LOCUS_25440 1750 1214 gene locus_tag LOCUS_25450 1750 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence342 1527 142 gene locus_tag LOCUS_25460 1527 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919744.1 protein_id gnl|my_center|LOCUS_25460 <2319 1620 gene locus_tag LOCUS_25470 <2319 1620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020477356.1:spermidine/putrescine ABC transporter ATPase >Feature sequence343 2135 2211 gene locus_tag LOCUS_t00320 2135 2211 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence344 1043 528 gene locus_tag LOCUS_25480 1043 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1736 1050 gene locus_tag LOCUS_25490 gene flgH 1736 1050 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4G3 protein_id gnl|my_center|LOCUS_25490 2158 1751 gene locus_tag LOCUS_25500 2158 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence345 2007 811 gene locus_tag LOCUS_25510 2007 811 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence346 <1 1013 gene locus_tag LOCUS_25520 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640051.1:(2Fe-2S) ferredoxin 1354 1073 gene locus_tag LOCUS_25530 1354 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence347 1081 794 gene locus_tag LOCUS_25540 1081 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1417 1097 gene locus_tag LOCUS_25550 1417 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence348 >Feature sequence349 860 183 gene locus_tag LOCUS_25560 860 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721612.1 protein_id gnl|my_center|LOCUS_25560 2229 835 gene locus_tag LOCUS_25570 2229 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence350 <1 522 gene locus_tag LOCUS_25580 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336857.1:glutathione-dependent reductase 613 1761 gene locus_tag LOCUS_25590 613 1761 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728213.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence351 1307 243 gene locus_tag LOCUS_25600 1307 243 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919488.1 protein_id gnl|my_center|LOCUS_25600 1440 1892 gene locus_tag LOCUS_25610 1440 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence352 <1 684 gene locus_tag LOCUS_25620 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971996.1:endonuclease 722 1246 gene locus_tag LOCUS_25630 722 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence353 <2200 1251 gene locus_tag LOCUS_25640 <2200 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P33156:protein RecA >Feature sequence354 >Feature sequence355 1215 220 gene locus_tag LOCUS_25650 1215 220 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068690.1 protein_id gnl|my_center|LOCUS_25650 <2196 1453 gene locus_tag LOCUS_25660 <2196 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918612.1:electron transfer flavoprotein subunit alpha >Feature sequence356 1432 413 gene locus_tag LOCUS_25670 1432 413 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY9 protein_id gnl|my_center|LOCUS_25670 >Feature sequence357 174 665 gene locus_tag LOCUS_25680 gene bfr 174 665 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPS5 protein_id gnl|my_center|LOCUS_25680 1496 672 gene locus_tag LOCUS_25690 gene kcnb2 1496 672 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_25690 <2190 1528 gene locus_tag LOCUS_25700 <2190 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A9E5:phenylalanine--tRNA ligase beta subunit >Feature sequence358 1048 1251 gene locus_tag LOCUS_25710 1048 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence359 <1 1024 gene locus_tag LOCUS_25720 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090824.1:membrane protein 1021 1767 gene locus_tag LOCUS_25730 1021 1767 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence360 218 1183 gene locus_tag LOCUS_25740 gene exoM 218 1183 CDS product succinoglycan biosynthesis protein ExoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887909.1 protein_id gnl|my_center|LOCUS_25740 1520 1194 gene locus_tag LOCUS_25750 1520 1194 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS7 protein_id gnl|my_center|LOCUS_25750 <2161 1537 gene locus_tag LOCUS_25760 <2161 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067630.1:DNA polymerase III subunit gamma/tau >Feature sequence361 2128 1079 gene locus_tag LOCUS_25770 2128 1079 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734851.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence362 <1 919 gene locus_tag LOCUS_25780 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RMW0:3-dehydroquinate synthase >Feature sequence363 >Feature sequence364 69 953 gene locus_tag LOCUS_25790 69 953 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920426.1 protein_id gnl|my_center|LOCUS_25790 1933 1100 gene locus_tag LOCUS_25800 1933 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence365 373 1401 gene locus_tag LOCUS_25810 373 1401 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_25810 <2094 1409 gene locus_tag LOCUS_25820 <2094 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921174.1:GDP-mannose-dependent alpha-mannosyltransferase >Feature sequence366 411 142 gene locus_tag LOCUS_25830 gene rpsO 411 142 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF33 protein_id gnl|my_center|LOCUS_25830 1613 1161 gene locus_tag LOCUS_25840 1613 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1911 1645 gene locus_tag LOCUS_25850 1911 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence367 366 848 gene locus_tag LOCUS_25860 366 848 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_25860 859 1605 gene locus_tag LOCUS_25870 gene truA 859 1605 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence368 40 798 gene locus_tag LOCUS_25880 40 798 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_25880 1712 765 gene locus_tag LOCUS_25890 1712 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence369 1650 952 gene locus_tag LOCUS_25900 1650 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence370 500 1042 gene locus_tag LOCUS_25910 500 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1063 1848 gene locus_tag LOCUS_25920 1063 1848 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence371 <1913 1134 gene locus_tag LOCUS_25930 <1913 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338631.1:2-oxoglutarate dehydrogenase subunit E1 >Feature sequence372 318 566 gene locus_tag LOCUS_25940 318 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25940 542 1219 gene locus_tag LOCUS_25950 542 1219 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25950 >Feature sequence373 843 1790 gene locus_tag LOCUS_25960 gene oxyR 843 1790 CDS product hyaluronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036667.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence374 59 1114 gene locus_tag LOCUS_25970 gene alr 59 1114 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD1 protein_id gnl|my_center|LOCUS_25970 1047 1904 gene locus_tag LOCUS_25980 1047 1904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921522.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence375 >Feature sequence376 373 1002 gene locus_tag LOCUS_25990 373 1002 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722856.1 protein_id gnl|my_center|LOCUS_25990 1839 1006 gene locus_tag LOCUS_26000 1839 1006 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771267.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence377 1382 339 gene locus_tag LOCUS_26010 1382 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence378 <1 596 gene locus_tag LOCUS_26020 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8H5U4:methionine--tRNA ligase 1279 587 gene locus_tag LOCUS_26030 1279 587 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 protein_id gnl|my_center|LOCUS_26030 <1851 1276 gene locus_tag LOCUS_26040 <1851 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113326.1:oxidoreductase >Feature sequence379 714 367 gene locus_tag LOCUS_26050 714 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 1112 735 gene locus_tag LOCUS_26060 1112 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1618 1142 gene locus_tag LOCUS_26070 1618 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence380 371 27 gene locus_tag LOCUS_26080 371 27 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265672.1 protein_id gnl|my_center|LOCUS_26080 540 1244 gene locus_tag LOCUS_26090 540 1244 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140539.1 protein_id gnl|my_center|LOCUS_26090 <1815 1241 gene locus_tag LOCUS_26100 <1815 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9AB91:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex >Feature sequence381 1776 298 gene locus_tag LOCUS_26110 gene tacA 1776 298 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence382 625 164 gene locus_tag LOCUS_26120 625 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence383 870 538 gene locus_tag LOCUS_26130 870 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 <1773 1238 gene locus_tag LOCUS_26140 <1773 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958140.1:phosphohydrolase >Feature sequence384 1492 761 gene locus_tag LOCUS_26150 1492 761 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061494.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence385 >Feature sequence386 624 415 gene locus_tag LOCUS_26160 624 415 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886880.1 protein_id gnl|my_center|LOCUS_26160 <1749 893 gene locus_tag LOCUS_26170 <1749 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455384.1:Zn-dependent protease >Feature sequence387 284 1405 gene locus_tag LOCUS_26180 gene queG 284 1405 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 protein_id gnl|my_center|LOCUS_26180 >Feature sequence388 1664 1092 gene locus_tag LOCUS_26190 1664 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence389 1268 393 gene locus_tag LOCUS_26200 gene motA 1268 393 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence390 617 808 gene locus_tag LOCUS_26210 617 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence391 314 796 gene locus_tag LOCUS_26220 314 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 885 1574 gene locus_tag LOCUS_26230 gene udk 885 1574 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WTY6 protein_id gnl|my_center|LOCUS_26230 >Feature sequence392 246 491 gene locus_tag LOCUS_26240 gene rpsQ 246 491 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U4 protein_id gnl|my_center|LOCUS_26240 488 856 gene locus_tag LOCUS_26250 gene rplN 488 856 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ0 protein_id gnl|my_center|LOCUS_26250 858 1175 gene locus_tag LOCUS_26260 gene rplX 858 1175 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence393 >Feature sequence394 >Feature sequence395 >Feature sequence396 365 760 gene locus_tag LOCUS_26270 365 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 822 1604 gene locus_tag LOCUS_26280 gene sufC 822 1604 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence397 <1 948 gene locus_tag LOCUS_26290 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919742.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence398 <1 883 gene locus_tag LOCUS_26300 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089998.1:acyl-CoA dehydrogenase 880 1254 gene locus_tag LOCUS_26310 880 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence399 >Feature sequence400 <1556 135 gene locus_tag LOCUS_26320 <1556 135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y5E0:elongation factor G >Feature sequence401 81 1073 gene locus_tag LOCUS_26330 81 1073 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence402 <1 567 gene locus_tag LOCUS_26340 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262294.1:cell envelope biogenesis protein AsmA 1515 637 gene locus_tag LOCUS_26350 1515 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence403 816 100 gene locus_tag LOCUS_26360 816 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence404 >Feature sequence405 1045 221 gene locus_tag LOCUS_26370 1045 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence406 1124 387 gene locus_tag LOCUS_26380 gene ucpA1 1124 387 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338043.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence407 1464 991 gene locus_tag LOCUS_26390 1464 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence408 >Feature sequence409 <1452 584 gene locus_tag LOCUS_26400 <1452 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918455.1:membrane protein >Feature sequence410 >Feature sequence411 233 658 gene locus_tag LOCUS_26410 233 658 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919964.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence412 820 83 gene locus_tag LOCUS_26420 820 83 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_26420 <1420 826 gene locus_tag LOCUS_26430 <1420 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89MW0:malonyl CoA-acyl carrier protein transacylase >Feature sequence413 <1 902 gene locus_tag LOCUS_26440 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A2H4:30S ribosomal protein S1 1002 1301 gene locus_tag LOCUS_26450 gene ihfB 1002 1301 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP8 protein_id gnl|my_center|LOCUS_26450 >Feature sequence414 63 542 gene locus_tag LOCUS_26460 63 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 <1414 601 gene locus_tag LOCUS_26470 <1414 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527948.1:ATP-dependent DNA ligase >Feature sequence415 >Feature sequence416 880 209 gene locus_tag LOCUS_26480 880 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 <1394 892 gene locus_tag LOCUS_26490 <1394 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389599.1:C4-dicarboxylate ABC transporter >Feature sequence417 859 1170 gene locus_tag LOCUS_26500 859 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26500 >Feature sequence418 >Feature sequence419 852 349 gene locus_tag LOCUS_26510 852 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921548.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence420 <1362 472 gene locus_tag LOCUS_26520 <1362 472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479099.1:hemolysin D >Feature sequence421 725 330 gene locus_tag LOCUS_26530 725 330 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313469.1 protein_id gnl|my_center|LOCUS_26530 <1355 796 gene locus_tag LOCUS_26540 <1355 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852026.1:saccharopine dehydrogenase >Feature sequence422 547 110 gene locus_tag LOCUS_26550 547 110 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 protein_id gnl|my_center|LOCUS_26550 1328 747 gene locus_tag LOCUS_26560 1328 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence423 436 594 gene locus_tag LOCUS_26570 436 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 <1327 678 gene locus_tag LOCUS_26580 <1327 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O33915:citrate synthase >Feature sequence424 248 799 gene locus_tag LOCUS_26590 248 799 CDS product smr protein/Muts2-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 protein_id gnl|my_center|LOCUS_26590 1039 746 gene locus_tag LOCUS_26600 1039 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence425 >Feature sequence426 <1 954 gene locus_tag LOCUS_26610 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222825.1:methylmalonyl-CoA mutase >Feature sequence427 <1 1084 gene locus_tag LOCUS_26620 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533272.1:conjugal transfer protein TraG >Feature sequence428 >Feature sequence429 <1276 452 gene locus_tag LOCUS_26630 <1276 452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337924.1:multidrug transporter >Feature sequence430 <1 954 gene locus_tag LOCUS_26640 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257832.1:alcohol dehydrogenase >Feature sequence431 395 1093 gene locus_tag LOCUS_26650 395 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140332.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence432 497 267 gene locus_tag LOCUS_26660 497 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1057 494 gene locus_tag LOCUS_26670 1057 494 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence433 <1 933 gene locus_tag LOCUS_26680 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085596.1:alcohol dehydrogenase >Feature sequence434 364 765 gene locus_tag LOCUS_26690 364 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 837 1220 gene locus_tag LOCUS_26700 gene clpS 837 1220 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I0 protein_id gnl|my_center|LOCUS_26700 >Feature sequence435 <1 1086 gene locus_tag LOCUS_26710 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918249.1:ornithine decarboxylase >Feature sequence436 >Feature sequence437 <1 666 gene locus_tag LOCUS_26720 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937588.1:sodium-independent anion transporter 1203 688 gene locus_tag LOCUS_26730 1203 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence438 100 432 gene locus_tag LOCUS_26740 100 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence439 954 760 gene locus_tag LOCUS_26750 954 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence440 >Feature sequence441 >Feature sequence442 440 829 gene locus_tag LOCUS_26760 gene gcvH 440 829 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY55 protein_id gnl|my_center|LOCUS_26760 >Feature sequence443 >Feature sequence444 >Feature sequence445 >Feature sequence446 >Feature sequence447 >Feature sequence448 72 737 gene locus_tag LOCUS_26770 72 737 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257948.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence449 377 18 gene locus_tag LOCUS_26780 377 18 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708282.1 protein_id gnl|my_center|LOCUS_26780 <1084 483 gene locus_tag LOCUS_26790 <1084 483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388166.1:ABC transporter ATP-binding protein >Feature sequence450 <1 800 gene locus_tag LOCUS_26800 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CCA9:UvrABC system protein B >Feature sequence451 675 274 gene locus_tag LOCUS_26810 675 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence452 2 715 gene locus_tag LOCUS_26820 gene com1 2 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947567.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence453 519 181 gene locus_tag LOCUS_26830 519 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 868 632 gene locus_tag LOCUS_26840 868 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence454 100 846 gene locus_tag LOCUS_26850 gene etfB 100 846 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53575 protein_id gnl|my_center|LOCUS_26850 >Feature sequence455 >Feature sequence456 32 940 gene locus_tag LOCUS_26860 32 940 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377838.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence457