COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..617412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..939 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ5 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene rplF CDS 942..1304 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T7 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene rplR CDS 1314..1922 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene rpsE CDS 1934..2125 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F2 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rpmD CDS 2166..2645 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q3 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene rplO CDS 2761..4104 product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA4 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene prlA CDS 4101..4718 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F5 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene adk CDS 4883..5251 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE39 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene rpsM CDS 5270..5659 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rpsK CDS 5691..6728 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F8 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene rpoA CDS 6758..7180 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB04 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene rplQ CDS 7258..8712 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 8715..10037 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 10039..10752 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 10749..11459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 11511..11900 product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX35 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene crcB CDS 11897..12895 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9P6 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 12892..13572 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 13620..14354 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919843.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 14438..15715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(15768..16151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(16236..16712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(16766..18724) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 18701..18904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(18926..20131) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(20364..21899) product (6-4) photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH39 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene phrB CDS complement(21896..22603) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene csgA CDS complement(22670..24400) product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEV3 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene kefC CDS complement(24516..25175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(25593..26408) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 26335..26508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 26525..27481 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 27481..27948 product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD54 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene queF CDS complement(27955..28593) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 28665..29378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 29472..30632 product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 30637..33777 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 33906..34733 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 34866..35072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 35098..35841 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974448.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(35838..36587) product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C588 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene fliP CDS complement(36589..36879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 37031..37444 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6X7 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene flgB CDS 37473..37892 product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG22 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene flgC CDS 37913..38227 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH4 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene fliE CDS complement(38264..39145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 39363..39578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(39606..40313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(40481..40972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 41364..42584 product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6H4 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 42591..42821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(42837..43808) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 43957..44277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(44361..45146) product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(45200..45658) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 45756..46142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(46157..46813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(46957..48243) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918576.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 48424..49194 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(49198..49869) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3S5 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene purQ CDS complement(50166..51122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(51219..51467) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCH0 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene purS CDS complement(51475..52254) product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L2 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene purC CDS 52445..52765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 52923..53243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(53244..53654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(53722..54201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 54420..54791 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene csaA CDS complement(54795..56531) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(56691..57392) product extensin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 57545..58468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 58511..59251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 59304..59732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 59762..60478 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142599.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 60494..61990 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene glsF CDS complement(61987..62829) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBK7 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene panC CDS 62943..63467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 63464..64360 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(64387..65508) product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene ansA CDS complement(65629..68991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 69292..71085 product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 71085..75230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640286.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(75280..75987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(76218..76955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(77045..77995) product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 78319..78591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(78682..79365) product polysaccharide secretin protein HfsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene hfsD CDS 79502..81004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 81018..81722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene hfsB CDS 81741..83015 product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene hfsI CDS complement(83012..83938) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(83935..84711) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920286.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene hfsH CDS complement(84698..85708) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene hfsG CDS complement(85698..87221) product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920283.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene hfsE CDS complement(87321..88532) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 88588..89223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 89426..92278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 92380..95037 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene fecA CDS 95145..96035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 96047..97996 product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene pulD CDS 98023..99534 product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene xcsE CDS 99521..100735 product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene pulF CDS 100749..101225 product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene xcsG CDS 101226..101735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 101719..102102 product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 102099..102719 product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 102719..103720 product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5C4 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 103717..104892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 104889..105371 product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC0 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene gspM CDS 105371..106111 product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene xcsN CDS 106120..106617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 106599..107588 product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(107580..109592) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 109689..110564 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZG9 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene dapA CDS 110566..111024 product ssrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z9 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene smpB CDS complement(111021..111698) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(111673..112251) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919424.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 112448..112798 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H618 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene rpoZ CDS 112839..115079 product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919427.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene spoT CDS 115083..115667 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A810 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene pyrE CDS 115667..116410 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene pdxJ CDS 116407..116820 product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A807 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene acpS CDS 116817..117593 product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A805 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene rnc CDS 117583..118536 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H630 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene era CDS complement(118582..118800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 118690..119430 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVD0 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene recO CDS complement(119520..119762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(119960..120727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 121226..123169 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 123398..125635 product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8F5 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene parC CDS complement(125649..126458) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 126557..126823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 126962..127525 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(127709..129088) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(129230..129781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 129865..130944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(130954..132534) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(132524..133189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(133204..134328) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(134383..135138) product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J340 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene ate CDS complement(135157..137010) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(137057..137974) product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 138036..138548 product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972905.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 138561..139445 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 139426..139863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 139872..141866 product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 141963..142946 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(142969..143763) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene hfsH CDS 143798..144877 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(144874..145545) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(145549..146565) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8K6 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(146562..147176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 147526..148038 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene mucS CDS 148213..148380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 148414..148884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 148871..150049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 150054..150641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(150661..153039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(153187..154146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 154361..154801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 154912..155319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 155432..155767 product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8I7 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene clpS CDS 155777..158137 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene clpA CDS 158302..159558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(159808..160245) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(160242..161414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(161424..162149) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(162149..162604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(162606..163742) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAY0 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene dinB CDS 164083..164475 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 164472..165836 product response regulator PleD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZM2 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene pleD CDS complement(165919..166086) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I8 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene rpmG CDS complement(166161..166898) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(166895..169156) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAS2 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene rnr CDS complement(169153..171714) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA12 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene topA CDS complement(171780..172898) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919560.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(172901..174037) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 174145..175599 product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8R6 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene pepA CDS 175604..176059 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707479.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 176177..176599 product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MS3 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene ndk CDS 176704..177393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(177634..179241) product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5P4 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 179449..179994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 180200..180559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 180769..181350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 tRNA complement(181782..181856) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(181988..182788) product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP43 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene rlmJ CDS complement(182868..184625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(184695..185540) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHH3 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene speE CDS complement(185602..186498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 186693..187169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 187091..188152 product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 188230..189177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 189265..190308 product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 190476..190709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 190836..191300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 191476..192651 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 192796..193614 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVL8 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene panB CDS 193699..194382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 194379..195755 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQB5 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene bamB CDS 195765..197150 product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R6 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene der tRNA 197224..197300 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 197439..198044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 198116..198319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 198528..198794 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 198799..200592 product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 200713..204177 product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(204174..204815) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 204997..206304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 206330..208288 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene acsA CDS complement(208411..210438) product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(210607..211908) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(211908..212771) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 212941..213612 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(213648..215975) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(216135..216284) product cytochrome oxidase maturation protein, cbb3-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene ccoS CDS complement(216281..218488) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919283.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene fixI CDS complement(218476..218964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(218970..220403) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene fixG CDS complement(220527..221411) product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8F0 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(221404..221568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(221573..222349) product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene fixO2 CDS complement(222362..224047) product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 224184..224441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 224661..224921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(225008..225592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(225704..227236) product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919841.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(227410..227904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 tRNA 228100..228175 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 228322..229476 product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(229473..230708) product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 230839..231639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 231642..232262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 232290..233264 product KpsF/GutQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(233269..234186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 234293..235297 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 235398..236408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 236405..237061 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(237062..237784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(237833..239185) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640355.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(239303..241714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 242132..243379 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919742.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 243513..246260 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 246436..247452 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A752 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene prfB CDS complement(247520..247927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(247974..249197) product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919738.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(249356..249829) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971896.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene bcp CDS 249911..253309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(253306..254559) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A756 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene tyrS CDS 254654..255730 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9D2 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene anmK CDS complement(255731..256399) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495402.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 256542..257000 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 257009..258136 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 258136..259698 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531481.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 259698..259949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 259964..260725 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene sufC CDS 260725..261939 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene sufD CDS 261918..263159 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAQ0 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 263168..263572 product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 263607..263972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(264024..264548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(264662..265453) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(265453..266046) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919721.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(266150..267202) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(267368..268783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(268926..270899) product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54479 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene parE CDS 270959..272254 product FMN oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(272251..272961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(273074..274477) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIN7 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene glnA CDS complement(274520..274858) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 tRNA 275339..275423 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 275785..278541 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene acnB CDS complement(278594..279364) product SoxAX cytochrome complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RN1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(279364..279684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(279692..280120) product sulfur oxidation protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085519.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(280156..280611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(280608..281891) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(281896..282234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(282236..284422) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(284437..284889) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(285100..285579) product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PR8 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene moaC CDS complement(285579..286109) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3L0 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene moaB CDS complement(286110..286580) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene moaE CDS complement(286583..286831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 note possible pseudo, internal stop codon, frameshifted CDS complement(286835..287866) product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF6 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene moaA CDS complement(287859..289370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(289488..290798) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 291166..294144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 294141..295667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 295682..296221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 296288..297289 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 297286..298635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(298632..299384) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(299503..300636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 300794..302014 product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene mntH CDS 302011..302763 product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 302750..303391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(304290..304790) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C334 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene tadA CDS 304882..305451 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(305448..306464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921212.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(306528..307310) product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VK4 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(307469..308890) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(308921..309832) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A316 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 309958..311037 product zinc metallohydrolase glyoxalase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 311037..311297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 311299..311613 product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 311610..312473 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 312535..313704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 313795..314433 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919932.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 314486..314731 product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXC6 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene xseB CDS 314743..315630 product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 315664..317580 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M5 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene dxs CDS 317713..319422 product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(319448..320848) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097453.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(320848..323973) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(323970..325088) product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(325228..328560) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 328698..330107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 330114..331133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 331267..331998 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719573.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(332009..332863) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJT8 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene purU tRNA 333021..333096 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 333314..334510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(334532..335416) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 335638..337470 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59362 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene glmS CDS 337519..338868 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCS2 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene glmM CDS 338868..339884 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67175 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene rfbD CDS 340164..340538 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene nuoA CDS 340538..341110 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWV5 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene nuoB CDS 341112..341732 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7W5 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene nuoC CDS 341732..342925 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6X4 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene nuoD CDS 342925..343965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 344011..345315 product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene nuoF CDS 345321..347438 product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QP6 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene nuoG1 CDS 347448..348539 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C802 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene nuoH CDS 348554..349039 product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F0 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene nuoI1 CDS 349111..349704 product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919807.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene nuoJ CDS 349706..350014 product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KJ8 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene nuoK CDS 350022..352148 product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919805.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene nuoL CDS 352148..353704 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene nuoM CDS 353711..355129 product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZK9 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene nuoN CDS 355136..355903 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 355907..356677 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene coaX CDS 356683..358353 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 358378..358788 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 358788..359039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 359107..360429 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z5 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene proS CDS 360426..361730 product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 361735..362433 product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z7 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene lolD2 CDS 362476..363522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 note possible pseudo, internal stop codon CDS 363592..365901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 note possible pseudo, internal stop codon CDS 366039..366830 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TA05 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rpsB CDS 366873..367787 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A704 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene tsf CDS 367934..368599 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C997 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene pyrH CDS 368610..369170 product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X4 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene frr CDS 369179..369928 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL9 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene uppS CDS 369988..370758 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q50 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene cdsA CDS 370758..371930 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC86 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene dxr CDS 371951..373144 product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640363.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene mmpA CDS 373189..375732 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9L0 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene bamA CDS 375752..376342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 376357..377367 product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR3 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene lpxD CDS 377373..378161 product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED5 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene lpxA CDS 378171..379013 product UDP-2,3-diacylglucosamine pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene lpxI CDS 379010..380161 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene lpxB CDS complement(380211..381515) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBR5 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene gltA CDS complement(381530..383005) product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene gltX2 CDS 384748..384957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(385079..385762) product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFK2 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene lexA CDS complement(385820..386620) product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A727 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene trpC CDS complement(386617..387642) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene trpD CDS complement(387674..388249) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(388246..389685) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene trpE CDS complement(389699..391597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 391695..392438 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU3 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene tpiA CDS 392523..392954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 393014..394645 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU5 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene pyrG CDS 394779..394961 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW65 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene rpmF CDS 395001..396275 product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7J9 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene eno CDS 396335..396667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 396709..397707 product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBK1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene pdhA2 CDS 397707..399104 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919595.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 399114..400433 product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7J4 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 400455..401867 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y975 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(401868..403448) product acyl-ACP synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 403602..404582 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW82 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene lipA CDS 404594..405052 product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315362.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(405041..405538) product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(405580..406803) product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q90 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene ispDF CDS 406862..407857 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ7 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene nifR CDS 407854..408927 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 408934..410358 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 410420..412645 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919610.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 412645..414027 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene ntrX CDS 414037..415416 product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene trkA CDS complement(415539..415832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 415999..416841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 416992..417249 product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW92 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene hfq CDS 417246..418574 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7H6 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene hflX CDS complement(418588..419385) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(419407..420234) product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(420234..421025) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919688.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(421025..421990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(421995..422630) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7R0 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene tmk CDS complement(422638..423780) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(423862..424620) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 424599..424808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 tRNA 425234..425321 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(425335..426468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(426562..426969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(427097..428443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(428440..430134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(430155..431516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 432283..432714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(432711..433538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(433607..434233) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(434237..434941) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(435208..435933) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(435935..437026) product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 437190..438428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(438410..441847) product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F5 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene mfd CDS complement(441881..442132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 442217..444277 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9B7 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene recG CDS complement(444268..445017) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 445364..446227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(446231..447619) product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJ76 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene hldE CDS 447965..449272 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 449269..450597 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 450687..451403 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 451400..452629 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(452632..453321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 453491..454489 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene cysK CDS 454505..455356 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 455353..456525 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919300.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 tRNA complement(456533..456609) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(456621..456929) product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 tRNA complement(456948..457024) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(457065..457493) product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I644 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(457500..458006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(458061..458582) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene cspD tRNA complement(458675..458749) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(458814..460577) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene recJ CDS complement(460582..461535) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C840 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene glpX CDS complement(461555..462844) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7Y3 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(462848..464059) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H2 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(464090..464419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 464495..466411 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265707.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(466412..467464) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRM4 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene argC CDS complement(467537..468019) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H554 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene rpsI CDS complement(468023..468490) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H7 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene rplM CDS 468527..469546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(469528..470541) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KD9 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene ctaA CDS 470693..470869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(470881..471795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(471798..473525) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 473446..473661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 473736..474296 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6D2 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(474304..475662) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9Y2 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene gltX CDS complement(475674..476870) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(476911..478563) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971777.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene nadE CDS complement(478602..479513) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 479942..480208 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(480250..481617) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537616.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(481634..483022) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBY3 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(483179..484552) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(484562..485269) product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NS9 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene rpiA CDS complement(485273..486616) product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYT1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene glmU CDS 486597..487373 product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene gph CDS complement(487366..487626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 tRNA complement(487930..488005) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 488129..488809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(488806..489915) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9Y7 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene tgt CDS complement(489908..490576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(490976..491872) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640279.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(491875..492363) product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE7 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene coaD CDS complement(492382..495096) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y8 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene gyrA CDS complement(495258..495743) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A7 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 495943..498852 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A572 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene uvrA CDS complement(498871..499692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 499922..501319 product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAE1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene trmFO CDS complement(501314..501865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 502060..502662 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTI5 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(502737..503759) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33568 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene secF CDS complement(503770..505377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 note possible pseudo, internal stop codon, frameshifted CDS complement(505393..505737) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919858.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(505809..506468) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T6 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene pcm CDS complement(506477..507250) product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T5 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene surE CDS complement(507250..508569) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5J2 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene serS CDS complement(508623..509453) product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T2 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene tatC CDS complement(509437..509754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(509772..509969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(510038..510814) product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6S9 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(510807..511646) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(511646..512680) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087522.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(512684..513550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(513616..514647) product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6S5 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 514864..515196 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 515276..515944 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 515948..516727 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(516724..517104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(517212..518198) product Galanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(518241..521264) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEN6 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene valS CDS complement(521338..521898) product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene popZ CDS complement(522028..523290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(523357..524007) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene pcm tRNA 524179..524252 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 524519..524594 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 524670..525503 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(525554..527962) product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX12 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene lon CDS complement(528121..529389) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFY5 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene clpX CDS complement(529582..530211) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX16 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene clpP CDS complement(530434..531771) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX17 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene tig CDS 532009..532875 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 tRNA complement(532943..533019) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 533171..535534 product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 tRNA complement(535567..535644) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(535708..536220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(536232..536540) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene ihfA CDS complement(536594..537565) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9J6 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene fabH2 CDS complement(537562..538614) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8I5 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene plsX CDS complement(538691..539236) product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919243.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 539306..539770 product SmpA/OmlA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene bamE CDS complement(539839..541998) product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THD0 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene hppA CDS complement(542196..542645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(542669..543547) product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC5 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene thiL CDS complement(543610..544110) product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H535 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene nusB CDS complement(544107..544538) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG70 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene ribH CDS complement(544540..545892) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(545931..546533) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(546537..547187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(547193..547675) product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J5 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene nrdR CDS complement(547679..548989) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene glyA CDS 549160..549606 product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 549714..550127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(550124..551683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(551701..553587) product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 553819..554109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(554111..554890) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(554913..556250) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB46 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 556394..557209 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene gcvT CDS 557220..557810 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(557811..559355) product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(559458..560954) product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(560958..561482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(561619..562845) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(562899..563690) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A746 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene thiG CDS complement(563692..563901) product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene thiS CDS 564064..564405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 564417..564905 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009516.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene accB CDS 564915..566261 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(566291..566575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 566591..566923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(566854..567612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(567642..568106) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(568099..568491) product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 tRNA 568669..568758 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 569135..570595 product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 570684..571802 product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 571818..573548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 573560..574486 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087597.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 574497..576941 product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 576955..577287 product tRNA-(guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003519747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene nirD CDS 577324..580023 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 580028..580777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(580787..582070) product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(582067..582735) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(582719..583945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(584307..585134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(585157..585573) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525346.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(585607..589059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 note possible pseudo, internal stop codon CDS 589309..590163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 590208..591008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 591146..593053 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 593569..594624 product glycerol-3-phosphate dehydrogenase (NAD(P)(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 594639..595394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 note possible pseudo, frameshifted CDS 595387..596925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 note possible pseudo, frameshifted CDS 596947..598527 product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(598533..601808) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y786 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene dnaE2 CDS complement(601805..603292) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(603249..603875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 604175..606232 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene fadJ CDS 606385..607623 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 tRNA complement(608022..608108) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(608188..609399) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(609415..610194) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(610280..611038) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 611179..611994 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4Z4 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene map CDS 612015..612752 product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ6 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 612868..614367 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 614442..615902 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(615892..616299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(616296..617165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 sequence02 source 1..309162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(13..89) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(188..1186) product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 1252..3030 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339171.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene ggt CDS complement(3034..4482) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene cenK CDS complement(4513..5946) product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene merA1 CDS complement(5966..6712) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(6736..7551) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 7908..8255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 8301..10112 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AA40 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene yidC CDS 10109..10744 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY4 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene engB CDS 10760..11668 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYF5 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene argB CDS 11628..12680 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 12677..13381 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 13405..14235 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4Y5 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene dapD CDS 14228..15373 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF3 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene dapE CDS 15590..16054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(16048..16785) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF0 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene truA CDS complement(16884..17387) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(17387..18316) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYF1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene fmt CDS complement(18321..18509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(18514..19038) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF5 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene def CDS complement(19070..20608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 20909..21682 product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene pphA CDS complement(21661..22893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 23079..23696 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 23856..24497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 24500..25030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706608.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 25076..25873 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921427.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 25884..27383 product RNA polymerase sigma-54 factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30333 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene rpoN2 CDS 27654..28238 product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 28376..28747 product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 28875..31880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 31884..32702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 32699..33505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(33502..33879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(34001..34774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(35067..35366) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C3 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene ihfB CDS complement(35451..37142) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCW5 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(37276..38424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 38549..39217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(39214..40614) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 40809..41603 product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(41651..42886) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WF2 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene aroA CDS 43078..43581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 tRNA 43663..43738 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(44159..44767) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZU8 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene pth CDS complement(44899..45519) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV8 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene rplY CDS complement(45642..46217) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(46269..46844) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(46870..47802) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV6 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene prs CDS complement(47902..48693) product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J663 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 48852..49163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(49217..50824) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881759.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(50940..52007) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(52012..53034) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE8 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene lgt CDS 53126..53371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 53492..53995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 54076..54429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 54413..54931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 55020..55625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(55670..55975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(56063..57001) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(57109..57549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 57876..59489 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 59526..60161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 60262..60990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(61068..61688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 62087..62404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(62405..62569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(62850..63476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(63487..64758) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(64755..65459) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(65471..66121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 66229..67023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(67033..67425) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(67554..69428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 69697..70020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 70303..70920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 70917..71351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 71594..73171 product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E0 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene xseA CDS complement(73665..75014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 75495..76529 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 76484..77266 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 77278..78306 product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M44 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 78473..79087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 79219..81348 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCA9 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene uvrB CDS 81423..82166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(82229..83116) product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(83167..84555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 84951..85637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 85799..86506 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 86771..86926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(86930..87115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 87275..88213 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(88185..88955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(89025..89162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 89289..90167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(90174..90554) product cytochrome c6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 90686..91969 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABD2 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene purD CDS complement(91933..92370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(92367..92918) product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 93099..94187 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 94337..95110 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYX9 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene mtgA CDS complement(95107..95901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 96032..96976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(97038..98078) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161578.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 98202..99101 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530091.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 99172..99696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 99805..100920 product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 100958..102280 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 102304..103197 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene lipg CDS complement(103201..104301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(104413..105357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(105410..105820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 105955..106122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(106138..106617) product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004417824.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(106674..107633) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(107630..108619) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58184 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene lpxK CDS complement(108616..109893) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene kdtA CDS complement(109890..110633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 110721..111440 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene ctpA CDS 111520..111798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 111891..113231 product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918198.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 113218..114036 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 114076..114330 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918196.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 114386..116110 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(116098..116787) product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 116937..118364 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 118445..119677 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(119717..120658) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921251.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(120758..121696) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DB8 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene ubiA CDS 121781..122578 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(122625..123944) product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(124060..125256) product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4J7 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene carA CDS 125416..125901 product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(125909..126679) product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(126778..127716) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9X0 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene metA CDS 127890..128909 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3Z4 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(128912..129313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(129310..129876) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 130045..131073 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 131206..133089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 133141..135114 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAV3 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene rpoD CDS 135163..135843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 136001..136813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 136904..137686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 137782..139188 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9G0 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 139374..140537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 140582..140947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(140944..141465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 141624..142088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 142155..142631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 142687..143526 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(143585..144439) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 144634..146559 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31605 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene yjbG CDS 146601..147017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976348.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(147014..147763) product NAD-dependent protein deacetylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LY4 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene cobB1 CDS complement(147833..147985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(147996..148472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 148741..149277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 149433..150083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 150083..151312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918452.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 151299..152258 product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 152262..153569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918454.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 153572..154564 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 154564..155487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 155531..156451 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 156448..157212 product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 157302..158279 product subclass B3 metallo-beta-lactamase BJP-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(158276..158653) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(158736..159536) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(159608..160141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(160153..160797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(160879..161526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(161558..162238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(162312..163469) product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(163529..164719) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(164848..165831) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P98 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene cobT CDS 165989..166186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 166202..166726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(166734..167558) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(167635..168654) product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJ14 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene dusA CDS complement(168768..168956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(169030..169203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 169379..170215 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921384.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 170215..170973 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921385.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 171034..171183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(171274..172989) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(172986..173567) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene sigT CDS complement(173576..173782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 173956..174747 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene phyR CDS 174856..175434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 175508..175819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 175872..176222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 176377..176595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 176599..177159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921520.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(177216..179231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(179403..179738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 180011..181336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(181341..181838) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 182661..183137 product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0A3 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene mraZ CDS 183137..184126 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ6 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rsmH CDS 184123..184431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 184428..186089 product peptidoglycan synthase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 186086..187519 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N0 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene murE CDS 187516..188928 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A596 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene murF CDS 188928..190082 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene mraY CDS 190095..191516 product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A597 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene murD CDS 191513..192640 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H092 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene ftsW CDS 192677..193780 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5A1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene murG CDS complement(193777..194295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(194312..195109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(195306..195461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(195577..198057) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 198481..199890 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU8 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene murC CDS 199890..200831 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene murB CDS 200892..201689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(201692..201904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 201977..202813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(202810..203328) product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene sixA CDS complement(203473..203916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(203928..204233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(204236..205348) product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33979 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene flgI CDS 205489..205926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 206023..206439 product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9J6 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene dksA CDS 206520..207311 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(207616..208356) product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9Y8 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene flgH CDS complement(208359..209126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(209135..209920) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06172 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene flgG CDS complement(209943..210758) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF6 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 210860..211531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 211540..212718 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXB5 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene fliM CDS 212715..213002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 213005..213694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 213684..217100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 217075..217590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 217668..219752 product copper transporter porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene oprC CDS complement(219894..220700) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 220991..221518 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 221612..222511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 222638..223549 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NM4 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene ddl CDS 223537..224454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 224454..225761 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene ftsA CDS 225852..227363 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H080 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene ftsZ CDS 227667..228590 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45070 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene lpxC CDS 228781..229605 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6U9 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene bamD CDS 229650..231356 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C835 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 231372..233810 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF64 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene ligA CDS complement(233820..235637) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(235720..236703) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A838 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene prmA CDS complement(236768..237364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 237375..237584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 237648..238526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(238538..239068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 239317..240063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(240060..240545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(240774..241967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 241999..242289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 242557..243717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(243774..246101) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7U0 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene uvrD CDS 246248..247228 product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(247218..247910) product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(247907..248326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(248403..249818) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 250088..250594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 250600..251058 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919964.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 251151..252068 product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U720 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(252065..252451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene rusA CDS 252573..252908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene phnA CDS complement(252918..253130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(253210..254229) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIN3 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene hemH CDS 254357..254758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(254739..256055) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(256105..256575) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene ptpA CDS 256909..257958 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2S1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene asd CDS 258082..259215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 259215..259919 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene rluA CDS complement(259955..260137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(260222..260401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 260547..261959 product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF0 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene fumC CDS complement(262019..262486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 262848..263258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 263336..264094 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 264311..265846 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A823 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene leuA CDS 266038..267078 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene mreB CDS 267127..268008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 268005..268529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 268529..270454 product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene pbpA CDS 270454..271599 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rodA CDS 271707..273203 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4E6 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(273266..274126) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7R9 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 274346..274951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(274963..275325) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(275330..275770) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 275987..277111 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 277108..277866 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 277869..278825 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 278828..279433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(279438..281429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(281510..281722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 281869..282240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(282201..282545) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(282642..284738) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(284904..285716) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(285840..286772) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 286964..288367 product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL6 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene cysG CDS 288364..288693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 288686..289327 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 289324..289680 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene mmcA CDS 289684..291345 product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene cysI CDS 291332..291775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 291980..292654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 292745..293416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 293428..294051 product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene pmtA CDS 294051..294884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529732.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 294911..295330 product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 295327..295542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 295631..296086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 296086..296307 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(296308..296835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(296872..298236) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 298679..300151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(300167..301348) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 301482..302186 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(302200..302493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 302688..303428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(303405..303617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 303546..304385 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 304609..305730 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 305735..306127 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 306134..307567 product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU9 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 307737..308714 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 sequence03 source 1..282278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..1261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1254..1799) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 2092..2670 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 2731..3546 product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4E5 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene ubiE CDS 3548..5107 product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCL8 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene ubiB CDS 5210..6112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 6224..7414 product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 7441..7905 product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFD9 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene dut CDS 7987..8223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(8220..9386) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 9531..10172 product exopolysaccharide biosynthesis protein ExoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390541.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 10486..10785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 note possible pseudo, frameshifted CDS complement(10782..11642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 12002..14236 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(14442..15104) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(15297..16613) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 16773..17363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 17486..18439 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(18493..20433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(20536..21054) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(21116..21652) product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124170.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(21713..22522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 22843..24468 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE40 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene estA1 CDS complement(24522..26048) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(26237..26590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(26587..27573) product sal operon transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639440.2 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene salR CDS complement(27767..28087) product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(28104..29354) product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 29447..29920 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 29898..30995 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 30997..31725 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene galF CDS 31722..34820 product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 34817..38338 product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 38392..38715 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ6 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene trxA CDS complement(38721..39998) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(40035..40982) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L5 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene accD CDS complement(40994..41824) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12291 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene trpA CDS 41961..42536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(42533..42856) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7SIA8 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene cutA CDS complement(42943..43338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(43356..44567) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ6 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene trpB CDS 44697..45371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(45381..46286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(46412..47026) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS6 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene trpF CDS 47255..47677 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene arsC CDS 47670..48386 product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene arsH CDS 48504..49094 product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 49303..51846 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061923.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(51924..52283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(52283..53641) product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8E3 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(53865..54176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 54057..54815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 54884..55324 product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528883.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(55383..56450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(56605..57018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(57066..57923) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene uppP CDS 58176..59624 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene gltD CDS 59628..60062 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 60064..64584 product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene gltB CDS complement(64639..65136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088607.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 65249..65617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 66324..67091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 67181..68068 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene lpqC CDS 68129..68839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 68932..69588 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(69650..70027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(70131..71168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 71334..71909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 71947..72321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 72401..72982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 72979..73536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 73617..73988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(73985..74836) product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706582.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 74900..75478 product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(75487..75942) product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(75942..76205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(76350..77618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 77844..78539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 78539..79387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 79577..80164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 80164..82056 product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FP0 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene thiC CDS complement(82091..83449) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(84520..85311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(85408..85596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(85726..85917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 86363..86782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 86836..87048 product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDQ2 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene slyX CDS 87518..87769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 87903..88460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(88535..90775) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 90974..91441 product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 91804..92019 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene cspA CDS 92166..93458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(93489..94142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(94287..95240) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5E1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene htpX CDS complement(95336..96109) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(96231..97322) product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene yqiG CDS 97452..97961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(97962..98408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(98428..98979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 99062..99553 product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Y2 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(99550..100764) product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 101061..102584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 102698..103123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(103158..103841) product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 103999..104601 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(104665..105570) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6U1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene fljL CDS complement(105651..106325) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086963.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 106559..107713 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 107801..109258 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene gabD CDS complement(109311..110057) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 110148..110978 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 111120..113114 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(113155..113691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 113803..114393 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI10 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene tdk CDS 114478..115083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(115084..116265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 116431..116856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 117132..117776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 117821..118090 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rpmA CDS 118223..118744 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 118757..119797 product GTPase Obg/CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYI7 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene cgtA CDS 119801..120943 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYI6 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene proB CDS 120950..121588 product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C4 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene nadD CDS 121683..122081 product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCI2 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene rsfS CDS 122095..122559 product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X82 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene rlmH CDS 122559..122888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(122943..123392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 123589..124785 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 124813..126141 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 126274..127533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921268.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 127533..128036 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV14 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene rppH CDS complement(128117..128527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(128570..128752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 128751..130043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(130044..130592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(130753..132579) product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene atpD CDS complement(132596..133480) product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC75 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene atpG CDS complement(133553..135097) product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV20 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene atpA CDS complement(135094..135657) product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL30 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene atpH CDS complement(135836..137890) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene nicT CDS 138058..138888 product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(138891..140033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(140036..141103) product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VT4 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene mtnA CDS complement(141121..141810) product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I340 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene mtnC CDS complement(141807..142361) product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I341 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene mtnD CDS complement(142358..143011) product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene mtnB CDS complement(143008..144192) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(144454..145404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(145502..145921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(146244..146687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(146691..146975) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(147047..149218) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB85 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene priA CDS 149290..150213 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S9 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene xerC CDS 150303..150926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 150933..151250 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(151315..152478) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918955.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(152518..153357) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(153527..156187) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(156521..157114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(157305..158711) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3C8 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(158826..159185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(159220..160032) product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 160162..160611 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(160614..160931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(160935..161759) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(161824..163722) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CT50 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene ftsH CDS complement(163778..165130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(165114..166115) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(166194..166751) product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921062.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene pal CDS complement(166868..168232) product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene tolB CDS complement(168252..169142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(169148..169591) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921065.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene tolR CDS complement(169595..170314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(170435..170827) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 170714..171001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 170998..172683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 172683..173045 product zinc-finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537578.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 173101..173532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 173706..174134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(174131..175156) product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H454 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene ruvB CDS complement(175153..175779) product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U81 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene ruvA CDS complement(175776..176216) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3G6 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene ruvC CDS 176506..178800 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(178862..179476) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542505.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(179589..180038) product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J427 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(180040..180696) product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3E0 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene thiE CDS 180787..181269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 181292..181705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 181801..183495 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 183498..183866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(184131..185021) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(185087..186283) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I9 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene pgk CDS complement(186287..186922) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404718.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(187127..188134) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIJ0 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(188271..188777) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(188947..190659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(190913..192892) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M82 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene tkt2 CDS 193030..193308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 193328..193657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 193754..194566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 194641..195561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(195563..196825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 197107..197601 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 197594..198388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 198378..198893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(198952..200988) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084021.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(201123..201443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(201723..204086) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 204418..205002 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3F9 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 205143..207311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 207435..208259 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(208256..208663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 208844..209593 product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 209718..210086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 210146..211009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 211104..212750 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(212806..214062) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 214289..215599 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene amt-2 CDS 215839..218310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(218349..218747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 219017..219715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(219776..220384) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 220738..221463 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 221636..222307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(222310..222651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(222651..222857) product UPF0434 protein R03186 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L94 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(222845..223501) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(223557..224456) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 224650..224961 product urease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083173.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(224958..225458) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 225533..226279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918001.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 226276..227019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(227016..227906) product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529172.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(227972..228490) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(228699..229040) product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45972 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene fdxA CDS complement(229104..229556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(229615..229905) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(229914..232763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(232883..233332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 233500..234219 product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(234267..235169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 235884..237698 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(237754..239010) product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940107.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(239454..240677) product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWG2 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 240803..241534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(241531..241863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 241971..242420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 242527..242808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(242812..243573) product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 243516..244085 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 244147..244332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(244342..244755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(244758..245570) product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEH0 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene fabI CDS complement(245648..246118) product putative N-acetyltransferase YsnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94562 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene ysnE CDS complement(246108..246863) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(246872..247396) product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene fabA CDS complement(247498..248103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 248260..249246 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(249247..250272) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(250269..251009) product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923352.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene moeB CDS 251080..252408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(252727..253227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 253373..254371 product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58141 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene gpsA CDS 254368..254814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene mmcB CDS 254875..256089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 256086..256271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 256362..256913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(256936..258063) product NAD-dependent 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene gbd CDS 258185..260038 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(260043..260852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLW9 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 260954..261349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 261356..262579 product L-threonine dehydratase catabolic TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE74 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 262602..263171 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBQ0 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(263197..263907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(264019..264789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 264951..266261 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917952.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(266315..267235) product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 267692..268117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 268321..268938 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403296.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 268938..270068 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(270065..270784) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 270836..271504 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919627.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 271501..274020 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 274163..274813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 274961..275305 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 275617..276903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(277091..277852) product LytTr DNA-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 278032..278586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 278732..279910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 279914..281161 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 sequence04 source 1..266002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(34..108) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(207..1019) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1066..1401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1477..1671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(1744..2649) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW9 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene rpoH CDS 2981..5290 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(5350..5928) product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8G5 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 6082..6519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(6522..7580) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T0 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(7639..8256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 8538..9665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 9751..11487 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 11522..12181 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSW3 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene rluA CDS complement(12229..12459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(12619..13008) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(13030..13650) product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T6 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene folE CDS 13909..14550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 14608..15948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(16003..16374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(16464..17129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 17341..19104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(19163..19768) product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(19793..20401) product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389207.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(20442..21050) product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 21393..22766 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(22752..23285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(23436..25145) product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene yqiK CDS complement(25173..25847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(26154..27413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 27787..29175 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZS3 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene cysS CDS complement(29548..29718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 29867..30415 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 30561..31910 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene atrB CDS complement(31907..32065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(32058..33095) product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974381.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(33099..34490) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 34662..35105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 35162..35773 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 35897..36673 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(36674..38740) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3F5 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(38789..40228) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83R17 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene amn CDS 40338..40916 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene rfbC CDS complement(40898..41839) product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531310.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 42023..42850 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 42895..43848 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A448 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene accA CDS 43855..44334 product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EB5 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(44341..45009) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(45077..45796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 45873..47003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(47007..47777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(47770..48627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene rpfD CDS 48807..49040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 note possible pseudo, frameshifted CDS 48943..50010 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087109.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(50014..50514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 50744..51499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(51508..52623) product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9W0 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene ispG CDS 52803..53951 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J243 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene aspAT CDS complement(54010..54906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(54993..57197) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene ptsP CDS complement(57296..58549) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9W8 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 58643..59419 product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9X1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene ubiG CDS complement(59478..60350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(60443..60928) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NC8 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene bfr CDS complement(61030..61236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(61303..62625) product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199804.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(62700..63314) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D981 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene acpD CDS 63446..64063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(64054..64284) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(64286..64708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(64736..65158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(65310..66956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(66966..68378) product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230408.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 68608..68766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(68744..69748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 69870..70700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(70697..71608) product HTH-type transcriptional regulator VirS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMJ3 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene virS CDS 71842..72282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(72320..73717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 74075..75673 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C6 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene lysS CDS 75663..76262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(76259..77146) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894197.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(77155..77748) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(77881..78735) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 78993..80255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 80261..80827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 80824..81252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(81278..82816) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS31 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene pgi CDS 83213..84139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(84176..85399) product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF6 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 85803..88670 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(88779..89768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(89851..90579) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170826.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene yenR CDS complement(90740..91264) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9D9 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene infC CDS complement(91338..92351) product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(92351..93505) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 93548..94297 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 94297..95070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(96982..97674) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z749 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene pcgL CDS complement(97681..97821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(97951..98079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(98160..98615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(98627..98887) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(98912..99304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 99263..99658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 99699..100595 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene bioC CDS complement(100596..100781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(100778..101203) product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene mutT CDS complement(101245..102480) product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene argJ CDS complement(102477..103466) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAX1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 103632..106331 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GT8 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene secA CDS 106719..107393 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 107402..109087 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(109255..109776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 110076..110885 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S9 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(111118..113166) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene nicT CDS complement(113318..114142) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(114230..114634) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036362.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(114798..115673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 115987..117174 product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB6 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene argD CDS 117175..118095 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A653 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene argF CDS 118077..119045 product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58097 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene hslO CDS complement(119049..120284) product D-amino acid dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU99 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene dadA2 CDS 120567..121682 product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 121682..123172 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528231.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 123240..123917 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene fzlA CDS 123898..125013 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD15 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene queG CDS complement(124990..125697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 125753..126598 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 126705..127028 product UPF0386 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAA5 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(127091..129331) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(129306..132530) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(132594..133769) product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(133769..135196) product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811956.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene cusC CDS 135444..136913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 137072..138214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 138201..139937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 139934..140755 product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAT6 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene pstB CDS 140773..141459 product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV9 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene phoU CDS 141489..142184 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene phoB CDS 142247..143221 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(143229..144191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(144188..145084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 145281..145787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(145788..146174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(146272..147099) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 147249..147746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(147743..148231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(148249..149880) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(149925..150896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(150961..151836) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527947.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 151843..151977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(152041..152436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 152647..153372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 153475..155544 product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 156008..159406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 159591..162059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 162165..162512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 162557..163078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(163134..163352) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(163352..163759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 163937..164572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(164662..166251) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 166583..168538 product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(168623..168976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(169143..171371) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(171391..171603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(171606..172811) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(172836..173270) product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085287.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(173275..174441) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(174609..176393) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(176457..176954) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 177152..180823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(180838..181572) product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(181633..182424) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 182579..183940 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(183944..186442) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 186559..187227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(187237..187665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 187774..188574 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(188579..190171) product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 190298..191353 product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 191417..192475 product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene idiA CDS 192708..194333 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 194415..194789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921230.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(195646..196155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 196274..196720 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 196840..197376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 197449..198525 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9V5 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene prfA CDS 198528..199295 product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 199292..200152 product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG70 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene prmC CDS 200321..200968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(200989..201369) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970731.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 201631..202035 product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670476.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 202113..202559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(202582..203199) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(203279..203500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 203587..204639 product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAR8 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 204716..207538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 207826..210480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 210702..212219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 212252..213190 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(213169..214356) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 214501..214737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 214830..215429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(215492..216871) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918659.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 217175..218389 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 218399..218719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 218716..219852 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 220181..220975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(221059..222336) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 222612..224600 product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(224662..225906) product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 226091..227077 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U7F8 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 227077..227727 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(227734..228534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 228677..230209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 230222..230572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(230652..231551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(231596..232498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 232688..233659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(233715..234494) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(234669..236108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(236120..237931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(238257..240047) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCQ9 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(240075..240464) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504989.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene sdhD CDS complement(240469..240801) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921358.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene sdhC CDS 240950..242704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 242820..243542 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089944.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(243549..245036) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(245155..246633) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(246915..247316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(247316..248356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921483.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(248437..248709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 249023..251203 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(251204..252535) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(252589..252969) product putative arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44589 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene arsC CDS complement(252985..253749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 253966..255513 product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene yhcX CDS 255521..256351 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(256344..257468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(257465..257938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(257945..258865) product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921486.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 258952..259815 product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABH1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 259923..260120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 260229..260732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(260739..261176) product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P4 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(261201..261767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 261735..261920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 262158..265010 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920997.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(265104..265619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 sequence05 source 1..258652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0CAT9:60 kDa chaperonin locus_tag LOCUS_14470 CDS 1062..1823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1897..3600) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389048.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(3705..5681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(5721..6236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(7288..8235) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5P6 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene hisG CDS complement(8232..9344) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene hisZ CDS complement(9341..10810) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2P3 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene hisS CDS 11089..11457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(11426..11599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(11611..13764) product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(13961..14749) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 14963..16837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 16938..18632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(18693..19022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(19139..19399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(19492..19911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 20179..20646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(20649..21143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 21315..21629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 21650..22198 product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene rluE CDS complement(22199..24949) product regulatory protein FlaEY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919340.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene flaY CDS 25195..26301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(26298..26825) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015753.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(26825..27901) product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(27853..28743) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene rfbD CDS complement(28743..29462) product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 note possible pseudo, frameshifted CDS complement(29521..30393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 30495..31610 product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8W4 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene pseB CDS 31727..32266 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(32329..32970) product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H24 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 33200..34945 product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(35041..35874) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene fljJ CDS complement(35992..36369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(36442..37266) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene fljJ CDS complement(37661..38485) product flagellin FljM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52529 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene fljM CDS complement(38867..39691) product flagellin FljK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18913 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene fljK CDS complement(39792..39986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(40056..40886) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7K6 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene fljK CDS 41202..41672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(41673..42452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(42529..42879) product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene flaF CDS complement(42827..43264) product flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21297 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene flbT CDS 43405..45222 product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene flbA CDS 45197..45388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 45462..46424 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(46407..47921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(48026..49825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(50059..50487) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(50487..50960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 51008..51499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 51635..52276 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 52310..53350 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(53358..54104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 54411..55421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(55418..55834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(55831..57147) product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H363 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene fliI CDS 57580..58293 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008138878.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 58467..60626 product ferrisiderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene bfrI CDS 60623..61201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 61213..62697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(62722..63726) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 64014..65678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(65754..66593) product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene cheR CDS complement(66590..67738) product chemotaxis response regulator protein-glutamate methylesterase of group 2 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T55 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene cheB2 CDS complement(67750..68115) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921300.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(68136..68597) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene cheW CDS complement(68594..71371) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(71532..72161) product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(72548..72892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921381.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(72908..73144) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(73137..76199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 76609..78033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 78249..78677 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 78772..79335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(79338..79907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 80045..80485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(80546..83173) product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAM5 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene clpB CDS complement(83665..84534) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 84667..85167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 85164..85847 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 85851..87197 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(87249..89297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(89369..90763) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA6 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(90906..91973) product epoxide hydrolase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6YGS0 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene ephA CDS complement(92085..93518) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 94211..94600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 94610..95845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(95839..96357) product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 96678..97508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(97585..97794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(98039..102007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(102367..104325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466016.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(104329..104823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 106847..108199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(108196..110460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 111631..112092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(112148..112606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(112603..112869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(113319..113885) product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(114422..115114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 115426..116721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 116734..117603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 117745..119400 product type IV secretion system protein VirD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(119397..119762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 119828..120472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 120595..120849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 120839..122569 product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 tRNA complement(122400..122484) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(122579..122836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 122904..123596 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8M0 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene lipB CDS complement(123593..124093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(124090..126741) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9J0 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene alaS CDS complement(126852..127931) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33156 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene recA CDS complement(128093..130663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(130745..131803) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene flhB CDS complement(131803..132558) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I29 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene fliR CDS complement(132566..132829) product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45974 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene fliQ CDS complement(132970..133941) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 134077..135930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 136070..137944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(137997..138590) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 139363..140829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 140966..142441 product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene glpK1 CDS 142462..142983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(142971..143450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(143487..144923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(144988..145986) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 146200..148647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 note possible pseudo, internal stop codon, frameshifted CDS 148668..149078 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 149092..149538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(149518..149706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 149878..150585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 150734..152758 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 152769..154937 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085838.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene mutA CDS complement(154984..155877) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886753.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 156004..156552 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene mip CDS 156643..157104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369090.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(157120..159729) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919893.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(159852..160193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 160308..161018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 161025..161981 product putative GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37895 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(161978..162478) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 162670..163512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 163546..164502 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 164594..165241 product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 165254..165643 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 165751..167184 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene gatA CDS 167177..167578 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(167585..168340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(168367..169509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(169502..170962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 171010..171906 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene trmH CDS 171903..172799 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(172796..173791) product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEK1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene coaA CDS complement(173912..174223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 174284..174727 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 174784..177612 product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S7 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene glnE CDS 177680..178264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 178336..178896 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S9 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 178901..179344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 179347..179922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(179926..180981) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(180997..181947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 182093..183307 product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887546.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 183453..184973 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 184982..185653 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532631.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 185776..187047 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 187216..189555 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene fyuA CDS complement(189646..190401) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(190482..191921) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E324 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene murC CDS 191959..192795 product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(192806..193258) product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1L5 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene ccmE CDS complement(193269..194846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(194849..195520) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(195535..195840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(195973..196917) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(197319..197897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(197785..198903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(198934..199365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(199362..200018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(200011..200631) product glycoside hydrolase family 24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971292.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(200628..201053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(201057..201242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(201239..201529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640584.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(201643..202059) product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(202234..202629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(202626..203156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(203365..204561) product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(204612..205004) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920627.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(204994..206133) product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(206144..207262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(207354..207677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 207793..208086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(208090..209487) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 209627..210904 product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 210907..211317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640347.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 211668..214313 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528684.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 214572..216548 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 216585..217595 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(217598..218374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 218764..219984 product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD89 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene icd CDS complement(220054..220221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(220223..220618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 220872..221312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 221309..221758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 221759..222277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 tRNA 222379..222455 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(222834..223304) product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918825.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(223310..225160) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UD23 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene ilvD CDS complement(225385..226119) product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 226290..228461 product exogenous ferric siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene bfrA CDS complement(228523..229389) product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809214.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(229536..230681) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 230666..232603 product holdfast attachment protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 232715..233818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640543.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(233843..235090) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 235313..236551 product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 236704..237168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 237179..237391 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 237500..238558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(238564..239553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 239844..242126 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5F0 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene purL CDS complement(242137..242769) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918663.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 242916..244220 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 244329..245426 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene yliI CDS complement(245466..246236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(246357..246974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 247596..249515 product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(249575..250435) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(250502..251224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 251574..252008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(252012..252557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(252643..253413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(253410..254201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(254198..254968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(254981..255481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(255501..255989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(255986..256744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(256741..257580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(257577..258287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 sequence06 source 1..247914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..983 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A287:signal recognition particle receptor FtsY locus_tag LOCUS_16860 CDS 980..1840 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1837..2421) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 2531..2929 product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 2982..4454 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920284.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene hfsF CDS 4599..5147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 5209..5940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(5944..6483) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 6572..7201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(7206..7385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(7382..8110) product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(8121..8777) product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE4 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(8774..9397) product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33570 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene ccmA CDS 9526..12210 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A299 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 12391..13068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(13065..13991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(13988..16522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(16519..17247) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 17649..17909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(17916..18839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(18853..20988) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene flaN CDS 21329..22795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 22808..23467 product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ4 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 23586..24968 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRB3 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 25169..25444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 25547..27229 product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ES3 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene fliF CDS 27229..28323 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6V1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene fliG CDS 28307..28945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 28962..29303 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03593 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene fliN CDS 29359..30741 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene flbD CDS 30766..32910 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03845 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene flhA CDS 32925..33920 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 33920..34768 product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(34784..36157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 36319..37476 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(37503..38372) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene motA CDS 38536..39837 product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918637.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(39834..41129) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene MltB CDS 41665..42198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 42203..43183 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 43187..43462 product UPF0335 protein R02793 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M59 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(43530..43847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 44067..44600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 44681..45550 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089234.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 45666..46967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(46964..48304) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 48404..49066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(49123..49446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 49806..51290 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene tacA CDS complement(51295..51786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(51876..52160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 52266..52838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 52857..53390 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE05 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 53495..54472 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 54578..54874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 55264..56223 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 56216..57649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(57743..57991) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3A7 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene rpsU CDS 58070..58690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(58694..59686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(59683..60438) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene plsC CDS complement(60438..61013) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066766.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(61028..61900) product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene FtsX CDS complement(61893..62624) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene ftsE CDS 62706..63608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920076.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 63617..64150 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920075.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(64154..66844) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(66829..68094) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8H9 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene lysA CDS complement(68105..68413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(68410..69807) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY2 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene argH CDS 69846..70430 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene tlpA CDS complement(70431..72140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 72282..72971 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene chvI CDS 73078..74577 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene chvG CDS 74736..75140 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 75149..75421 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(75431..75994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 76180..77574 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TC1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene ahcY CDS complement(77629..79044) product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 79185..79772 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(79779..80246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(80312..81079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 81298..81999 product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C302 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene trmD CDS 82032..82574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 82739..83161 product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSV9 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene mscL CDS 83295..83708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(83753..84526) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 84693..87107 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921186.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(87111..87962) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(87995..88387) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920112.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene staR CDS complement(88730..89527) product formiminoglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918629.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 89735..90094 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene cpdR CDS complement(90123..91028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(91079..91456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 91625..91789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(91786..92142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07080 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene yrdB CDS complement(92216..93322) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GY0 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene adhC CDS 93420..94319 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113868.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 94333..95178 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H09 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(95179..96111) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210991.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 96222..97442 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 97529..99052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 99066..99566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(99588..100736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(100810..101256) product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719802.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(101331..102692) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(102786..105227) product sensor protein DivL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQQ9 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene divL CDS complement(105331..107853) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920378.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(108014..108460) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639995.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(108462..109229) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAS7 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene gloB CDS 109297..110088 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 110085..110429 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene glnC CDS complement(110584..111831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(111928..112143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 112281..113099 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728V8 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene htpX CDS 113131..114414 product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene rsmB CDS 114543..115028 product outer membrane lipoprotein pcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P10325 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene pcp CDS 115155..115754 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 115760..117457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene fzlC CDS complement(117476..117823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 118133..119719 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU8 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene purH CDS complement(119786..120706) product cyclohexadienyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene tyrC CDS complement(120707..121786) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCK0 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene hisC CDS complement(121884..122693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(122877..123755) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene hbdA CDS complement(123917..124885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(124875..126587) product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 126933..127877 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923262.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 127877..128347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 128485..129228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(129195..129950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 130065..132236 product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene fdhF CDS 132289..132684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 132752..134917 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 134941..136431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963892.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(136438..137670) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS87 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene kynU CDS 137818..138669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(138666..139430) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(139583..141757) product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene katG CDS 141967..142704 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 142715..143317 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640024.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(143376..144239) product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(144296..144640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(144647..145840) product arabinose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279096.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(145930..146415) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975073.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 146608..147513 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705386.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(147510..147995) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(148005..148430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 148594..150156 product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Y5 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 150153..150671 product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHM4 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 150679..150918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 151112..151522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(151639..152568) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918612.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(152568..153314) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039481.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene etfB CDS 153711..155828 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 155984..156808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(156810..157388) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(157603..157809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 157961..158590 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(158591..158815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(158831..159472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(159527..159865) product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene tfoX CDS complement(159877..160338) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(160382..162079) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 162334..162876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(162937..164025) product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(164037..165533) product carboxypeptidase S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265607.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 165760..166227 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 166389..167855 product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 168009..168659 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(168683..168958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 168881..169255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 169335..170105 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 170152..170832 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(170838..171281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(171330..172250) product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFD9 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene ttcA CDS 172566..172862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 172874..173752 product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Y0 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene folD CDS 173837..174133 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 174202..174450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 174540..175637 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(175638..176861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 176931..181886 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 181912..184002 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921399.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 184157..184624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 note possible pseudo, frameshifted CDS 184650..184820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 note possible pseudo, frameshifted CDS complement(184877..185317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(185389..186900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 187037..187516 product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTQ3 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene speH CDS 187808..191038 product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene oar CDS 191380..192408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918100.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 192412..193254 product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055967.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(193318..194148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 194242..195063 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63634 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene murI CDS complement(195069..195440) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(195522..196718) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 196993..198060 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(198098..199123) product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4U9 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(199276..199812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(199851..201257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(201323..201676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(201755..202486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 202662..203324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 203461..204315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 204414..204626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 204644..205063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 205819..206064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(206457..208328) product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC10 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 208848..209042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 209096..210802 product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSG8 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene opgG CDS 210799..212898 product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSG9 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene opgH CDS complement(212917..213732) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640711.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 213884..214534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 214689..216269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(216318..216884) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(217024..217653) product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(217779..218210) product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384082.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(218436..218894) product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384082.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 219302..220189 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 220186..221085 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 221168..222721 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene phoA CDS complement(222794..224593) product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920158.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 224801..225145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(225166..225735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(225844..226641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(226709..227560) product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61655 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene kdsA CDS complement(227638..229089) product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR2 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene trkI CDS complement(229105..229524) product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS7 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene apaG CDS complement(229528..230727) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A656 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene metZ CDS 230835..231839 product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083925.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene dcd CDS 231869..232144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(232208..233290) product chemotaxis sensory transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387843.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(233475..236597) product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AA07 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 236851..237945 product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 238124..238765 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710111.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 238891..240330 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z766 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 240516..241046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(241074..242237) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 tRNA 242423..242507 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 242598..244040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 244344..245609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 245993..246304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(246353..246916) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 repeat_region 247681..>247914 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccggttggcctgacttttccagagtgctagaac sequence07 source 1..234721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(517..1956) product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920780.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene cpaE CDS complement(1978..2664) product pilus biogenesis lipoprotein CpaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533682.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2679..4325) product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920782.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene cpaC CDS complement(4322..5170) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene ctpC CDS complement(5229..5756) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533685.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(5951..6112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 6364..6831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 6925..7494 product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920787.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 7498..8043 product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(8047..9558) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(9644..10420) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(10445..11869) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(11902..12720) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU4 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene dapB CDS complement(12767..13261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(13382..14326) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229205.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(14463..15602) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50018 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene dnaJ CDS complement(15632..15979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(16013..17929) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20442 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene dnaK CDS 18173..18778 product alkylated DNA repair dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 18863..19075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 19130..19750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(19747..20553) product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(20632..21984) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(22099..23538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(23669..23995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(24164..24769) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCN8 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene grpE CDS complement(24770..25837) product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP3 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene hrcA CDS 25984..26697 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW5 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene rph CDS complement(26758..29277) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 29463..31019 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(31023..31520) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene aspG CDS complement(31643..31882) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(31889..32413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 32774..33376 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 33376..34539 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(34542..35852) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 35895..36800 product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFQ0 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene rsmI CDS 36800..37183 product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIJ2 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 37227..37886 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 38040..38993 product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM6 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene gshB CDS complement(38978..40417) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(40414..40827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 41250..42779 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene chlI CDS 42834..44303 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918027.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene shkA CDS 44300..45742 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene ampG CDS complement(45795..48092) product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 48239..50923 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C2I6 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene mutS CDS 50973..53828 product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC53 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene glnD CDS 53861..55429 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4E4 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene mviN CDS 55440..56474 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC05 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene trpS CDS 56525..56992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 57147..58010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 58058..58633 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917951.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 58648..59250 product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXF0 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 59257..59910 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 59879..60352 product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ7 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene rimI CDS 60416..60835 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 60850..62211 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U7 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene miaB CDS 62208..63215 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917945.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 63205..63687 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX09 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene ybeY CDS 63701..64588 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene corC CDS 64612..66282 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene lnt CDS 66373..66825 product putative HTH-type transcriptional regulator R00410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C5S2 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 66912..68084 product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene metK2 CDS 68101..68793 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX04 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene trmB CDS 68830..69255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(69259..70041) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene bdhA CDS 70128..70562 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918024.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 70574..71401 product endopeptidase DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 71403..72293 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene pyrF CDS 72330..72866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 73000..73479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 73552..74370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(74367..74651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(74651..75121) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530919.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene gloA CDS complement(75118..75612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(75639..76541) product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(76598..77101) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921557.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 77228..77911 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T20 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene nth CDS complement(77912..80491) product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(80484..81065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(81070..81834) product ATP-grasp domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265999.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 82017..83012 product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(83009..83611) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 83734..84192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 84554..85720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(85726..87030) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN2 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene hslU CDS complement(87154..88248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976394.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(88250..88813) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM9 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene hslV CDS complement(88888..91011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 91150..91737 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW12 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene hisB CDS 91764..92405 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33565 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene hisH CDS 92402..93133 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG72 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene hisA CDS 93127..93894 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50937 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene hisF CDS 93897..94259 product phosphoribosyl-ATP pyrophosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM3 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene hisE1 CDS complement(94256..94864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(94861..96090) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(96060..96647) product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067421.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(96786..97511) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067418.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(97508..98110) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C2I0 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene coaE CDS complement(98171..99010) product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DM7 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene aroE CDS complement(99007..99603) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Q9 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(99607..100449) product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 100775..101821 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene hemE CDS 101831..102259 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 102383..103669 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A211 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene rho CDS 103718..105055 product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX2 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene mnmE CDS 105077..106981 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW33 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene mnmG CDS 106981..107598 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW32 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene rsmG CDS 107591..108397 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 108399..109289 product chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW30 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene parB CDS complement(109301..109864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(109867..114738) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917977.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene gdhZ CDS 115284..116792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(116746..117633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(117808..118545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 118712..119938 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THW9 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene argG CDS 119947..120561 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 120727..121260 product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC37 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene ppa CDS 121284..121940 product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 122080..122685 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 122729..124618 product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AA58 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene mnmC CDS complement(124615..124854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(124891..125376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(125376..125636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(125629..125760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(125766..126467) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(126493..126642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 126844..127929 product PSP operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 128014..128790 product WecB/TagA/CpsF family glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061718.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(128839..129171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(129268..130311) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(130365..132818) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640169.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 132938..133252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(133221..134141) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 134449..135012 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 135189..136784 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920757.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 136842..137441 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854745.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 137689..139098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(139217..139504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 139503..140426 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(140363..140983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 141204..141986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709090.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(141953..142387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 142441..143220 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(143301..143816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918014.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(143969..145390) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 145632..146195 product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731343.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 146192..147019 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811499.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(147069..147971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 148208..148501 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4W8 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene rpmB CDS 148596..150248 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(150261..151340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(151327..153336) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 153397..154452 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726907.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(154449..155273) product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(155406..156389) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920857.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(156510..157139) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 157178..157441 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(157445..158707) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 159089..161452 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 161682..162533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035595.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(162530..163789) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640633.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(163789..164907) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ME7 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene aroB CDS complement(164900..165478) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A435 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene aroK CDS 165562..165696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 165689..167398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 167400..168332 product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A437 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene xerD CDS 168447..169502 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265893.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(169561..170400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 170435..171469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 171505..172398 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 172470..173273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 173263..174162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 174321..175208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(175277..175645) product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(175651..176838) product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXM4 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene rlmN CDS complement(176922..177410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 177570..178157 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 178233..178895 product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40685 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene chrR CDS 178931..179320 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063587.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(179324..179845) product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(179848..180717) product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917986.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 180831..181823 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 181912..182760 product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 182819..183469 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887707.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(183466..184098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 184337..185848 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2B3 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene ffh CDS 185845..186051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 186048..186638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 186635..186931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 187006..187425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 187560..188726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 188825..189544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 189686..191755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 191844..192398 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ03 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene rimM CDS 192413..192970 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 193059..194570 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 194694..195614 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5G2 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene cysK CDS 195722..196702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 196755..197756 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388682.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(197777..198655) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123106.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(198740..199414) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(199424..200185) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX9 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 200389..200850 product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 200854..203091 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529192.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 203104..203424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 203525..204787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 204820..207066 product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene gcd-1 CDS complement(207069..207704) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(207701..209578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(209878..210585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 210748..211524 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(211548..212111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(212183..214555) product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVE3 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(214726..215643) product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE96 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene fbp CDS complement(215803..216618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54549 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene yqjL CDS complement(216645..218069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(218149..219018) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932170.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(219077..219457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(219483..220532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(220617..221663) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205693.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(221784..222422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 222523..223407 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(223400..225193) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 225499..226137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(226212..226652) product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene rpiB CDS complement(226731..227654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(227667..229850) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(229955..230338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(230489..231541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(231620..234454) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 sequence08 source 1..194782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..913) product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene atpB CDS complement(910..1275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(1406..4870) product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZ28 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene smc CDS complement(5007..5660) product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385520.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(5684..6337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(6375..7010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(7048..7602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 7648..8724 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532756.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(8735..8935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(9011..10093) product modification methylase CcrMI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZ33 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene ccrMIM CDS complement(10205..11341) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 11652..12350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(12347..12949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124719.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(12974..13660) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene wcaA CDS complement(13710..14516) product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 14908..16593 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene fzeA CDS 16703..18463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 18460..19380 product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHC4 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene ispE CDS 19416..20462 product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(20456..21466) product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene ispB CDS 21622..21831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 21831..22568 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919975.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 22627..22752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(22810..23979) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene hisC CDS 24284..25180 product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H516 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene glyQ CDS 25237..25590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 25614..26339 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814256.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 26358..26783 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538074.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 26880..27566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(27614..29509) product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 29713..30090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(30136..30294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 30515..32542 product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T912 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene glyS CDS 32555..35242 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 35747..36544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(36596..37408) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920803.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(37489..38343) product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(38356..39894) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUG1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(39934..40380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(40377..40844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(40870..42018) product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2F3 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene nadA CDS complement(42326..42763) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(42854..43822) product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919326.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(43822..44358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 44492..44695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(44673..45227) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 45445..45582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 45696..46430 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971109.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 46483..47556 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919204.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 47553..48104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(48108..48608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(48608..49708) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RY1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene aroC CDS complement(49737..50396) product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 50476..51150 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHC2 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene pdxH CDS complement(51210..51578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920369.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(51662..53860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(54007..54837) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(54904..56208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(56386..57003) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H053 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene rpsD CDS complement(57155..57343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 57459..57890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(57875..58612) product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CYC5 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene lasT CDS complement(58614..59552) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120175.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(59580..60041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(60121..60903) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene bdhA CDS complement(61005..61439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(61984..62682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(62692..63672) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 63853..65496 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene alkK CDS 65511..66260 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529743.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 66304..67554 product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 67677..68486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(68538..69440) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(69468..70394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(70434..70664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(70695..71129) product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 71281..72231 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706429.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene oppB CDS 72231..73133 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(73206..73916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 74040..75644 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 75686..76849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919988.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 77028..80153 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene btuB CDS complement(80588..82336) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9P7 transl_table 11 codon_start 1 locus_tag LOCUS_22420 tRNA 82530..82604 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(82629..82823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 83493..84263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 84287..85669 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 85700..86209 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 86206..86613 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 86623..87030 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 87044..87667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 88142..88399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 88430..89824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(89902..92010) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707320.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene ptrB CDS 92266..92634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(92777..93193) product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE61 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene msrB CDS 93286..94593 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957740.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(94577..95686) product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 95847..97118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(97115..97300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(97303..98274) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 98419..99324 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385500.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(99315..99752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(99862..100320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(100467..101492) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6H4 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene ilvC CDS complement(101568..102134) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919962.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(102194..103966) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA17 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(104143..105087) product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G43 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene miaA CDS 105130..106041 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640406.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(106045..107442) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(107583..107777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(107787..108698) product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G39 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(108711..109823) product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 109924..111096 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T733 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 111294..112127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(112128..112655) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEC3 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene folA CDS 112758..113471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 113550..113720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(113717..114565) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919328.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(114684..115538) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDS3 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene thyA CDS 115747..117027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(117500..118144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(118232..118687) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(118705..120270) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(120405..122228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 122442..123428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 123524..124438 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(124484..124897) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 125160..126434 product sodium dependent nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919950.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 126551..128578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114901.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 128648..129268 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(129265..129705) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(129773..130357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 130536..131696 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918315.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(131806..132135) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 132267..133397 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 133390..134109 product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7V4 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene rlmE CDS 134150..134812 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 134993..138061 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 138242..138772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 138765..139505 product nickel-dependent hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225210.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(139569..140513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(140520..142310) product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 142586..144787 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706388.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(145057..147864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(147897..148547) product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene eda CDS complement(148571..149605) product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640467.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(149605..150882) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(150873..151382) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640242.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(151382..152404) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919322.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(152405..153877) product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640251.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(153874..155388) product altronate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919362.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene uxaA CDS 155549..156970 product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5V4 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene uxaC CDS complement(156967..157479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919887.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(157481..159046) product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE40 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene estA1 CDS complement(159066..160067) product 2-keto-3-deoxygluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035376.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene kdgK CDS complement(160086..160844) product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(160950..161987) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919363.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(162095..163498) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 163641..164450 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919383.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(164511..166136) product xylosidase/arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(166235..168994) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene iroN CDS 169474..169881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 169885..171240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 171814..172647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(172644..172919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(173084..173374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(173376..173891) product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 174347..176887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 177032..178141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089044.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 178384..178896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(178883..180082) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 180514..181482 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974801.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 181495..183969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(184253..184666) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085569.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(184744..184935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 185741..186748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(186745..187050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(187834..188064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 188289..188612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 188640..189320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 189794..191620 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074382.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(191698..192942) product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640036.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene hlyD CDS complement(193006..193230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(193285..193641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(193876..194346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 sequence09 source 1..194434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1592..2698) product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921010.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 2906..4273 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918830.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(4354..5880) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(5907..6194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 tRNA complement(6366..6442) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 6590..7324 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 7329..7601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(7605..7961) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYS2 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene panD CDS complement(8256..8669) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(8731..10407) product antibiotic hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919496.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(10500..10733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 10777..11496 product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(11538..12200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(12229..12786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(12836..13423) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(13558..14505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(14662..17079) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 17133..17582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(17579..18394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(18466..19212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(19202..20464) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(20550..21287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 21384..23051 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920009.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 23055..23303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 23353..23607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 23789..24313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 24416..24748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 24794..25147 product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640610.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(25221..26210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(26517..27515) product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(27522..27839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(27942..28517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 28741..28935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(28938..29450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 29944..30834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 30909..32549 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 32641..33528 product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABG6 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(33579..34556) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene ncd-2 CDS 34787..36439 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918631.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(36504..37187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(37208..37945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 38164..39120 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 39117..40013 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UJ7 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene metF CDS 40018..40497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 40494..41015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 41300..41494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 41481..42545 product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919999.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 42566..43243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 43257..43517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 43561..44112 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 44112..44306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 44316..44699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(44783..47848) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 48652..51270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 51274..51759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 52230..53360 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409667.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 53451..54020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(54245..54880) product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 55429..55881 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(55892..56317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(56343..57761) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 57907..58665 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9V6 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene proC CDS 58775..59632 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN2 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene surA CDS complement(59629..60639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967555.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 60798..62090 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(62231..63457) product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206886.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 63526..63957 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462760.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 63954..64355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708797.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 64364..64774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 64824..65123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231597.2 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(65120..66070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064119.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(66077..67117) product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968467.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(67114..68139) product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087159.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 68287..68859 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6U8 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene efp CDS 69040..69687 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968191.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene gst14 CDS complement(69684..70484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 70663..71043 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086688.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 71142..72320 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968228.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 72376..72564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 72613..74535 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 74590..75174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(75165..75629) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(75636..78632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 78829..79230 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(79222..79725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 tRNA 80123..80199 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(80252..80836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(80945..81634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(81802..82194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(83504..84388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 84872..85642 product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918057.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 85700..86281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918058.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 86432..86926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 87175..88260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918052.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 88355..90577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 90623..91600 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973608.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene galE/exoB CDS 92024..93124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 93166..94323 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 95579..96400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 96442..97707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 97920..99038 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV56 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene gmd CDS 99043..99996 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5H3 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene fcl CDS 100053..101234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(101307..101546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(101560..103080) product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(103156..103740) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 103870..104109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(104118..104756) product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene eda CDS complement(104767..105726) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58619 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene glk CDS complement(105726..107555) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S0 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene edd CDS complement(107552..108241) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene pgl CDS complement(108238..109713) product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene zwf CDS complement(109819..110067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(110126..110563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 110852..112573 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971605.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene acd CDS 112753..115086 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(115171..116061) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(116061..117098) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919229.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(117103..118239) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919227.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(118248..119021) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067768.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(119031..120527) product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 120626..121504 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 121634..124135 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637089.2 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(124309..125538) product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684147.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(125616..126749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089165.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(126813..127787) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089162.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(127784..128365) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089163.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(128384..129544) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089168.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(129548..130450) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226917.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 130813..131721 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 131850..133028 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226921.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 133065..134066 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532317.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 134093..135019 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089161.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 135123..136337 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268247.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 136354..137559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 137559..139028 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 139038..139868 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 139966..140718 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896700.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 140758..142119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 142123..143205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 143209..144648 product putative symporter YjmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34961 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene yjmB CDS complement(144921..146297) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279690.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(146400..146711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(146711..147889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 148166..149401 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 149492..151120 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 151120..152823 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5P4 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 153110..155461 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 155537..156055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 156055..156534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 156815..157894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 158170..159540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 160864..161547 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY76 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 161550..162293 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8E0 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene lfgG CDS 162296..162829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 162826..163413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 163410..164540 product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene flgI CDS 164553..164888 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6D0 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 164892..165320 product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97H49 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene flgC CDS 165317..165640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 165761..166765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 166762..167133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 167138..167800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 167896..169113 product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082899.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 169110..169562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 169555..170349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 170339..170794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 170794..171960 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1J2 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene flgE CDS 171960..172730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 172750..173007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 173025..173384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 173387..174103 product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQZ8 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene fliP CDS 174103..174846 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726C4 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene fliA CDS 174870..175445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 175462..175815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(175812..176945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(177003..179027) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene flhA CDS complement(179048..180103) product type III secretion system protein HrcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551930.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(180106..180666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 note possible pseudo, internal stop codon, frameshifted CDS complement(180885..181151) product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 181431..192431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(192448..192678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 192677..192838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 192805..193047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 193472..194104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 tRNA complement(194349..194425) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence10 source 1..181262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(866..1624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385563.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(1652..1870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(2305..2673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 2785..3282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088607.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(3477..7997) product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921434.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene gltB CDS complement(8002..9447) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene gltD CDS 9697..10551 product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SL0 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene uppP CDS 10639..11052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 11198..12259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(12325..12765) product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528883.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(12837..13820) product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 13979..15382 product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8E3 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 15470..17416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(17413..18210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(18311..18913) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071590.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 19241..20989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(21014..21985) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N5 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene bioB CDS 22099..22743 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS6 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene trpF CDS 22847..23773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(23792..24466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 24649..25026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 25094..26305 product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12290 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene trpB CDS 26328..26651 product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene cutA CDS 26651..27481 product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H661 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene trpA CDS 27493..28437 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L5 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene accD CDS 28473..29750 product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene folC CDS complement(29761..30084) product thioredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA30 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene trxA CDS complement(30138..33659) product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(33656..36754) product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(36751..37476) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene galF CDS complement(37478..38575) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(38553..39026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 note possible pseudo, internal stop codon, frameshifted CDS 39120..40367 product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 40382..40702 product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene fdxB CDS 40833..41882 product sal operon transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639440.2 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene salR CDS 41879..42217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 42381..43877 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920344.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(43934..45559) product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE40 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene estA1 CDS 45747..46664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 46725..47246 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 47318..48217 product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404104.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 48285..50237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(50298..50591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(50619..51572) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(51663..52148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 52366..53934 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 53992..55296 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 55492..56154 product putative outer-membrane protein y4mB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55561 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 56344..57204 product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230665.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene tauD CDS 57319..57798 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(57851..60091) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 60543..61292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(61295..61837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(61912..62553) product protein exod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene exoD CDS 62697..63839 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(63836..64063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(64151..64615) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SM6 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene dut CDS complement(64646..65836) product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(65960..66862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(66967..68529) product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A257 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(68530..69345) product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A258 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene ubiE CDS complement(69406..69969) product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(69966..70139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 70277..70816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331451.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 71295..71909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(71933..73237) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920237.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(73312..73506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 73663..75360 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 75485..76051 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086920.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(76052..76831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 77061..78773 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 79032..79904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(79977..81551) product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCT7 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(81707..82018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(82022..83185) product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene serC CDS 83450..83956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 84023..84631 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UGP7 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene trpF CDS 84628..85578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(85593..85931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(86080..87963) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140190.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(88075..89010) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(89020..89319) product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(89427..90131) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene bioH CDS 90232..91779 product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 92476..93552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(93602..94567) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 94747..95211 product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(95281..96606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(96713..97156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(97153..97869) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYN6 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene gpmA CDS complement(97963..98454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 98578..99165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 99206..100723 product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920125.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 100891..101469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 101544..101927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887731.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 102015..103313 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3C9 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene purA CDS 103341..103802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 103990..105327 product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(105324..106391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066961.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(106395..106820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(106964..108145) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918779.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(108249..109307) product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082283.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(109504..109806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 110360..110623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 110726..111577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 111631..112242 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV54 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene leuD CDS 112242..112679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 112874..113953 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4N8 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene leuB CDS 114068..114496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 114499..114813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 114912..115772 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918346.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 115839..116753 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140956.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(116756..117307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(117322..119019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(119170..119547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 119672..120730 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X21 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene asd CDS 121178..121570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 121737..122600 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 122750..123646 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532555.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(123651..124181) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(124408..125535) product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5U6 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene tsaD CDS 125583..126530 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene hemC CDS 126542..127252 product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639872.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 127276..128706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 128703..130172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917964.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 130173..130565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 130633..132642 product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene copA CDS 132639..133448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 133435..134259 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(134256..134711) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970711.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 tRNA complement(134944..135019) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 135268..136347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 136344..137762 product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 137816..138670 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVY4 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene mutM CDS 138805..139581 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 139691..139954 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY9 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene rpsT CDS 140565..142004 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWW5 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene dnaA CDS 142213..143331 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP6 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene dnaN CDS 143336..144484 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT0 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene recF CDS 144704..147148 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXQ0 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene gyrB CDS 147315..147701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 147723..148712 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708455.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 148780..149295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 149435..151342 product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(151312..152040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 152114..153706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(153786..155081) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(155223..155948) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090573.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 156036..156737 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090575.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(156722..157360) product SCO1/SenC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064817.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 157428..158828 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918137.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 158845..159411 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918136.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene spdR CDS complement(159408..159800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(159829..160743) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 160852..161406 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918293.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(161330..163357) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529965.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(163354..166167) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976404.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(166164..167033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537859.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(167037..168065) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708852.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 168115..168699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 168723..169328 product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976400.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 169325..169684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 169681..170874 product poly(A) polymerase/tRNA-nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265544.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(170871..171374) product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(171506..172396) product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC2 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene hemF CDS complement(172420..172911) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4U6 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene trmL CDS 173027..173590 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAX0 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 173612..175102 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAW9 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 175114..176022 product ubiquinol cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918362.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 176126..177352 product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533665.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 177460..178332 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene mtnP CDS 178334..178990 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920342.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(178991..179488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 179624..180151 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB5 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene apt CDS 180198..180788 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBU1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene clpP sequence11 source 1..153648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1201..5295) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZW7 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene rpoB CDS complement(5460..5834) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV2 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene rplL CDS complement(5894..6409) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58060 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene rplJ CDS complement(6808..7506) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAG0 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene rplA CDS complement(7512..7940) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLH9 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene rplK CDS complement(8619..9260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(9554..10168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(10379..10936) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAW6 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene nusG CDS complement(10950..11159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 11421..13664 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887486.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene manC CDS 13861..14775 product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene cysD CDS 14777..16681 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(16742..17341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 17454..18662 product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene acrA CDS 18678..21818 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene acrB2 CDS 21818..23224 product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943333.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 23334..24470 product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(24527..25264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(25367..26176) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J542 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene cysH CDS 26438..26635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(26632..28149) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC0 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene gatB CDS complement(28257..29042) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBV7 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(29045..29578) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920703.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 29748..30605 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(30724..32208) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L0 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene gatA CDS complement(32419..32877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(32960..33247) product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K9 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene gatC CDS 33383..33841 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Z5 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 33838..34755 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 34851..35801 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K19 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene pyrB CDS 35798..37120 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAV9 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene pyrC CDS 37123..37773 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8G9 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene plsY CDS 37770..38873 product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 39003..41243 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA88 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene lptD CDS 41348..42622 product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8Y4 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 42597..43652 product 4-hydroxythreonine-4-phosphate dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MT9 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene pdxA2 CDS 43645..44481 product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGD5 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene rsmA CDS complement(44478..45113) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene gmk CDS complement(45103..45987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337847.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(45999..47027) product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707469.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(47072..48355) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC2 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(48364..48600) product acyl carrier protein AcpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGE2 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene acpP CDS complement(48732..49469) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(49501..50445) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MW0 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene fabD CDS 50637..50987 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene rpsF CDS 50997..51260 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7G6 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene rpsR CDS 51273..51863 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q3 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene rplI CDS 52039..54021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 54176..55645 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7A8 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 55647..56738 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5H2 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene alr CDS 56742..57545 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921522.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 57542..58300 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(58293..59501) product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 59543..60982 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3L8 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene radA CDS 60975..61532 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45108 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene cvpA CDS 61566..63023 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R2 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene purF CDS 63043..63750 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(63803..64642) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918762.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(64718..65887) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086703.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(65949..66524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(66626..67399) product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z4 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 67555..68319 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58056 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene nadK CDS 68405..68896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265683.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(68900..69703) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 69813..70484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(70491..71639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920182.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 71778..72971 product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(73029..74387) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 74555..74932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 74929..76260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(76319..78034) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5U4 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene metG CDS 78248..79198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(79233..80543) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIZ9 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(80714..81169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 tRNA 81361..81436 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(81465..82070) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZX0 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene mobA CDS complement(82204..83517) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112297.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(83595..85721) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(85726..86568) product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920259.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(86643..88040) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5P5 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 88126..88548 product hydroxycinnamic acid degradation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401022.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(88608..89486) product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(89486..90517) product FldA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene fldA CDS complement(90531..91205) product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 91310..92470 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039100.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene fldY CDS 92553..93413 product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969452.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 93410..94435 product 4-oxalomesaconate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene fldW CDS 94432..95448 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085177.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene vanA CDS 95441..95845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 95847..96689 product protocatechuate 4,5-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene pcaH CDS 96686..97627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 97627..98796 product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920262.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 98869..99864 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970770.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(99909..101660) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921222.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(101746..102936) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(102972..103289) product transcriptional activator HlyU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52695 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene hlyU CDS complement(103289..106567) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088515.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(106572..107558) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338241.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(107542..107901) product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086585.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 108048..109319 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 109343..109798 product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370277.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 109819..110022 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 110037..111299 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene rsaFb CDS 111369..112148 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 112159..113049 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(113053..114774) product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(114890..116071) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039906.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(116129..117346) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389213.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(117448..119277) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640360.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 119368..120549 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QV7 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene rnd CDS complement(120553..122076) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919577.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene ppx1 CDS complement(122076..124271) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSD4 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene ppk CDS complement(124292..124984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(124997..126016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 126100..127122 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C924 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene purM CDS 127115..127735 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J516 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene purN CDS complement(127732..128421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(128494..129840) product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8X9 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene rimO CDS complement(129901..130227) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFD5 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(130301..131155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(131165..131398) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(131400..132728) product N-succinylarginine dihydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7W1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene astB2 CDS complement(132725..134173) product N-succinylglutamate 5-semialdehyde dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7W2 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene astD2 CDS complement(134176..135207) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919480.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(135204..136463) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 136462..136647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(136700..137971) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265968.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(138347..138535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(138532..139587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(139580..140113) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V5 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(140188..140406) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAM1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene infA CDS complement(140558..141031) product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Y8 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(141028..142332) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL91 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene hisD CDS complement(142339..142749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920207.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(142800..144071) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5U7 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene murA CDS complement(144141..144293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(144364..146022) product serine type site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062934.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 tRNA 144369..144443 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(146022..146321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(146421..146759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(146845..147309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(147306..148313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(149011..149217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(149263..149433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(149553..149840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(149911..150060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(150172..150978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 152017..152346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 152491..153195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(153192..153557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 sequence12 source 1..125263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(404..694) product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAU0 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene groS CDS complement(1012..1779) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(1859..3514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 3592..4464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 4469..5422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 5846..7102 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene tipF CDS 7152..8012 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265598.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 8090..8587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(8654..9382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(9479..9871) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 9984..10415 product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 10422..11396 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAC6 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene ribF CDS 11503..12297 product rhamnolipids biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RPT1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene rhlG CDS 12304..12921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 13198..14349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 14519..15169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 15516..18473 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAA5 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene ileS CDS 18466..19080 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HL3 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene lspA CDS 19134..19691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640037.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene bamF CDS 19731..21101 product putative zinc protease y4wA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55679 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 21103..22560 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090217.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 22643..24607 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H173 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene mutL CDS 24620..25465 product RNA pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918740.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 25588..28866 product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBT8 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 28952..29968 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene cmaX CDS complement(29965..30549) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZ34 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene rnhB CDS 30585..31559 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531651.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(31556..32458) product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640449.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(32464..32682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(32697..33377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 33644..34651 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113326.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(34617..34883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(34905..35783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 35877..36791 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976359.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(37064..38095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 38386..40446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207299.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(40544..42682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 42789..43040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 43144..44352 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A830 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 44518..44982 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658301.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene dps CDS complement(45381..46280) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(46374..48923) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(49123..50070) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840254.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene trxB CDS complement(50143..51147) product cation efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene zitB CDS 51361..52035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(52157..52996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(53194..54273) product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920689.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(54274..54747) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4I3 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene greA CDS complement(54907..58203) product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN8 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene carB CDS 58418..58738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 58795..59247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640509.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(59244..60059) product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962670.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(60143..60658) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702452.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(60667..61668) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 61944..63386 product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTN5 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene mltF CDS complement(63387..64088) product Zn-dependent hydrolase glyoxalase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 64210..65112 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 65202..65387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 65387..67285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(67310..68263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 68538..69920 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921243.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 69931..70932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(70968..72632) product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AA12 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(72694..73635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(73720..75795) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918113.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 76042..77847 product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 77934..78368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(78422..79075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(79157..80551) product Zn-dependent protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265953.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(80679..81245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 81427..82302 product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6U4 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 82323..83996 product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDH9 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene coxA CDS 84143..84976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 84995..85954 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDA3 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene coxE CDS 85957..86223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 86216..86776 product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T812 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene ctaG CDS 86823..87743 product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707109.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene ctaE CDS 87836..88552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 88592..89977 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707124.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene thrC CDS 89990..90574 product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 90601..91698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(91695..92270) product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A311 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 92428..92910 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(92960..93742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(93752..94594) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957750.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(94630..95205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(95224..99474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(99789..100682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(101223..101918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(101915..102667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 102983..103939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331298.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 103987..104214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 104204..105400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(105410..106159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(106209..107396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(107553..108038) product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK3 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene rnhA CDS complement(108062..110665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(110808..111782) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU7 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene thrB CDS 112071..112637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(112694..113632) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A345 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene ispH CDS 113751..114308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 114342..116111 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A347 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene argS CDS 116476..117621 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD57 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene gcvT CDS 117678..118049 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A352 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene gcvH CDS 118090..119439 product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4V4 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene gcvPA CDS 119436..121007 product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC5 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene gcvPB CDS complement(121015..121287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(121325..122188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(122201..123388) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142183.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(123493..123690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 123587..123856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(123866..124138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(124222..124785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 sequence13 source 1..77036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region <1..280 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccggttggcctgacttttccagagtgctagaacg CDS complement(352..693) product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WVJ7 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene cas2 CDS complement(690..1652) product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene cas1 CDS complement(1667..4831) product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P897 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene cas9 CDS 5214..5489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 5510..6415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 6660..8396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(8372..9055) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084154.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(9058..10260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 10421..14422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 14581..15762 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 tRNA complement(15792..15868) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 16030..16251 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UB0 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene rpmE CDS 16405..17526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 17542..17964 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(17975..18529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene rcdA CDS complement(18620..19132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087107.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(19138..19326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 19386..20348 product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 20484..21149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923245.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 21284..21541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 21596..22840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 22815..23165 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529296.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(23169..23786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 23875..24534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 24620..26404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 26457..27359 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402775.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 27475..28722 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(28796..29347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918963.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(29456..29920) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918964.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(30015..30689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(30758..31801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(31913..32494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(32507..33016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(33156..34349) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58074 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene mnmA CDS 34459..34905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 34974..35123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 35179..37104 product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528095.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 37295..37873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 37904..38224 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529933.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 38225..38782 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(38774..40519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 note possible pseudo, internal stop codon, frameshifted CDS 40778..41644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(41739..42278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120910.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(42444..43637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66504 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 43754..44464 product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265766.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 44507..44806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 tRNA 44910..44994 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(45120..46292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(46435..47052) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QE8 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene msrQ CDS complement(47052..47999) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB06 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene msrP CDS 48076..49563 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(49564..50772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(50838..52484) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881044.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 52768..55365 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 55464..57449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 57463..57945 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423733.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 58013..58474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(58475..59497) product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(59596..61167) product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110305.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(61253..62518) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV06 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene proA CDS complement(62558..63325) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXL8 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene proC CDS 63587..64756 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABB6 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene proB CDS complement(64753..65235) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(65329..67494) product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(67603..68538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(68535..69008) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45405 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene ccmH CDS complement(69008..69316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(69313..69855) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387795.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(69865..71841) product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene ccmF CDS 72187..74793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 75002..76693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532365.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 sequence14 source 1..67946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(616..2223) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C769 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene prfC CDS complement(2262..2825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 3303..4355 product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB72 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(4389..4751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(4748..5167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(5270..6169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918996.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(6242..8860) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(9075..9452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 9572..10603 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(10629..11828) product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY62 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene nhaA CDS complement(11933..12550) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 12648..13580 product hyaluronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036667.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene oxyR CDS 13645..14247 product putative nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703921.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 14247..14831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(14853..15749) product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(15859..16860) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene oruR CDS 17175..17804 product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919879.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 17882..18826 product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710099.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 18925..20193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 20289..20723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(20779..21165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(21323..21502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 21419..22228 product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(22189..22569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(22687..23031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 23087..23317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(23450..24133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(24422..24988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 25410..26015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 26097..27044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918948.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(27041..28654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 28813..29991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 30051..30470 product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532659.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(30424..30825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(30986..31501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(31641..32069) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085852.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(32520..34307) product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(34300..34623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(34620..36098) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(36095..37618) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(37622..38188) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335819.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(38192..38644) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(38641..39258) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328224.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(39255..39632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(39632..39937) product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(39934..40437) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(40573..41796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(41938..42381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 42526..43929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(43935..44558) product 2OG-Fe(II) oxygenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 44732..45127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 45275..46375 product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C709 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene ychF CDS complement(46384..46776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(46858..48012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 48114..49139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(49200..50021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 50234..51079 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970653.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene pheA CDS 51193..51654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 52117..52659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(52718..53674) product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 53839..55653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(55803..56183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(56239..58122) product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 58272..60020 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene dnaX CDS 60017..60349 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YA84 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene ybaB CDS 60361..60843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 60902..61510 product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene recR CDS complement(61514..62884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(62963..63298) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530549.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(63370..64110) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039062.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene ecaA CDS complement(64231..65790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 65981..66175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(66247..67398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039938.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(67453..67704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 67586..67819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 sequence15 source 1..35581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 469..801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338625.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 881..1288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 1512..3587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 3692..4291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 4355..4582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 4579..4998 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 5030..5932 product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LJ5 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene sucD CDS complement(5993..6664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 6731..7144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 7511..10522 product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_419158.2 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene kgd CDS 10555..12087 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene sucB CDS complement(12138..12812) product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM60 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene piuC CDS 12911..13825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 13919..14515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(14472..15743) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537814.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene ugt CDS complement(15740..17017) product adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368570.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(17017..17790) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947356.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(17787..18761) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(18758..19750) product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene fabH CDS complement(19961..21256) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M923 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene bkdB CDS complement(21258..22271) product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315045.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene bkdA2 CDS complement(22273..23520) product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528741.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 23792..24007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 24001..24435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 24440..25726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(25738..26022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 26455..26583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(26747..27262) product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021204.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(27518..29914) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084731.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(29916..30128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 30157..30600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(30616..30879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 31507..33318 product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918848.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 33315..34133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 34143..34820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 34839..35282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 sequence16 source 1..34615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4..759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(1022..1861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 2059..3459 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GY66 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene leuC CDS 3542..3769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 3890..4576 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266002.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene cenR CDS 4591..5217 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403296.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 5272..5832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(5833..6633) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene xthA3 CDS 6926..7270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 7270..7407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(7464..7919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918358.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(8056..8787) product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 8908..10854 product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 10851..11750 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(11740..12663) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(12663..13904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(13983..15911) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZS7 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene thrS CDS complement(16050..16379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(16398..16967) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 16927..17730 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene hetN CDS 17727..18200 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530097.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(18197..19627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(19717..22563) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265962.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 22669..22944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 23083..23493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(23490..24947) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(24971..25168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 25258..26220 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918077.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(26230..27162) product GumN protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402916.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(27224..28822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 tRNA 27227..27303 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(28819..29190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(29331..29654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(29667..31466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(31740..31916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(32184..32342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 32538..33467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 sequence17 source 1..24348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1504 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708832.1:aldehyde dehydrogenase locus_tag LOCUS_31800 CDS 1760..2470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 2566..2928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708831.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(2925..4454) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 4688..5248 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_234853.2 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(5269..6207) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(6324..7346) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185221.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(7358..7825) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene zur CDS complement(7925..8200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(8340..8516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(8739..9596) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 9765..11651 product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088252.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 11724..12050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 12155..14104 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140180.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 14282..15265 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene mdh CDS complement(15321..15908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 16028..17638 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(17661..18203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 18382..19281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920491.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(19449..20729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(20782..21786) product putative transcription activator protein HfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27343 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene hfaB CDS complement(21779..22204) product holdfast attachment protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920481.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene hfaA CDS 22517..22762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 22961..23392 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 sequence18 source 1..22640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..1655) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J210 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene guaA CDS complement(1801..2664) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(2674..3324) product FMN-dependent NADH-azoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F3 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene azoR1 CDS 3426..4319 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143747.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(4332..4811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(4908..6215) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919493.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 6460..6699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(6701..7270) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036526.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene rpoE CDS 7501..9255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 9385..9843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(9909..11078) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 11244..11852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 11922..12815 product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083759.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(12817..14289) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7V2 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene guaB CDS 14523..15599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(15622..15933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(16072..18270) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 18473..18979 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(18985..20007) product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 20188..21012 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X45 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene dapF CDS 21064..22344 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921511.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 sequence19 source 1..11474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 390..1982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 2169..3548 product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene rimK CDS 3777..4082 product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAE3 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 4299..4619 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V4 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene rpsJ CDS 4619..5413 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7T8 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene rplC CDS 5413..6354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 6358..6660 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4D6 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene rplW CDS 6672..7502 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D4 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene rplB CDS 7514..7792 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U863 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene rpsS CDS 7795..8187 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C933 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene rplV CDS 8187..8924 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE24 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene rpsC CDS 8928..9341 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene rplP CDS 9360..9560 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD2 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene rpmC CDS 9582..9833 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U4 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene rpsQ CDS 9830..10198 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ0 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene rplN CDS 10198..10515 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene rplX CDS 10508..11068 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene rplE CDS 11086..11391 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U0 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene rpsN sequence20 source 1..7524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1327 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FX68:carboxylic ester hydrolase locus_tag LOCUS_32430 CDS complement(1402..1776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 1881..3473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 3494..3898 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 4089..5198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 5195..6226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(6244..7131) product putative hydrolase, alpha/beta fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704286.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 tRNA complement(7448..7522) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 sequence21 source 1..6695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(114..2234) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5E0 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene fusA CDS complement(2271..2741) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX6 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene rpsG CDS complement(2754..3125) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H416 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene rpsL misc_feature complement(3470..>6695) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9AAU1:DNA-directed RNA polymerase subunit beta' locus_tag LOCUS_32530