>Feature sequence001 1230 58 gene locus_tag LOCUS_00010 1230 58 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8K6 protein_id gnl|my_center|LOCUS_00010 1129 2265 gene locus_tag LOCUS_00020 1129 2265 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919227.1 protein_id gnl|my_center|LOCUS_00020 2262 3320 gene locus_tag LOCUS_00030 2262 3320 CDS product 3-hydroxyisobutyryl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973097.1 protein_id gnl|my_center|LOCUS_00030 3324 4217 gene locus_tag LOCUS_00040 3324 4217 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_00040 4291 4782 gene locus_tag LOCUS_00050 4291 4782 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875359.1 protein_id gnl|my_center|LOCUS_00050 4883 6097 gene locus_tag LOCUS_00060 4883 6097 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J8 protein_id gnl|my_center|LOCUS_00060 6142 6354 gene locus_tag LOCUS_00070 6142 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6790 6365 gene locus_tag LOCUS_00080 6790 6365 CDS product ROS/MUCR transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265704.1 protein_id gnl|my_center|LOCUS_00080 7011 8291 gene locus_tag LOCUS_00090 gene glyA 7011 8291 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_00090 8301 8783 gene locus_tag LOCUS_00100 gene nrdR 8301 8783 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H533 protein_id gnl|my_center|LOCUS_00100 8780 9454 gene locus_tag LOCUS_00110 8780 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9455 10057 gene locus_tag LOCUS_00120 9455 10057 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_00120 10061 11185 gene locus_tag LOCUS_00130 10061 11185 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_00130 11182 11607 gene locus_tag LOCUS_00140 gene ribH1 11182 11607 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZV0 protein_id gnl|my_center|LOCUS_00140 11607 12062 gene locus_tag LOCUS_00150 gene nusB 11607 12062 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J3 protein_id gnl|my_center|LOCUS_00150 12059 13027 gene locus_tag LOCUS_00160 gene thiL 12059 13027 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9B8 protein_id gnl|my_center|LOCUS_00160 13052 13555 gene locus_tag LOCUS_00170 13052 13555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13725 15893 gene locus_tag LOCUS_00180 gene hppA 13725 15893 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J0 protein_id gnl|my_center|LOCUS_00180 16455 15967 gene locus_tag LOCUS_00190 16455 15967 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919242.1 protein_id gnl|my_center|LOCUS_00190 16554 17081 gene locus_tag LOCUS_00200 16554 17081 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532235.1 protein_id gnl|my_center|LOCUS_00200 17188 18249 gene locus_tag LOCUS_00210 gene plsX 17188 18249 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7B8 protein_id gnl|my_center|LOCUS_00210 18246 19208 gene locus_tag LOCUS_00220 gene fabH2 18246 19208 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9J6 protein_id gnl|my_center|LOCUS_00220 19283 19588 gene locus_tag LOCUS_00230 gene ihfA 19283 19588 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 protein_id gnl|my_center|LOCUS_00230 19593 20024 gene locus_tag LOCUS_00240 19593 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 20107 20184 gene locus_tag LOCUS_t00010 20107 20184 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20257 23094 gene locus_tag LOCUS_00250 20257 23094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23579 23070 gene locus_tag LOCUS_00260 23579 23070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24815 23691 gene locus_tag LOCUS_00270 24815 23691 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_00270 26011 24830 gene locus_tag LOCUS_00280 26011 24830 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_00280 26156 27178 gene locus_tag LOCUS_00290 gene ctaA 26156 27178 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H9 protein_id gnl|my_center|LOCUS_00290 28161 27175 gene locus_tag LOCUS_00300 28161 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29564 28176 gene locus_tag LOCUS_00310 29564 28176 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_00310 29780 30244 gene locus_tag LOCUS_00320 gene rplM 29780 30244 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7X8 protein_id gnl|my_center|LOCUS_00320 30249 30746 gene locus_tag LOCUS_00330 gene rpsI 30249 30746 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KE5 protein_id gnl|my_center|LOCUS_00330 31684 30767 gene locus_tag LOCUS_00340 31684 30767 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_00340 31808 32428 gene locus_tag LOCUS_00350 31808 32428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32463 34331 gene locus_tag LOCUS_00360 32463 34331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923241.1 protein_id gnl|my_center|LOCUS_00360 34741 34340 gene locus_tag LOCUS_00370 34741 34340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36678 34750 gene locus_tag LOCUS_00380 36678 34750 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265707.1 protein_id gnl|my_center|LOCUS_00380 36772 37095 gene locus_tag LOCUS_00390 36772 37095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 37118 38071 gene locus_tag LOCUS_00400 37118 38071 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H0 protein_id gnl|my_center|LOCUS_00400 38080 39846 gene locus_tag LOCUS_00410 gene recJ 38080 39846 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919262.1 protein_id gnl|my_center|LOCUS_00410 39913 39987 gene locus_tag LOCUS_t00020 39913 39987 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 40216 40737 gene locus_tag LOCUS_00420 40216 40737 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531329.1 protein_id gnl|my_center|LOCUS_00420 40792 41385 gene locus_tag LOCUS_00430 40792 41385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 41448 41524 gene locus_tag LOCUS_t00030 41448 41524 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41552 41857 gene locus_tag LOCUS_00440 41552 41857 CDS product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_00440 41889 41965 gene locus_tag LOCUS_t00040 41889 41965 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 43043 41970 gene locus_tag LOCUS_00450 43043 41970 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532426.1 protein_id gnl|my_center|LOCUS_00450 43171 44232 gene locus_tag LOCUS_00460 43171 44232 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388759.1 protein_id gnl|my_center|LOCUS_00460 45233 44229 gene locus_tag LOCUS_00470 45233 44229 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919302.1 protein_id gnl|my_center|LOCUS_00470 45362 45979 gene locus_tag LOCUS_00480 45362 45979 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384381.1 protein_id gnl|my_center|LOCUS_00480 45976 46644 gene locus_tag LOCUS_00490 45976 46644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389069.1 protein_id gnl|my_center|LOCUS_00490 46641 48185 gene locus_tag LOCUS_00500 46641 48185 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_00500 49417 48182 gene locus_tag LOCUS_00510 49417 48182 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919303.1 protein_id gnl|my_center|LOCUS_00510 50122 49436 gene locus_tag LOCUS_00520 50122 49436 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_00520 51567 50206 gene locus_tag LOCUS_00530 51567 50206 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_00530 53015 51564 gene locus_tag LOCUS_00540 53015 51564 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_00540 53113 53967 gene locus_tag LOCUS_00550 gene kdsA 53113 53967 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5A9 protein_id gnl|my_center|LOCUS_00550 53997 55460 gene locus_tag LOCUS_00560 gene hldE 53997 55460 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2C5 protein_id gnl|my_center|LOCUS_00560 56674 55457 gene locus_tag LOCUS_00570 56674 55457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_00570 56791 57459 gene locus_tag LOCUS_00580 56791 57459 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708013.1 protein_id gnl|my_center|LOCUS_00580 59543 57456 gene locus_tag LOCUS_00590 59543 57456 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_00590 59608 59880 gene locus_tag LOCUS_00600 59608 59880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 59883 63359 gene locus_tag LOCUS_00610 gene mfd 59883 63359 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F5 protein_id gnl|my_center|LOCUS_00610 64642 63356 gene locus_tag LOCUS_00620 gene popA 64642 63356 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919708.1 protein_id gnl|my_center|LOCUS_00620 64916 65824 gene locus_tag LOCUS_00630 64916 65824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919706.1 protein_id gnl|my_center|LOCUS_00630 65892 66593 gene locus_tag LOCUS_00640 65892 66593 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918095.1 protein_id gnl|my_center|LOCUS_00640 66596 67243 gene locus_tag LOCUS_00650 66596 67243 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_00650 67375 70470 gene locus_tag LOCUS_00660 67375 70470 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_00660 70475 71581 gene locus_tag LOCUS_00670 70475 71581 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_00670 72970 71588 gene locus_tag LOCUS_00680 gene sdaA 72970 71588 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_00680 73241 72975 gene locus_tag LOCUS_00690 73241 72975 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 protein_id gnl|my_center|LOCUS_00690 74054 73293 gene locus_tag LOCUS_00700 74054 73293 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_00700 76128 74059 gene locus_tag LOCUS_00710 76128 74059 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528930.1 protein_id gnl|my_center|LOCUS_00710 77366 76125 gene locus_tag LOCUS_00720 gene kynU 77366 76125 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS87 protein_id gnl|my_center|LOCUS_00720 77997 77368 gene locus_tag LOCUS_00730 gene kynB 77997 77368 CDS product kynurenine formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WP3 protein_id gnl|my_center|LOCUS_00730 78842 77997 gene locus_tag LOCUS_00740 gene kynA 78842 77997 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHX9 protein_id gnl|my_center|LOCUS_00740 80910 78988 gene locus_tag LOCUS_00750 80910 78988 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_00750 81195 83294 gene locus_tag LOCUS_00760 81195 83294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 83514 83427 gene locus_tag LOCUS_t00050 83514 83427 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 83724 84470 gene locus_tag LOCUS_00770 83724 84470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 84553 85686 gene locus_tag LOCUS_00780 84553 85686 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_00780 85686 86318 gene locus_tag LOCUS_00790 gene tmk 85686 86318 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9D5 protein_id gnl|my_center|LOCUS_00790 86308 87318 gene locus_tag LOCUS_00800 86308 87318 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919689.1 protein_id gnl|my_center|LOCUS_00800 87323 88108 gene locus_tag LOCUS_00810 87323 88108 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919688.1 protein_id gnl|my_center|LOCUS_00810 88105 88953 gene locus_tag LOCUS_00820 88105 88953 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919687.1 protein_id gnl|my_center|LOCUS_00820 89077 89832 gene locus_tag LOCUS_00830 89077 89832 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_00830 <90429 89829 gene locus_tag LOCUS_00840 <90429 89829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A7H7:GTPase HflX >Feature sequence002 1512 277 gene locus_tag LOCUS_00850 1512 277 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919738.1 protein_id gnl|my_center|LOCUS_00850 2101 1628 gene locus_tag LOCUS_00860 2101 1628 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975630.1 protein_id gnl|my_center|LOCUS_00860 2201 5674 gene locus_tag LOCUS_00870 2201 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 6926 5676 gene locus_tag LOCUS_00880 gene tyrS 6926 5676 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A756 protein_id gnl|my_center|LOCUS_00880 6995 8101 gene locus_tag LOCUS_00890 gene anmK 6995 8101 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9D2 protein_id gnl|my_center|LOCUS_00890 8775 8098 gene locus_tag LOCUS_00900 8775 8098 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615265.1 protein_id gnl|my_center|LOCUS_00900 8988 9452 gene locus_tag LOCUS_00910 8988 9452 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_00910 9472 10614 gene locus_tag LOCUS_00920 9472 10614 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 protein_id gnl|my_center|LOCUS_00920 10628 12130 gene locus_tag LOCUS_00930 gene sufB 10628 12130 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708081.1 protein_id gnl|my_center|LOCUS_00930 12127 12756 gene locus_tag LOCUS_00940 12127 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 12756 13505 gene locus_tag LOCUS_00950 gene sufC 12756 13505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_00950 13505 14614 gene locus_tag LOCUS_00960 gene sufD 13505 14614 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919727.1 protein_id gnl|my_center|LOCUS_00960 14611 15849 gene locus_tag LOCUS_00970 14611 15849 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAQ0 protein_id gnl|my_center|LOCUS_00970 15850 16266 gene locus_tag LOCUS_00980 15850 16266 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708085.1 protein_id gnl|my_center|LOCUS_00980 16278 16634 gene locus_tag LOCUS_00990 16278 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_00990 16799 17356 gene locus_tag LOCUS_01000 16799 17356 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 protein_id gnl|my_center|LOCUS_01000 18497 17484 gene locus_tag LOCUS_01010 gene dgcB 18497 17484 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919716.1 protein_id gnl|my_center|LOCUS_01010 20073 18643 gene locus_tag LOCUS_01020 gene rhlE 20073 18643 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337555.1 protein_id gnl|my_center|LOCUS_01020 21460 20192 gene locus_tag LOCUS_01030 21460 20192 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_01030 22881 21460 gene locus_tag LOCUS_01040 22881 21460 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919838.1 protein_id gnl|my_center|LOCUS_01040 25039 22952 gene locus_tag LOCUS_01050 gene parE 25039 22952 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9E0 protein_id gnl|my_center|LOCUS_01050 25686 25078 gene locus_tag LOCUS_01060 25686 25078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_01060 28929 25726 gene locus_tag LOCUS_01070 28929 25726 CDS product autotransporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265524.1 protein_id gnl|my_center|LOCUS_01070 30491 29088 gene locus_tag LOCUS_01080 gene glnA 30491 29088 CDS product glutamine synthetase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59747 protein_id gnl|my_center|LOCUS_01080 30883 30545 gene locus_tag LOCUS_01090 gene glnB-1 30883 30545 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_01090 30980 32512 gene locus_tag LOCUS_01100 30980 32512 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU48 protein_id gnl|my_center|LOCUS_01100 32542 34821 gene locus_tag LOCUS_01110 32542 34821 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 protein_id gnl|my_center|LOCUS_01110 35424 35903 gene locus_tag LOCUS_01120 35424 35903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 36342 36569 gene locus_tag LOCUS_01130 36342 36569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 37504 38916 gene locus_tag LOCUS_01140 37504 38916 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_01140 39472 38894 gene locus_tag LOCUS_01150 39472 38894 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_01150 39633 39827 gene locus_tag LOCUS_01160 39633 39827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 39875 40630 gene locus_tag LOCUS_01170 39875 40630 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_01170 40690 40774 gene locus_tag LOCUS_t00060 40690 40774 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41091 42644 gene locus_tag LOCUS_01180 gene tig 41091 42644 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX0 protein_id gnl|my_center|LOCUS_01180 42805 43410 gene locus_tag LOCUS_01190 gene clpP 42805 43410 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX16 protein_id gnl|my_center|LOCUS_01190 43569 44855 gene locus_tag LOCUS_01200 gene clpX 43569 44855 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX14 protein_id gnl|my_center|LOCUS_01200 45017 47419 gene locus_tag LOCUS_01210 gene lon 45017 47419 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW0 protein_id gnl|my_center|LOCUS_01210 47554 48711 gene locus_tag LOCUS_01220 gene pheA 47554 48711 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705019.1 protein_id gnl|my_center|LOCUS_01220 48734 48809 gene locus_tag LOCUS_t00070 48734 48809 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 49501 49914 gene locus_tag LOCUS_01230 49501 49914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 50895 50971 gene locus_tag LOCUS_t00080 50895 50971 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 51120 52265 gene locus_tag LOCUS_01240 51120 52265 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_01240 52392 53897 gene locus_tag LOCUS_01250 52392 53897 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_01250 53908 54777 gene locus_tag LOCUS_01260 53908 54777 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_01260 54869 55534 gene locus_tag LOCUS_01270 54869 55534 CDS product 20-beta-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405006.1 protein_id gnl|my_center|LOCUS_01270 56192 55647 gene locus_tag LOCUS_01280 56192 55647 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930760.1 protein_id gnl|my_center|LOCUS_01280 56536 56189 gene locus_tag LOCUS_01290 56536 56189 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_01290 56675 57244 gene locus_tag LOCUS_01300 56675 57244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 57315 57605 gene locus_tag LOCUS_01310 57315 57605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 58117 58026 gene locus_tag LOCUS_t00090 58117 58026 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 58828 59193 gene locus_tag LOCUS_01320 gene nuoA 58828 59193 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6X0 protein_id gnl|my_center|LOCUS_01320 59197 59763 gene locus_tag LOCUS_01330 gene nuoB 59197 59763 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWV5 protein_id gnl|my_center|LOCUS_01330 59760 60371 gene locus_tag LOCUS_01340 gene nuoC 59760 60371 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6X2 protein_id gnl|my_center|LOCUS_01340 60371 60802 gene locus_tag LOCUS_01350 60371 60802 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971509.1 protein_id gnl|my_center|LOCUS_01350 60799 62016 gene locus_tag LOCUS_01360 gene nuoD 60799 62016 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KI9 protein_id gnl|my_center|LOCUS_01360 62016 62462 gene locus_tag LOCUS_01370 62016 62462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 62459 63133 gene locus_tag LOCUS_01380 gene nuoE 62459 63133 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919816.1 protein_id gnl|my_center|LOCUS_01380 63136 64446 gene locus_tag LOCUS_01390 gene nuoF 63136 64446 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919813.1 protein_id gnl|my_center|LOCUS_01390 64456 66558 gene locus_tag LOCUS_01400 gene nuoG 64456 66558 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S6 protein_id gnl|my_center|LOCUS_01400 66564 67628 gene locus_tag LOCUS_01410 gene nuoH 66564 67628 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C802 protein_id gnl|my_center|LOCUS_01410 67625 68113 gene locus_tag LOCUS_01420 gene nuoI 67625 68113 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA65 protein_id gnl|my_center|LOCUS_01420 68144 68755 gene locus_tag LOCUS_01430 gene nuoJ 68144 68755 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919807.1 protein_id gnl|my_center|LOCUS_01430 68752 69063 gene locus_tag LOCUS_01440 gene nuoK1 68752 69063 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QP2 protein_id gnl|my_center|LOCUS_01440 69069 71207 gene locus_tag LOCUS_01450 gene nuoL 69069 71207 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337553.1 protein_id gnl|my_center|LOCUS_01450 71208 72701 gene locus_tag LOCUS_01460 gene nuoM 71208 72701 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640368.1 protein_id gnl|my_center|LOCUS_01460 >Feature sequence003 3147 394 gene locus_tag LOCUS_01470 gene secA 3147 394 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MI9 protein_id gnl|my_center|LOCUS_01470 3327 4205 gene locus_tag LOCUS_01480 3327 4205 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAX1 protein_id gnl|my_center|LOCUS_01480 4245 4655 gene locus_tag LOCUS_01490 4245 4655 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918718.1 protein_id gnl|my_center|LOCUS_01490 5700 4798 gene locus_tag LOCUS_01500 gene bioC 5700 4798 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_01500 5718 6464 gene locus_tag LOCUS_01510 5718 6464 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_01510 6494 6751 gene locus_tag LOCUS_01520 6494 6751 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 protein_id gnl|my_center|LOCUS_01520 6756 7571 gene locus_tag LOCUS_01530 6756 7571 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918713.1 protein_id gnl|my_center|LOCUS_01530 7619 8044 gene locus_tag LOCUS_01540 7619 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 protein_id gnl|my_center|LOCUS_01540 8805 8041 gene locus_tag LOCUS_01550 gene ubiG 8805 8041 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9X1 protein_id gnl|my_center|LOCUS_01550 8940 10142 gene locus_tag LOCUS_01560 8940 10142 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6R1 protein_id gnl|my_center|LOCUS_01560 10139 12457 gene locus_tag LOCUS_01570 gene ptsP 10139 12457 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 protein_id gnl|my_center|LOCUS_01570 12542 13396 gene locus_tag LOCUS_01580 12542 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 13466 14593 gene locus_tag LOCUS_01590 gene ispG 13466 14593 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U8 protein_id gnl|my_center|LOCUS_01590 14598 14936 gene locus_tag LOCUS_01600 14598 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720551.1 protein_id gnl|my_center|LOCUS_01600 14939 16024 gene locus_tag LOCUS_01610 14939 16024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_01610 17130 16021 gene locus_tag LOCUS_01620 17130 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 17213 17803 gene locus_tag LOCUS_01630 17213 17803 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_01630 17858 18280 gene locus_tag LOCUS_01640 17858 18280 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_01640 18329 19399 gene locus_tag LOCUS_01650 gene prfA 18329 19399 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9V5 protein_id gnl|my_center|LOCUS_01650 19396 20157 gene locus_tag LOCUS_01660 19396 20157 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918757.1 protein_id gnl|my_center|LOCUS_01660 20157 20951 gene locus_tag LOCUS_01670 gene prmC 20157 20951 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9T7 protein_id gnl|my_center|LOCUS_01670 21177 21827 gene locus_tag LOCUS_01680 21177 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 22002 24614 gene locus_tag LOCUS_01690 gene clpB 22002 24614 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAM5 protein_id gnl|my_center|LOCUS_01690 25089 24661 gene locus_tag LOCUS_01700 25089 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 25538 25089 gene locus_tag LOCUS_01710 25538 25089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528909.1 protein_id gnl|my_center|LOCUS_01710 26599 25718 gene locus_tag LOCUS_01720 26599 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 26668 27165 gene locus_tag LOCUS_01730 26668 27165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 28638 27166 gene locus_tag LOCUS_01740 28638 27166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 28832 29506 gene locus_tag LOCUS_01750 28832 29506 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 protein_id gnl|my_center|LOCUS_01750 29587 29958 gene locus_tag LOCUS_01760 29587 29958 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921300.1 protein_id gnl|my_center|LOCUS_01760 29963 30799 gene locus_tag LOCUS_01770 29963 30799 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921301.1 protein_id gnl|my_center|LOCUS_01770 31589 30894 gene locus_tag LOCUS_01780 gene ctrA 31589 30894 CDS product cell cycle transcriptional regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW8 protein_id gnl|my_center|LOCUS_01780 31841 32104 gene locus_tag LOCUS_01790 31841 32104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_01790 32188 33513 gene locus_tag LOCUS_01800 gene fliI 32188 33513 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H363 protein_id gnl|my_center|LOCUS_01800 33510 33926 gene locus_tag LOCUS_01810 33510 33926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 36127 34025 gene locus_tag LOCUS_01820 36127 34025 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096983.1 protein_id gnl|my_center|LOCUS_01820 36341 37288 gene locus_tag LOCUS_01830 36341 37288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636161.2 protein_id gnl|my_center|LOCUS_01830 37799 37344 gene locus_tag LOCUS_01840 37799 37344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 38378 37860 gene locus_tag LOCUS_01850 38378 37860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 38782 38462 gene locus_tag LOCUS_01860 38782 38462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 39589 38792 gene locus_tag LOCUS_01870 39589 38792 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 protein_id gnl|my_center|LOCUS_01870 40593 39586 gene locus_tag LOCUS_01880 40593 39586 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 protein_id gnl|my_center|LOCUS_01880 42708 40597 gene locus_tag LOCUS_01890 gene flhA 42708 40597 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03845 protein_id gnl|my_center|LOCUS_01890 44078 42714 gene locus_tag LOCUS_01900 gene flbD 44078 42714 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918793.1 protein_id gnl|my_center|LOCUS_01900 44496 44116 gene locus_tag LOCUS_01910 gene fliN 44496 44116 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03593 protein_id gnl|my_center|LOCUS_01910 45182 44508 gene locus_tag LOCUS_01920 gene flbE 45182 44508 CDS product protein FlbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918791.1 protein_id gnl|my_center|LOCUS_01920 46226 45195 gene locus_tag LOCUS_01930 gene fliG 46226 45195 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04955 protein_id gnl|my_center|LOCUS_01930 47893 46226 gene locus_tag LOCUS_01940 gene fliF 47893 46226 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ES3 protein_id gnl|my_center|LOCUS_01940 48342 48052 gene locus_tag LOCUS_01950 48342 48052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_01950 49919 48531 gene locus_tag LOCUS_01960 gene flgE 49919 48531 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY3 protein_id gnl|my_center|LOCUS_01960 50681 50016 gene locus_tag LOCUS_01970 50681 50016 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ4 protein_id gnl|my_center|LOCUS_01970 52337 50691 gene locus_tag LOCUS_01980 52337 50691 CDS product flagellar hook-length control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089734.1 protein_id gnl|my_center|LOCUS_01980 52770 54908 gene locus_tag LOCUS_01990 gene flaN 52770 54908 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918784.1 protein_id gnl|my_center|LOCUS_01990 54919 55833 gene locus_tag LOCUS_02000 54919 55833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 55928 56464 gene locus_tag LOCUS_02010 55928 56464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 56547 57734 gene locus_tag LOCUS_02020 gene mnmA 56547 57734 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6U5 protein_id gnl|my_center|LOCUS_02020 58922 57774 gene locus_tag LOCUS_02030 58922 57774 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110064.1 protein_id gnl|my_center|LOCUS_02030 59443 58922 gene locus_tag LOCUS_02040 59443 58922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 59650 60840 gene locus_tag LOCUS_02050 59650 60840 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918779.1 protein_id gnl|my_center|LOCUS_02050 61590 60895 gene locus_tag LOCUS_02060 61590 60895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 protein_id gnl|my_center|LOCUS_02060 61739 63931 gene locus_tag LOCUS_02070 61739 63931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 64131 65360 gene locus_tag LOCUS_02080 gene bkdA1 64131 65360 CDS product 2-oxoisovalerate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M2 protein_id gnl|my_center|LOCUS_02080 65364 66380 gene locus_tag LOCUS_02090 gene bkdA2 65364 66380 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315045.1 protein_id gnl|my_center|LOCUS_02090 66380 67660 gene locus_tag LOCUS_02100 66380 67660 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDC8 protein_id gnl|my_center|LOCUS_02100 67934 68533 gene locus_tag LOCUS_02110 67934 68533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 68940 68500 gene locus_tag LOCUS_02120 68940 68500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 69458 70885 gene locus_tag LOCUS_02130 69458 70885 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW3 protein_id gnl|my_center|LOCUS_02130 70885 71301 gene locus_tag LOCUS_02140 70885 71301 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_02140 71544 72410 gene locus_tag LOCUS_02150 71544 72410 CDS product zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529747.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence004 427 1170 gene locus_tag LOCUS_02160 427 1170 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_02160 1181 1960 gene locus_tag LOCUS_02170 gene coaX 1181 1960 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A7 protein_id gnl|my_center|LOCUS_02170 1960 3630 gene locus_tag LOCUS_02180 1960 3630 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_02180 3642 4058 gene locus_tag LOCUS_02190 3642 4058 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_02190 4055 4420 gene locus_tag LOCUS_02200 4055 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5214 4417 gene locus_tag LOCUS_02210 5214 4417 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703169.1 protein_id gnl|my_center|LOCUS_02210 6188 5268 gene locus_tag LOCUS_02220 gene yetK 6188 5268 CDS product putative transporter YetK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31540 protein_id gnl|my_center|LOCUS_02220 6311 7648 gene locus_tag LOCUS_02230 gene proS 6311 7648 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z5 protein_id gnl|my_center|LOCUS_02230 7641 8948 gene locus_tag LOCUS_02240 7641 8948 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919796.1 protein_id gnl|my_center|LOCUS_02240 8941 9633 gene locus_tag LOCUS_02250 gene lolD2 8941 9633 CDS product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z7 protein_id gnl|my_center|LOCUS_02250 9875 13327 gene locus_tag LOCUS_02260 gene dnaE1 9875 13327 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A700 protein_id gnl|my_center|LOCUS_02260 13509 14396 gene locus_tag LOCUS_02270 gene rpsB 13509 14396 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWS3 protein_id gnl|my_center|LOCUS_02270 14438 15316 gene locus_tag LOCUS_02280 gene tsf 14438 15316 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N5 protein_id gnl|my_center|LOCUS_02280 15376 16140 gene locus_tag LOCUS_02290 gene pyrH 15376 16140 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C997 protein_id gnl|my_center|LOCUS_02290 16156 16716 gene locus_tag LOCUS_02300 gene frr 16156 16716 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBQ5 protein_id gnl|my_center|LOCUS_02300 16741 17469 gene locus_tag LOCUS_02310 gene lpxD 16741 17469 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBQ6 protein_id gnl|my_center|LOCUS_02310 17459 18277 gene locus_tag LOCUS_02320 gene cdsA 17459 18277 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KP8 protein_id gnl|my_center|LOCUS_02320 18274 19452 gene locus_tag LOCUS_02330 gene dxr 18274 19452 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_02330 19470 20645 gene locus_tag LOCUS_02340 19470 20645 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL7 protein_id gnl|my_center|LOCUS_02340 20671 23046 gene locus_tag LOCUS_02350 gene bamA 20671 23046 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9L0 protein_id gnl|my_center|LOCUS_02350 23048 23647 gene locus_tag LOCUS_02360 23048 23647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 23667 24674 gene locus_tag LOCUS_02370 gene lpxD 23667 24674 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A713 protein_id gnl|my_center|LOCUS_02370 24677 25132 gene locus_tag LOCUS_02380 gene fabZ 24677 25132 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR2 protein_id gnl|my_center|LOCUS_02380 25129 25920 gene locus_tag LOCUS_02390 gene lpxA 25129 25920 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR1 protein_id gnl|my_center|LOCUS_02390 25913 26776 gene locus_tag LOCUS_02400 gene lpxI 25913 26776 CDS product UDP-2,3-diacylglucosamine pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_02400 26769 27944 gene locus_tag LOCUS_02410 gene lpxB 26769 27944 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919775.1 protein_id gnl|my_center|LOCUS_02410 29248 27941 gene locus_tag LOCUS_02420 gene cisY 29248 27941 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ53 protein_id gnl|my_center|LOCUS_02420 30708 29275 gene locus_tag LOCUS_02430 gene gltX 30708 29275 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A721 protein_id gnl|my_center|LOCUS_02430 30832 32880 gene locus_tag LOCUS_02440 30832 32880 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_02440 33541 32861 gene locus_tag LOCUS_02450 gene lexA 33541 32861 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9K1 protein_id gnl|my_center|LOCUS_02450 34408 33623 gene locus_tag LOCUS_02460 gene trpC 34408 33623 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 protein_id gnl|my_center|LOCUS_02460 35424 34405 gene locus_tag LOCUS_02470 gene trpD 35424 34405 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_02470 36014 35421 gene locus_tag LOCUS_02480 36014 35421 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_02480 36133 37065 gene locus_tag LOCUS_02490 36133 37065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 38463 37027 gene locus_tag LOCUS_02500 gene trpE 38463 37027 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95646 protein_id gnl|my_center|LOCUS_02500 40370 38460 gene locus_tag LOCUS_02510 40370 38460 CDS product rotamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919760.1 protein_id gnl|my_center|LOCUS_02510 40482 41213 gene locus_tag LOCUS_02520 gene cbbJ 40482 41213 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J536 protein_id gnl|my_center|LOCUS_02520 41258 42268 gene locus_tag LOCUS_02530 41258 42268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 42302 42628 gene locus_tag LOCUS_02540 42302 42628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 42706 44334 gene locus_tag LOCUS_02550 gene pyrG 42706 44334 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBJ6 protein_id gnl|my_center|LOCUS_02550 45778 44339 gene locus_tag LOCUS_02560 45778 44339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 46292 46044 gene locus_tag LOCUS_02570 46292 46044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 46636 46307 gene locus_tag LOCUS_02580 46636 46307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 46789 46971 gene locus_tag LOCUS_02590 gene rpmF 46789 46971 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW65 protein_id gnl|my_center|LOCUS_02590 47076 48350 gene locus_tag LOCUS_02600 gene eno 47076 48350 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBJ9 protein_id gnl|my_center|LOCUS_02600 48671 48946 gene locus_tag LOCUS_02610 48671 48946 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389635.1 protein_id gnl|my_center|LOCUS_02610 49051 50085 gene locus_tag LOCUS_02620 gene pdhA 49051 50085 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9R9N5 protein_id gnl|my_center|LOCUS_02620 50085 50483 gene locus_tag LOCUS_02630 50085 50483 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206942.1 protein_id gnl|my_center|LOCUS_02630 50483 50890 gene locus_tag LOCUS_02640 50483 50890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 50890 52320 gene locus_tag LOCUS_02650 gene pdhB 50890 52320 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087550.1 protein_id gnl|my_center|LOCUS_02650 52320 52718 gene locus_tag LOCUS_02660 52320 52718 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143594.1 protein_id gnl|my_center|LOCUS_02660 52715 53029 gene locus_tag LOCUS_02670 52715 53029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 53031 54383 gene locus_tag LOCUS_02680 53031 54383 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C893 protein_id gnl|my_center|LOCUS_02680 54448 54813 gene locus_tag LOCUS_02690 54448 54813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_02690 55833 54931 gene locus_tag LOCUS_02700 gene dhmA 55833 54931 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3S9 protein_id gnl|my_center|LOCUS_02700 55966 57378 gene locus_tag LOCUS_02710 55966 57378 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KX2 protein_id gnl|my_center|LOCUS_02710 57452 58126 gene locus_tag LOCUS_02720 57452 58126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 58205 58942 gene locus_tag LOCUS_02730 58205 58942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 60702 58939 gene locus_tag LOCUS_02740 60702 58939 CDS product acyl-ACP synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919601.1 protein_id gnl|my_center|LOCUS_02740 60953 61831 gene locus_tag LOCUS_02750 60953 61831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 61880 63139 gene locus_tag LOCUS_02760 61880 63139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 63204 64169 gene locus_tag LOCUS_02770 gene lipA 63204 64169 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW82 protein_id gnl|my_center|LOCUS_02770 >Feature sequence005 929 477 gene locus_tag LOCUS_02780 gene dut 929 477 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_02780 1421 975 gene locus_tag LOCUS_02790 1421 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 2138 1488 gene locus_tag LOCUS_02800 2138 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02800 2704 2135 gene locus_tag LOCUS_02810 2704 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 2785 3195 gene locus_tag LOCUS_02820 2785 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 4760 3192 gene locus_tag LOCUS_02830 4760 3192 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A257 protein_id gnl|my_center|LOCUS_02830 5033 5863 gene locus_tag LOCUS_02840 gene cmaX 5033 5863 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 protein_id gnl|my_center|LOCUS_02840 7090 5873 gene locus_tag LOCUS_02850 7090 5873 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_02850 7436 7095 gene locus_tag LOCUS_02860 7436 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_02860 7790 7440 gene locus_tag LOCUS_02870 7790 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265538.1 protein_id gnl|my_center|LOCUS_02870 8642 7875 gene locus_tag LOCUS_02880 gene ubiE 8642 7875 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A258 protein_id gnl|my_center|LOCUS_02880 8690 9553 gene locus_tag LOCUS_02890 gene mutM 8690 9553 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_02890 9654 10529 gene locus_tag LOCUS_02900 9654 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_02900 10651 11427 gene locus_tag LOCUS_02910 gene fadB1 10651 11427 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52995 protein_id gnl|my_center|LOCUS_02910 11542 11808 gene locus_tag LOCUS_02920 gene rpsT 11542 11808 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY9 protein_id gnl|my_center|LOCUS_02920 12173 13591 gene locus_tag LOCUS_02930 gene dnaA 12173 13591 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAU4 protein_id gnl|my_center|LOCUS_02930 13743 14861 gene locus_tag LOCUS_02940 gene dnaN 13743 14861 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP6 protein_id gnl|my_center|LOCUS_02940 14888 16030 gene locus_tag LOCUS_02950 gene recF 14888 16030 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBZ9 protein_id gnl|my_center|LOCUS_02950 16020 16637 gene locus_tag LOCUS_02960 16020 16637 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433130.1 protein_id gnl|my_center|LOCUS_02960 16783 19200 gene locus_tag LOCUS_02970 gene gyrB 16783 19200 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXQ0 protein_id gnl|my_center|LOCUS_02970 19300 19728 gene locus_tag LOCUS_02980 19300 19728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 19829 20530 gene locus_tag LOCUS_02990 19829 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 20543 20998 gene locus_tag LOCUS_03000 20543 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 21534 20995 gene locus_tag LOCUS_03010 21534 20995 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE05 protein_id gnl|my_center|LOCUS_03010 21718 22470 gene locus_tag LOCUS_03020 21718 22470 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923334.1 protein_id gnl|my_center|LOCUS_03020 22861 22541 gene locus_tag LOCUS_03030 22861 22541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921491.1 protein_id gnl|my_center|LOCUS_03030 23196 23927 gene locus_tag LOCUS_03040 23196 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 23924 24676 gene locus_tag LOCUS_03050 23924 24676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_03050 24673 26511 gene locus_tag LOCUS_03060 24673 26511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 26508 27536 gene locus_tag LOCUS_03070 26508 27536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 27533 27916 gene locus_tag LOCUS_03080 27533 27916 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937587.1 protein_id gnl|my_center|LOCUS_03080 28654 27926 gene locus_tag LOCUS_03090 28654 27926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265989.1 protein_id gnl|my_center|LOCUS_03090 31537 28859 gene locus_tag LOCUS_03100 31537 28859 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIT7 protein_id gnl|my_center|LOCUS_03100 31691 32311 gene locus_tag LOCUS_03110 gene ccmA 31691 32311 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30963 protein_id gnl|my_center|LOCUS_03110 32308 32973 gene locus_tag LOCUS_03120 32308 32973 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE4 protein_id gnl|my_center|LOCUS_03120 33014 33853 gene locus_tag LOCUS_03130 33014 33853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085836.1 protein_id gnl|my_center|LOCUS_03130 33911 34639 gene locus_tag LOCUS_03140 33911 34639 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_03140 34636 34794 gene locus_tag LOCUS_03150 34636 34794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 34791 35312 gene locus_tag LOCUS_03160 gene cycY 34791 35312 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384161.1 protein_id gnl|my_center|LOCUS_03160 35872 35318 gene locus_tag LOCUS_03170 35872 35318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 36632 35964 gene locus_tag LOCUS_03180 36632 35964 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIU7 protein_id gnl|my_center|LOCUS_03180 37499 36654 gene locus_tag LOCUS_03190 37499 36654 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728494.1 protein_id gnl|my_center|LOCUS_03190 38446 37496 gene locus_tag LOCUS_03200 gene ftsY 38446 37496 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A287 protein_id gnl|my_center|LOCUS_03200 39750 38443 gene locus_tag LOCUS_03210 39750 38443 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 protein_id gnl|my_center|LOCUS_03210 40602 39799 gene locus_tag LOCUS_03220 gene dapF 40602 39799 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVW2 protein_id gnl|my_center|LOCUS_03220 40688 42910 gene locus_tag LOCUS_03230 40688 42910 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 protein_id gnl|my_center|LOCUS_03230 43851 42958 gene locus_tag LOCUS_03240 43851 42958 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 protein_id gnl|my_center|LOCUS_03240 43984 44535 gene locus_tag LOCUS_03250 gene ahpC 43984 44535 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084586.1 protein_id gnl|my_center|LOCUS_03250 44620 45153 gene locus_tag LOCUS_03260 gene ahpD 44620 45153 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKI6 protein_id gnl|my_center|LOCUS_03260 45332 45640 gene locus_tag LOCUS_03270 45332 45640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 45701 46978 gene locus_tag LOCUS_03280 45701 46978 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_03280 46983 47609 gene locus_tag LOCUS_03290 46983 47609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 48039 48398 gene locus_tag LOCUS_03300 48039 48398 CDS product zinc-finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720584.1 protein_id gnl|my_center|LOCUS_03300 48635 48940 gene locus_tag LOCUS_03310 48635 48940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 49923 48937 gene locus_tag LOCUS_03320 49923 48937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 51350 49926 gene locus_tag LOCUS_03330 51350 49926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933534.1 protein_id gnl|my_center|LOCUS_03330 51574 53118 gene locus_tag LOCUS_03340 gene srp 51574 53118 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCF4 protein_id gnl|my_center|LOCUS_03340 53160 53741 gene locus_tag LOCUS_03350 53160 53741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 53868 54419 gene locus_tag LOCUS_03360 gene rimM 53868 54419 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X39 protein_id gnl|my_center|LOCUS_03360 54466 55176 gene locus_tag LOCUS_03370 gene trmD 54466 55176 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABM9 protein_id gnl|my_center|LOCUS_03370 55173 55571 gene locus_tag LOCUS_03380 gene rplS 55173 55571 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAF7 protein_id gnl|my_center|LOCUS_03380 56046 55699 gene locus_tag LOCUS_03390 gene yfgD 56046 55699 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H8 protein_id gnl|my_center|LOCUS_03390 56887 56036 gene locus_tag LOCUS_03400 gene mcl2 56887 56036 CDS product (3S)-malyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3JV05 protein_id gnl|my_center|LOCUS_03400 56911 58461 gene locus_tag LOCUS_03410 56911 58461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 58493 59626 gene locus_tag LOCUS_03420 58493 59626 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_03420 60226 59636 gene locus_tag LOCUS_03430 60226 59636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 61272 60310 gene locus_tag LOCUS_03440 gene ephA 61272 60310 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085665.1 protein_id gnl|my_center|LOCUS_03440 <61854 61269 gene locus_tag LOCUS_03450 <61854 61269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918143.1:permease >Feature sequence006 633 466 gene locus_tag LOCUS_03460 gene rpmG 633 466 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4S1 protein_id gnl|my_center|LOCUS_03460 1795 719 gene locus_tag LOCUS_03470 1795 719 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531920.1 protein_id gnl|my_center|LOCUS_03470 2575 1907 gene locus_tag LOCUS_03480 2575 1907 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920315.1 protein_id gnl|my_center|LOCUS_03480 4833 2572 gene locus_tag LOCUS_03490 gene rnr 4833 2572 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J4 protein_id gnl|my_center|LOCUS_03490 7403 4830 gene locus_tag LOCUS_03500 gene topA 7403 4830 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA12 protein_id gnl|my_center|LOCUS_03500 7559 7741 gene locus_tag LOCUS_03510 7559 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 8853 7732 gene locus_tag LOCUS_03520 gene dprA 8853 7732 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920305.1 protein_id gnl|my_center|LOCUS_03520 9455 8850 gene locus_tag LOCUS_03530 gene plsY 9455 8850 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K1 protein_id gnl|my_center|LOCUS_03530 10737 9460 gene locus_tag LOCUS_03540 gene pyrC 10737 9460 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K3 protein_id gnl|my_center|LOCUS_03540 11702 10734 gene locus_tag LOCUS_03550 gene pyrB 11702 10734 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAX5 protein_id gnl|my_center|LOCUS_03550 11788 12294 gene locus_tag LOCUS_03560 11788 12294 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 protein_id gnl|my_center|LOCUS_03560 12295 13203 gene locus_tag LOCUS_03570 12295 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 14126 13200 gene locus_tag LOCUS_03580 14126 13200 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_03580 14566 14123 gene locus_tag LOCUS_03590 14566 14123 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K8 protein_id gnl|my_center|LOCUS_03590 14677 14964 gene locus_tag LOCUS_03600 gene gatC 14677 14964 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J460 protein_id gnl|my_center|LOCUS_03600 14964 15443 gene locus_tag LOCUS_03610 14964 15443 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707827.1 protein_id gnl|my_center|LOCUS_03610 15440 16915 gene locus_tag LOCUS_03620 gene gatA 15440 16915 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZJ5 protein_id gnl|my_center|LOCUS_03620 16912 17157 gene locus_tag LOCUS_03630 16912 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 17154 18647 gene locus_tag LOCUS_03640 gene gatB 17154 18647 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L1 protein_id gnl|my_center|LOCUS_03640 18702 18845 gene locus_tag LOCUS_03650 18702 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 18917 19330 gene locus_tag LOCUS_03660 18917 19330 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918964.1 protein_id gnl|my_center|LOCUS_03660 19445 19981 gene locus_tag LOCUS_03670 19445 19981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918963.1 protein_id gnl|my_center|LOCUS_03670 21190 20246 gene locus_tag LOCUS_03680 21190 20246 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 protein_id gnl|my_center|LOCUS_03680 21560 21844 gene locus_tag LOCUS_03690 21560 21844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 22646 21855 gene locus_tag LOCUS_03700 22646 21855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920290.1 protein_id gnl|my_center|LOCUS_03700 22841 24268 gene locus_tag LOCUS_03710 22841 24268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 24316 24954 gene locus_tag LOCUS_03720 gene hfsB 24316 24954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920288.1 protein_id gnl|my_center|LOCUS_03720 25017 26219 gene locus_tag LOCUS_03730 gene hfsI 25017 26219 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 protein_id gnl|my_center|LOCUS_03730 26962 26195 gene locus_tag LOCUS_03740 gene hfsH 26962 26195 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920286.1 protein_id gnl|my_center|LOCUS_03740 27894 26959 gene locus_tag LOCUS_03750 gene hfsG 27894 26959 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920285.1 protein_id gnl|my_center|LOCUS_03750 29384 27891 gene locus_tag LOCUS_03760 gene hfsF 29384 27891 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920284.1 protein_id gnl|my_center|LOCUS_03760 29485 30576 gene locus_tag LOCUS_03770 29485 30576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920139.1 protein_id gnl|my_center|LOCUS_03770 30570 31688 gene locus_tag LOCUS_03780 30570 31688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 33190 31685 gene locus_tag LOCUS_03790 gene hfsE 33190 31685 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920283.1 protein_id gnl|my_center|LOCUS_03790 33488 34303 gene locus_tag LOCUS_03800 33488 34303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 35850 34300 gene locus_tag LOCUS_03810 35850 34300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 36378 35929 gene locus_tag LOCUS_03820 gene msrB1 36378 35929 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W178 protein_id gnl|my_center|LOCUS_03820 39609 36487 gene locus_tag LOCUS_03830 39609 36487 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_03830 40727 39606 gene locus_tag LOCUS_03840 40727 39606 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640175.1 protein_id gnl|my_center|LOCUS_03840 41911 40847 gene locus_tag LOCUS_03850 41911 40847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_03850 42755 43462 gene locus_tag LOCUS_03860 42755 43462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 43359 44936 gene locus_tag LOCUS_03870 43359 44936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970471.1 protein_id gnl|my_center|LOCUS_03870 44933 48181 gene locus_tag LOCUS_03880 gene dnaE2 44933 48181 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H427 protein_id gnl|my_center|LOCUS_03880 49523 48471 gene locus_tag LOCUS_03890 49523 48471 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704178.1 protein_id gnl|my_center|LOCUS_03890 49876 49520 gene locus_tag LOCUS_03900 49876 49520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 50917 49889 gene locus_tag LOCUS_03910 50917 49889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 54048 50914 gene locus_tag LOCUS_03920 54048 50914 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_03920 55674 54061 gene locus_tag LOCUS_03930 55674 54061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 56921 55674 gene locus_tag LOCUS_03940 gene czcC 56921 55674 CDS product cobalt-zinc-cadmium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205515.1 protein_id gnl|my_center|LOCUS_03940 57895 56924 gene locus_tag LOCUS_03950 57895 56924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 58296 57892 gene locus_tag LOCUS_03960 58296 57892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 60184 58856 gene locus_tag LOCUS_03970 60184 58856 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence007 <1 775 gene locus_tag LOCUS_03980 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707859.1:branched chain amino acid aminotransferase 779 1231 gene locus_tag LOCUS_03990 gene nodN 779 1231 CDS product nodulation protein NodN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 protein_id gnl|my_center|LOCUS_03990 1850 1395 gene locus_tag LOCUS_04000 1850 1395 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_04000 2910 1858 gene locus_tag LOCUS_04010 2910 1858 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920390.1 protein_id gnl|my_center|LOCUS_04010 3056 3706 gene locus_tag LOCUS_04020 3056 3706 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_04020 3711 4364 gene locus_tag LOCUS_04030 gene maiA 3711 4364 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57109 protein_id gnl|my_center|LOCUS_04030 5596 4361 gene locus_tag LOCUS_04040 5596 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918600.1 protein_id gnl|my_center|LOCUS_04040 5741 5956 gene locus_tag LOCUS_04050 5741 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 6066 7976 gene locus_tag LOCUS_04060 6066 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 8627 7989 gene locus_tag LOCUS_04070 8627 7989 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708215.1 protein_id gnl|my_center|LOCUS_04070 9580 8624 gene locus_tag LOCUS_04080 9580 8624 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920179.1 protein_id gnl|my_center|LOCUS_04080 10357 9584 gene locus_tag LOCUS_04090 10357 9584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920178.1 protein_id gnl|my_center|LOCUS_04090 11496 10354 gene locus_tag LOCUS_04100 11496 10354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920177.1 protein_id gnl|my_center|LOCUS_04100 12695 11541 gene locus_tag LOCUS_04110 12695 11541 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919355.1 protein_id gnl|my_center|LOCUS_04110 12648 12797 gene locus_tag LOCUS_04120 12648 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 12801 14108 gene locus_tag LOCUS_04130 12801 14108 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_04130 14102 14818 gene locus_tag LOCUS_04140 14102 14818 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_04140 14815 15900 gene locus_tag LOCUS_04150 14815 15900 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_04150 16468 15860 gene locus_tag LOCUS_04160 16468 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028272.1 protein_id gnl|my_center|LOCUS_04160 17096 16476 gene locus_tag LOCUS_04170 17096 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 17230 18198 gene locus_tag LOCUS_04180 17230 18198 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA3 protein_id gnl|my_center|LOCUS_04180 19550 18195 gene locus_tag LOCUS_04190 19550 18195 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4E6 protein_id gnl|my_center|LOCUS_04190 20788 19643 gene locus_tag LOCUS_04200 gene rodA 20788 19643 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_04200 22647 20788 gene locus_tag LOCUS_04210 gene pbpA 22647 20788 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 protein_id gnl|my_center|LOCUS_04210 23155 22652 gene locus_tag LOCUS_04220 23155 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 24126 23164 gene locus_tag LOCUS_04230 24126 23164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 25197 24157 gene locus_tag LOCUS_04240 gene mreB 25197 24157 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919417.1 protein_id gnl|my_center|LOCUS_04240 26020 25304 gene locus_tag LOCUS_04250 26020 25304 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919412.1 protein_id gnl|my_center|LOCUS_04250 26590 26075 gene locus_tag LOCUS_04260 26590 26075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 27117 26662 gene locus_tag LOCUS_04270 27117 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 28081 27146 gene locus_tag LOCUS_04280 gene miaA 28081 27146 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6J5 protein_id gnl|my_center|LOCUS_04280 29463 28078 gene locus_tag LOCUS_04290 29463 28078 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089246.1 protein_id gnl|my_center|LOCUS_04290 29761 29561 gene locus_tag LOCUS_04300 29761 29561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 30661 29771 gene locus_tag LOCUS_04310 30661 29771 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_04310 31815 30661 gene locus_tag LOCUS_04320 31815 30661 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_04320 32420 31911 gene locus_tag LOCUS_04330 32420 31911 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9U0 protein_id gnl|my_center|LOCUS_04330 32857 32408 gene locus_tag LOCUS_04340 32857 32408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 33708 32854 gene locus_tag LOCUS_04350 gene thyA 33708 32854 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_04350 33863 34258 gene locus_tag LOCUS_04360 33863 34258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 35682 34171 gene locus_tag LOCUS_04370 gene ccrB 35682 34171 CDS product serine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_04370 36477 35797 gene locus_tag LOCUS_04380 36477 35797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 36888 36562 gene locus_tag LOCUS_04390 36888 36562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 37203 40235 gene locus_tag LOCUS_04400 37203 40235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 40892 40335 gene locus_tag LOCUS_04410 40892 40335 CDS product DNA recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824704.1 protein_id gnl|my_center|LOCUS_04410 41252 42091 gene locus_tag LOCUS_04420 41252 42091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 42742 43914 gene locus_tag LOCUS_04430 42742 43914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 43914 45254 gene locus_tag LOCUS_04440 gene gpuP 43914 45254 CDS product 3-guanidinopropionate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 protein_id gnl|my_center|LOCUS_04440 48164 45378 gene locus_tag LOCUS_04450 48164 45378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 48656 48249 gene locus_tag LOCUS_04460 48656 48249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 49933 48710 gene locus_tag LOCUS_04470 49933 48710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 50268 51998 gene locus_tag LOCUS_04480 50268 51998 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533280.1 protein_id gnl|my_center|LOCUS_04480 52447 52106 gene locus_tag LOCUS_04490 52447 52106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_04490 54137 52704 gene locus_tag LOCUS_04500 54137 52704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 54248 54475 gene locus_tag LOCUS_04510 54248 54475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence008 1030 353 gene locus_tag LOCUS_04520 1030 353 CDS product alkylated DNA repair dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 protein_id gnl|my_center|LOCUS_04520 1242 3164 gene locus_tag LOCUS_04530 gene dnaK 1242 3164 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TER2 protein_id gnl|my_center|LOCUS_04530 3230 4405 gene locus_tag LOCUS_04540 gene dnaJ 3230 4405 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T07 protein_id gnl|my_center|LOCUS_04540 5315 4671 gene locus_tag LOCUS_04550 5315 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 5801 6613 gene locus_tag LOCUS_04560 gene dapB 5801 6613 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L1 protein_id gnl|my_center|LOCUS_04560 6665 7279 gene locus_tag LOCUS_04570 6665 7279 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 protein_id gnl|my_center|LOCUS_04570 7744 7280 gene locus_tag LOCUS_04580 7744 7280 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_04580 8307 7744 gene locus_tag LOCUS_04590 8307 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 9174 8317 gene locus_tag LOCUS_04600 9174 8317 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921556.1 protein_id gnl|my_center|LOCUS_04600 9742 9200 gene locus_tag LOCUS_04610 9742 9200 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968398.1 protein_id gnl|my_center|LOCUS_04610 9813 10430 gene locus_tag LOCUS_04620 9813 10430 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919879.1 protein_id gnl|my_center|LOCUS_04620 10469 11131 gene locus_tag LOCUS_04630 gene nth 10469 11131 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WJ8 protein_id gnl|my_center|LOCUS_04630 11595 11128 gene locus_tag LOCUS_04640 11595 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12516 11647 gene locus_tag LOCUS_04650 12516 11647 CDS product ATP-grasp domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265999.1 protein_id gnl|my_center|LOCUS_04650 12663 13667 gene locus_tag LOCUS_04660 12663 13667 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266000.1 protein_id gnl|my_center|LOCUS_04660 13898 15997 gene locus_tag LOCUS_04670 13898 15997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 16062 16622 gene locus_tag LOCUS_04680 gene hslV 16062 16622 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM9 protein_id gnl|my_center|LOCUS_04680 17054 16623 gene locus_tag LOCUS_04690 17054 16623 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_04690 17140 18444 gene locus_tag LOCUS_04700 gene hslU 17140 18444 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ87 protein_id gnl|my_center|LOCUS_04700 18983 18441 gene locus_tag LOCUS_04710 18983 18441 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 protein_id gnl|my_center|LOCUS_04710 20074 18980 gene locus_tag LOCUS_04720 20074 18980 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_04720 20765 20163 gene locus_tag LOCUS_04730 20765 20163 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_04730 20937 21455 gene locus_tag LOCUS_04740 gene secB 20937 21455 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TE7 protein_id gnl|my_center|LOCUS_04740 22157 21465 gene locus_tag LOCUS_04750 gene dnaQ 22157 21465 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917896.1 protein_id gnl|my_center|LOCUS_04750 22775 22161 gene locus_tag LOCUS_04760 gene coaE 22775 22161 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58100 protein_id gnl|my_center|LOCUS_04760 23602 22772 gene locus_tag LOCUS_04770 gene aroE 23602 22772 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWW0 protein_id gnl|my_center|LOCUS_04770 24186 23599 gene locus_tag LOCUS_04780 24186 23599 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Q9 protein_id gnl|my_center|LOCUS_04780 25019 24183 gene locus_tag LOCUS_04790 25019 24183 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 protein_id gnl|my_center|LOCUS_04790 25473 26495 gene locus_tag LOCUS_04800 gene hemE 25473 26495 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX3 protein_id gnl|my_center|LOCUS_04800 26498 27535 gene locus_tag LOCUS_04810 gene hemH 26498 27535 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57777 protein_id gnl|my_center|LOCUS_04810 27528 27992 gene locus_tag LOCUS_04820 27528 27992 CDS product UPF0093 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53229 protein_id gnl|my_center|LOCUS_04820 28200 29582 gene locus_tag LOCUS_04830 gene rho 28200 29582 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG88 protein_id gnl|my_center|LOCUS_04830 29590 30216 gene locus_tag LOCUS_04840 29590 30216 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_04840 31049 30213 gene locus_tag LOCUS_04850 31049 30213 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_04850 31760 31062 gene locus_tag LOCUS_04860 31760 31062 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_04860 31844 32080 gene locus_tag LOCUS_04870 31844 32080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921584.1 protein_id gnl|my_center|LOCUS_04870 32086 33411 gene locus_tag LOCUS_04880 gene mnmE 32086 33411 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX2 protein_id gnl|my_center|LOCUS_04880 33500 35362 gene locus_tag LOCUS_04890 gene mnmG 33500 35362 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW33 protein_id gnl|my_center|LOCUS_04890 35289 35191 gene locus_tag LOCUS_t00100 35289 35191 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 35364 36014 gene locus_tag LOCUS_04900 gene gidB 35364 36014 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y688 protein_id gnl|my_center|LOCUS_04900 36007 36849 gene locus_tag LOCUS_04910 gene parA 36007 36849 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083458.1 protein_id gnl|my_center|LOCUS_04910 36846 37718 gene locus_tag LOCUS_04920 gene parB 36846 37718 CDS product chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV8 protein_id gnl|my_center|LOCUS_04920 38090 37719 gene locus_tag LOCUS_04930 38090 37719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 39104 38148 gene locus_tag LOCUS_04940 39104 38148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 protein_id gnl|my_center|LOCUS_04940 39183 39371 gene locus_tag LOCUS_04950 39183 39371 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721359.1 protein_id gnl|my_center|LOCUS_04950 39381 40862 gene locus_tag LOCUS_04960 39381 40862 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_04960 40932 43709 gene locus_tag LOCUS_04970 40932 43709 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265962.1 protein_id gnl|my_center|LOCUS_04970 44235 43801 gene locus_tag LOCUS_04980 44235 43801 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706462.1 protein_id gnl|my_center|LOCUS_04980 45038 44283 gene locus_tag LOCUS_04990 45038 44283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 45189 45605 gene locus_tag LOCUS_05000 45189 45605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083733.1 protein_id gnl|my_center|LOCUS_05000 45927 45619 gene locus_tag LOCUS_05010 45927 45619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 46498 46001 gene locus_tag LOCUS_05020 46498 46001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 47356 46559 gene locus_tag LOCUS_05030 47356 46559 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_05030 47495 48985 gene locus_tag LOCUS_05040 47495 48985 CDS product flavin-binding family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088683.1 protein_id gnl|my_center|LOCUS_05040 48991 49818 gene locus_tag LOCUS_05050 48991 49818 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090078.1 protein_id gnl|my_center|LOCUS_05050 50984 49815 gene locus_tag LOCUS_05060 50984 49815 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902843.1 protein_id gnl|my_center|LOCUS_05060 52303 51002 gene locus_tag LOCUS_05070 52303 51002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 52456 52746 gene locus_tag LOCUS_05080 52456 52746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence009 1980 1267 gene locus_tag LOCUS_05090 1980 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 2372 1983 gene locus_tag LOCUS_05100 2372 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3481 2369 gene locus_tag LOCUS_05110 gene fliM 3481 2369 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXB5 protein_id gnl|my_center|LOCUS_05110 4038 3490 gene locus_tag LOCUS_05120 4038 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4218 5039 gene locus_tag LOCUS_05130 gene flgF 4218 5039 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06171 protein_id gnl|my_center|LOCUS_05130 5053 5838 gene locus_tag LOCUS_05140 gene flgG 5053 5838 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06172 protein_id gnl|my_center|LOCUS_05140 5849 6784 gene locus_tag LOCUS_05150 gene flgA 5849 6784 CDS product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 protein_id gnl|my_center|LOCUS_05150 6912 7787 gene locus_tag LOCUS_05160 gene flgH 6912 7787 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF3 protein_id gnl|my_center|LOCUS_05160 8618 8256 gene locus_tag LOCUS_05170 8618 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707140.1 protein_id gnl|my_center|LOCUS_05170 11389 10946 gene locus_tag LOCUS_05180 gene dksA 11389 10946 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC05 protein_id gnl|my_center|LOCUS_05180 11944 11534 gene locus_tag LOCUS_05190 gene fliX 11944 11534 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920437.1 protein_id gnl|my_center|LOCUS_05190 12184 13299 gene locus_tag LOCUS_05200 gene flgI1 12184 13299 CDS product flagellar P-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I01 protein_id gnl|my_center|LOCUS_05200 13302 13631 gene locus_tag LOCUS_05210 13302 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 protein_id gnl|my_center|LOCUS_05210 13628 14065 gene locus_tag LOCUS_05220 13628 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 14156 14935 gene locus_tag LOCUS_05230 14156 14935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 17869 15119 gene locus_tag LOCUS_05240 gene flaEY 17869 15119 CDS product regulatory protein FlaEY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15345 protein_id gnl|my_center|LOCUS_05240 18083 18817 gene locus_tag LOCUS_05250 18083 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 18814 19347 gene locus_tag LOCUS_05260 18814 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390639.1 protein_id gnl|my_center|LOCUS_05260 19599 19396 gene locus_tag LOCUS_05270 19599 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 19842 19648 gene locus_tag LOCUS_05280 19842 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 20251 20063 gene locus_tag LOCUS_05290 20251 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 21106 20327 gene locus_tag LOCUS_05300 gene spsF 21106 20327 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937657.1 protein_id gnl|my_center|LOCUS_05300 21210 22295 gene locus_tag LOCUS_05310 gene pseB 21210 22295 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8W4 protein_id gnl|my_center|LOCUS_05310 22298 23104 gene locus_tag LOCUS_05320 22298 23104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 23091 24305 gene locus_tag LOCUS_05330 23091 24305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 25033 24410 gene locus_tag LOCUS_05340 25033 24410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 25722 25030 gene locus_tag LOCUS_05350 25722 25030 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707835.1 protein_id gnl|my_center|LOCUS_05350 26447 25722 gene locus_tag LOCUS_05360 26447 25722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLW5 protein_id gnl|my_center|LOCUS_05360 27334 26444 gene locus_tag LOCUS_05370 27334 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLW7 protein_id gnl|my_center|LOCUS_05370 28025 27327 gene locus_tag LOCUS_05380 28025 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_05380 29091 28018 gene locus_tag LOCUS_05390 gene nueB 29091 28018 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707837.1 protein_id gnl|my_center|LOCUS_05390 30131 29142 gene locus_tag LOCUS_05400 30131 29142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 31294 30128 gene locus_tag LOCUS_05410 31294 30128 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639919.1 protein_id gnl|my_center|LOCUS_05410 32217 31381 gene locus_tag LOCUS_05420 gene fljJ 32217 31381 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 protein_id gnl|my_center|LOCUS_05420 32789 32430 gene locus_tag LOCUS_05430 32789 32430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 33732 32908 gene locus_tag LOCUS_05440 gene fljK 33732 32908 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7K6 protein_id gnl|my_center|LOCUS_05440 34658 33834 gene locus_tag LOCUS_05450 gene fljN 34658 33834 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4Q0 protein_id gnl|my_center|LOCUS_05450 35585 34761 gene locus_tag LOCUS_05460 gene fljN 35585 34761 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4Q0 protein_id gnl|my_center|LOCUS_05460 36733 35900 gene locus_tag LOCUS_05470 gene fljL 36733 35900 CDS product flagellin FljL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18914 protein_id gnl|my_center|LOCUS_05470 37408 36980 gene locus_tag LOCUS_05480 37408 36980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389554.1 protein_id gnl|my_center|LOCUS_05480 37676 37413 gene locus_tag LOCUS_05490 37676 37413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 37904 38206 gene locus_tag LOCUS_05500 37904 38206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 38594 38214 gene locus_tag LOCUS_05510 gene flaF 38594 38214 CDS product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 protein_id gnl|my_center|LOCUS_05510 38980 38594 gene locus_tag LOCUS_05520 gene flbT 38980 38594 CDS product flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21297 protein_id gnl|my_center|LOCUS_05520 39795 39061 gene locus_tag LOCUS_05530 39795 39061 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_05530 39899 41698 gene locus_tag LOCUS_05540 gene flbA 39899 41698 CDS product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919333.1 protein_id gnl|my_center|LOCUS_05540 42356 41793 gene locus_tag LOCUS_05550 42356 41793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 42633 43517 gene locus_tag LOCUS_05560 42633 43517 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_05560 43870 43514 gene locus_tag LOCUS_05570 43870 43514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 44883 43969 gene locus_tag LOCUS_05580 gene oxyR 44883 43969 CDS product hyaluronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036667.1 protein_id gnl|my_center|LOCUS_05580 45006 45236 gene locus_tag LOCUS_05590 45006 45236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 45479 46111 gene locus_tag LOCUS_05600 45479 46111 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969125.1 protein_id gnl|my_center|LOCUS_05600 46791 46108 gene locus_tag LOCUS_05610 46791 46108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 46949 48124 gene locus_tag LOCUS_05620 46949 48124 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529103.1 protein_id gnl|my_center|LOCUS_05620 48907 48287 gene locus_tag LOCUS_05630 48907 48287 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919008.1 protein_id gnl|my_center|LOCUS_05630 49034 49342 gene locus_tag LOCUS_05640 49034 49342 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919000.1 protein_id gnl|my_center|LOCUS_05640 49653 49339 gene locus_tag LOCUS_05650 gene shpA 49653 49339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918998.1 protein_id gnl|my_center|LOCUS_05650 49809 49884 gene locus_tag LOCUS_t00110 49809 49884 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 50176 51198 gene locus_tag LOCUS_05660 50176 51198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 51195 51647 gene locus_tag LOCUS_05670 51195 51647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 51699 52226 gene locus_tag LOCUS_05680 gene ppa 51699 52226 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC37 protein_id gnl|my_center|LOCUS_05680 >Feature sequence010 1179 1442 gene locus_tag LOCUS_05690 gene fliQ 1179 1442 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45974 protein_id gnl|my_center|LOCUS_05690 1439 2191 gene locus_tag LOCUS_05700 gene fliR 1439 2191 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45975 protein_id gnl|my_center|LOCUS_05700 2195 3283 gene locus_tag LOCUS_05710 gene flhB 2195 3283 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_05710 3291 5852 gene locus_tag LOCUS_05720 3291 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 5947 7035 gene locus_tag LOCUS_05730 gene recA 5947 7035 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD93 protein_id gnl|my_center|LOCUS_05730 7146 9803 gene locus_tag LOCUS_05740 gene alaS 7146 9803 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5C1 protein_id gnl|my_center|LOCUS_05740 9800 10138 gene locus_tag LOCUS_05750 9800 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 10175 11911 gene locus_tag LOCUS_05760 10175 11911 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_05760 12024 12365 gene locus_tag LOCUS_05770 12024 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 12362 12562 gene locus_tag LOCUS_05780 12362 12562 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261880.1 protein_id gnl|my_center|LOCUS_05780 12559 13596 gene locus_tag LOCUS_05790 12559 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 14873 13656 gene locus_tag LOCUS_05800 14873 13656 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI4 protein_id gnl|my_center|LOCUS_05800 14979 15716 gene locus_tag LOCUS_05810 14979 15716 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640515.1 protein_id gnl|my_center|LOCUS_05810 16193 15720 gene locus_tag LOCUS_05820 16193 15720 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975288.1 protein_id gnl|my_center|LOCUS_05820 17485 16190 gene locus_tag LOCUS_05830 17485 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920737.1 protein_id gnl|my_center|LOCUS_05830 17697 18314 gene locus_tag LOCUS_05840 gene rpsD 17697 18314 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H053 protein_id gnl|my_center|LOCUS_05840 18611 18997 gene locus_tag LOCUS_05850 18611 18997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 19336 19004 gene locus_tag LOCUS_05860 gene grlA 19336 19004 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CYD6 protein_id gnl|my_center|LOCUS_05860 20232 19366 gene locus_tag LOCUS_05870 20232 19366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 20453 20229 gene locus_tag LOCUS_05880 20453 20229 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_05880 20533 21552 gene locus_tag LOCUS_05890 20533 21552 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_05890 23765 21555 gene locus_tag LOCUS_05900 gene purL 23765 21555 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5F0 protein_id gnl|my_center|LOCUS_05900 24429 23767 gene locus_tag LOCUS_05910 gene purQ 24429 23767 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9G6 protein_id gnl|my_center|LOCUS_05910 24787 24500 gene locus_tag LOCUS_05920 24787 24500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 25025 24771 gene locus_tag LOCUS_05930 gene parD-4 25025 24771 CDS product antitoxin protein parD-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_05930 25338 25099 gene locus_tag LOCUS_05940 gene purS 25338 25099 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_05940 26096 25335 gene locus_tag LOCUS_05950 gene purC1 26096 25335 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5F9 protein_id gnl|my_center|LOCUS_05950 26300 26623 gene locus_tag LOCUS_05960 26300 26623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530104.1 protein_id gnl|my_center|LOCUS_05960 26823 26620 gene locus_tag LOCUS_05970 26823 26620 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_05970 30082 26825 gene locus_tag LOCUS_05980 30082 26825 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088515.1 protein_id gnl|my_center|LOCUS_05980 31035 30079 gene locus_tag LOCUS_05990 31035 30079 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088516.1 protein_id gnl|my_center|LOCUS_05990 31397 31041 gene locus_tag LOCUS_06000 31397 31041 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086585.1 protein_id gnl|my_center|LOCUS_06000 31480 31812 gene locus_tag LOCUS_06010 31480 31812 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920704.1 protein_id gnl|my_center|LOCUS_06010 31850 33133 gene locus_tag LOCUS_06020 31850 33133 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_06020 33573 33130 gene locus_tag LOCUS_06030 33573 33130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 34130 33570 gene locus_tag LOCUS_06040 34130 33570 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_06040 35449 34148 gene locus_tag LOCUS_06050 gene purB 35449 34148 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIJ9 protein_id gnl|my_center|LOCUS_06050 36423 35659 gene locus_tag LOCUS_06060 36423 35659 CDS product phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527613.1 protein_id gnl|my_center|LOCUS_06060 37640 36420 gene locus_tag LOCUS_06070 37640 36420 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_06070 38464 37775 gene locus_tag LOCUS_06080 38464 37775 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ6 protein_id gnl|my_center|LOCUS_06080 39304 38468 gene locus_tag LOCUS_06090 gene map 39304 38468 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD91 protein_id gnl|my_center|LOCUS_06090 41074 39398 gene locus_tag LOCUS_06100 41074 39398 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_06100 41626 41129 gene locus_tag LOCUS_06110 41626 41129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 41625 42458 gene locus_tag LOCUS_06120 41625 42458 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_06120 42853 42509 gene locus_tag LOCUS_06130 42853 42509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 43089 44918 gene locus_tag LOCUS_06140 43089 44918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 46654 44993 gene locus_tag LOCUS_06150 46654 44993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_06150 47262 46651 gene locus_tag LOCUS_06160 47262 46651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 47400 47486 gene locus_tag LOCUS_t00120 47400 47486 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 3 518 gene locus_tag LOCUS_06170 3 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 515 1078 gene locus_tag LOCUS_06180 gene adk 515 1078 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F5 protein_id gnl|my_center|LOCUS_06180 1229 1597 gene locus_tag LOCUS_06190 gene rpsM 1229 1597 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME6 protein_id gnl|my_center|LOCUS_06190 1610 1999 gene locus_tag LOCUS_06200 gene rpsK 1610 1999 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F7 protein_id gnl|my_center|LOCUS_06200 2081 3100 gene locus_tag LOCUS_06210 gene rpoA 2081 3100 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8S9 protein_id gnl|my_center|LOCUS_06210 3151 3573 gene locus_tag LOCUS_06220 gene rplQ 3151 3573 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4G0 protein_id gnl|my_center|LOCUS_06220 3668 5137 gene locus_tag LOCUS_06230 3668 5137 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531440.1 protein_id gnl|my_center|LOCUS_06230 5541 5134 gene locus_tag LOCUS_06240 5541 5134 CDS product putative glyoxalase/bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701677.1 protein_id gnl|my_center|LOCUS_06240 5578 6891 gene locus_tag LOCUS_06250 5578 6891 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919162.1 protein_id gnl|my_center|LOCUS_06250 6891 7715 gene locus_tag LOCUS_06260 6891 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 7780 8160 gene locus_tag LOCUS_06270 7780 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529135.1 protein_id gnl|my_center|LOCUS_06270 8428 8859 gene locus_tag LOCUS_06280 gene crcB 8428 8859 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6V2 protein_id gnl|my_center|LOCUS_06280 8856 9845 gene locus_tag LOCUS_06290 8856 9845 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9P6 protein_id gnl|my_center|LOCUS_06290 9842 10528 gene locus_tag LOCUS_06300 9842 10528 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_06300 10525 11271 gene locus_tag LOCUS_06310 10525 11271 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_06310 11510 13042 gene locus_tag LOCUS_06320 11510 13042 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919841.1 protein_id gnl|my_center|LOCUS_06320 13920 13039 gene locus_tag LOCUS_06330 13920 13039 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921251.1 protein_id gnl|my_center|LOCUS_06330 14034 14993 gene locus_tag LOCUS_06340 14034 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 15844 14990 gene locus_tag LOCUS_06350 15844 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141815.1 protein_id gnl|my_center|LOCUS_06350 15915 16370 gene locus_tag LOCUS_06360 15915 16370 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970503.1 protein_id gnl|my_center|LOCUS_06360 16450 18474 gene locus_tag LOCUS_06370 16450 18474 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920040.1 protein_id gnl|my_center|LOCUS_06370 18568 19101 gene locus_tag LOCUS_06380 18568 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 19185 19685 gene locus_tag LOCUS_06390 19185 19685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 19708 20256 gene locus_tag LOCUS_06400 19708 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 20933 20253 gene locus_tag LOCUS_06410 gene lipB 20933 20253 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JM6 protein_id gnl|my_center|LOCUS_06410 21023 21274 gene locus_tag LOCUS_06420 21023 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920036.1 protein_id gnl|my_center|LOCUS_06420 21340 21426 gene locus_tag LOCUS_t00130 21340 21426 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21464 22654 gene locus_tag LOCUS_06430 gene purT 21464 22654 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VY4 protein_id gnl|my_center|LOCUS_06430 22716 24107 gene locus_tag LOCUS_06440 22716 24107 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA80 protein_id gnl|my_center|LOCUS_06440 24150 25151 gene locus_tag LOCUS_06450 24150 25151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 25220 26494 gene locus_tag LOCUS_06460 gene spmX 25220 26494 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6C1 protein_id gnl|my_center|LOCUS_06460 26569 27717 gene locus_tag LOCUS_06470 26569 27717 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 protein_id gnl|my_center|LOCUS_06470 27761 28129 gene locus_tag LOCUS_06480 27761 28129 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_06480 28184 28903 gene locus_tag LOCUS_06490 28184 28903 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405475.1 protein_id gnl|my_center|LOCUS_06490 30634 28904 gene locus_tag LOCUS_06500 30634 28904 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265771.1 protein_id gnl|my_center|LOCUS_06500 32299 30683 gene locus_tag LOCUS_06510 32299 30683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 32764 32402 gene locus_tag LOCUS_06520 32764 32402 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708433.1 protein_id gnl|my_center|LOCUS_06520 33597 32761 gene locus_tag LOCUS_06530 33597 32761 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_06530 34469 33666 gene locus_tag LOCUS_06540 34469 33666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 34592 36199 gene locus_tag LOCUS_06550 gene accB 34592 36199 CDS product carboxyltransferase subunit of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 protein_id gnl|my_center|LOCUS_06550 36311 36874 gene locus_tag LOCUS_06560 36311 36874 CDS product SOUL heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022600.1 protein_id gnl|my_center|LOCUS_06560 36950 37534 gene locus_tag LOCUS_06570 36950 37534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918166.1 protein_id gnl|my_center|LOCUS_06570 37639 38070 gene locus_tag LOCUS_06580 37639 38070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 38141 38509 gene locus_tag LOCUS_06590 38141 38509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 38538 39335 gene locus_tag LOCUS_06600 38538 39335 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920030.1 protein_id gnl|my_center|LOCUS_06600 39408 40217 gene locus_tag LOCUS_06610 39408 40217 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918346.1 protein_id gnl|my_center|LOCUS_06610 41338 40214 gene locus_tag LOCUS_06620 41338 40214 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_06620 41512 43467 gene locus_tag LOCUS_06630 gene accA 41512 43467 CDS product biotin carboxylase subunit of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_06630 43614 44564 gene locus_tag LOCUS_06640 43614 44564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920137.1 protein_id gnl|my_center|LOCUS_06640 44639 45364 gene locus_tag LOCUS_06650 44639 45364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 45402 45839 gene locus_tag LOCUS_06660 45402 45839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971846.1 protein_id gnl|my_center|LOCUS_06660 46596 45841 gene locus_tag LOCUS_06670 gene panC 46596 45841 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6C8 protein_id gnl|my_center|LOCUS_06670 >Feature sequence012 113 874 gene locus_tag LOCUS_06680 gene blaA 113 874 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_06680 1047 1235 gene locus_tag LOCUS_06690 1047 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06690 1236 3827 gene locus_tag LOCUS_06700 gene gyrA 1236 3827 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y8 protein_id gnl|my_center|LOCUS_06700 3824 4438 gene locus_tag LOCUS_06710 3824 4438 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969757.1 protein_id gnl|my_center|LOCUS_06710 4443 4934 gene locus_tag LOCUS_06720 gene coaD 4443 4934 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE7 protein_id gnl|my_center|LOCUS_06720 4949 5953 gene locus_tag LOCUS_06730 4949 5953 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_06730 5960 6412 gene locus_tag LOCUS_06740 gene ppiB 5960 6412 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_06740 6513 7571 gene locus_tag LOCUS_06750 gene queA 6513 7571 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVF3 protein_id gnl|my_center|LOCUS_06750 7568 8698 gene locus_tag LOCUS_06760 gene tgt 7568 8698 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9Y7 protein_id gnl|my_center|LOCUS_06760 9312 8695 gene locus_tag LOCUS_06770 9312 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 9420 9495 gene locus_tag LOCUS_t00140 9420 9495 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9872 11074 gene locus_tag LOCUS_06780 9872 11074 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918633.1 protein_id gnl|my_center|LOCUS_06780 11207 12487 gene locus_tag LOCUS_06790 gene mdeA 11207 12487 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534205.1 protein_id gnl|my_center|LOCUS_06790 12522 13787 gene locus_tag LOCUS_06800 12522 13787 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_06800 13788 14798 gene locus_tag LOCUS_06810 13788 14798 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919480.1 protein_id gnl|my_center|LOCUS_06810 14795 16252 gene locus_tag LOCUS_06820 gene astD 14795 16252 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76217 protein_id gnl|my_center|LOCUS_06820 16249 17586 gene locus_tag LOCUS_06830 gene astB 16249 17586 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7Z8 protein_id gnl|my_center|LOCUS_06830 18842 17583 gene locus_tag LOCUS_06840 18842 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 21046 18941 gene locus_tag LOCUS_06850 gene amsA 21046 18941 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337150.1 protein_id gnl|my_center|LOCUS_06850 21139 21921 gene locus_tag LOCUS_06860 21139 21921 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918762.1 protein_id gnl|my_center|LOCUS_06860 22325 21912 gene locus_tag LOCUS_06870 22325 21912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 22381 23478 gene locus_tag LOCUS_06880 gene thiO 22381 23478 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403986.1 protein_id gnl|my_center|LOCUS_06880 23530 24351 gene locus_tag LOCUS_06890 23530 24351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 24453 25598 gene locus_tag LOCUS_06900 24453 25598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920182.1 protein_id gnl|my_center|LOCUS_06900 26092 25574 gene locus_tag LOCUS_06910 26092 25574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265683.1 protein_id gnl|my_center|LOCUS_06910 26489 26118 gene locus_tag LOCUS_06920 26489 26118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 27354 26569 gene locus_tag LOCUS_06930 gene nadK 27354 26569 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58056 protein_id gnl|my_center|LOCUS_06930 28438 27383 gene locus_tag LOCUS_06940 28438 27383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975236.1 protein_id gnl|my_center|LOCUS_06940 28589 29356 gene locus_tag LOCUS_06950 28589 29356 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z4 protein_id gnl|my_center|LOCUS_06950 29557 30117 gene locus_tag LOCUS_06960 29557 30117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 30638 30114 gene locus_tag LOCUS_06970 30638 30114 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265682.1 protein_id gnl|my_center|LOCUS_06970 30844 31377 gene locus_tag LOCUS_06980 30844 31377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 31389 32693 gene locus_tag LOCUS_06990 31389 32693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_06990 32755 33162 gene locus_tag LOCUS_07000 32755 33162 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_07000 33159 34247 gene locus_tag LOCUS_07010 33159 34247 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_07010 35437 34244 gene locus_tag LOCUS_07020 35437 34244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721110.1 protein_id gnl|my_center|LOCUS_07020 36216 35434 gene locus_tag LOCUS_07030 36216 35434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 38486 36213 gene locus_tag LOCUS_07040 38486 36213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227803.1 protein_id gnl|my_center|LOCUS_07040 39998 38631 gene locus_tag LOCUS_07050 39998 38631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 40245 40170 gene locus_tag LOCUS_t00150 40245 40170 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 40714 40310 gene locus_tag LOCUS_07060 40714 40310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 41134 40724 gene locus_tag LOCUS_07070 41134 40724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 41242 42957 gene locus_tag LOCUS_07080 gene metG 41242 42957 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5U4 protein_id gnl|my_center|LOCUS_07080 43679 42954 gene locus_tag LOCUS_07090 43679 42954 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921111.1 protein_id gnl|my_center|LOCUS_07090 44524 43676 gene locus_tag LOCUS_07100 44524 43676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921112.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence013 3 185 gene locus_tag LOCUS_07110 3 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 1515 175 gene locus_tag LOCUS_07120 1515 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 1585 2085 gene locus_tag LOCUS_07130 1585 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2171 3157 gene locus_tag LOCUS_07140 2171 3157 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920002.1 protein_id gnl|my_center|LOCUS_07140 3154 4053 gene locus_tag LOCUS_07150 3154 4053 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A8 protein_id gnl|my_center|LOCUS_07150 4057 5118 gene locus_tag LOCUS_07160 4057 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07160 5115 7769 gene locus_tag LOCUS_07170 5115 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07170 8617 7766 gene locus_tag LOCUS_07180 8617 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261699.1 protein_id gnl|my_center|LOCUS_07180 8761 9351 gene locus_tag LOCUS_07190 8761 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 9406 9795 gene locus_tag LOCUS_07200 9406 9795 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660269.1 protein_id gnl|my_center|LOCUS_07200 9844 10749 gene locus_tag LOCUS_07210 gene rimK 9844 10749 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_07210 10746 11783 gene locus_tag LOCUS_07220 10746 11783 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_07220 12413 11898 gene locus_tag LOCUS_07230 12413 11898 CDS product beta-Ig-H3/fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_07230 16163 12573 gene locus_tag LOCUS_07240 gene oplaH 16163 12573 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063869.1 protein_id gnl|my_center|LOCUS_07240 16216 16905 gene locus_tag LOCUS_07250 16216 16905 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919995.1 protein_id gnl|my_center|LOCUS_07250 17009 17305 gene locus_tag LOCUS_07260 17009 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 17360 18274 gene locus_tag LOCUS_07270 17360 18274 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920424.1 protein_id gnl|my_center|LOCUS_07270 18271 18939 gene locus_tag LOCUS_07280 18271 18939 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_07280 19243 18902 gene locus_tag LOCUS_07290 19243 18902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07290 19562 20026 gene locus_tag LOCUS_07300 gene mraZ 19562 20026 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A594 protein_id gnl|my_center|LOCUS_07300 20023 21015 gene locus_tag LOCUS_07310 gene rsmH 20023 21015 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ6 protein_id gnl|my_center|LOCUS_07310 21012 21368 gene locus_tag LOCUS_07320 21012 21368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 21365 23137 gene locus_tag LOCUS_07330 21365 23137 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_07330 23134 24582 gene locus_tag LOCUS_07340 gene murE 23134 24582 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU2 protein_id gnl|my_center|LOCUS_07340 24575 25981 gene locus_tag LOCUS_07350 gene murF 24575 25981 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A596 protein_id gnl|my_center|LOCUS_07350 25991 27100 gene locus_tag LOCUS_07360 gene mraY 25991 27100 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 protein_id gnl|my_center|LOCUS_07360 27106 28506 gene locus_tag LOCUS_07370 gene murD 27106 28506 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H096 protein_id gnl|my_center|LOCUS_07370 28516 29634 gene locus_tag LOCUS_07380 28516 29634 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920409.1 protein_id gnl|my_center|LOCUS_07380 29631 30722 gene locus_tag LOCUS_07390 gene murG 29631 30722 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF54 protein_id gnl|my_center|LOCUS_07390 30727 32130 gene locus_tag LOCUS_07400 gene murC 30727 32130 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU8 protein_id gnl|my_center|LOCUS_07400 32127 33050 gene locus_tag LOCUS_07410 gene murB 32127 33050 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H085 protein_id gnl|my_center|LOCUS_07410 33047 33961 gene locus_tag LOCUS_07420 gene ddl 33047 33961 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA93 protein_id gnl|my_center|LOCUS_07420 33949 34863 gene locus_tag LOCUS_07430 33949 34863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 34860 36173 gene locus_tag LOCUS_07440 gene ftsA 34860 36173 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF59 protein_id gnl|my_center|LOCUS_07440 36281 37861 gene locus_tag LOCUS_07450 gene ftsZ 36281 37861 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H080 protein_id gnl|my_center|LOCUS_07450 37997 38905 gene locus_tag LOCUS_07460 gene lpxC 37997 38905 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q2 protein_id gnl|my_center|LOCUS_07460 38997 39833 gene locus_tag LOCUS_07470 gene bamD 38997 39833 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8V9 protein_id gnl|my_center|LOCUS_07470 39846 41546 gene locus_tag LOCUS_07480 39846 41546 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C835 protein_id gnl|my_center|LOCUS_07480 43075 41543 gene locus_tag LOCUS_07490 43075 41543 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_07490 43166 45274 gene locus_tag LOCUS_07500 gene ligA 43166 45274 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FV8 protein_id gnl|my_center|LOCUS_07500 >Feature sequence014 1255 419 gene locus_tag LOCUS_07510 gene hetN 1255 419 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_07510 2338 1427 gene locus_tag LOCUS_07520 2338 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640454.1 protein_id gnl|my_center|LOCUS_07520 2515 2979 gene locus_tag LOCUS_07530 2515 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4619 2976 gene locus_tag LOCUS_07540 4619 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 4782 5960 gene locus_tag LOCUS_07550 4782 5960 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_07550 6048 6380 gene locus_tag LOCUS_07560 6048 6380 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 protein_id gnl|my_center|LOCUS_07560 6380 6913 gene locus_tag LOCUS_07570 6380 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 8313 6910 gene locus_tag LOCUS_07580 8313 6910 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_07580 8382 8654 gene locus_tag LOCUS_07590 8382 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 8651 9358 gene locus_tag LOCUS_07600 8651 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259108.1 protein_id gnl|my_center|LOCUS_07600 9425 10660 gene locus_tag LOCUS_07610 gene argG 9425 10660 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXL9 protein_id gnl|my_center|LOCUS_07610 10754 12040 gene locus_tag LOCUS_07620 10754 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 12379 12041 gene locus_tag LOCUS_07630 12379 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 12514 13041 gene locus_tag LOCUS_07640 12514 13041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918014.1 protein_id gnl|my_center|LOCUS_07640 13739 13038 gene locus_tag LOCUS_07650 13739 13038 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_07650 13860 14630 gene locus_tag LOCUS_07660 13860 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709090.1 protein_id gnl|my_center|LOCUS_07660 14797 14588 gene locus_tag LOCUS_07670 14797 14588 CDS product cytochrome oxidase maturation protein, cbb3-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391070.1 protein_id gnl|my_center|LOCUS_07670 16956 14797 gene locus_tag LOCUS_07680 gene fixI 16956 14797 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919283.1 protein_id gnl|my_center|LOCUS_07680 17402 16944 gene locus_tag LOCUS_07690 gene fixH 17402 16944 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919282.1 protein_id gnl|my_center|LOCUS_07690 18883 17399 gene locus_tag LOCUS_07700 gene fixG 18883 17399 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_07700 19840 18926 gene locus_tag LOCUS_07710 gene ccoP 19840 18926 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C806 protein_id gnl|my_center|LOCUS_07710 20021 19833 gene locus_tag LOCUS_07720 20021 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 20788 20033 gene locus_tag LOCUS_07730 gene ccoO 20788 20033 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919278.1 protein_id gnl|my_center|LOCUS_07730 22454 20799 gene locus_tag LOCUS_07740 22454 20799 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919277.1 protein_id gnl|my_center|LOCUS_07740 24581 22641 gene locus_tag LOCUS_07750 24581 22641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 24800 27061 gene locus_tag LOCUS_07760 24800 27061 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_07760 27070 29811 gene locus_tag LOCUS_07770 27070 29811 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_07770 30275 29814 gene locus_tag LOCUS_07780 30275 29814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 30982 31317 gene locus_tag LOCUS_07790 30982 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 31403 32461 gene locus_tag LOCUS_07800 31403 32461 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_07800 32534 32986 gene locus_tag LOCUS_07810 32534 32986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706115.1 protein_id gnl|my_center|LOCUS_07810 34210 32987 gene locus_tag LOCUS_07820 34210 32987 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_07820 35056 34265 gene locus_tag LOCUS_07830 35056 34265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 36748 35153 gene locus_tag LOCUS_07840 36748 35153 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532466.1 protein_id gnl|my_center|LOCUS_07840 36891 37475 gene locus_tag LOCUS_07850 36891 37475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 37783 37709 gene locus_tag LOCUS_t00160 37783 37709 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 38567 37863 gene locus_tag LOCUS_07860 38567 37863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 38511 39020 gene locus_tag LOCUS_07870 38511 39020 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_07870 39083 40012 gene locus_tag LOCUS_07880 39083 40012 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 protein_id gnl|my_center|LOCUS_07880 40053 40682 gene locus_tag LOCUS_07890 40053 40682 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 protein_id gnl|my_center|LOCUS_07890 40754 41203 gene locus_tag LOCUS_07900 40754 41203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 41203 41427 gene locus_tag LOCUS_07910 41203 41427 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921114.1 protein_id gnl|my_center|LOCUS_07910 41470 41682 gene locus_tag LOCUS_07920 41470 41682 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW2 protein_id gnl|my_center|LOCUS_07920 41679 41978 gene locus_tag LOCUS_07930 41679 41978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975729.1 protein_id gnl|my_center|LOCUS_07930 43250 42240 gene locus_tag LOCUS_07940 gene bioB 43250 42240 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFL1 protein_id gnl|my_center|LOCUS_07940 43300 43641 gene locus_tag LOCUS_07950 43300 43641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence015 2387 1062 gene locus_tag LOCUS_07960 2387 1062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_07960 2632 3330 gene locus_tag LOCUS_07970 gene ftrB 2632 3330 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919286.1 protein_id gnl|my_center|LOCUS_07970 3314 3865 gene locus_tag LOCUS_07980 gene mobA 3314 3865 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_07980 3941 4960 gene locus_tag LOCUS_07990 gene moaA 3941 4960 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PB4 protein_id gnl|my_center|LOCUS_07990 4964 5221 gene locus_tag LOCUS_08000 4964 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5221 5679 gene locus_tag LOCUS_08010 gene moaE 5221 5679 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383373.1 protein_id gnl|my_center|LOCUS_08010 5676 6191 gene locus_tag LOCUS_08020 5676 6191 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6N2 protein_id gnl|my_center|LOCUS_08020 6193 6684 gene locus_tag LOCUS_08030 gene moaC 6193 6684 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Y0 protein_id gnl|my_center|LOCUS_08030 6681 7871 gene locus_tag LOCUS_08040 6681 7871 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 protein_id gnl|my_center|LOCUS_08040 7868 8626 gene locus_tag LOCUS_08050 7868 8626 CDS product UPF0721 transmembrane protein y4hK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55478 protein_id gnl|my_center|LOCUS_08050 8635 9009 gene locus_tag LOCUS_08060 8635 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563264.1 protein_id gnl|my_center|LOCUS_08060 9070 9750 gene locus_tag LOCUS_08070 9070 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 11103 9922 gene locus_tag LOCUS_08080 11103 9922 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_08080 13571 11226 gene locus_tag LOCUS_08090 13571 11226 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_08090 15453 13708 gene locus_tag LOCUS_08100 15453 13708 CDS product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294717.1 protein_id gnl|my_center|LOCUS_08100 15655 17043 gene locus_tag LOCUS_08110 gene hemN 15655 17043 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31381 protein_id gnl|my_center|LOCUS_08110 17392 18018 gene locus_tag LOCUS_08120 17392 18018 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084154.1 protein_id gnl|my_center|LOCUS_08120 19907 18015 gene locus_tag LOCUS_08130 19907 18015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 20441 20103 gene locus_tag LOCUS_08140 20441 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 20931 20395 gene locus_tag LOCUS_08150 20931 20395 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8D7 protein_id gnl|my_center|LOCUS_08150 21261 21620 gene locus_tag LOCUS_08160 21261 21620 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923312.1 protein_id gnl|my_center|LOCUS_08160 22039 22293 gene locus_tag LOCUS_08170 22039 22293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435988.1 protein_id gnl|my_center|LOCUS_08170 25387 22388 gene locus_tag LOCUS_08180 25387 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 26025 25384 gene locus_tag LOCUS_08190 26025 25384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 26161 27363 gene locus_tag LOCUS_08200 26161 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_08200 27546 28100 gene locus_tag LOCUS_08210 27546 28100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 28076 32341 gene locus_tag LOCUS_08220 28076 32341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 32341 33318 gene locus_tag LOCUS_08230 32341 33318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 34569 33736 gene locus_tag LOCUS_08240 34569 33736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 35027 37282 gene locus_tag LOCUS_08250 35027 37282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 40123 37400 gene locus_tag LOCUS_08260 40123 37400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 40659 40189 gene locus_tag LOCUS_08270 40659 40189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 41252 40656 gene locus_tag LOCUS_08280 gene cheYIII 41252 40656 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918328.1 protein_id gnl|my_center|LOCUS_08280 41595 41254 gene locus_tag LOCUS_08290 41595 41254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 42173 41628 gene locus_tag LOCUS_08300 gene cheD 42173 41628 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87719 protein_id gnl|my_center|LOCUS_08300 42559 42170 gene locus_tag LOCUS_08310 42559 42170 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918325.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence016 1582 59 gene locus_tag LOCUS_08320 gene glsF 1582 59 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_08320 2977 1685 gene locus_tag LOCUS_08330 gene yhfN 2977 1685 CDS product putative metalloprotease YhfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40769 protein_id gnl|my_center|LOCUS_08330 3727 3044 gene locus_tag LOCUS_08340 3727 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4816 3746 gene locus_tag LOCUS_08350 gene hrcA 4816 3746 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP3 protein_id gnl|my_center|LOCUS_08350 4935 5645 gene locus_tag LOCUS_08360 gene rph 4935 5645 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP2 protein_id gnl|my_center|LOCUS_08360 6022 5792 gene locus_tag LOCUS_08370 6022 5792 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_08370 6578 6036 gene locus_tag LOCUS_08380 6578 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 6937 7536 gene locus_tag LOCUS_08390 6937 7536 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_08390 7529 8665 gene locus_tag LOCUS_08400 7529 8665 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 protein_id gnl|my_center|LOCUS_08400 9978 8662 gene locus_tag LOCUS_08410 9978 8662 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391441.1 protein_id gnl|my_center|LOCUS_08410 9977 10873 gene locus_tag LOCUS_08420 gene rsmI 9977 10873 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCU9 protein_id gnl|my_center|LOCUS_08420 10870 11256 gene locus_tag LOCUS_08430 10870 11256 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIJ2 protein_id gnl|my_center|LOCUS_08430 11317 11982 gene locus_tag LOCUS_08440 11317 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 11995 12942 gene locus_tag LOCUS_08450 gene gshB 11995 12942 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H2 protein_id gnl|my_center|LOCUS_08450 13083 14621 gene locus_tag LOCUS_08460 gene chlI 13083 14621 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918029.1 protein_id gnl|my_center|LOCUS_08460 14658 16502 gene locus_tag LOCUS_08470 14658 16502 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529573.1 protein_id gnl|my_center|LOCUS_08470 16519 17859 gene locus_tag LOCUS_08480 gene ampG 16519 17859 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_08480 20142 17863 gene locus_tag LOCUS_08490 20142 17863 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 protein_id gnl|my_center|LOCUS_08490 20263 22941 gene locus_tag LOCUS_08500 gene mutS 20263 22941 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC54 protein_id gnl|my_center|LOCUS_08500 22975 25788 gene locus_tag LOCUS_08510 gene glnD 22975 25788 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWX0 protein_id gnl|my_center|LOCUS_08510 25791 27353 gene locus_tag LOCUS_08520 25791 27353 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T788 protein_id gnl|my_center|LOCUS_08520 27395 28423 gene locus_tag LOCUS_08530 gene trpS 27395 28423 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3N8 protein_id gnl|my_center|LOCUS_08530 28483 28989 gene locus_tag LOCUS_08540 28483 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 29540 28986 gene locus_tag LOCUS_08550 29540 28986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 29594 30070 gene locus_tag LOCUS_08560 29594 30070 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 protein_id gnl|my_center|LOCUS_08560 30134 30685 gene locus_tag LOCUS_08570 30134 30685 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_08570 30769 31386 gene locus_tag LOCUS_08580 30769 31386 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58792 protein_id gnl|my_center|LOCUS_08580 31397 32062 gene locus_tag LOCUS_08590 31397 32062 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 protein_id gnl|my_center|LOCUS_08590 32059 32493 gene locus_tag LOCUS_08600 32059 32493 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917947.1 protein_id gnl|my_center|LOCUS_08600 32594 32971 gene locus_tag LOCUS_08610 32594 32971 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_08610 32987 34216 gene locus_tag LOCUS_08620 32987 34216 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509587.1 protein_id gnl|my_center|LOCUS_08620 34283 35653 gene locus_tag LOCUS_08630 gene miaB 34283 35653 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U7 protein_id gnl|my_center|LOCUS_08630 35650 36654 gene locus_tag LOCUS_08640 35650 36654 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917945.1 protein_id gnl|my_center|LOCUS_08640 36658 37122 gene locus_tag LOCUS_08650 gene ybeY 36658 37122 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLV8 protein_id gnl|my_center|LOCUS_08650 37119 37979 gene locus_tag LOCUS_08660 gene corC 37119 37979 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 protein_id gnl|my_center|LOCUS_08660 37976 39598 gene locus_tag LOCUS_08670 gene lnt 37976 39598 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC16 protein_id gnl|my_center|LOCUS_08670 39784 40125 gene locus_tag LOCUS_08680 39784 40125 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706636.1 protein_id gnl|my_center|LOCUS_08680 40226 41392 gene locus_tag LOCUS_08690 gene metK2 40226 41392 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_08690 41385 42059 gene locus_tag LOCUS_08700 gene trmB 41385 42059 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX04 protein_id gnl|my_center|LOCUS_08700 >Feature sequence017 638 63 gene locus_tag LOCUS_08710 638 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926119.1 protein_id gnl|my_center|LOCUS_08710 1384 635 gene locus_tag LOCUS_08720 1384 635 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975387.1 protein_id gnl|my_center|LOCUS_08720 2231 1377 gene locus_tag LOCUS_08730 2231 1377 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEP9 protein_id gnl|my_center|LOCUS_08730 2535 2245 gene locus_tag LOCUS_08740 2535 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 3871 2708 gene locus_tag LOCUS_08750 3871 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 4811 3930 gene locus_tag LOCUS_08760 4811 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5602 4859 gene locus_tag LOCUS_08770 5602 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 6236 5697 gene locus_tag LOCUS_08780 6236 5697 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918220.1 protein_id gnl|my_center|LOCUS_08780 6381 7115 gene locus_tag LOCUS_08790 6381 7115 CDS product LytTr DNA-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265527.1 protein_id gnl|my_center|LOCUS_08790 7660 7112 gene locus_tag LOCUS_08800 7660 7112 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_08800 7868 8317 gene locus_tag LOCUS_08810 7868 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8934 8314 gene locus_tag LOCUS_08820 8934 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 9995 9033 gene locus_tag LOCUS_08830 gene mdh 9995 9033 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7K1 protein_id gnl|my_center|LOCUS_08830 10858 10073 gene locus_tag LOCUS_08840 10858 10073 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_08840 10918 11358 gene locus_tag LOCUS_08850 10918 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920316.1 protein_id gnl|my_center|LOCUS_08850 12026 11355 gene locus_tag LOCUS_08860 12026 11355 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_08860 13141 12026 gene locus_tag LOCUS_08870 13141 12026 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_08870 13894 13466 gene locus_tag LOCUS_08880 13894 13466 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561457.1 protein_id gnl|my_center|LOCUS_08880 15030 13891 gene locus_tag LOCUS_08890 gene blcB 15030 13891 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 protein_id gnl|my_center|LOCUS_08890 16728 15232 gene locus_tag LOCUS_08900 16728 15232 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 protein_id gnl|my_center|LOCUS_08900 20313 17005 gene locus_tag LOCUS_08910 20313 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 20614 21435 gene locus_tag LOCUS_08920 20614 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 24488 21432 gene locus_tag LOCUS_08930 24488 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 24856 24485 gene locus_tag LOCUS_08940 24856 24485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 25394 24873 gene locus_tag LOCUS_08950 25394 24873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 25563 26480 gene locus_tag LOCUS_08960 25563 26480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 26473 27540 gene locus_tag LOCUS_08970 26473 27540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 27783 27532 gene locus_tag LOCUS_08980 27783 27532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 27886 28596 gene locus_tag LOCUS_08990 27886 28596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 28705 29637 gene locus_tag LOCUS_09000 28705 29637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 31122 29863 gene locus_tag LOCUS_09010 31122 29863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 31666 34182 gene locus_tag LOCUS_09020 gene divL 31666 34182 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921313.1 protein_id gnl|my_center|LOCUS_09020 34512 34192 gene locus_tag LOCUS_09030 34512 34192 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_09030 34612 35070 gene locus_tag LOCUS_09040 34612 35070 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 protein_id gnl|my_center|LOCUS_09040 35063 36157 gene locus_tag LOCUS_09050 35063 36157 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 protein_id gnl|my_center|LOCUS_09050 36154 36864 gene locus_tag LOCUS_09060 36154 36864 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921365.1 protein_id gnl|my_center|LOCUS_09060 36861 39872 gene locus_tag LOCUS_09070 36861 39872 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921366.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence018 302 880 gene locus_tag LOCUS_09080 302 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976401.1 protein_id gnl|my_center|LOCUS_09080 877 1494 gene locus_tag LOCUS_09090 877 1494 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918295.1 protein_id gnl|my_center|LOCUS_09090 1494 1889 gene locus_tag LOCUS_09100 1494 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1861 3066 gene locus_tag LOCUS_09110 1861 3066 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969879.1 protein_id gnl|my_center|LOCUS_09110 3552 3091 gene locus_tag LOCUS_09120 3552 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 4442 3543 gene locus_tag LOCUS_09130 gene hemF 4442 3543 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC2 protein_id gnl|my_center|LOCUS_09130 4588 5448 gene locus_tag LOCUS_09140 4588 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5885 5445 gene locus_tag LOCUS_09150 gene trmL 5885 5445 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAX1 protein_id gnl|my_center|LOCUS_09150 6061 6663 gene locus_tag LOCUS_09160 6061 6663 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9Q3 protein_id gnl|my_center|LOCUS_09160 6660 7955 gene locus_tag LOCUS_09170 6660 7955 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAW9 protein_id gnl|my_center|LOCUS_09170 7971 8798 gene locus_tag LOCUS_09180 7971 8798 CDS product ubiquinol cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918362.1 protein_id gnl|my_center|LOCUS_09180 8880 9752 gene locus_tag LOCUS_09190 gene mtnP 8880 9752 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VT5 protein_id gnl|my_center|LOCUS_09190 9763 10485 gene locus_tag LOCUS_09200 9763 10485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 10533 11252 gene locus_tag LOCUS_09210 10533 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 11306 11707 gene locus_tag LOCUS_09220 11306 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 11704 12336 gene locus_tag LOCUS_09230 11704 12336 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112753.1 protein_id gnl|my_center|LOCUS_09230 12346 12876 gene locus_tag LOCUS_09240 gene apt 12346 12876 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI44 protein_id gnl|my_center|LOCUS_09240 13051 13710 gene locus_tag LOCUS_09250 13051 13710 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457314.1 protein_id gnl|my_center|LOCUS_09250 15418 13928 gene locus_tag LOCUS_09260 15418 13928 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118742.1 protein_id gnl|my_center|LOCUS_09260 16129 15482 gene locus_tag LOCUS_09270 16129 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 16230 17123 gene locus_tag LOCUS_09280 gene rlmJ 16230 17123 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKL4 protein_id gnl|my_center|LOCUS_09280 18130 17258 gene locus_tag LOCUS_09290 18130 17258 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_09290 19372 18140 gene locus_tag LOCUS_09300 19372 18140 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 protein_id gnl|my_center|LOCUS_09300 20164 19439 gene locus_tag LOCUS_09310 20164 19439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 21335 20238 gene locus_tag LOCUS_09320 gene ychF 21335 20238 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZM2 protein_id gnl|my_center|LOCUS_09320 21788 21396 gene locus_tag LOCUS_09330 21788 21396 CDS product VapC ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67239 protein_id gnl|my_center|LOCUS_09330 22042 21785 gene locus_tag LOCUS_09340 22042 21785 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389024.1 protein_id gnl|my_center|LOCUS_09340 22166 22546 gene locus_tag LOCUS_09350 22166 22546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 23298 22693 gene locus_tag LOCUS_09360 gene pth 23298 22693 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZU8 protein_id gnl|my_center|LOCUS_09360 24002 23331 gene locus_tag LOCUS_09370 gene rplY 24002 23331 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 protein_id gnl|my_center|LOCUS_09370 25101 24151 gene locus_tag LOCUS_09380 gene prs 25101 24151 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZV1 protein_id gnl|my_center|LOCUS_09380 26267 25170 gene locus_tag LOCUS_09390 26267 25170 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_09390 27163 26264 gene locus_tag LOCUS_09400 gene lgt 27163 26264 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZV6 protein_id gnl|my_center|LOCUS_09400 27246 27578 gene locus_tag LOCUS_09410 27246 27578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 27714 28214 gene locus_tag LOCUS_09420 27714 28214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918381.1 protein_id gnl|my_center|LOCUS_09420 28218 29048 gene locus_tag LOCUS_09430 gene proC 28218 29048 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DI5 protein_id gnl|my_center|LOCUS_09430 30085 29045 gene locus_tag LOCUS_09440 30085 29045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143497.1 protein_id gnl|my_center|LOCUS_09440 30913 30170 gene locus_tag LOCUS_09450 30913 30170 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312872.1 protein_id gnl|my_center|LOCUS_09450 30912 32819 gene locus_tag LOCUS_09460 gene uvrC 30912 32819 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYX6 protein_id gnl|my_center|LOCUS_09460 32816 33400 gene locus_tag LOCUS_09470 gene pgsA 32816 33400 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707493.1 protein_id gnl|my_center|LOCUS_09470 33463 34164 gene locus_tag LOCUS_09480 33463 34164 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 protein_id gnl|my_center|LOCUS_09480 34172 35491 gene locus_tag LOCUS_09490 34172 35491 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920769.1 protein_id gnl|my_center|LOCUS_09490 35770 35946 gene locus_tag LOCUS_09500 35770 35946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 36091 36483 gene locus_tag LOCUS_09510 36091 36483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 36603 37172 gene locus_tag LOCUS_09520 36603 37172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 37236 37559 gene locus_tag LOCUS_09530 37236 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 38097 37618 gene locus_tag LOCUS_09540 38097 37618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 38530 38186 gene locus_tag LOCUS_09550 38530 38186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 38665 39576 gene locus_tag LOCUS_09560 38665 39576 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence019 <1 1112 gene locus_tag LOCUS_09570 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389689.1:murein L,D-transpeptidase 1185 1748 gene locus_tag LOCUS_09580 1185 1748 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC87 protein_id gnl|my_center|LOCUS_09580 2003 3163 gene locus_tag LOCUS_09590 2003 3163 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_09590 3245 3907 gene locus_tag LOCUS_09600 3245 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5109 3904 gene locus_tag LOCUS_09610 gene serA 5109 3904 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43885 protein_id gnl|my_center|LOCUS_09610 5703 5173 gene locus_tag LOCUS_09620 5703 5173 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919545.1 protein_id gnl|my_center|LOCUS_09620 5855 6547 gene locus_tag LOCUS_09630 5855 6547 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706239.1 protein_id gnl|my_center|LOCUS_09630 9613 6548 gene locus_tag LOCUS_09640 9613 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 9887 10786 gene locus_tag LOCUS_09650 9887 10786 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083373.1 protein_id gnl|my_center|LOCUS_09650 10793 11002 gene locus_tag LOCUS_09660 10793 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 12815 10971 gene locus_tag LOCUS_09670 gene lepA 12815 10971 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SU3 protein_id gnl|my_center|LOCUS_09670 12936 13532 gene locus_tag LOCUS_09680 12936 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 13541 14056 gene locus_tag LOCUS_09690 13541 14056 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_09690 14305 15702 gene locus_tag LOCUS_09700 14305 15702 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_09700 18155 15756 gene locus_tag LOCUS_09710 gene pheT 18155 15756 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8M4 protein_id gnl|my_center|LOCUS_09710 18793 18152 gene locus_tag LOCUS_09720 18793 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 20030 18948 gene locus_tag LOCUS_09730 gene pheS 20030 18948 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H307 protein_id gnl|my_center|LOCUS_09730 20649 20293 gene locus_tag LOCUS_09740 gene rplT 20649 20293 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG4 protein_id gnl|my_center|LOCUS_09740 20885 20682 gene locus_tag LOCUS_09750 gene rpmI 20885 20682 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIN8 protein_id gnl|my_center|LOCUS_09750 21108 21806 gene locus_tag LOCUS_09760 21108 21806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 22234 21803 gene locus_tag LOCUS_09770 22234 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 24187 22370 gene locus_tag LOCUS_09780 24187 22370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 24701 24219 gene locus_tag LOCUS_09790 24701 24219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 25329 24907 gene locus_tag LOCUS_09800 gene infC 25329 24907 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H312 protein_id gnl|my_center|LOCUS_09800 26549 25572 gene locus_tag LOCUS_09810 26549 25572 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 protein_id gnl|my_center|LOCUS_09810 27684 26554 gene locus_tag LOCUS_09820 27684 26554 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_09820 27771 28547 gene locus_tag LOCUS_09830 27771 28547 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_09830 29392 28466 gene locus_tag LOCUS_09840 29392 28466 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_09840 29373 30095 gene locus_tag LOCUS_09850 29373 30095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 31309 30092 gene locus_tag LOCUS_09860 31309 30092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 33250 31508 gene locus_tag LOCUS_09870 33250 31508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 protein_id gnl|my_center|LOCUS_09870 34190 33309 gene locus_tag LOCUS_09880 34190 33309 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_09880 34311 35702 gene locus_tag LOCUS_09890 34311 35702 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_09890 37406 35706 gene locus_tag LOCUS_09900 37406 35706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 37576 37980 gene locus_tag LOCUS_09910 gene sdhC 37576 37980 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310797.1 protein_id gnl|my_center|LOCUS_09910 37977 38360 gene locus_tag LOCUS_09920 37977 38360 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence020 360 1433 gene locus_tag LOCUS_09930 360 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1449 2126 gene locus_tag LOCUS_09940 1449 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312857.1 protein_id gnl|my_center|LOCUS_09940 2126 4339 gene locus_tag LOCUS_09950 gene ppk 2126 4339 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7L2 protein_id gnl|my_center|LOCUS_09950 4336 5853 gene locus_tag LOCUS_09960 gene ppx1 4336 5853 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919577.1 protein_id gnl|my_center|LOCUS_09960 7001 5850 gene locus_tag LOCUS_09970 gene rnd 7001 5850 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAA2 protein_id gnl|my_center|LOCUS_09970 8343 7027 gene locus_tag LOCUS_09980 8343 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 9047 8340 gene locus_tag LOCUS_09990 9047 8340 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 protein_id gnl|my_center|LOCUS_09990 9721 9053 gene locus_tag LOCUS_10000 9721 9053 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229664.1 protein_id gnl|my_center|LOCUS_10000 10030 10674 gene locus_tag LOCUS_10010 10030 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 10825 12624 gene locus_tag LOCUS_10020 gene aspS 10825 12624 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9G8 protein_id gnl|my_center|LOCUS_10020 13986 12625 gene locus_tag LOCUS_10030 13986 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 14543 14058 gene locus_tag LOCUS_10040 14543 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919756.1 protein_id gnl|my_center|LOCUS_10040 14768 16666 gene locus_tag LOCUS_10050 14768 16666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 18981 16672 gene locus_tag LOCUS_10060 18981 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 19131 19529 gene locus_tag LOCUS_10070 19131 19529 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640357.1 protein_id gnl|my_center|LOCUS_10070 19577 19984 gene locus_tag LOCUS_10080 19577 19984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975140.1 protein_id gnl|my_center|LOCUS_10080 20601 19951 gene locus_tag LOCUS_10090 gene aat 20601 19951 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWN5 protein_id gnl|my_center|LOCUS_10090 21954 20605 gene locus_tag LOCUS_10100 21954 20605 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 protein_id gnl|my_center|LOCUS_10100 22456 21968 gene locus_tag LOCUS_10110 22456 21968 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919749.1 protein_id gnl|my_center|LOCUS_10110 22930 22496 gene locus_tag LOCUS_10120 gene aroQ 22930 22496 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15474 protein_id gnl|my_center|LOCUS_10120 23011 23211 gene locus_tag LOCUS_10130 gene thiS 23011 23211 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_10130 23214 23987 gene locus_tag LOCUS_10140 gene thiG 23214 23987 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A746 protein_id gnl|my_center|LOCUS_10140 24751 23984 gene locus_tag LOCUS_10150 24751 23984 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 protein_id gnl|my_center|LOCUS_10150 26191 24821 gene locus_tag LOCUS_10160 26191 24821 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640355.1 protein_id gnl|my_center|LOCUS_10160 28876 26285 gene locus_tag LOCUS_10170 28876 26285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 29312 30523 gene locus_tag LOCUS_10180 29312 30523 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919742.1 protein_id gnl|my_center|LOCUS_10180 30646 33159 gene locus_tag LOCUS_10190 gene mrcA1 30646 33159 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969182.1 protein_id gnl|my_center|LOCUS_10190 33405 34379 gene locus_tag LOCUS_10200 gene prfB 33405 34379 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWM3 protein_id gnl|my_center|LOCUS_10200 34432 34632 gene locus_tag LOCUS_10210 34432 34632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence021 2516 753 gene locus_tag LOCUS_10220 gene argS 2516 753 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A347 protein_id gnl|my_center|LOCUS_10220 3084 2521 gene locus_tag LOCUS_10230 3084 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3179 4126 gene locus_tag LOCUS_10240 gene ispH 3179 4126 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC9 protein_id gnl|my_center|LOCUS_10240 4129 4557 gene locus_tag LOCUS_10250 4129 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4557 5003 gene locus_tag LOCUS_10260 gene rnhA 4557 5003 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU6 protein_id gnl|my_center|LOCUS_10260 5533 5039 gene locus_tag LOCUS_10270 5533 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 6124 5669 gene locus_tag LOCUS_10280 6124 5669 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313449.1 protein_id gnl|my_center|LOCUS_10280 7108 6137 gene locus_tag LOCUS_10290 7108 6137 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923262.1 protein_id gnl|my_center|LOCUS_10290 7613 7131 gene locus_tag LOCUS_10300 7613 7131 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_10300 7725 8291 gene locus_tag LOCUS_10310 7725 8291 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5C6 protein_id gnl|my_center|LOCUS_10310 9425 8295 gene locus_tag LOCUS_10320 9425 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 9999 9418 gene locus_tag LOCUS_10330 gene rimJ 9999 9418 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707122.1 protein_id gnl|my_center|LOCUS_10330 10730 10044 gene locus_tag LOCUS_10340 10730 10044 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 protein_id gnl|my_center|LOCUS_10340 11042 10743 gene locus_tag LOCUS_10350 11042 10743 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971138.1 protein_id gnl|my_center|LOCUS_10350 11975 11112 gene locus_tag LOCUS_10360 gene coxC 11975 11112 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921231.1 protein_id gnl|my_center|LOCUS_10360 12608 12048 gene locus_tag LOCUS_10370 gene ctaG 12608 12048 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T812 protein_id gnl|my_center|LOCUS_10370 12861 12601 gene locus_tag LOCUS_10380 12861 12601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 13847 12858 gene locus_tag LOCUS_10390 gene coxE 13847 12858 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDA3 protein_id gnl|my_center|LOCUS_10390 15552 13903 gene locus_tag LOCUS_10400 15552 13903 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A300 protein_id gnl|my_center|LOCUS_10400 16412 15564 gene locus_tag LOCUS_10410 16412 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 16647 17201 gene locus_tag LOCUS_10420 16647 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 17286 18698 gene locus_tag LOCUS_10430 17286 18698 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921240.1 protein_id gnl|my_center|LOCUS_10430 18813 20909 gene locus_tag LOCUS_10440 18813 20909 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918113.1 protein_id gnl|my_center|LOCUS_10440 20979 21911 gene locus_tag LOCUS_10450 20979 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 23795 21987 gene locus_tag LOCUS_10460 23795 21987 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 protein_id gnl|my_center|LOCUS_10460 25331 23889 gene locus_tag LOCUS_10470 25331 23889 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_10470 26081 25335 gene locus_tag LOCUS_10480 26081 25335 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2Z1 protein_id gnl|my_center|LOCUS_10480 26158 27090 gene locus_tag LOCUS_10490 gene ubiA 26158 27090 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2Y5 protein_id gnl|my_center|LOCUS_10490 27163 28587 gene locus_tag LOCUS_10500 27163 28587 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_10500 28604 30016 gene locus_tag LOCUS_10510 28604 30016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 30114 30548 gene locus_tag LOCUS_10520 30114 30548 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918284.1 protein_id gnl|my_center|LOCUS_10520 30621 31397 gene locus_tag LOCUS_10530 30621 31397 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_10530 31397 32305 gene locus_tag LOCUS_10540 gene ilvE2 31397 32305 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_10540 32302 33036 gene locus_tag LOCUS_10550 32302 33036 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_10550 34118 33039 gene locus_tag LOCUS_10560 34118 33039 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931313.1 protein_id gnl|my_center|LOCUS_10560 34214 34510 gene locus_tag LOCUS_10570 34214 34510 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840431.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence022 <1 2036 gene locus_tag LOCUS_10580 <1 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528761.1:NADPH flavoprotein 2017 2997 gene locus_tag LOCUS_10590 gene apbE 2017 2997 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKH5 protein_id gnl|my_center|LOCUS_10590 3003 3392 gene locus_tag LOCUS_10600 3003 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10600 3411 3884 gene locus_tag LOCUS_10610 3411 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10610 5946 4261 gene locus_tag LOCUS_10620 5946 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6389 5943 gene locus_tag LOCUS_10630 6389 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_10630 6645 6379 gene locus_tag LOCUS_10640 6645 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8475 7033 gene locus_tag LOCUS_10650 8475 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 protein_id gnl|my_center|LOCUS_10650 8963 8472 gene locus_tag LOCUS_10660 8963 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 10282 8975 gene locus_tag LOCUS_10670 10282 8975 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832V4 protein_id gnl|my_center|LOCUS_10670 11027 10461 gene locus_tag LOCUS_10680 11027 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 11150 11353 gene locus_tag LOCUS_10690 11150 11353 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970277.1 protein_id gnl|my_center|LOCUS_10690 11488 12186 gene locus_tag LOCUS_10700 11488 12186 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142671.1 protein_id gnl|my_center|LOCUS_10700 13522 12626 gene locus_tag LOCUS_10710 13522 12626 CDS product pyruvate formate lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_10710 15751 13523 gene locus_tag LOCUS_10720 15751 13523 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878946.1 protein_id gnl|my_center|LOCUS_10720 16157 16810 gene locus_tag LOCUS_10730 16157 16810 CDS product putative transcription regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701437.1 protein_id gnl|my_center|LOCUS_10730 16869 18623 gene locus_tag LOCUS_10740 16869 18623 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_10740 18630 19619 gene locus_tag LOCUS_10750 18630 19619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_10750 19616 20413 gene locus_tag LOCUS_10760 19616 20413 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_10760 21277 20780 gene locus_tag LOCUS_10770 21277 20780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 22249 21386 gene locus_tag LOCUS_10780 22249 21386 CDS product insertion element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_10780 22512 22282 gene locus_tag LOCUS_10790 22512 22282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 22511 23116 gene locus_tag LOCUS_10800 22511 23116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 24830 23703 gene locus_tag LOCUS_10810 gene dauA 24830 23703 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 protein_id gnl|my_center|LOCUS_10810 25870 25532 gene locus_tag LOCUS_10820 25870 25532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 26760 25855 gene locus_tag LOCUS_10830 26760 25855 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090353.1 protein_id gnl|my_center|LOCUS_10830 27770 26751 gene locus_tag LOCUS_10840 27770 26751 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338244.1 protein_id gnl|my_center|LOCUS_10840 28303 27767 gene locus_tag LOCUS_10850 28303 27767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090355.1 protein_id gnl|my_center|LOCUS_10850 28720 30264 gene locus_tag LOCUS_10860 gene ilvB 28720 30264 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence023 1743 124 gene locus_tag LOCUS_10870 1743 124 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088762.1 protein_id gnl|my_center|LOCUS_10870 2795 1743 gene locus_tag LOCUS_10880 2795 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4828 2792 gene locus_tag LOCUS_10890 4828 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5683 4922 gene locus_tag LOCUS_10900 5683 4922 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABP2 protein_id gnl|my_center|LOCUS_10900 7719 5680 gene locus_tag LOCUS_10910 gene gspD 7719 5680 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708827.1 protein_id gnl|my_center|LOCUS_10910 9344 7791 gene locus_tag LOCUS_10920 9344 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_10920 9685 12972 gene locus_tag LOCUS_10930 9685 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_10930 13084 14100 gene locus_tag LOCUS_10940 13084 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918100.1 protein_id gnl|my_center|LOCUS_10940 14134 15366 gene locus_tag LOCUS_10950 gene bla 14134 15366 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037998.1 protein_id gnl|my_center|LOCUS_10950 15380 16216 gene locus_tag LOCUS_10960 15380 16216 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 protein_id gnl|my_center|LOCUS_10960 16225 17778 gene locus_tag LOCUS_10970 gene yhcX 16225 17778 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_10970 18036 17836 gene locus_tag LOCUS_10980 18036 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 18744 18094 gene locus_tag LOCUS_10990 18744 18094 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C8 protein_id gnl|my_center|LOCUS_10990 19126 18860 gene locus_tag LOCUS_11000 19126 18860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 20549 19239 gene locus_tag LOCUS_11010 20549 19239 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640670.1 protein_id gnl|my_center|LOCUS_11010 21602 20553 gene locus_tag LOCUS_11020 21602 20553 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_11020 21848 22327 gene locus_tag LOCUS_11030 21848 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 22435 22740 gene locus_tag LOCUS_11040 22435 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231597.2 protein_id gnl|my_center|LOCUS_11040 24407 22755 gene locus_tag LOCUS_11050 24407 22755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 24919 24407 gene locus_tag LOCUS_11060 24919 24407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 25646 24966 gene locus_tag LOCUS_11070 25646 24966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 26947 25901 gene locus_tag LOCUS_11080 26947 25901 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB72 protein_id gnl|my_center|LOCUS_11080 28201 26966 gene locus_tag LOCUS_11090 28201 26966 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence024 <1 836 gene locus_tag LOCUS_11100 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640003.1:alpha/beta hydrolase 1240 1653 gene locus_tag LOCUS_11110 1240 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919518.1 protein_id gnl|my_center|LOCUS_11110 1656 2189 gene locus_tag LOCUS_11120 1656 2189 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8T2 protein_id gnl|my_center|LOCUS_11120 2186 2503 gene locus_tag LOCUS_11130 2186 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2672 3232 gene locus_tag LOCUS_11140 2672 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918592.1 protein_id gnl|my_center|LOCUS_11140 3318 3704 gene locus_tag LOCUS_11150 3318 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3720 4268 gene locus_tag LOCUS_11160 3720 4268 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7S1 protein_id gnl|my_center|LOCUS_11160 4265 4606 gene locus_tag LOCUS_11170 4265 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4654 5481 gene locus_tag LOCUS_11180 gene panB 4654 5481 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVL8 protein_id gnl|my_center|LOCUS_11180 5554 6420 gene locus_tag LOCUS_11190 5554 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6425 7792 gene locus_tag LOCUS_11200 6425 7792 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 protein_id gnl|my_center|LOCUS_11200 7798 9159 gene locus_tag LOCUS_11210 gene der 7798 9159 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R6 protein_id gnl|my_center|LOCUS_11210 9763 9404 gene locus_tag LOCUS_11220 9763 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 10575 9868 gene locus_tag LOCUS_11230 10575 9868 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086835.1 protein_id gnl|my_center|LOCUS_11230 12056 10584 gene locus_tag LOCUS_11240 gene purF 12056 10584 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R2 protein_id gnl|my_center|LOCUS_11240 12658 12053 gene locus_tag LOCUS_11250 12658 12053 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974928.1 protein_id gnl|my_center|LOCUS_11250 14038 12662 gene locus_tag LOCUS_11260 gene radA 14038 12662 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7A4 protein_id gnl|my_center|LOCUS_11260 15584 14100 gene locus_tag LOCUS_11270 15584 14100 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7A8 protein_id gnl|my_center|LOCUS_11270 16405 15761 gene locus_tag LOCUS_11280 gene rplI 16405 15761 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q3 protein_id gnl|my_center|LOCUS_11280 16671 16417 gene locus_tag LOCUS_11290 gene rpsR 16671 16417 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLI9 protein_id gnl|my_center|LOCUS_11290 17163 16690 gene locus_tag LOCUS_11300 17163 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 17512 17219 gene locus_tag LOCUS_11310 17512 17219 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_11310 17780 17499 gene locus_tag LOCUS_11320 17780 17499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 18047 17835 gene locus_tag LOCUS_11330 18047 17835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 18207 18605 gene locus_tag LOCUS_11340 18207 18605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 18660 19610 gene locus_tag LOCUS_11350 18660 19610 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C853 protein_id gnl|my_center|LOCUS_11350 19610 20347 gene locus_tag LOCUS_11360 19610 20347 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_11360 20512 20748 gene locus_tag LOCUS_11370 gene acpP 20512 20748 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7P3 protein_id gnl|my_center|LOCUS_11370 20761 22041 gene locus_tag LOCUS_11380 20761 22041 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA77 protein_id gnl|my_center|LOCUS_11380 22051 23082 gene locus_tag LOCUS_11390 22051 23082 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 protein_id gnl|my_center|LOCUS_11390 23082 23963 gene locus_tag LOCUS_11400 23082 23963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919551.1 protein_id gnl|my_center|LOCUS_11400 24004 24615 gene locus_tag LOCUS_11410 gene gmk 24004 24615 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_11410 25625 24777 gene locus_tag LOCUS_11420 gene rsmA 25625 24777 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X4 protein_id gnl|my_center|LOCUS_11420 26605 25622 gene locus_tag LOCUS_11430 gene pdxA 26605 25622 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7N4 protein_id gnl|my_center|LOCUS_11430 27843 26605 gene locus_tag LOCUS_11440 27843 26605 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8Y4 protein_id gnl|my_center|LOCUS_11440 30131 27921 gene locus_tag LOCUS_11450 gene lptD 30131 27921 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7I9 protein_id gnl|my_center|LOCUS_11450 >Feature sequence025 154 1494 gene locus_tag LOCUS_11460 154 1494 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083637.1 protein_id gnl|my_center|LOCUS_11460 1781 1491 gene locus_tag LOCUS_11470 1781 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1892 3391 gene locus_tag LOCUS_11480 1892 3391 CDS product 3-polyprenyl-4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918202.1 protein_id gnl|my_center|LOCUS_11480 3721 3407 gene locus_tag LOCUS_11490 3721 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3999 3718 gene locus_tag LOCUS_11500 3999 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4771 4112 gene locus_tag LOCUS_11510 4771 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 5527 4835 gene locus_tag LOCUS_11520 5527 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 5686 6873 gene locus_tag LOCUS_11530 5686 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6986 7423 gene locus_tag LOCUS_11540 6986 7423 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_11540 8402 7506 gene locus_tag LOCUS_11550 8402 7506 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 protein_id gnl|my_center|LOCUS_11550 8510 9505 gene locus_tag LOCUS_11560 8510 9505 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_11560 9510 10388 gene locus_tag LOCUS_11570 9510 10388 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710105.1 protein_id gnl|my_center|LOCUS_11570 10385 11026 gene locus_tag LOCUS_11580 10385 11026 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816000.1 protein_id gnl|my_center|LOCUS_11580 11237 11812 gene locus_tag LOCUS_11590 11237 11812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 11924 13228 gene locus_tag LOCUS_11600 11924 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 13225 14037 gene locus_tag LOCUS_11610 13225 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 14075 14341 gene locus_tag LOCUS_11620 14075 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 14664 15785 gene locus_tag LOCUS_11630 14664 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 16125 17456 gene locus_tag LOCUS_11640 16125 17456 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022902.1 protein_id gnl|my_center|LOCUS_11640 17511 17729 gene locus_tag LOCUS_11650 17511 17729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 17790 18185 gene locus_tag LOCUS_11660 17790 18185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 18186 18848 gene locus_tag LOCUS_11670 18186 18848 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919709.1 protein_id gnl|my_center|LOCUS_11670 18910 19341 gene locus_tag LOCUS_11680 18910 19341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 19354 19746 gene locus_tag LOCUS_11690 19354 19746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 protein_id gnl|my_center|LOCUS_11690 19791 21152 gene locus_tag LOCUS_11700 19791 21152 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_11700 21167 21409 gene locus_tag LOCUS_11710 21167 21409 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918196.1 protein_id gnl|my_center|LOCUS_11710 21501 23171 gene locus_tag LOCUS_11720 21501 23171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 protein_id gnl|my_center|LOCUS_11720 23837 23172 gene locus_tag LOCUS_11730 gene ctpA 23837 23172 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_11730 23924 24673 gene locus_tag LOCUS_11740 23924 24673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 24670 25938 gene locus_tag LOCUS_11750 24670 25938 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918191.1 protein_id gnl|my_center|LOCUS_11750 25935 26945 gene locus_tag LOCUS_11760 gene lpxK 25935 26945 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58184 protein_id gnl|my_center|LOCUS_11760 26955 27899 gene locus_tag LOCUS_11770 26955 27899 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_11770 28729 27848 gene locus_tag LOCUS_11780 28729 27848 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920109.1 protein_id gnl|my_center|LOCUS_11780 28956 28726 gene locus_tag LOCUS_11790 28956 28726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640448.1 protein_id gnl|my_center|LOCUS_11790 <30031 28985 gene locus_tag LOCUS_11800 <30031 28985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92SR7:exodeoxyribonuclease 7 large subunit >Feature sequence026 468 3068 gene locus_tag LOCUS_11810 gene fecA 468 3068 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_11810 3218 4027 gene locus_tag LOCUS_11820 3218 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4024 5961 gene locus_tag LOCUS_11830 gene pulD 4024 5961 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 protein_id gnl|my_center|LOCUS_11830 5958 7448 gene locus_tag LOCUS_11840 gene pulE 5958 7448 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918063.1 protein_id gnl|my_center|LOCUS_11840 7435 8661 gene locus_tag LOCUS_11850 gene pulF 7435 8661 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918064.1 protein_id gnl|my_center|LOCUS_11850 8673 9116 gene locus_tag LOCUS_11860 8673 9116 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918065.1 protein_id gnl|my_center|LOCUS_11860 9113 9607 gene locus_tag LOCUS_11870 9113 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 9607 9966 gene locus_tag LOCUS_11880 9607 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 9963 10607 gene locus_tag LOCUS_11890 9963 10607 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918068.1 protein_id gnl|my_center|LOCUS_11890 10604 11590 gene locus_tag LOCUS_11900 gene xcsK 10604 11590 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5C3 protein_id gnl|my_center|LOCUS_11900 11587 12780 gene locus_tag LOCUS_11910 11587 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 12777 13277 gene locus_tag LOCUS_11920 12777 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 13274 14005 gene locus_tag LOCUS_11930 13274 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 14002 14454 gene locus_tag LOCUS_11940 14002 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 14524 15324 gene locus_tag LOCUS_11950 gene phnC 14524 15324 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3F1 protein_id gnl|my_center|LOCUS_11950 15321 17390 gene locus_tag LOCUS_11960 15321 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 17579 18700 gene locus_tag LOCUS_11970 gene oprO 17579 18700 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036714.1 protein_id gnl|my_center|LOCUS_11970 18781 19878 gene locus_tag LOCUS_11980 18781 19878 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_11980 21229 20075 gene locus_tag LOCUS_11990 21229 20075 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921174.1 protein_id gnl|my_center|LOCUS_11990 21348 24467 gene locus_tag LOCUS_12000 21348 24467 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Q1 protein_id gnl|my_center|LOCUS_12000 24733 26625 gene locus_tag LOCUS_12010 24733 26625 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2R4 protein_id gnl|my_center|LOCUS_12010 27521 26619 gene locus_tag LOCUS_12020 27521 26619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 27740 28561 gene locus_tag LOCUS_12030 27740 28561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 28698 29735 gene locus_tag LOCUS_12040 28698 29735 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABG7 protein_id gnl|my_center|LOCUS_12040 >Feature sequence027 1555 752 gene locus_tag LOCUS_12050 1555 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2507 1578 gene locus_tag LOCUS_12060 2507 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2673 4382 gene locus_tag LOCUS_12070 2673 4382 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_12070 4379 5020 gene locus_tag LOCUS_12080 4379 5020 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_12080 5236 7761 gene locus_tag LOCUS_12090 5236 7761 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_12090 7884 8921 gene locus_tag LOCUS_12100 7884 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 8922 9437 gene locus_tag LOCUS_12110 8922 9437 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529735.1 protein_id gnl|my_center|LOCUS_12110 9904 9434 gene locus_tag LOCUS_12120 9904 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 12048 9916 gene locus_tag LOCUS_12130 12048 9916 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_12130 13397 12045 gene locus_tag LOCUS_12140 13397 12045 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920231.1 protein_id gnl|my_center|LOCUS_12140 13548 15188 gene locus_tag LOCUS_12150 13548 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 15289 15792 gene locus_tag LOCUS_12160 15289 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 16622 15789 gene locus_tag LOCUS_12170 16622 15789 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_12170 16885 16811 gene locus_tag LOCUS_t00170 16885 16811 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17169 18428 gene locus_tag LOCUS_12180 gene murA 17169 18428 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZB1 protein_id gnl|my_center|LOCUS_12180 18438 18878 gene locus_tag LOCUS_12190 18438 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920207.1 protein_id gnl|my_center|LOCUS_12190 18875 19351 gene locus_tag LOCUS_12200 18875 19351 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFX3 protein_id gnl|my_center|LOCUS_12200 19472 19690 gene locus_tag LOCUS_12210 gene infA 19472 19690 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAM1 protein_id gnl|my_center|LOCUS_12210 19711 20295 gene locus_tag LOCUS_12220 19711 20295 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V5 protein_id gnl|my_center|LOCUS_12220 20292 21371 gene locus_tag LOCUS_12230 20292 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 21368 21538 gene locus_tag LOCUS_12240 21368 21538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 21629 21704 gene locus_tag LOCUS_t00180 21629 21704 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 22085 21723 gene locus_tag LOCUS_12250 22085 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 22776 22192 gene locus_tag LOCUS_12260 22776 22192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 22895 24340 gene locus_tag LOCUS_12270 22895 24340 CDS product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_12270 24360 25637 gene locus_tag LOCUS_12280 24360 25637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 25634 26965 gene locus_tag LOCUS_12290 25634 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_12290 26962 27936 gene locus_tag LOCUS_12300 26962 27936 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_12300 29180 27939 gene locus_tag LOCUS_12310 29180 27939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence028 2794 2177 gene locus_tag LOCUS_12320 2794 2177 CDS product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921307.1 protein_id gnl|my_center|LOCUS_12320 2903 3433 gene locus_tag LOCUS_12330 2903 3433 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_12330 4449 3430 gene locus_tag LOCUS_12340 4449 3430 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J428 protein_id gnl|my_center|LOCUS_12340 5097 4483 gene locus_tag LOCUS_12350 5097 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5311 5496 gene locus_tag LOCUS_12360 5311 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 5782 6987 gene locus_tag LOCUS_12370 5782 6987 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8I0 protein_id gnl|my_center|LOCUS_12370 7107 7568 gene locus_tag LOCUS_12380 gene dps 7107 7568 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658301.1 protein_id gnl|my_center|LOCUS_12380 8751 7858 gene locus_tag LOCUS_12390 8751 7858 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_12390 9764 8766 gene locus_tag LOCUS_12400 9764 8766 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_12400 11064 9874 gene locus_tag LOCUS_12410 11064 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 12107 11163 gene locus_tag LOCUS_12420 12107 11163 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF0 protein_id gnl|my_center|LOCUS_12420 13104 12181 gene locus_tag LOCUS_12430 13104 12181 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920689.1 protein_id gnl|my_center|LOCUS_12430 13178 13495 gene locus_tag LOCUS_12440 13178 13495 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089489.1 protein_id gnl|my_center|LOCUS_12440 13479 13940 gene locus_tag LOCUS_12450 13479 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 14071 14451 gene locus_tag LOCUS_12460 14071 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 14451 15941 gene locus_tag LOCUS_12470 14451 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 16463 16080 gene locus_tag LOCUS_12480 gene greA 16463 16080 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4I3 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12480 19832 16518 gene locus_tag LOCUS_12490 gene carB 19832 16518 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC22 protein_id gnl|my_center|LOCUS_12490 20599 19964 gene locus_tag LOCUS_12500 20599 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083175.1 protein_id gnl|my_center|LOCUS_12500 22137 20596 gene locus_tag LOCUS_12510 22137 20596 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061615.1 protein_id gnl|my_center|LOCUS_12510 23777 22152 gene locus_tag LOCUS_12520 23777 22152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 24961 23777 gene locus_tag LOCUS_12530 gene carA 24961 23777 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TK68 protein_id gnl|my_center|LOCUS_12530 25123 25599 gene locus_tag LOCUS_12540 25123 25599 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563806.1 protein_id gnl|my_center|LOCUS_12540 25661 27484 gene locus_tag LOCUS_12550 gene dnaG 25661 27484 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A401 protein_id gnl|my_center|LOCUS_12550 >Feature sequence029 <1 1334 gene locus_tag LOCUS_12560 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258122.1:transcriptional activator 1435 2106 gene locus_tag LOCUS_12570 1435 2106 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536888.1 protein_id gnl|my_center|LOCUS_12570 2120 3859 gene locus_tag LOCUS_12580 2120 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4635 3856 gene locus_tag LOCUS_12590 4635 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113852.1 protein_id gnl|my_center|LOCUS_12590 5504 4647 gene locus_tag LOCUS_12600 5504 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6661 5501 gene locus_tag LOCUS_12610 gene rlmN 6661 5501 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXM4 protein_id gnl|my_center|LOCUS_12610 6752 7972 gene locus_tag LOCUS_12620 6752 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 7982 8731 gene locus_tag LOCUS_12630 7982 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920086.1 protein_id gnl|my_center|LOCUS_12630 9229 8732 gene locus_tag LOCUS_12640 9229 8732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529690.1 protein_id gnl|my_center|LOCUS_12640 9414 9962 gene locus_tag LOCUS_12650 9414 9962 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_12650 10036 10719 gene locus_tag LOCUS_12660 10036 10719 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_12660 11252 10716 gene locus_tag LOCUS_12670 11252 10716 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_12670 12124 11249 gene locus_tag LOCUS_12680 12124 11249 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917986.1 protein_id gnl|my_center|LOCUS_12680 12264 13043 gene locus_tag LOCUS_12690 12264 13043 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_12690 13179 15473 gene locus_tag LOCUS_12700 13179 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 16786 15470 gene locus_tag LOCUS_12710 16786 15470 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_12710 16909 17109 gene locus_tag LOCUS_12720 16909 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 17198 17851 gene locus_tag LOCUS_12730 17198 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 19760 17856 gene locus_tag LOCUS_12740 19760 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 21002 19854 gene locus_tag LOCUS_12750 21002 19854 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969301.1 protein_id gnl|my_center|LOCUS_12750 22777 20999 gene locus_tag LOCUS_12760 22777 20999 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969277.1 protein_id gnl|my_center|LOCUS_12760 24557 22779 gene locus_tag LOCUS_12770 gene asnB 24557 22779 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_12770 24825 25313 gene locus_tag LOCUS_12780 24825 25313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence030 <1 578 gene locus_tag LOCUS_12790 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946516.1:glycosyl transferase 816 1568 gene locus_tag LOCUS_12800 816 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1565 3673 gene locus_tag LOCUS_12810 1565 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4518 3670 gene locus_tag LOCUS_12820 4518 3670 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142863.1 protein_id gnl|my_center|LOCUS_12820 5278 4535 gene locus_tag LOCUS_12830 5278 4535 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143766.1 protein_id gnl|my_center|LOCUS_12830 6217 5285 gene locus_tag LOCUS_12840 6217 5285 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143765.1 protein_id gnl|my_center|LOCUS_12840 6925 6221 gene locus_tag LOCUS_12850 6925 6221 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143764.1 protein_id gnl|my_center|LOCUS_12850 7864 6980 gene locus_tag LOCUS_12860 7864 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143763.1 protein_id gnl|my_center|LOCUS_12860 8116 8898 gene locus_tag LOCUS_12870 gene rfbD 8116 8898 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420610.1 protein_id gnl|my_center|LOCUS_12870 8906 9865 gene locus_tag LOCUS_12880 gene rfbA 8906 9865 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086432.1 protein_id gnl|my_center|LOCUS_12880 13798 9893 gene locus_tag LOCUS_12890 13798 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 16410 13795 gene locus_tag LOCUS_12900 16410 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 17413 16421 gene locus_tag LOCUS_12910 17413 16421 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_12910 17678 18490 gene locus_tag LOCUS_12920 17678 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 21093 18553 gene locus_tag LOCUS_12930 21093 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 21808 21083 gene locus_tag LOCUS_12940 21808 21083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 23026 21824 gene locus_tag LOCUS_12950 gene mshG 23026 21824 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261163.1 protein_id gnl|my_center|LOCUS_12950 24822 23023 gene locus_tag LOCUS_12960 24822 23023 CDS product type II secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113395.1 protein_id gnl|my_center|LOCUS_12960 26549 24981 gene locus_tag LOCUS_12970 26549 24981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 27009 27203 gene locus_tag LOCUS_12980 27009 27203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence031 469 1551 gene locus_tag LOCUS_12990 469 1551 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 protein_id gnl|my_center|LOCUS_12990 2241 1555 gene locus_tag LOCUS_13000 2241 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2357 3337 gene locus_tag LOCUS_13010 2357 3337 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921468.1 protein_id gnl|my_center|LOCUS_13010 3369 4034 gene locus_tag LOCUS_13020 gene fzlA 3369 4034 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921466.1 protein_id gnl|my_center|LOCUS_13020 4039 5049 gene locus_tag LOCUS_13030 gene queG 4039 5049 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 protein_id gnl|my_center|LOCUS_13030 5164 5883 gene locus_tag LOCUS_13040 gene cobB 5164 5883 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2S6 protein_id gnl|my_center|LOCUS_13040 5880 7481 gene locus_tag LOCUS_13050 5880 7481 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_13050 7478 9052 gene locus_tag LOCUS_13060 7478 9052 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_13060 9463 9068 gene locus_tag LOCUS_13070 9463 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921312.1 protein_id gnl|my_center|LOCUS_13070 9563 10009 gene locus_tag LOCUS_13080 gene mmcB 9563 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 protein_id gnl|my_center|LOCUS_13080 10554 10006 gene locus_tag LOCUS_13090 10554 10006 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 protein_id gnl|my_center|LOCUS_13090 11898 10585 gene locus_tag LOCUS_13100 11898 10585 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918137.1 protein_id gnl|my_center|LOCUS_13100 12010 12660 gene locus_tag LOCUS_13110 12010 12660 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_13110 12688 13917 gene locus_tag LOCUS_13120 12688 13917 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709850.1 protein_id gnl|my_center|LOCUS_13120 14372 13914 gene locus_tag LOCUS_13130 14372 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 14438 15562 gene locus_tag LOCUS_13140 14438 15562 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975188.1 protein_id gnl|my_center|LOCUS_13140 17249 15564 gene locus_tag LOCUS_13150 17249 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 19227 17299 gene locus_tag LOCUS_13160 gene pbpX 19227 17299 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918141.1 protein_id gnl|my_center|LOCUS_13160 19399 19578 gene locus_tag LOCUS_13170 19399 19578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 19673 19981 gene locus_tag LOCUS_13180 19673 19981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 20502 19978 gene locus_tag LOCUS_13190 20502 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 20566 21567 gene locus_tag LOCUS_13200 20566 21567 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_13200 21853 21641 gene locus_tag LOCUS_13210 21853 21641 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530020.1 protein_id gnl|my_center|LOCUS_13210 22161 22514 gene locus_tag LOCUS_13220 22161 22514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 22886 23899 gene locus_tag LOCUS_13230 gene asd 22886 23899 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWX8 protein_id gnl|my_center|LOCUS_13230 25798 23903 gene locus_tag LOCUS_13240 25798 23903 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708403.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence032 275 574 gene locus_tag LOCUS_13250 275 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 661 747 gene locus_tag LOCUS_t00190 661 747 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1273 1551 gene locus_tag LOCUS_13260 gene phnA 1273 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932683.1 protein_id gnl|my_center|LOCUS_13260 1551 2060 gene locus_tag LOCUS_13270 1551 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2057 3529 gene locus_tag LOCUS_13280 2057 3529 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532574.1 protein_id gnl|my_center|LOCUS_13280 3574 4176 gene locus_tag LOCUS_13290 3574 4176 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_13290 4251 4448 gene locus_tag LOCUS_13300 4251 4448 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_13300 4874 4479 gene locus_tag LOCUS_13310 4874 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5018 5632 gene locus_tag LOCUS_13320 5018 5632 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921430.1 protein_id gnl|my_center|LOCUS_13320 5681 6367 gene locus_tag LOCUS_13330 5681 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 6364 6957 gene locus_tag LOCUS_13340 6364 6957 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563197.1 protein_id gnl|my_center|LOCUS_13340 6954 7724 gene locus_tag LOCUS_13350 6954 7724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921427.1 protein_id gnl|my_center|LOCUS_13350 7764 9260 gene locus_tag LOCUS_13360 7764 9260 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCA2 protein_id gnl|my_center|LOCUS_13360 9373 9969 gene locus_tag LOCUS_13370 9373 9969 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921424.1 protein_id gnl|my_center|LOCUS_13370 10035 10499 gene locus_tag LOCUS_13380 10035 10499 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 protein_id gnl|my_center|LOCUS_13380 10734 10570 gene locus_tag LOCUS_13390 10734 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 11092 11484 gene locus_tag LOCUS_13400 11092 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 11481 12794 gene locus_tag LOCUS_13410 11481 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 13056 13703 gene locus_tag LOCUS_13420 13056 13703 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887011.1 protein_id gnl|my_center|LOCUS_13420 13696 14934 gene locus_tag LOCUS_13430 13696 14934 CDS product putative kinase Y4dM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55412 protein_id gnl|my_center|LOCUS_13430 15289 21726 gene locus_tag LOCUS_13440 15289 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 22323 22829 gene locus_tag LOCUS_13450 22323 22829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 22832 23230 gene locus_tag LOCUS_13460 22832 23230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 24438 23803 gene locus_tag LOCUS_13470 24438 23803 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_13470 24688 24981 gene locus_tag LOCUS_13480 24688 24981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 25718 24978 gene locus_tag LOCUS_13490 25718 24978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence033 853 218 gene locus_tag LOCUS_13500 853 218 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 protein_id gnl|my_center|LOCUS_13500 953 1795 gene locus_tag LOCUS_13510 953 1795 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919328.1 protein_id gnl|my_center|LOCUS_13510 1849 2223 gene locus_tag LOCUS_13520 1849 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919329.1 protein_id gnl|my_center|LOCUS_13520 3213 2227 gene locus_tag LOCUS_13530 3213 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402886.1 protein_id gnl|my_center|LOCUS_13530 4341 3223 gene locus_tag LOCUS_13540 4341 3223 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_13540 5459 4338 gene locus_tag LOCUS_13550 5459 4338 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104870.1 protein_id gnl|my_center|LOCUS_13550 5718 5485 gene locus_tag LOCUS_13560 5718 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6311 5718 gene locus_tag LOCUS_13570 6311 5718 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918270.1 protein_id gnl|my_center|LOCUS_13570 7214 6357 gene locus_tag LOCUS_13580 7214 6357 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532568.1 protein_id gnl|my_center|LOCUS_13580 7204 8163 gene locus_tag LOCUS_13590 7204 8163 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_13590 8160 9503 gene locus_tag LOCUS_13600 8160 9503 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5S1 protein_id gnl|my_center|LOCUS_13600 9503 10270 gene locus_tag LOCUS_13610 9503 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 10689 10267 gene locus_tag LOCUS_13620 10689 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 11081 10722 gene locus_tag LOCUS_13630 11081 10722 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_13630 11161 11778 gene locus_tag LOCUS_13640 11161 11778 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_13640 12575 11775 gene locus_tag LOCUS_13650 12575 11775 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921213.1 protein_id gnl|my_center|LOCUS_13650 13418 12627 gene locus_tag LOCUS_13660 13418 12627 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A321 protein_id gnl|my_center|LOCUS_13660 14883 13477 gene locus_tag LOCUS_13670 14883 13477 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923265.1 protein_id gnl|my_center|LOCUS_13670 15833 14880 gene locus_tag LOCUS_13680 15833 14880 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S35 protein_id gnl|my_center|LOCUS_13680 16431 15871 gene locus_tag LOCUS_13690 16431 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947372.1 protein_id gnl|my_center|LOCUS_13690 17035 16445 gene locus_tag LOCUS_13700 17035 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 17641 17039 gene locus_tag LOCUS_13710 17641 17039 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203376.1 protein_id gnl|my_center|LOCUS_13710 17737 19515 gene locus_tag LOCUS_13720 17737 19515 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921222.1 protein_id gnl|my_center|LOCUS_13720 19889 19512 gene locus_tag LOCUS_13730 19889 19512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265546.1 protein_id gnl|my_center|LOCUS_13730 19992 20219 gene locus_tag LOCUS_13740 19992 20219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 20216 20536 gene locus_tag LOCUS_13750 20216 20536 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_13750 20533 21321 gene locus_tag LOCUS_13760 20533 21321 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 protein_id gnl|my_center|LOCUS_13760 21338 22210 gene locus_tag LOCUS_13770 21338 22210 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_13770 22347 22751 gene locus_tag LOCUS_13780 22347 22751 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529654.1 protein_id gnl|my_center|LOCUS_13780 22791 23753 gene locus_tag LOCUS_13790 22791 23753 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338742.1 protein_id gnl|my_center|LOCUS_13790 23774 24367 gene locus_tag LOCUS_13800 23774 24367 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919932.1 protein_id gnl|my_center|LOCUS_13800 24432 24677 gene locus_tag LOCUS_13810 gene xseB 24432 24677 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M3 protein_id gnl|my_center|LOCUS_13810 24677 25564 gene locus_tag LOCUS_13820 24677 25564 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919930.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence034 523 1113 gene locus_tag LOCUS_13830 523 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1412 1110 gene locus_tag LOCUS_13840 1412 1110 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 protein_id gnl|my_center|LOCUS_13840 2025 1405 gene locus_tag LOCUS_13850 2025 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3172 2237 gene locus_tag LOCUS_13860 gene xerC 3172 2237 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7E9 protein_id gnl|my_center|LOCUS_13860 3837 3154 gene locus_tag LOCUS_13870 3837 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3956 6139 gene locus_tag LOCUS_13880 gene priA 3956 6139 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB85 protein_id gnl|my_center|LOCUS_13880 6158 6877 gene locus_tag LOCUS_13890 6158 6877 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087355.1 protein_id gnl|my_center|LOCUS_13890 7983 6874 gene locus_tag LOCUS_13900 gene solA 7983 6874 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_13900 8239 8796 gene locus_tag LOCUS_13910 gene atpH 8239 8796 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X71 protein_id gnl|my_center|LOCUS_13910 8804 10333 gene locus_tag LOCUS_13920 gene atpA 8804 10333 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL31 protein_id gnl|my_center|LOCUS_13920 10356 11243 gene locus_tag LOCUS_13930 gene atpG 10356 11243 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC75 protein_id gnl|my_center|LOCUS_13930 11267 12706 gene locus_tag LOCUS_13940 gene atpD 11267 12706 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X74 protein_id gnl|my_center|LOCUS_13940 12806 13573 gene locus_tag LOCUS_13950 12806 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 13662 14063 gene locus_tag LOCUS_13960 gene atpC 13662 14063 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV17 protein_id gnl|my_center|LOCUS_13960 14114 14359 gene locus_tag LOCUS_13970 14114 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 14805 14317 gene locus_tag LOCUS_13980 gene rppH 14805 14317 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5H3 protein_id gnl|my_center|LOCUS_13980 15995 14805 gene locus_tag LOCUS_13990 15995 14805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 17396 16104 gene locus_tag LOCUS_14000 17396 16104 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921264.1 protein_id gnl|my_center|LOCUS_14000 18647 17427 gene locus_tag LOCUS_14010 18647 17427 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_14010 19122 18652 gene locus_tag LOCUS_14020 gene rlmH 19122 18652 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI5 protein_id gnl|my_center|LOCUS_14020 19365 19129 gene locus_tag LOCUS_14030 19365 19129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 20571 19591 gene locus_tag LOCUS_14040 20571 19591 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_14040 21252 20605 gene locus_tag LOCUS_14050 gene nadD 21252 20605 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C4 protein_id gnl|my_center|LOCUS_14050 22304 21249 gene locus_tag LOCUS_14060 gene cgtA 22304 21249 CDS product GTPase Obg/CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYI7 protein_id gnl|my_center|LOCUS_14060 22503 23399 gene locus_tag LOCUS_14070 22503 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 23528 24205 gene locus_tag LOCUS_14080 23528 24205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 24732 24202 gene locus_tag LOCUS_14090 24732 24202 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918206.1 protein_id gnl|my_center|LOCUS_14090 25114 24848 gene locus_tag LOCUS_14100 gene rpmA 25114 24848 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB7 protein_id gnl|my_center|LOCUS_14100 25642 25118 gene locus_tag LOCUS_14110 25642 25118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 25855 25944 gene locus_tag LOCUS_t00200 25855 25944 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 826 3378 gene locus_tag LOCUS_14120 826 3378 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637089.2 protein_id gnl|my_center|LOCUS_14120 3449 3859 gene locus_tag LOCUS_14130 3449 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3864 4799 gene locus_tag LOCUS_14140 3864 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_14140 4894 6000 gene locus_tag LOCUS_14150 4894 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_14150 6012 6866 gene locus_tag LOCUS_14160 6012 6866 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_14160 7078 7926 gene locus_tag LOCUS_14170 7078 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 10055 8013 gene locus_tag LOCUS_14180 10055 8013 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921399.1 protein_id gnl|my_center|LOCUS_14180 14923 10055 gene locus_tag LOCUS_14190 14923 10055 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921400.1 protein_id gnl|my_center|LOCUS_14190 15095 15781 gene locus_tag LOCUS_14200 gene fabG 15095 15781 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_14200 15988 16212 gene locus_tag LOCUS_14210 15988 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 17414 16209 gene locus_tag LOCUS_14220 17414 16209 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_14220 17740 17411 gene locus_tag LOCUS_14230 17740 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14230 18553 17747 gene locus_tag LOCUS_14240 18553 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14240 19170 18550 gene locus_tag LOCUS_14250 19170 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 19949 19167 gene locus_tag LOCUS_14260 gene kdsB 19949 19167 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385423.1 protein_id gnl|my_center|LOCUS_14260 20518 20832 gene locus_tag LOCUS_14270 20518 20832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 20888 21214 gene locus_tag LOCUS_14280 20888 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21266 22327 gene locus_tag LOCUS_14290 gene argF' 21266 22327 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 protein_id gnl|my_center|LOCUS_14290 22324 23643 gene locus_tag LOCUS_14300 gene argB 22324 23643 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J6 protein_id gnl|my_center|LOCUS_14300 23640 24584 gene locus_tag LOCUS_14310 gene argC 23640 24584 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J8 protein_id gnl|my_center|LOCUS_14310 25303 24620 gene locus_tag LOCUS_14320 25303 24620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence036 1 732 gene locus_tag LOCUS_14330 1 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 745 4482 gene locus_tag LOCUS_14340 gene narG 745 4482 CDS product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205550.1 protein_id gnl|my_center|LOCUS_14340 4479 6005 gene locus_tag LOCUS_14350 gene narH 4479 6005 CDS product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_14350 6005 6703 gene locus_tag LOCUS_14360 gene narJ 6005 6703 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 protein_id gnl|my_center|LOCUS_14360 6700 7404 gene locus_tag LOCUS_14370 gene narI 6700 7404 CDS product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 protein_id gnl|my_center|LOCUS_14370 7401 8234 gene locus_tag LOCUS_14380 7401 8234 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528382.1 protein_id gnl|my_center|LOCUS_14380 8257 9459 gene locus_tag LOCUS_14390 8257 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_14390 9489 10172 gene locus_tag LOCUS_14400 9489 10172 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2J2 protein_id gnl|my_center|LOCUS_14400 10261 10632 gene locus_tag LOCUS_14410 gene csaA 10261 10632 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_14410 12573 10633 gene locus_tag LOCUS_14420 12573 10633 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606001.1 protein_id gnl|my_center|LOCUS_14420 14641 12587 gene locus_tag LOCUS_14430 14641 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_14430 17255 14667 gene locus_tag LOCUS_14440 17255 14667 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_14440 17577 18083 gene locus_tag LOCUS_14450 17577 18083 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 protein_id gnl|my_center|LOCUS_14450 20275 18140 gene locus_tag LOCUS_14460 20275 18140 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528794.1 protein_id gnl|my_center|LOCUS_14460 20458 21060 gene locus_tag LOCUS_14470 gene tdk 20458 21060 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI10 protein_id gnl|my_center|LOCUS_14470 21053 21727 gene locus_tag LOCUS_14480 21053 21727 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGL4 protein_id gnl|my_center|LOCUS_14480 21824 22939 gene locus_tag LOCUS_14490 21824 22939 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_14490 23720 22959 gene locus_tag LOCUS_14500 23720 22959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence037 <1 1183 gene locus_tag LOCUS_14510 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639997.1:gamma-glutamyltranspeptidase 2628 1180 gene locus_tag LOCUS_14520 gene cenK 2628 1180 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918418.1 protein_id gnl|my_center|LOCUS_14520 2914 3270 gene locus_tag LOCUS_14530 2914 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3292 5061 gene locus_tag LOCUS_14540 gene yidC 3292 5061 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDM9 protein_id gnl|my_center|LOCUS_14540 5139 5705 gene locus_tag LOCUS_14550 gene engB 5139 5705 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZG89 protein_id gnl|my_center|LOCUS_14550 5715 6728 gene locus_tag LOCUS_14560 5715 6728 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090824.1 protein_id gnl|my_center|LOCUS_14560 6725 7423 gene locus_tag LOCUS_14570 6725 7423 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918171.1 protein_id gnl|my_center|LOCUS_14570 7420 8247 gene locus_tag LOCUS_14580 gene dapD 7420 8247 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_14580 8249 9391 gene locus_tag LOCUS_14590 gene dapE 8249 9391 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF3 protein_id gnl|my_center|LOCUS_14590 9388 9960 gene locus_tag LOCUS_14600 9388 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 10694 9957 gene locus_tag LOCUS_14610 gene truA 10694 9957 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP1 protein_id gnl|my_center|LOCUS_14610 11626 10694 gene locus_tag LOCUS_14620 gene fmt 11626 10694 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABE9 protein_id gnl|my_center|LOCUS_14620 12307 11675 gene locus_tag LOCUS_14630 12307 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_14630 12984 12466 gene locus_tag LOCUS_14640 12984 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 13508 12981 gene locus_tag LOCUS_14650 gene def 13508 12981 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF5 protein_id gnl|my_center|LOCUS_14650 14902 13541 gene locus_tag LOCUS_14660 gene rmuC 14902 13541 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4U3 protein_id gnl|my_center|LOCUS_14660 15008 16141 gene locus_tag LOCUS_14670 15008 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921516.1 protein_id gnl|my_center|LOCUS_14670 16764 16159 gene locus_tag LOCUS_14680 gene recR 16764 16159 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 protein_id gnl|my_center|LOCUS_14680 17094 16771 gene locus_tag LOCUS_14690 17094 16771 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYD9 protein_id gnl|my_center|LOCUS_14690 18875 17091 gene locus_tag LOCUS_14700 gene dnaX 18875 17091 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918156.1 protein_id gnl|my_center|LOCUS_14700 20617 19049 gene locus_tag LOCUS_14710 20617 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 20880 20686 gene locus_tag LOCUS_14720 20880 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 21963 20977 gene locus_tag LOCUS_14730 21963 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 23458 21869 gene locus_tag LOCUS_14740 23458 21869 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence038 1032 2012 gene locus_tag LOCUS_14750 1032 2012 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_14750 2392 3105 gene locus_tag LOCUS_14760 2392 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4813 3167 gene locus_tag LOCUS_14770 gene groL 4813 3167 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H163 protein_id gnl|my_center|LOCUS_14770 5162 4875 gene locus_tag LOCUS_14780 gene groS1 5162 4875 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35473 protein_id gnl|my_center|LOCUS_14780 5396 6067 gene locus_tag LOCUS_14790 5396 6067 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918090.1 protein_id gnl|my_center|LOCUS_14790 6165 7373 gene locus_tag LOCUS_14800 gene tipF 6165 7373 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 protein_id gnl|my_center|LOCUS_14800 7415 8260 gene locus_tag LOCUS_14810 7415 8260 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265598.1 protein_id gnl|my_center|LOCUS_14810 8323 8766 gene locus_tag LOCUS_14820 8323 8766 CDS product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921327.1 protein_id gnl|my_center|LOCUS_14820 8776 9699 gene locus_tag LOCUS_14830 8776 9699 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_14830 9747 10268 gene locus_tag LOCUS_14840 gene lspA 9747 10268 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ33 protein_id gnl|my_center|LOCUS_14840 10337 10861 gene locus_tag LOCUS_14850 gene bamF 10337 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640037.1 protein_id gnl|my_center|LOCUS_14850 10932 11219 gene locus_tag LOCUS_14860 10932 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 11251 13065 gene locus_tag LOCUS_14870 gene mutL 11251 13065 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV5 protein_id gnl|my_center|LOCUS_14870 13181 14050 gene locus_tag LOCUS_14880 13181 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 14617 14051 gene locus_tag LOCUS_14890 14617 14051 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_14890 15365 14619 gene locus_tag LOCUS_14900 15365 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 15407 15868 gene locus_tag LOCUS_14910 gene tadA 15407 15868 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABJ6 protein_id gnl|my_center|LOCUS_14910 16436 15840 gene locus_tag LOCUS_14920 16436 15840 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887249.1 protein_id gnl|my_center|LOCUS_14920 17179 16448 gene locus_tag LOCUS_14930 17179 16448 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_14930 17268 18485 gene locus_tag LOCUS_14940 17268 18485 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_14940 18488 18895 gene locus_tag LOCUS_14950 18488 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 18955 19371 gene locus_tag LOCUS_14960 18955 19371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 20432 19368 gene locus_tag LOCUS_14970 20432 19368 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088202.1 protein_id gnl|my_center|LOCUS_14970 21709 20429 gene locus_tag LOCUS_14980 21709 20429 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_14980 23017 21737 gene locus_tag LOCUS_14990 gene purD 23017 21737 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DE1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence039 1392 1132 gene locus_tag LOCUS_15000 1392 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1535 1445 gene locus_tag LOCUS_t00210 1535 1445 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1664 2863 gene locus_tag LOCUS_15010 1664 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2955 4784 gene locus_tag LOCUS_15020 gene bipA 2955 4784 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074056.1 protein_id gnl|my_center|LOCUS_15020 5022 6209 gene locus_tag LOCUS_15030 5022 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 7970 6210 gene locus_tag LOCUS_15040 7970 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_15040 8538 7993 gene locus_tag LOCUS_15050 8538 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 9513 8650 gene locus_tag LOCUS_15060 9513 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_15060 9617 9949 gene locus_tag LOCUS_15070 9617 9949 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086585.1 protein_id gnl|my_center|LOCUS_15070 10118 10432 gene locus_tag LOCUS_15080 10118 10432 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869726.1 protein_id gnl|my_center|LOCUS_15080 10425 10673 gene locus_tag LOCUS_15090 10425 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15090 10695 11312 gene locus_tag LOCUS_15100 10695 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15100 11312 12607 gene locus_tag LOCUS_15110 gene hisD 11312 12607 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKB8 protein_id gnl|my_center|LOCUS_15110 12600 13727 gene locus_tag LOCUS_15120 12600 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 13724 14323 gene locus_tag LOCUS_15130 gene hisH 13724 14323 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P1 protein_id gnl|my_center|LOCUS_15130 14320 15054 gene locus_tag LOCUS_15140 gene hisA 14320 15054 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EIU5 protein_id gnl|my_center|LOCUS_15140 15036 15803 gene locus_tag LOCUS_15150 gene hisF 15036 15803 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N9 protein_id gnl|my_center|LOCUS_15150 15800 16405 gene locus_tag LOCUS_15160 gene hisI 15800 16405 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUU7 protein_id gnl|my_center|LOCUS_15160 17757 16402 gene locus_tag LOCUS_15170 gene hutF 17757 16402 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 protein_id gnl|my_center|LOCUS_15170 17821 19023 gene locus_tag LOCUS_15180 gene hutI 17821 19023 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GV2 protein_id gnl|my_center|LOCUS_15180 19020 20537 gene locus_tag LOCUS_15190 gene hutH 19020 20537 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2S1 protein_id gnl|my_center|LOCUS_15190 20537 21343 gene locus_tag LOCUS_15200 20537 21343 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389055.1 protein_id gnl|my_center|LOCUS_15200 21343 23010 gene locus_tag LOCUS_15210 gene hutU 21343 23010 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GV4 protein_id gnl|my_center|LOCUS_15210 >Feature sequence040 <1 1024 gene locus_tag LOCUS_15220 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529369.1:cobaltochelatase subunit CobT 1021 2019 gene locus_tag LOCUS_15230 1021 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918557.1 protein_id gnl|my_center|LOCUS_15230 3874 2186 gene locus_tag LOCUS_15240 3874 2186 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918544.1 protein_id gnl|my_center|LOCUS_15240 4464 3904 gene locus_tag LOCUS_15250 4464 3904 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084104.1 protein_id gnl|my_center|LOCUS_15250 4824 4537 gene locus_tag LOCUS_15260 gene rpmB 4824 4537 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4W8 protein_id gnl|my_center|LOCUS_15260 5023 5835 gene locus_tag LOCUS_15270 5023 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082993.1 protein_id gnl|my_center|LOCUS_15270 5851 8421 gene locus_tag LOCUS_15280 gene mgpS 5851 8421 CDS product ATP-dependent helicase MgpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003581.1 protein_id gnl|my_center|LOCUS_15280 8418 8714 gene locus_tag LOCUS_15290 8418 8714 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918542.1 protein_id gnl|my_center|LOCUS_15290 8707 9159 gene locus_tag LOCUS_15300 8707 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720534.1 protein_id gnl|my_center|LOCUS_15300 9224 9565 gene locus_tag LOCUS_15310 9224 9565 CDS product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918540.1 protein_id gnl|my_center|LOCUS_15310 9724 10278 gene locus_tag LOCUS_15320 9724 10278 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918539.1 protein_id gnl|my_center|LOCUS_15320 10382 11275 gene locus_tag LOCUS_15330 10382 11275 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529172.1 protein_id gnl|my_center|LOCUS_15330 12124 11282 gene locus_tag LOCUS_15340 12124 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 12185 12261 gene locus_tag LOCUS_t00220 12185 12261 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13903 12311 gene locus_tag LOCUS_15350 gene abgT 13903 12311 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 protein_id gnl|my_center|LOCUS_15350 14944 14027 gene locus_tag LOCUS_15360 14944 14027 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_15360 15804 14941 gene locus_tag LOCUS_15370 gene rbsK 15804 14941 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DK00 protein_id gnl|my_center|LOCUS_15370 16739 15801 gene locus_tag LOCUS_15380 16739 15801 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267466.1 protein_id gnl|my_center|LOCUS_15380 16898 17671 gene locus_tag LOCUS_15390 16898 17671 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_15390 19825 17675 gene locus_tag LOCUS_15400 19825 17675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 19980 20777 gene locus_tag LOCUS_15410 19980 20777 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_15410 21535 20774 gene locus_tag LOCUS_15420 21535 20774 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT03 protein_id gnl|my_center|LOCUS_15420 <22914 21529 gene locus_tag LOCUS_15430 <22914 21529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NN18:UPF0061 protein >Feature sequence041 1862 675 gene locus_tag LOCUS_15440 gene argD 1862 675 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKT0 protein_id gnl|my_center|LOCUS_15440 2681 1920 gene locus_tag LOCUS_15450 2681 1920 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A651 protein_id gnl|my_center|LOCUS_15450 2948 3463 gene locus_tag LOCUS_15460 2948 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4156 3467 gene locus_tag LOCUS_15470 gene phoB 4156 3467 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_15470 4871 4170 gene locus_tag LOCUS_15480 gene phoU 4871 4170 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV9 protein_id gnl|my_center|LOCUS_15480 5704 4892 gene locus_tag LOCUS_15490 gene pstB 5704 4892 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYG4 protein_id gnl|my_center|LOCUS_15490 7443 5707 gene locus_tag LOCUS_15500 7443 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 9007 7436 gene locus_tag LOCUS_15510 9007 7436 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABD8 protein_id gnl|my_center|LOCUS_15510 10596 9208 gene locus_tag LOCUS_15520 gene phoR 10596 9208 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918178.1 protein_id gnl|my_center|LOCUS_15520 10843 12231 gene locus_tag LOCUS_15530 gene mtrE 10843 12231 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244265.1 protein_id gnl|my_center|LOCUS_15530 12241 13539 gene locus_tag LOCUS_15540 12241 13539 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_15540 13564 16773 gene locus_tag LOCUS_15550 13564 16773 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_15550 16889 18982 gene locus_tag LOCUS_15560 16889 18982 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122114.1 protein_id gnl|my_center|LOCUS_15560 19162 21267 gene locus_tag LOCUS_15570 19162 21267 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 protein_id gnl|my_center|LOCUS_15570 21416 21964 gene locus_tag LOCUS_15580 21416 21964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence042 1359 46 gene locus_tag LOCUS_15590 gene amt-2 1359 46 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_15590 1560 2510 gene locus_tag LOCUS_15600 1560 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2513 2905 gene locus_tag LOCUS_15610 2513 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4087 2966 gene locus_tag LOCUS_15620 4087 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5316 4087 gene locus_tag LOCUS_15630 5316 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5857 5399 gene locus_tag LOCUS_15640 5857 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090683.1 protein_id gnl|my_center|LOCUS_15640 5984 6904 gene locus_tag LOCUS_15650 5984 6904 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_15650 7428 6883 gene locus_tag LOCUS_15660 7428 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 7528 8229 gene locus_tag LOCUS_15670 7528 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 8253 10013 gene locus_tag LOCUS_15680 8253 10013 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_15680 10171 10533 gene locus_tag LOCUS_15690 10171 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 11318 10515 gene locus_tag LOCUS_15700 11318 10515 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919543.1 protein_id gnl|my_center|LOCUS_15700 12432 11413 gene locus_tag LOCUS_15710 12432 11413 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_15710 13844 12444 gene locus_tag LOCUS_15720 13844 12444 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9C8 protein_id gnl|my_center|LOCUS_15720 14182 13841 gene locus_tag LOCUS_15730 14182 13841 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921136.1 protein_id gnl|my_center|LOCUS_15730 15318 14197 gene locus_tag LOCUS_15740 15318 14197 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921137.1 protein_id gnl|my_center|LOCUS_15740 15707 15411 gene locus_tag LOCUS_15750 15707 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 16740 15796 gene locus_tag LOCUS_15760 16740 15796 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_15760 17505 16795 gene locus_tag LOCUS_15770 17505 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 17784 19235 gene locus_tag LOCUS_15780 gene tacA 17784 19235 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 protein_id gnl|my_center|LOCUS_15780 20876 19329 gene locus_tag LOCUS_15790 20876 19329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 20971 22026 gene locus_tag LOCUS_15800 20971 22026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence043 612 1508 gene locus_tag LOCUS_15810 612 1508 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_15810 2120 1581 gene locus_tag LOCUS_15820 2120 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2432 3178 gene locus_tag LOCUS_15830 2432 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4023 3175 gene locus_tag LOCUS_15840 4023 3175 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_15840 5392 4025 gene locus_tag LOCUS_15850 5392 4025 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_15850 5508 6317 gene locus_tag LOCUS_15860 5508 6317 CDS product pilus assembly protein TadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920775.1 protein_id gnl|my_center|LOCUS_15860 6824 6324 gene locus_tag LOCUS_15870 6824 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 7860 6883 gene locus_tag LOCUS_15880 7860 6883 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 protein_id gnl|my_center|LOCUS_15880 8859 7870 gene locus_tag LOCUS_15890 8859 7870 CDS product secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920778.1 protein_id gnl|my_center|LOCUS_15890 10173 8863 gene locus_tag LOCUS_15900 gene cpaF 10173 8863 CDS product pilus assembly protein CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920779.1 protein_id gnl|my_center|LOCUS_15900 11900 10350 gene locus_tag LOCUS_15910 gene cpaE 11900 10350 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920780.1 protein_id gnl|my_center|LOCUS_15910 12590 11916 gene locus_tag LOCUS_15920 12590 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 14061 12604 gene locus_tag LOCUS_15930 gene cpaC 14061 12604 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920782.1 protein_id gnl|my_center|LOCUS_15930 14920 14072 gene locus_tag LOCUS_15940 14920 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 15537 15034 gene locus_tag LOCUS_15950 gene cpaA 15537 15034 CDS product pilus assembly protein CpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920784.1 protein_id gnl|my_center|LOCUS_15950 15832 15674 gene locus_tag LOCUS_15960 15832 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 16114 16599 gene locus_tag LOCUS_15970 16114 16599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 16688 17215 gene locus_tag LOCUS_15980 16688 17215 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 protein_id gnl|my_center|LOCUS_15980 17208 17744 gene locus_tag LOCUS_15990 17208 17744 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920788.1 protein_id gnl|my_center|LOCUS_15990 18548 17745 gene locus_tag LOCUS_16000 18548 17745 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920789.1 protein_id gnl|my_center|LOCUS_16000 19819 18551 gene locus_tag LOCUS_16010 19819 18551 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388887.1 protein_id gnl|my_center|LOCUS_16010 20580 19816 gene locus_tag LOCUS_16020 20580 19816 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 protein_id gnl|my_center|LOCUS_16020 22141 20678 gene locus_tag LOCUS_16030 gene amn 22141 20678 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABG3 protein_id gnl|my_center|LOCUS_16030 >Feature sequence044 2213 657 gene locus_tag LOCUS_16040 2213 657 CDS product 4-coumarate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_16040 2963 2307 gene locus_tag LOCUS_16050 2963 2307 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918223.1 protein_id gnl|my_center|LOCUS_16050 3217 5538 gene locus_tag LOCUS_16060 3217 5538 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_16060 5591 6535 gene locus_tag LOCUS_16070 5591 6535 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_16070 6532 7908 gene locus_tag LOCUS_16080 6532 7908 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_16080 7912 8772 gene locus_tag LOCUS_16090 7912 8772 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 protein_id gnl|my_center|LOCUS_16090 8846 9778 gene locus_tag LOCUS_16100 8846 9778 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U7F8 protein_id gnl|my_center|LOCUS_16100 9775 10398 gene locus_tag LOCUS_16110 9775 10398 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_16110 10492 11199 gene locus_tag LOCUS_16120 10492 11199 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 protein_id gnl|my_center|LOCUS_16120 11193 13559 gene locus_tag LOCUS_16130 11193 13559 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_16130 13566 14792 gene locus_tag LOCUS_16140 13566 14792 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_16140 14913 15890 gene locus_tag LOCUS_16150 gene msrP 14913 15890 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU8 protein_id gnl|my_center|LOCUS_16150 15896 16561 gene locus_tag LOCUS_16160 gene msrQ 15896 16561 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU7 protein_id gnl|my_center|LOCUS_16160 16621 17142 gene locus_tag LOCUS_16170 16621 17142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 17219 19324 gene locus_tag LOCUS_16180 17219 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 19335 20453 gene locus_tag LOCUS_16190 gene adhI 19335 20453 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VT06 protein_id gnl|my_center|LOCUS_16190 20453 20887 gene locus_tag LOCUS_16200 20453 20887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 21003 21839 gene locus_tag LOCUS_16210 21003 21839 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H09 protein_id gnl|my_center|LOCUS_16210 >Feature sequence045 1248 2207 gene locus_tag LOCUS_16220 1248 2207 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_16220 3021 2221 gene locus_tag LOCUS_16230 gene uppP1 3021 2221 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH3 protein_id gnl|my_center|LOCUS_16230 4029 3328 gene locus_tag LOCUS_16240 4029 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 4941 4075 gene locus_tag LOCUS_16250 4941 4075 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_16250 7352 4995 gene locus_tag LOCUS_16260 7352 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 8026 7523 gene locus_tag LOCUS_16270 8026 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 8500 8066 gene locus_tag LOCUS_16280 8500 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 9342 8497 gene locus_tag LOCUS_16290 9342 8497 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_16290 10456 9449 gene locus_tag LOCUS_16300 gene oruR 10456 9449 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_16300 10599 11864 gene locus_tag LOCUS_16310 10599 11864 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 protein_id gnl|my_center|LOCUS_16310 12138 11866 gene locus_tag LOCUS_16320 12138 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 12224 13306 gene locus_tag LOCUS_16330 12224 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 13430 14464 gene locus_tag LOCUS_16340 13430 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 14518 14796 gene locus_tag LOCUS_16350 14518 14796 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABI2 protein_id gnl|my_center|LOCUS_16350 15119 14817 gene locus_tag LOCUS_16360 15119 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 15147 15317 gene locus_tag LOCUS_16370 15147 15317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 15391 16179 gene locus_tag LOCUS_16380 15391 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972647.1 protein_id gnl|my_center|LOCUS_16380 16419 16344 gene locus_tag LOCUS_t00230 16419 16344 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16946 16500 gene locus_tag LOCUS_16390 16946 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 17095 18372 gene locus_tag LOCUS_16400 gene aroA 17095 18372 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WF2 protein_id gnl|my_center|LOCUS_16400 18369 19007 gene locus_tag LOCUS_16410 gene cmk 18369 19007 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP6 protein_id gnl|my_center|LOCUS_16410 19204 21090 gene locus_tag LOCUS_16420 19204 21090 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCW5 protein_id gnl|my_center|LOCUS_16420 21219 21506 gene locus_tag LOCUS_16430 gene ihfB 21219 21506 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C3 protein_id gnl|my_center|LOCUS_16430 >Feature sequence046 1121 630 gene locus_tag LOCUS_16440 gene purE 1121 630 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3C0 protein_id gnl|my_center|LOCUS_16440 1273 2010 gene locus_tag LOCUS_16450 gene dgcA 1273 2010 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_16450 2228 2013 gene locus_tag LOCUS_16460 2228 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_16460 2758 2291 gene locus_tag LOCUS_16470 2758 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16470 3357 2755 gene locus_tag LOCUS_16480 gene ubiX 3357 2755 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD02 protein_id gnl|my_center|LOCUS_16480 3449 3619 gene locus_tag LOCUS_16490 3449 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921123.1 protein_id gnl|my_center|LOCUS_16490 3709 4578 gene locus_tag LOCUS_16500 3709 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4592 5401 gene locus_tag LOCUS_16510 4592 5401 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_16510 6069 5377 gene locus_tag LOCUS_16520 6069 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923245.1 protein_id gnl|my_center|LOCUS_16520 7210 6224 gene locus_tag LOCUS_16530 7210 6224 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_16530 7289 7483 gene locus_tag LOCUS_16540 7289 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 7539 8060 gene locus_tag LOCUS_16550 gene rcdA 7539 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 protein_id gnl|my_center|LOCUS_16550 8354 8136 gene locus_tag LOCUS_16560 gene rpmE 8354 8136 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM38 protein_id gnl|my_center|LOCUS_16560 9466 8453 gene locus_tag LOCUS_16570 9466 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709323.1 protein_id gnl|my_center|LOCUS_16570 10465 9470 gene locus_tag LOCUS_16580 10465 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709324.1 protein_id gnl|my_center|LOCUS_16580 12324 10642 gene locus_tag LOCUS_16590 12324 10642 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 protein_id gnl|my_center|LOCUS_16590 14641 12335 gene locus_tag LOCUS_16600 14641 12335 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_16600 15875 16234 gene locus_tag LOCUS_16610 15875 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 17997 17263 gene locus_tag LOCUS_16620 17997 17263 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_16620 19407 18001 gene locus_tag LOCUS_16630 19407 18001 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLW9 protein_id gnl|my_center|LOCUS_16630 21023 19419 gene locus_tag LOCUS_16640 21023 19419 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090609.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence047 96 731 gene locus_tag LOCUS_16650 96 731 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403961.1 protein_id gnl|my_center|LOCUS_16650 833 1960 gene locus_tag LOCUS_16660 833 1960 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_16660 1964 5101 gene locus_tag LOCUS_16670 1964 5101 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_16670 5121 5711 gene locus_tag LOCUS_16680 5121 5711 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_16680 5713 6525 gene locus_tag LOCUS_16690 gene cysE 5713 6525 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 protein_id gnl|my_center|LOCUS_16690 6550 6822 gene locus_tag LOCUS_16700 6550 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6819 7610 gene locus_tag LOCUS_16710 6819 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 7607 9151 gene locus_tag LOCUS_16720 7607 9151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089230.1 protein_id gnl|my_center|LOCUS_16720 9234 9788 gene locus_tag LOCUS_16730 9234 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 10613 9849 gene locus_tag LOCUS_16740 10613 9849 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 protein_id gnl|my_center|LOCUS_16740 10945 11478 gene locus_tag LOCUS_16750 10945 11478 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_16750 11892 11799 gene locus_tag LOCUS_t00240 11892 11799 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12851 12234 gene locus_tag LOCUS_16760 12851 12234 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088316.1 protein_id gnl|my_center|LOCUS_16760 13504 12911 gene locus_tag LOCUS_16770 13504 12911 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707809.1 protein_id gnl|my_center|LOCUS_16770 13816 13631 gene locus_tag LOCUS_16780 13816 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 13820 14554 gene locus_tag LOCUS_16790 13820 14554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16790 15835 14606 gene locus_tag LOCUS_16800 gene hfaD 15835 14606 CDS product holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640542.1 protein_id gnl|my_center|LOCUS_16800 16748 15750 gene locus_tag LOCUS_16810 gene hfaB 16748 15750 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920482.1 protein_id gnl|my_center|LOCUS_16810 17181 16738 gene locus_tag LOCUS_16820 gene hfaA 17181 16738 CDS product holdfast attachment protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27342 protein_id gnl|my_center|LOCUS_16820 17332 17961 gene locus_tag LOCUS_16830 17332 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 18494 17958 gene locus_tag LOCUS_16840 18494 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083237.1 protein_id gnl|my_center|LOCUS_16840 19849 18491 gene locus_tag LOCUS_16850 19849 18491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence048 19 2955 gene locus_tag LOCUS_16860 gene glnE 19 2955 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S7 protein_id gnl|my_center|LOCUS_16860 2957 3472 gene locus_tag LOCUS_16870 2957 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3514 4137 gene locus_tag LOCUS_16880 3514 4137 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S9 protein_id gnl|my_center|LOCUS_16880 4137 4550 gene locus_tag LOCUS_16890 4137 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 4547 5092 gene locus_tag LOCUS_16900 4547 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 7672 5093 gene locus_tag LOCUS_16910 gene pleC 7672 5093 CDS product non-motile and phage-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920340.1 protein_id gnl|my_center|LOCUS_16910 8241 7732 gene locus_tag LOCUS_16920 8241 7732 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_16920 8846 8298 gene locus_tag LOCUS_16930 8846 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640507.1 protein_id gnl|my_center|LOCUS_16930 8956 9951 gene locus_tag LOCUS_16940 gene dusA 8956 9951 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NV0 protein_id gnl|my_center|LOCUS_16940 9948 10769 gene locus_tag LOCUS_16950 9948 10769 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 protein_id gnl|my_center|LOCUS_16950 11059 12339 gene locus_tag LOCUS_16960 11059 12339 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_16960 13071 12349 gene locus_tag LOCUS_16970 13071 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 13100 13345 gene locus_tag LOCUS_16980 13100 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265759.1 protein_id gnl|my_center|LOCUS_16980 13342 13923 gene locus_tag LOCUS_16990 13342 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_16990 14040 15110 gene locus_tag LOCUS_17000 14040 15110 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919943.1 protein_id gnl|my_center|LOCUS_17000 16141 15107 gene locus_tag LOCUS_17010 16141 15107 CDS product spermidine/putrescine ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020477356.1 protein_id gnl|my_center|LOCUS_17010 17745 16138 gene locus_tag LOCUS_17020 17745 16138 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338036.1 protein_id gnl|my_center|LOCUS_17020 18772 17753 gene locus_tag LOCUS_17030 gene idiA 18772 17753 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_17030 18991 18917 gene locus_tag LOCUS_t00250 18991 18917 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19245 19499 gene locus_tag LOCUS_17040 19245 19499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 20180 19500 gene locus_tag LOCUS_17050 gene gph 20180 19500 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAC0 protein_id gnl|my_center|LOCUS_17050 >Feature sequence049 1023 532 gene locus_tag LOCUS_17060 1023 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1891 1295 gene locus_tag LOCUS_17070 1891 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2331 2005 gene locus_tag LOCUS_17080 2331 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3154 3996 gene locus_tag LOCUS_17090 3154 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4631 4038 gene locus_tag LOCUS_17100 4631 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_17100 4635 4817 gene locus_tag LOCUS_17110 4635 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4859 6358 gene locus_tag LOCUS_17120 4859 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 6560 7399 gene locus_tag LOCUS_17130 6560 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_17130 7409 8299 gene locus_tag LOCUS_17140 gene lysR 7409 8299 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383681.1 protein_id gnl|my_center|LOCUS_17140 8365 9174 gene locus_tag LOCUS_17150 8365 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 9210 10043 gene locus_tag LOCUS_17160 9210 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 10957 10040 gene locus_tag LOCUS_17170 10957 10040 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_17170 11404 10976 gene locus_tag LOCUS_17180 gene zur 11404 10976 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_17180 11508 13658 gene locus_tag LOCUS_17190 11508 13658 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 protein_id gnl|my_center|LOCUS_17190 13761 14381 gene locus_tag LOCUS_17200 13761 14381 CDS product putative outer-membrane protein y4mB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55561 protein_id gnl|my_center|LOCUS_17200 14521 15297 gene locus_tag LOCUS_17210 14521 15297 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 protein_id gnl|my_center|LOCUS_17210 15394 17484 gene locus_tag LOCUS_17220 15394 17484 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_17220 17942 17481 gene locus_tag LOCUS_17230 17942 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 17991 19598 gene locus_tag LOCUS_17240 gene pgi 17991 19598 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GY92 protein_id gnl|my_center|LOCUS_17240 >Feature sequence050 910 1329 gene locus_tag LOCUS_17250 910 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1332 1757 gene locus_tag LOCUS_17260 1332 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1760 1978 gene locus_tag LOCUS_17270 1760 1978 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_17270 2347 1991 gene locus_tag LOCUS_17280 2347 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3154 2510 gene locus_tag LOCUS_17290 3154 2510 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706748.1 protein_id gnl|my_center|LOCUS_17290 3259 3609 gene locus_tag LOCUS_17300 3259 3609 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083958.1 protein_id gnl|my_center|LOCUS_17300 3606 4646 gene locus_tag LOCUS_17310 3606 4646 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C744 protein_id gnl|my_center|LOCUS_17310 6068 4740 gene locus_tag LOCUS_17320 6068 4740 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 protein_id gnl|my_center|LOCUS_17320 6153 7172 gene locus_tag LOCUS_17330 gene yjgB 6153 7172 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_17330 7174 8076 gene locus_tag LOCUS_17340 7174 8076 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921475.1 protein_id gnl|my_center|LOCUS_17340 8120 8626 gene locus_tag LOCUS_17350 8120 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 9123 8749 gene locus_tag LOCUS_17360 9123 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 9960 9220 gene locus_tag LOCUS_17370 9960 9220 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119056.1 protein_id gnl|my_center|LOCUS_17370 11088 10045 gene locus_tag LOCUS_17380 11088 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 11547 11131 gene locus_tag LOCUS_17390 11547 11131 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_17390 12032 11544 gene locus_tag LOCUS_17400 12032 11544 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_17400 12851 12099 gene locus_tag LOCUS_17410 12851 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 13309 12986 gene locus_tag LOCUS_17420 13309 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 14191 13349 gene locus_tag LOCUS_17430 14191 13349 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_17430 14322 15953 gene locus_tag LOCUS_17440 14322 15953 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265611.1 protein_id gnl|my_center|LOCUS_17440 16117 18024 gene locus_tag LOCUS_17450 16117 18024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 18974 18021 gene locus_tag LOCUS_17460 18974 18021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence051 1318 1242 gene locus_tag LOCUS_t00260 1318 1242 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1439 1514 gene locus_tag LOCUS_t00270 1439 1514 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2065 2787 gene locus_tag LOCUS_17470 2065 2787 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_17470 2812 4212 gene locus_tag LOCUS_17480 2812 4212 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_17480 4227 4748 gene locus_tag LOCUS_17490 4227 4748 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_17490 4753 5172 gene locus_tag LOCUS_17500 4753 5172 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_17500 5188 5592 gene locus_tag LOCUS_17510 5188 5592 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423166.1 protein_id gnl|my_center|LOCUS_17510 5602 6219 gene locus_tag LOCUS_17520 5602 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 6273 7760 gene locus_tag LOCUS_17530 6273 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 7910 8521 gene locus_tag LOCUS_17540 7910 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 10840 8570 gene locus_tag LOCUS_17550 gene ptrB 10840 8570 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968970.1 protein_id gnl|my_center|LOCUS_17550 12254 10914 gene locus_tag LOCUS_17560 12254 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 12277 13368 gene locus_tag LOCUS_17570 12277 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 protein_id gnl|my_center|LOCUS_17570 13479 13961 gene locus_tag LOCUS_17580 13479 13961 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_17580 13958 14275 gene locus_tag LOCUS_17590 13958 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 14275 14634 gene locus_tag LOCUS_17600 14275 14634 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_17600 14631 15194 gene locus_tag LOCUS_17610 14631 15194 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_17610 15191 15634 gene locus_tag LOCUS_17620 15191 15634 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_17620 15634 16131 gene locus_tag LOCUS_17630 15634 16131 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335819.1 protein_id gnl|my_center|LOCUS_17630 16131 17660 gene locus_tag LOCUS_17640 16131 17660 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_17640 17657 19117 gene locus_tag LOCUS_17650 17657 19117 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_17650 19120 19437 gene locus_tag LOCUS_17660 19120 19437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence052 581 27 gene locus_tag LOCUS_17670 581 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1216 581 gene locus_tag LOCUS_17680 1216 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1281 1727 gene locus_tag LOCUS_17690 1281 1727 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_17690 5084 2367 gene locus_tag LOCUS_17700 5084 2367 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_17700 6738 5491 gene locus_tag LOCUS_17710 6738 5491 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269235.1 protein_id gnl|my_center|LOCUS_17710 8048 6735 gene locus_tag LOCUS_17720 gene czcC 8048 6735 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_17720 8410 8090 gene locus_tag LOCUS_17730 8410 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 9672 8590 gene locus_tag LOCUS_17740 9672 8590 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703287.1 protein_id gnl|my_center|LOCUS_17740 9768 10034 gene locus_tag LOCUS_17750 9768 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 10323 10090 gene locus_tag LOCUS_17760 10323 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 10869 11270 gene locus_tag LOCUS_17770 10869 11270 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105578.1 protein_id gnl|my_center|LOCUS_17770 12041 11307 gene locus_tag LOCUS_17780 12041 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 12363 12109 gene locus_tag LOCUS_17790 12363 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 13222 12611 gene locus_tag LOCUS_17800 13222 12611 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY9 protein_id gnl|my_center|LOCUS_17800 13616 13185 gene locus_tag LOCUS_17810 13616 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 13936 13616 gene locus_tag LOCUS_17820 13936 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 14393 13950 gene locus_tag LOCUS_17830 14393 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 15513 14395 gene locus_tag LOCUS_17840 15513 14395 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918237.1 protein_id gnl|my_center|LOCUS_17840 15828 15520 gene locus_tag LOCUS_17850 15828 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 15925 16248 gene locus_tag LOCUS_17860 15925 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 16289 16507 gene locus_tag LOCUS_17870 16289 16507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 17182 16433 gene locus_tag LOCUS_17880 17182 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 18506 17175 gene locus_tag LOCUS_17890 18506 17175 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_17890 19189 18515 gene locus_tag LOCUS_17900 19189 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence053 429 1784 gene locus_tag LOCUS_17910 429 1784 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_17910 1795 2415 gene locus_tag LOCUS_17920 1795 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_17920 2495 4771 gene locus_tag LOCUS_17930 2495 4771 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_17930 4768 5577 gene locus_tag LOCUS_17940 4768 5577 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 protein_id gnl|my_center|LOCUS_17940 5580 6752 gene locus_tag LOCUS_17950 5580 6752 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527981.1 protein_id gnl|my_center|LOCUS_17950 6749 7141 gene locus_tag LOCUS_17960 6749 7141 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814990.1 protein_id gnl|my_center|LOCUS_17960 8334 7138 gene locus_tag LOCUS_17970 8334 7138 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 protein_id gnl|my_center|LOCUS_17970 8424 10028 gene locus_tag LOCUS_17980 8424 10028 CDS product 2-aminobenzoate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814996.1 protein_id gnl|my_center|LOCUS_17980 13951 10025 gene locus_tag LOCUS_17990 13951 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 15660 13948 gene locus_tag LOCUS_18000 15660 13948 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640285.1 protein_id gnl|my_center|LOCUS_18000 16300 15977 gene locus_tag LOCUS_18010 16300 15977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 16628 17998 gene locus_tag LOCUS_18020 16628 17998 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_18020 17995 18531 gene locus_tag LOCUS_18030 17995 18531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence054 1238 237 gene locus_tag LOCUS_18040 1238 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1997 1266 gene locus_tag LOCUS_18050 1997 1266 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 protein_id gnl|my_center|LOCUS_18050 2605 1997 gene locus_tag LOCUS_18060 2605 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3542 2628 gene locus_tag LOCUS_18070 gene ftsX 3542 2628 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920078.1 protein_id gnl|my_center|LOCUS_18070 4255 3539 gene locus_tag LOCUS_18080 gene ftsE 4255 3539 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265777.1 protein_id gnl|my_center|LOCUS_18080 4431 5051 gene locus_tag LOCUS_18090 4431 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 7591 5054 gene locus_tag LOCUS_18100 7591 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 9194 7779 gene locus_tag LOCUS_18110 gene argH 9194 7779 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8I1 protein_id gnl|my_center|LOCUS_18110 9223 9807 gene locus_tag LOCUS_18120 gene tlpA 9223 9807 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 protein_id gnl|my_center|LOCUS_18120 10803 9862 gene locus_tag LOCUS_18130 gene etfA 10803 9862 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_18130 11552 10803 gene locus_tag LOCUS_18140 11552 10803 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918613.1 protein_id gnl|my_center|LOCUS_18140 12318 11734 gene locus_tag LOCUS_18150 12318 11734 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037974.1 protein_id gnl|my_center|LOCUS_18150 13016 12441 gene locus_tag LOCUS_18160 13016 12441 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_18160 13106 14173 gene locus_tag LOCUS_18170 13106 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 14384 14178 gene locus_tag LOCUS_18180 14384 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 15523 14447 gene locus_tag LOCUS_18190 15523 14447 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640051.1 protein_id gnl|my_center|LOCUS_18190 16466 15534 gene locus_tag LOCUS_18200 16466 15534 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066636.1 protein_id gnl|my_center|LOCUS_18200 17389 16514 gene locus_tag LOCUS_18210 17389 16514 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640436.1 protein_id gnl|my_center|LOCUS_18210 17455 18114 gene locus_tag LOCUS_18220 17455 18114 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence055 <1 834 gene locus_tag LOCUS_18230 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3HKP2:dTDP-glucose 4,6-dehydratase 848 1732 gene locus_tag LOCUS_18240 gene rfbA 848 1732 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G1UB20 protein_id gnl|my_center|LOCUS_18240 1844 2632 gene locus_tag LOCUS_18250 1844 2632 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4H2 protein_id gnl|my_center|LOCUS_18250 3660 2629 gene locus_tag LOCUS_18260 3660 2629 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_18260 4381 3677 gene locus_tag LOCUS_18270 4381 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_18270 5633 4401 gene locus_tag LOCUS_18280 5633 4401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_18280 6313 5630 gene locus_tag LOCUS_18290 6313 5630 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_18290 7779 6310 gene locus_tag LOCUS_18300 7779 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 8118 7891 gene locus_tag LOCUS_18310 8118 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 9554 8010 gene locus_tag LOCUS_18320 9554 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265680.1 protein_id gnl|my_center|LOCUS_18320 10110 9628 gene locus_tag LOCUS_18330 gene sixA 10110 9628 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918414.1 protein_id gnl|my_center|LOCUS_18330 11311 10208 gene locus_tag LOCUS_18340 11311 10208 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528655.1 protein_id gnl|my_center|LOCUS_18340 12231 11308 gene locus_tag LOCUS_18350 12231 11308 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 protein_id gnl|my_center|LOCUS_18350 13170 12238 gene locus_tag LOCUS_18360 13170 12238 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528657.1 protein_id gnl|my_center|LOCUS_18360 13813 13163 gene locus_tag LOCUS_18370 13813 13163 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_18370 14922 14047 gene locus_tag LOCUS_18380 14922 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 15446 15928 gene locus_tag LOCUS_18390 15446 15928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_18390 15983 17572 gene locus_tag LOCUS_18400 gene lysS 15983 17572 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C6 protein_id gnl|my_center|LOCUS_18400 17979 17569 gene locus_tag LOCUS_18410 17979 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence056 1554 133 gene locus_tag LOCUS_18420 1554 133 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920596.1 protein_id gnl|my_center|LOCUS_18420 2243 1572 gene locus_tag LOCUS_18430 2243 1572 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085915.1 protein_id gnl|my_center|LOCUS_18430 3750 2269 gene locus_tag LOCUS_18440 gene dop 3750 2269 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085377.1 protein_id gnl|my_center|LOCUS_18440 5087 3864 gene locus_tag LOCUS_18450 5087 3864 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970426.1 protein_id gnl|my_center|LOCUS_18450 5515 5165 gene locus_tag LOCUS_18460 5515 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 7440 5512 gene locus_tag LOCUS_18470 7440 5512 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920601.1 protein_id gnl|my_center|LOCUS_18470 7853 7437 gene locus_tag LOCUS_18480 gene ccmE 7853 7437 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1L5 protein_id gnl|my_center|LOCUS_18480 8812 7877 gene locus_tag LOCUS_18490 8812 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 9492 8809 gene locus_tag LOCUS_18500 9492 8809 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 protein_id gnl|my_center|LOCUS_18500 10829 9504 gene locus_tag LOCUS_18510 10829 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 12266 10884 gene locus_tag LOCUS_18520 12266 10884 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_18520 12937 12263 gene locus_tag LOCUS_18530 12937 12263 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532639.1 protein_id gnl|my_center|LOCUS_18530 13245 12946 gene locus_tag LOCUS_18540 13245 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 14193 13327 gene locus_tag LOCUS_18550 14193 13327 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970033.1 protein_id gnl|my_center|LOCUS_18550 <18005 14236 gene locus_tag LOCUS_18560 <18005 14236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337519.1:phage host specificity protein >Feature sequence057 1222 1686 gene locus_tag LOCUS_18570 1222 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5302 1676 gene locus_tag LOCUS_18580 5302 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_18580 6212 5325 gene locus_tag LOCUS_18590 6212 5325 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_18590 6458 7276 gene locus_tag LOCUS_18600 6458 7276 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707866.1 protein_id gnl|my_center|LOCUS_18600 7283 9094 gene locus_tag LOCUS_18610 7283 9094 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_18610 9177 9102 gene locus_tag LOCUS_t00280 9177 9102 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 9378 10643 gene locus_tag LOCUS_18620 9378 10643 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCC8 protein_id gnl|my_center|LOCUS_18620 10643 11512 gene locus_tag LOCUS_18630 10643 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 14852 11730 gene locus_tag LOCUS_18640 gene ileS 14852 11730 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3M4 protein_id gnl|my_center|LOCUS_18640 16485 14968 gene locus_tag LOCUS_18650 gene pepA 16485 14968 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C759 protein_id gnl|my_center|LOCUS_18650 16577 17506 gene locus_tag LOCUS_18660 16577 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence058 503 243 gene locus_tag LOCUS_18670 503 243 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266521.1 protein_id gnl|my_center|LOCUS_18670 587 1201 gene locus_tag LOCUS_18680 587 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 1402 2769 gene locus_tag LOCUS_18690 1402 2769 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832V4 protein_id gnl|my_center|LOCUS_18690 2766 3188 gene locus_tag LOCUS_18700 2766 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3175 3582 gene locus_tag LOCUS_18710 3175 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3676 3927 gene locus_tag LOCUS_18720 3676 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3924 4337 gene locus_tag LOCUS_18730 3924 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 4468 4241 gene locus_tag LOCUS_18740 4468 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 4483 5994 gene locus_tag LOCUS_18750 4483 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18750 7033 6395 gene locus_tag LOCUS_18760 7033 6395 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142671.1 protein_id gnl|my_center|LOCUS_18760 7858 7226 gene locus_tag LOCUS_18770 7858 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 8265 7855 gene locus_tag LOCUS_18780 8265 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 8441 10282 gene locus_tag LOCUS_18790 gene phbC1 8441 10282 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709900.1 protein_id gnl|my_center|LOCUS_18790 10326 10733 gene locus_tag LOCUS_18800 10326 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 11008 11886 gene locus_tag LOCUS_18810 11008 11886 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974634.1 protein_id gnl|my_center|LOCUS_18810 11904 14954 gene locus_tag LOCUS_18820 11904 14954 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881459.1 protein_id gnl|my_center|LOCUS_18820 15649 15008 gene locus_tag LOCUS_18830 15649 15008 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142671.1 protein_id gnl|my_center|LOCUS_18830 16604 15783 gene locus_tag LOCUS_18840 16604 15783 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389682.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence059 2352 163 gene locus_tag LOCUS_18850 2352 163 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_18850 3573 2365 gene locus_tag LOCUS_18860 3573 2365 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_18860 4769 3603 gene locus_tag LOCUS_18870 4769 3603 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917968.1 protein_id gnl|my_center|LOCUS_18870 6548 4770 gene locus_tag LOCUS_18880 6548 4770 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917969.1 protein_id gnl|my_center|LOCUS_18880 7093 6569 gene locus_tag LOCUS_18890 7093 6569 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 protein_id gnl|my_center|LOCUS_18890 7190 9394 gene locus_tag LOCUS_18900 7190 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 9585 12851 gene locus_tag LOCUS_18910 gene podJ 9585 12851 CDS product localization factor PodJL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXA0 protein_id gnl|my_center|LOCUS_18910 12864 13799 gene locus_tag LOCUS_18920 12864 13799 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C3 protein_id gnl|my_center|LOCUS_18920 13796 14593 gene locus_tag LOCUS_18930 13796 14593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533664.1 protein_id gnl|my_center|LOCUS_18930 14596 15039 gene locus_tag LOCUS_18940 14596 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640624.1 protein_id gnl|my_center|LOCUS_18940 16566 15253 gene locus_tag LOCUS_18950 16566 15253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 16804 16622 gene locus_tag LOCUS_18960 16804 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence060 2073 295 gene locus_tag LOCUS_18970 2073 295 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923272.1 protein_id gnl|my_center|LOCUS_18970 2365 3165 gene locus_tag LOCUS_18980 2365 3165 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_18980 3196 4446 gene locus_tag LOCUS_18990 3196 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 5342 4443 gene locus_tag LOCUS_19000 5342 4443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 protein_id gnl|my_center|LOCUS_19000 6478 5339 gene locus_tag LOCUS_19010 6478 5339 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_19010 6602 7771 gene locus_tag LOCUS_19020 gene serC 6602 7771 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 protein_id gnl|my_center|LOCUS_19020 7846 8418 gene locus_tag LOCUS_19030 7846 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 9058 8519 gene locus_tag LOCUS_19040 9058 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 9168 10457 gene locus_tag LOCUS_19050 gene purA 9168 10457 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD8 protein_id gnl|my_center|LOCUS_19050 10526 11140 gene locus_tag LOCUS_19060 10526 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 11158 12561 gene locus_tag LOCUS_19070 11158 12561 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_19070 13973 12558 gene locus_tag LOCUS_19080 13973 12558 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_19080 14136 14882 gene locus_tag LOCUS_19090 14136 14882 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531283.1 protein_id gnl|my_center|LOCUS_19090 14963 16477 gene locus_tag LOCUS_19100 14963 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence061 557 1540 gene locus_tag LOCUS_19110 557 1540 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920048.1 protein_id gnl|my_center|LOCUS_19110 1621 3756 gene locus_tag LOCUS_19120 1621 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3957 4778 gene locus_tag LOCUS_19130 3957 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4775 6202 gene locus_tag LOCUS_19140 4775 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 6215 8074 gene locus_tag LOCUS_19150 6215 8074 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_19150 9760 8084 gene locus_tag LOCUS_19160 9760 8084 CDS product serine type site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062934.1 protein_id gnl|my_center|LOCUS_19160 8150 8226 gene locus_tag LOCUS_t00290 8150 8226 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10086 9757 gene locus_tag LOCUS_19170 10086 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 10578 10210 gene locus_tag LOCUS_19180 10578 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 10957 10568 gene locus_tag LOCUS_19190 10957 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 12570 10954 gene locus_tag LOCUS_19200 12570 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 12777 12643 gene locus_tag LOCUS_19210 12777 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 13101 12802 gene locus_tag LOCUS_19220 13101 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 13744 13202 gene locus_tag LOCUS_19230 13744 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 14381 14163 gene locus_tag LOCUS_19240 14381 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 14869 15390 gene locus_tag LOCUS_19250 14869 15390 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021204.1 protein_id gnl|my_center|LOCUS_19250 16025 15426 gene locus_tag LOCUS_19260 16025 15426 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706595.1 protein_id gnl|my_center|LOCUS_19260 16124 16405 gene locus_tag LOCUS_19270 16124 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence062 206 937 gene locus_tag LOCUS_19280 gene recO 206 937 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVD0 protein_id gnl|my_center|LOCUS_19280 973 3252 gene locus_tag LOCUS_19290 gene gyrA 973 3252 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K54 protein_id gnl|my_center|LOCUS_19290 3296 3850 gene locus_tag LOCUS_19300 3296 3850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_19300 3860 4873 gene locus_tag LOCUS_19310 gene htpX 3860 4873 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB2 protein_id gnl|my_center|LOCUS_19310 5400 4870 gene locus_tag LOCUS_19320 5400 4870 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_19320 6982 5393 gene locus_tag LOCUS_19330 6982 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 7762 6983 gene locus_tag LOCUS_19340 7762 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 8881 7766 gene locus_tag LOCUS_19350 8881 7766 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_19350 9647 8883 gene locus_tag LOCUS_19360 gene ate 9647 8883 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z5 protein_id gnl|my_center|LOCUS_19360 11523 9694 gene locus_tag LOCUS_19370 11523 9694 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_19370 12530 11625 gene locus_tag LOCUS_19380 12530 11625 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_19380 12621 13085 gene locus_tag LOCUS_19390 12621 13085 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719756.1 protein_id gnl|my_center|LOCUS_19390 13110 13979 gene locus_tag LOCUS_19400 13110 13979 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969533.1 protein_id gnl|my_center|LOCUS_19400 13980 15002 gene locus_tag LOCUS_19410 13980 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403214.1 protein_id gnl|my_center|LOCUS_19410 15378 15055 gene locus_tag LOCUS_19420 15378 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 15524 16153 gene locus_tag LOCUS_19430 15524 16153 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388746.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence063 1871 2158 gene locus_tag LOCUS_19440 1871 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2398 2213 gene locus_tag LOCUS_19450 2398 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 3638 2457 gene locus_tag LOCUS_19460 3638 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4448 3711 gene locus_tag LOCUS_19470 4448 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 6799 4664 gene locus_tag LOCUS_19480 gene pnp 6799 4664 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWZ0 protein_id gnl|my_center|LOCUS_19480 7110 6841 gene locus_tag LOCUS_19490 gene rpsO 7110 6841 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC31 protein_id gnl|my_center|LOCUS_19490 8099 7143 gene locus_tag LOCUS_19500 gene truB 8099 7143 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58063 protein_id gnl|my_center|LOCUS_19500 8524 8099 gene locus_tag LOCUS_19510 gene rbfA 8524 8099 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC30 protein_id gnl|my_center|LOCUS_19510 8705 9169 gene locus_tag LOCUS_19520 8705 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 9185 9685 gene locus_tag LOCUS_19530 9185 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 12328 9752 gene locus_tag LOCUS_19540 12328 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 13045 12446 gene locus_tag LOCUS_19550 13045 12446 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917933.1 protein_id gnl|my_center|LOCUS_19550 14772 13060 gene locus_tag LOCUS_19560 gene nusA 14772 13060 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3M7 protein_id gnl|my_center|LOCUS_19560 15311 14769 gene locus_tag LOCUS_19570 gene rimP 15311 14769 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX01 protein_id gnl|my_center|LOCUS_19570 <16009 15441 gene locus_tag LOCUS_19580 <16009 15441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GX04:tRNA (guanine-N(7)-)-methyltransferase >Feature sequence064 2326 251 gene locus_tag LOCUS_19590 gene fusA 2326 251 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H414 protein_id gnl|my_center|LOCUS_19590 2833 2363 gene locus_tag LOCUS_19600 gene rpsG 2833 2363 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX6 protein_id gnl|my_center|LOCUS_19600 3217 2846 gene locus_tag LOCUS_19610 gene rpsL 3217 2846 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV5 protein_id gnl|my_center|LOCUS_19610 7736 3513 gene locus_tag LOCUS_19620 gene rpoC 7736 3513 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAU1 protein_id gnl|my_center|LOCUS_19620 11877 7798 gene locus_tag LOCUS_19630 gene rpoB 11877 7798 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZW7 protein_id gnl|my_center|LOCUS_19630 12478 12101 gene locus_tag LOCUS_19640 gene rplL 12478 12101 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV2 protein_id gnl|my_center|LOCUS_19640 13045 12533 gene locus_tag LOCUS_19650 gene rplJ 13045 12533 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5T2 protein_id gnl|my_center|LOCUS_19650 14060 13350 gene locus_tag LOCUS_19660 gene rplA 14060 13350 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAW8 protein_id gnl|my_center|LOCUS_19660 14497 14066 gene locus_tag LOCUS_19670 gene rplK 14497 14066 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE04 protein_id gnl|my_center|LOCUS_19670 15112 14579 gene locus_tag LOCUS_19680 gene nusG 15112 14579 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAW6 protein_id gnl|my_center|LOCUS_19680 15385 15128 gene locus_tag LOCUS_19690 gene secE 15385 15128 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEJ9 protein_id gnl|my_center|LOCUS_19690 15508 15433 gene locus_tag LOCUS_t00300 15508 15433 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence065 662 1138 gene locus_tag LOCUS_19700 662 1138 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_19700 2506 1208 gene locus_tag LOCUS_19710 2506 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_19710 3184 2555 gene locus_tag LOCUS_19720 3184 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 3930 3205 gene locus_tag LOCUS_19730 gene gpmA 3930 3205 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYN6 protein_id gnl|my_center|LOCUS_19730 4061 5026 gene locus_tag LOCUS_19740 4061 5026 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 protein_id gnl|my_center|LOCUS_19740 5098 6399 gene locus_tag LOCUS_19750 5098 6399 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920240.1 protein_id gnl|my_center|LOCUS_19750 6424 7932 gene locus_tag LOCUS_19760 6424 7932 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 protein_id gnl|my_center|LOCUS_19760 9968 8037 gene locus_tag LOCUS_19770 gene glmS 9968 8037 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9C0 protein_id gnl|my_center|LOCUS_19770 10121 11089 gene locus_tag LOCUS_19780 gene cysD 10121 11089 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNR3 protein_id gnl|my_center|LOCUS_19780 11089 12987 gene locus_tag LOCUS_19790 11089 12987 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532710.1 protein_id gnl|my_center|LOCUS_19790 13788 12991 gene locus_tag LOCUS_19800 13788 12991 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921298.1 protein_id gnl|my_center|LOCUS_19800 14514 13861 gene locus_tag LOCUS_19810 14514 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 <15303 14636 gene locus_tag LOCUS_19820 <15303 14636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222189.1:ABC transporter ATP-binding protein >Feature sequence066 2 1438 gene locus_tag LOCUS_19830 2 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1443 2177 gene locus_tag LOCUS_19840 1443 2177 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919201.1 protein_id gnl|my_center|LOCUS_19840 2939 2190 gene locus_tag LOCUS_19850 2939 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3658 3071 gene locus_tag LOCUS_19860 3658 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4047 3655 gene locus_tag LOCUS_19870 4047 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 4248 4057 gene locus_tag LOCUS_19880 4248 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5605 4517 gene locus_tag LOCUS_19890 gene aroC 5605 4517 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3W7 protein_id gnl|my_center|LOCUS_19890 6150 5656 gene locus_tag LOCUS_19900 6150 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 6235 6900 gene locus_tag LOCUS_19910 gene pdxH 6235 6900 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H292 protein_id gnl|my_center|LOCUS_19910 7817 6891 gene locus_tag LOCUS_19920 7817 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 8144 9076 gene locus_tag LOCUS_19930 gene OppB 8144 9076 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336773.1 protein_id gnl|my_center|LOCUS_19930 9073 9978 gene locus_tag LOCUS_19940 9073 9978 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_19940 10779 9979 gene locus_tag LOCUS_19950 10779 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 11422 10790 gene locus_tag LOCUS_19960 11422 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920662.1 protein_id gnl|my_center|LOCUS_19960 11551 13206 gene locus_tag LOCUS_19970 11551 13206 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_19970 13277 14485 gene locus_tag LOCUS_19980 13277 14485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919988.1 protein_id gnl|my_center|LOCUS_19980 15281 14487 gene locus_tag LOCUS_19990 15281 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence067 2700 1417 gene locus_tag LOCUS_20000 gene aceA 2700 1417 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527089.1 protein_id gnl|my_center|LOCUS_20000 2856 4277 gene locus_tag LOCUS_20010 2856 4277 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_20010 6529 4337 gene locus_tag LOCUS_20020 gene katG 6529 4337 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BE1 protein_id gnl|my_center|LOCUS_20020 8351 6693 gene locus_tag LOCUS_20030 gene pnbA 8351 6693 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37967 protein_id gnl|my_center|LOCUS_20030 9899 8406 gene locus_tag LOCUS_20040 gene glpK 9899 8406 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG71 protein_id gnl|my_center|LOCUS_20040 9992 10909 gene locus_tag LOCUS_20050 9992 10909 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969766.1 protein_id gnl|my_center|LOCUS_20050 11868 10906 gene locus_tag LOCUS_20060 11868 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 15118 11888 gene locus_tag LOCUS_20070 15118 11888 CDS product TolB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265500.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence068 1317 1000 gene locus_tag LOCUS_20080 1317 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331305.1 protein_id gnl|my_center|LOCUS_20080 1462 2121 gene locus_tag LOCUS_20090 1462 2121 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 protein_id gnl|my_center|LOCUS_20090 2118 3485 gene locus_tag LOCUS_20100 2118 3485 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140446.1 protein_id gnl|my_center|LOCUS_20100 4751 3807 gene locus_tag LOCUS_20110 4751 3807 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_20110 4869 5456 gene locus_tag LOCUS_20120 4869 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943772.1 protein_id gnl|my_center|LOCUS_20120 5676 5909 gene locus_tag LOCUS_20130 5676 5909 CDS product copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861284.1 protein_id gnl|my_center|LOCUS_20130 6076 6954 gene locus_tag LOCUS_20140 6076 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 7594 6956 gene locus_tag LOCUS_20150 7594 6956 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142671.1 protein_id gnl|my_center|LOCUS_20150 11301 7654 gene locus_tag LOCUS_20160 11301 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 11629 11426 gene locus_tag LOCUS_20170 11629 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 11725 12219 gene locus_tag LOCUS_20180 11725 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 12216 12413 gene locus_tag LOCUS_20190 12216 12413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 12439 13182 gene locus_tag LOCUS_20200 12439 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 13284 13511 gene locus_tag LOCUS_20210 13284 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 13508 14845 gene locus_tag LOCUS_20220 13508 14845 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A0P6 protein_id gnl|my_center|LOCUS_20220 >Feature sequence069 1098 130 gene locus_tag LOCUS_20230 gene secF 1098 130 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L14 protein_id gnl|my_center|LOCUS_20230 2692 1109 gene locus_tag LOCUS_20240 gene secD 2692 1109 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L13 protein_id gnl|my_center|LOCUS_20240 3076 2699 gene locus_tag LOCUS_20250 gene YajC 3076 2699 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_20250 4140 3160 gene locus_tag LOCUS_20260 4140 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 4864 4217 gene locus_tag LOCUS_20270 gene pcm 4864 4217 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH7 protein_id gnl|my_center|LOCUS_20270 5649 4861 gene locus_tag LOCUS_20280 gene surE 5649 4861 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX52 protein_id gnl|my_center|LOCUS_20280 6923 5646 gene locus_tag LOCUS_20290 gene serS 6923 5646 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q22 protein_id gnl|my_center|LOCUS_20290 7841 7026 gene locus_tag LOCUS_20300 gene tatC 7841 7026 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T2 protein_id gnl|my_center|LOCUS_20300 8293 7838 gene locus_tag LOCUS_20310 8293 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 8542 8303 gene locus_tag LOCUS_20320 8542 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 9389 8619 gene locus_tag LOCUS_20330 gene scpB 9389 8619 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C850 protein_id gnl|my_center|LOCUS_20330 10189 9386 gene locus_tag LOCUS_20340 gene scpA 10189 9386 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919871.1 protein_id gnl|my_center|LOCUS_20340 11199 10186 gene locus_tag LOCUS_20350 11199 10186 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389530.1 protein_id gnl|my_center|LOCUS_20350 12005 11196 gene locus_tag LOCUS_20360 12005 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 13269 12079 gene locus_tag LOCUS_20370 13269 12079 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB0 protein_id gnl|my_center|LOCUS_20370 13353 13682 gene locus_tag LOCUS_20380 13353 13682 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_20380 13682 14353 gene locus_tag LOCUS_20390 13682 14353 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_20390 14609 14382 gene locus_tag LOCUS_20400 14609 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 15137 14766 gene locus_tag LOCUS_20410 15137 14766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence070 1211 420 gene locus_tag LOCUS_20420 1211 420 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 protein_id gnl|my_center|LOCUS_20420 1647 1258 gene locus_tag LOCUS_20430 gene staR 1647 1258 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920112.1 protein_id gnl|my_center|LOCUS_20430 2626 1778 gene locus_tag LOCUS_20440 2626 1778 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385101.1 protein_id gnl|my_center|LOCUS_20440 2792 3157 gene locus_tag LOCUS_20450 2792 3157 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 protein_id gnl|my_center|LOCUS_20450 5217 3232 gene locus_tag LOCUS_20460 5217 3232 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_20460 8649 5392 gene locus_tag LOCUS_20470 8649 5392 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265669.1 protein_id gnl|my_center|LOCUS_20470 8919 8993 gene locus_tag LOCUS_t00310 8919 8993 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9099 10175 gene locus_tag LOCUS_20480 9099 10175 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N5 protein_id gnl|my_center|LOCUS_20480 10933 10172 gene locus_tag LOCUS_20490 10933 10172 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919076.1 protein_id gnl|my_center|LOCUS_20490 11901 10930 gene locus_tag LOCUS_20500 11901 10930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_20500 12743 11898 gene locus_tag LOCUS_20510 12743 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 14580 12682 gene locus_tag LOCUS_20520 14580 12682 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388247.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence071 1321 485 gene locus_tag LOCUS_20530 gene rfbD 1321 485 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086433.1 protein_id gnl|my_center|LOCUS_20530 2304 1423 gene locus_tag LOCUS_20540 2304 1423 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921464.1 protein_id gnl|my_center|LOCUS_20540 2337 2555 gene locus_tag LOCUS_20550 2337 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2631 3749 gene locus_tag LOCUS_20560 2631 3749 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921438.1 protein_id gnl|my_center|LOCUS_20560 4768 3800 gene locus_tag LOCUS_20570 gene fcl 4768 3800 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5H3 protein_id gnl|my_center|LOCUS_20570 5825 4761 gene locus_tag LOCUS_20580 gene gmd 5825 4761 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Y5 protein_id gnl|my_center|LOCUS_20580 6803 5958 gene locus_tag LOCUS_20590 6803 5958 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339394.1 protein_id gnl|my_center|LOCUS_20590 7284 6850 gene locus_tag LOCUS_20600 7284 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 9530 7428 gene locus_tag LOCUS_20610 9530 7428 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895558.1 protein_id gnl|my_center|LOCUS_20610 10038 9535 gene locus_tag LOCUS_20620 10038 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 10625 10035 gene locus_tag LOCUS_20630 10625 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 11707 10622 gene locus_tag LOCUS_20640 11707 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 12716 11652 gene locus_tag LOCUS_20650 12716 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 13306 12713 gene locus_tag LOCUS_20660 13306 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 13445 13933 gene locus_tag LOCUS_20670 13445 13933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence072 1789 920 gene locus_tag LOCUS_20680 1789 920 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB01 protein_id gnl|my_center|LOCUS_20680 2271 1786 gene locus_tag LOCUS_20690 gene cheW 2271 1786 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87715 protein_id gnl|my_center|LOCUS_20690 4462 2273 gene locus_tag LOCUS_20700 gene cheAI 4462 2273 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918321.1 protein_id gnl|my_center|LOCUS_20700 4835 4467 gene locus_tag LOCUS_20710 gene cheYI 4835 4467 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918320.1 protein_id gnl|my_center|LOCUS_20710 5121 4837 gene locus_tag LOCUS_20720 5121 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 6705 5128 gene locus_tag LOCUS_20730 6705 5128 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918316.1 protein_id gnl|my_center|LOCUS_20730 7559 6726 gene locus_tag LOCUS_20740 7559 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 7813 8202 gene locus_tag LOCUS_20750 7813 8202 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389152.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence073 2433 1840 gene locus_tag LOCUS_20760 2433 1840 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_20760 3486 2605 gene locus_tag LOCUS_20770 gene glyQ 3486 2605 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_20770 4491 3763 gene locus_tag LOCUS_20780 4491 3763 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919975.1 protein_id gnl|my_center|LOCUS_20780 4705 4484 gene locus_tag LOCUS_20790 4705 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 4829 5869 gene locus_tag LOCUS_20800 4829 5869 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919974.1 protein_id gnl|my_center|LOCUS_20800 6865 5870 gene locus_tag LOCUS_20810 6865 5870 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_20810 7743 6862 gene locus_tag LOCUS_20820 gene ispE 7743 6862 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_20820 9473 7740 gene locus_tag LOCUS_20830 9473 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919212.1 protein_id gnl|my_center|LOCUS_20830 11191 9521 gene locus_tag LOCUS_20840 11191 9521 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532620.1 protein_id gnl|my_center|LOCUS_20840 11490 12344 gene locus_tag LOCUS_20850 11490 12344 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532622.1 protein_id gnl|my_center|LOCUS_20850 12671 13798 gene locus_tag LOCUS_20860 12671 13798 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971096.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence074 <1 880 gene locus_tag LOCUS_20870 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388122.1:ATPase 896 1792 gene locus_tag LOCUS_20880 896 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_20880 1793 4525 gene locus_tag LOCUS_20890 1793 4525 CDS product LytTR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085250.1 protein_id gnl|my_center|LOCUS_20890 4522 6588 gene locus_tag LOCUS_20900 4522 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388125.1 protein_id gnl|my_center|LOCUS_20900 6631 7983 gene locus_tag LOCUS_20910 6631 7983 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_20910 8059 8295 gene locus_tag LOCUS_20920 8059 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 8367 8912 gene locus_tag LOCUS_20930 8367 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 9549 8920 gene locus_tag LOCUS_20940 gene queE 9549 8920 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBX3 protein_id gnl|my_center|LOCUS_20940 10256 9546 gene locus_tag LOCUS_20950 gene queC 10256 9546 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P2 protein_id gnl|my_center|LOCUS_20950 10288 10608 gene locus_tag LOCUS_20960 gene cutA 10288 10608 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7SIA8 protein_id gnl|my_center|LOCUS_20960 12575 10605 gene locus_tag LOCUS_20970 12575 10605 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920484.1 protein_id gnl|my_center|LOCUS_20970 13113 12697 gene locus_tag LOCUS_20980 gene mscL 13113 12697 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSV9 protein_id gnl|my_center|LOCUS_20980 13261 13185 gene locus_tag LOCUS_t00320 13261 13185 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 615 1106 gene locus_tag LOCUS_20990 615 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1407 2030 gene locus_tag LOCUS_21000 1407 2030 CDS product P44/Msp2 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141205.1 protein_id gnl|my_center|LOCUS_21000 2833 4086 gene locus_tag LOCUS_21010 2833 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 4083 4796 gene locus_tag LOCUS_21020 4083 4796 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_21020 5022 6863 gene locus_tag LOCUS_21030 5022 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 6887 7837 gene locus_tag LOCUS_21040 6887 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 8054 8269 gene locus_tag LOCUS_21050 8054 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21050 8988 9638 gene locus_tag LOCUS_21060 8988 9638 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319664.1 protein_id gnl|my_center|LOCUS_21060 11430 9631 gene locus_tag LOCUS_21070 11430 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 12868 11501 gene locus_tag LOCUS_21080 12868 11501 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence076 822 1802 gene locus_tag LOCUS_21090 822 1802 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_21090 3841 1799 gene locus_tag LOCUS_21100 3841 1799 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640172.1 protein_id gnl|my_center|LOCUS_21100 3980 4852 gene locus_tag LOCUS_21110 gene dapA 3980 4852 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZG9 protein_id gnl|my_center|LOCUS_21110 4852 5316 gene locus_tag LOCUS_21120 gene smpB 4852 5316 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H482 protein_id gnl|my_center|LOCUS_21120 5972 5307 gene locus_tag LOCUS_21130 5972 5307 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_21130 6516 5962 gene locus_tag LOCUS_21140 6516 5962 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919424.1 protein_id gnl|my_center|LOCUS_21140 6547 7056 gene locus_tag LOCUS_21150 6547 7056 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919425.1 protein_id gnl|my_center|LOCUS_21150 7156 7530 gene locus_tag LOCUS_21160 gene rpoZ 7156 7530 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H618 protein_id gnl|my_center|LOCUS_21160 7537 9765 gene locus_tag LOCUS_21170 gene spoT 7537 9765 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919427.1 protein_id gnl|my_center|LOCUS_21170 9762 10349 gene locus_tag LOCUS_21180 gene pyrE 9762 10349 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A810 protein_id gnl|my_center|LOCUS_21180 10346 11101 gene locus_tag LOCUS_21190 gene pdxJ 10346 11101 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_21190 11098 11505 gene locus_tag LOCUS_21200 gene acpS 11098 11505 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGK4 protein_id gnl|my_center|LOCUS_21200 11502 12188 gene locus_tag LOCUS_21210 gene rnc 11502 12188 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H627 protein_id gnl|my_center|LOCUS_21210 >Feature sequence077 1191 268 gene locus_tag LOCUS_21220 1191 268 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086737.1 protein_id gnl|my_center|LOCUS_21220 1342 1770 gene locus_tag LOCUS_21230 1342 1770 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 protein_id gnl|my_center|LOCUS_21230 2646 1774 gene locus_tag LOCUS_21240 2646 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2718 3194 gene locus_tag LOCUS_21250 2718 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_21250 3170 3913 gene locus_tag LOCUS_21260 3170 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204853.1 protein_id gnl|my_center|LOCUS_21260 6127 3914 gene locus_tag LOCUS_21270 6127 3914 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_21270 9502 6230 gene locus_tag LOCUS_21280 9502 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_21280 9639 10190 gene locus_tag LOCUS_21290 9639 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 10272 11939 gene locus_tag LOCUS_21300 10272 11939 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920009.1 protein_id gnl|my_center|LOCUS_21300 12643 11954 gene locus_tag LOCUS_21310 12643 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence078 4009 2942 gene locus_tag LOCUS_21320 4009 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 4229 4154 gene locus_tag LOCUS_t00330 4229 4154 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4483 4824 gene locus_tag LOCUS_21330 4483 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_21330 4930 4857 gene locus_tag LOCUS_t00340 4930 4857 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5072 5725 gene locus_tag LOCUS_21340 gene pcm 5072 5725 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 protein_id gnl|my_center|LOCUS_21340 5870 7216 gene locus_tag LOCUS_21350 5870 7216 CDS product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 protein_id gnl|my_center|LOCUS_21350 7313 7975 gene locus_tag LOCUS_21360 7313 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 8045 10891 gene locus_tag LOCUS_21370 gene valS 8045 10891 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C981 protein_id gnl|my_center|LOCUS_21370 11057 12043 gene locus_tag LOCUS_21380 11057 12043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_21380 12828 12040 gene locus_tag LOCUS_21390 12828 12040 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971819.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence079 790 29 gene locus_tag LOCUS_21400 790 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1528 932 gene locus_tag LOCUS_21410 1528 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1750 2646 gene locus_tag LOCUS_21420 gene rpoH 1750 2646 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3C3 protein_id gnl|my_center|LOCUS_21420 2709 3713 gene locus_tag LOCUS_21430 2709 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4351 3710 gene locus_tag LOCUS_21440 4351 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 5665 4355 gene locus_tag LOCUS_21450 5665 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 5863 6312 gene locus_tag LOCUS_21460 5863 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 7121 6309 gene locus_tag LOCUS_21470 7121 6309 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_21470 7618 7118 gene locus_tag LOCUS_21480 7618 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 8226 7615 gene locus_tag LOCUS_21490 8226 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879652.1 protein_id gnl|my_center|LOCUS_21490 9101 8214 gene locus_tag LOCUS_21500 9101 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 9230 10051 gene locus_tag LOCUS_21510 9230 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 10704 10042 gene locus_tag LOCUS_21520 10704 10042 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_21520 10995 11138 gene locus_tag LOCUS_21530 10995 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 11533 11270 gene locus_tag LOCUS_21540 11533 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 12024 11539 gene locus_tag LOCUS_21550 12024 11539 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710064.1 protein_id gnl|my_center|LOCUS_21550 12203 12526 gene locus_tag LOCUS_21560 12203 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence080 182 892 gene locus_tag LOCUS_21570 182 892 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_21570 1509 913 gene locus_tag LOCUS_21580 1509 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1569 2816 gene locus_tag LOCUS_21590 1569 2816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705619.1 protein_id gnl|my_center|LOCUS_21590 2925 4118 gene locus_tag LOCUS_21600 gene sucC 2925 4118 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ84 protein_id gnl|my_center|LOCUS_21600 4244 4537 gene locus_tag LOCUS_21610 4244 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 4534 4980 gene locus_tag LOCUS_21620 4534 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_21620 4993 5898 gene locus_tag LOCUS_21630 gene sucD 4993 5898 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ85 protein_id gnl|my_center|LOCUS_21630 6037 9015 gene locus_tag LOCUS_21640 gene odhA 6037 9015 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918228.1 protein_id gnl|my_center|LOCUS_21640 9041 10693 gene locus_tag LOCUS_21650 9041 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 10777 11214 gene locus_tag LOCUS_21660 10777 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071321.1 protein_id gnl|my_center|LOCUS_21660 11468 11211 gene locus_tag LOCUS_21670 11468 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence081 645 1367 gene locus_tag LOCUS_21680 645 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 1423 4857 gene locus_tag LOCUS_21690 gene smc 1423 4857 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C7H0 protein_id gnl|my_center|LOCUS_21690 4962 5300 gene locus_tag LOCUS_21700 4962 5300 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T934 protein_id gnl|my_center|LOCUS_21700 5311 6096 gene locus_tag LOCUS_21710 gene atpB 5311 6096 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 protein_id gnl|my_center|LOCUS_21710 6145 6381 gene locus_tag LOCUS_21720 6145 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 6457 7023 gene locus_tag LOCUS_21730 gene atpF2 6457 7023 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6M6 protein_id gnl|my_center|LOCUS_21730 7035 7529 gene locus_tag LOCUS_21740 gene atpF 7035 7529 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T930 protein_id gnl|my_center|LOCUS_21740 7887 7576 gene locus_tag LOCUS_21750 7887 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 9591 8017 gene locus_tag LOCUS_21760 gene gcvPB 9591 8017 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC5 protein_id gnl|my_center|LOCUS_21760 10937 9588 gene locus_tag LOCUS_21770 gene gcvPA 10937 9588 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4V4 protein_id gnl|my_center|LOCUS_21770 11453 11088 gene locus_tag LOCUS_21780 gene gcvH 11453 11088 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A352 protein_id gnl|my_center|LOCUS_21780 <12299 11472 gene locus_tag LOCUS_21790 <12299 11472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5DZM6:aminomethyltransferase >Feature sequence082 <1 981 gene locus_tag LOCUS_21800 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035484.1:isoaspartyl peptidase/L-asparaginase 983 1375 gene locus_tag LOCUS_21810 983 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 1441 2586 gene locus_tag LOCUS_21820 1441 2586 CDS product putative dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSB4 protein_id gnl|my_center|LOCUS_21820 2660 3307 gene locus_tag LOCUS_21830 gene cah 2660 3307 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHR7 protein_id gnl|my_center|LOCUS_21830 3370 4335 gene locus_tag LOCUS_21840 3370 4335 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227995.1 protein_id gnl|my_center|LOCUS_21840 4338 4649 gene locus_tag LOCUS_21850 4338 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 4727 5740 gene locus_tag LOCUS_21860 4727 5740 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536759.1 protein_id gnl|my_center|LOCUS_21860 6075 5737 gene locus_tag LOCUS_21870 6075 5737 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 protein_id gnl|my_center|LOCUS_21870 6231 7349 gene locus_tag LOCUS_21880 6231 7349 CDS product exopolyphosphatase GppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265726.1 protein_id gnl|my_center|LOCUS_21880 7346 8086 gene locus_tag LOCUS_21890 gene rlmE 7346 8086 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU5 protein_id gnl|my_center|LOCUS_21890 8311 9123 gene locus_tag LOCUS_21900 8311 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 9433 10905 gene locus_tag LOCUS_21910 gene guaB 9433 10905 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N70 protein_id gnl|my_center|LOCUS_21910 >Feature sequence083 <1 513 gene locus_tag LOCUS_21920 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142542.1:interphotoreceptor retinoid-binding protein 2418 958 gene locus_tag LOCUS_21930 2418 958 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_21930 3412 2546 gene locus_tag LOCUS_21940 3412 2546 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_21940 6573 3460 gene locus_tag LOCUS_21950 6573 3460 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_21950 6759 8066 gene locus_tag LOCUS_21960 6759 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 8081 9562 gene locus_tag LOCUS_21970 8081 9562 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY92 protein_id gnl|my_center|LOCUS_21970 9559 11067 gene locus_tag LOCUS_21980 9559 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 11305 11015 gene locus_tag LOCUS_21990 11305 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 11363 11632 gene locus_tag LOCUS_22000 11363 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence084 1130 870 gene locus_tag LOCUS_22010 gene hfq 1130 870 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7H8 protein_id gnl|my_center|LOCUS_22010 2098 1175 gene locus_tag LOCUS_22020 2098 1175 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531497.1 protein_id gnl|my_center|LOCUS_22020 3516 2104 gene locus_tag LOCUS_22030 3516 2104 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_22030 4895 3522 gene locus_tag LOCUS_22040 gene trkA 4895 3522 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_22040 6311 4908 gene locus_tag LOCUS_22050 gene ntrX 6311 4908 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919611.1 protein_id gnl|my_center|LOCUS_22050 8498 6315 gene locus_tag LOCUS_22060 gene ntrY 8498 6315 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640318.1 protein_id gnl|my_center|LOCUS_22060 8458 8619 gene locus_tag LOCUS_22070 8458 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 9485 8634 gene locus_tag LOCUS_22080 9485 8634 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y507 protein_id gnl|my_center|LOCUS_22080 9366 9635 gene locus_tag LOCUS_22090 9366 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 9693 10847 gene locus_tag LOCUS_22100 gene ispDF 9693 10847 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y505 protein_id gnl|my_center|LOCUS_22100 10840 11340 gene locus_tag LOCUS_22110 10840 11340 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087256.1 protein_id gnl|my_center|LOCUS_22110 11802 11314 gene locus_tag LOCUS_22120 11802 11314 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707850.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence085 761 1531 gene locus_tag LOCUS_22130 761 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2311 1664 gene locus_tag LOCUS_22140 2311 1664 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_22140 2635 3378 gene locus_tag LOCUS_22150 2635 3378 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_22150 3731 3402 gene locus_tag LOCUS_22160 3731 3402 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038260.1 protein_id gnl|my_center|LOCUS_22160 4021 3731 gene locus_tag LOCUS_22170 4021 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917958.1 protein_id gnl|my_center|LOCUS_22170 5023 4022 gene locus_tag LOCUS_22180 gene gpsA 5023 4022 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58141 protein_id gnl|my_center|LOCUS_22180 6150 5020 gene locus_tag LOCUS_22190 gene tsaD 6150 5020 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAF2 protein_id gnl|my_center|LOCUS_22190 6188 7129 gene locus_tag LOCUS_22200 gene hemC 6188 7129 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J029 protein_id gnl|my_center|LOCUS_22200 7126 7836 gene locus_tag LOCUS_22210 7126 7836 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639872.1 protein_id gnl|my_center|LOCUS_22210 7887 9146 gene locus_tag LOCUS_22220 7887 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 9143 10582 gene locus_tag LOCUS_22230 9143 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917964.1 protein_id gnl|my_center|LOCUS_22230 10579 11238 gene locus_tag LOCUS_22240 gene udk 10579 11238 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4Y5 protein_id gnl|my_center|LOCUS_22240 11300 11375 gene locus_tag LOCUS_t00350 11300 11375 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence086 823 83 gene locus_tag LOCUS_22250 823 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1593 820 gene locus_tag LOCUS_22260 1593 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2354 1590 gene locus_tag LOCUS_22270 2354 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3097 2351 gene locus_tag LOCUS_22280 3097 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 5040 3205 gene locus_tag LOCUS_22290 5040 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 6884 5037 gene locus_tag LOCUS_22300 6884 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 8737 6881 gene locus_tag LOCUS_22310 8737 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 10596 8734 gene locus_tag LOCUS_22320 10596 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 <11840 10698 gene locus_tag LOCUS_22330 <11840 10698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068343.1:aminopeptidase N >Feature sequence087 54 665 gene locus_tag LOCUS_22340 54 665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_22340 1364 759 gene locus_tag LOCUS_22350 1364 759 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTI5 protein_id gnl|my_center|LOCUS_22350 1281 1472 gene locus_tag LOCUS_22360 1281 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1480 2304 gene locus_tag LOCUS_22370 1480 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3653 2301 gene locus_tag LOCUS_22380 gene trmFO 3653 2301 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 protein_id gnl|my_center|LOCUS_22380 3789 4949 gene locus_tag LOCUS_22390 3789 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 4946 5770 gene locus_tag LOCUS_22400 4946 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 5832 6734 gene locus_tag LOCUS_22410 5832 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 6799 7779 gene locus_tag LOCUS_22420 6799 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 7850 8755 gene locus_tag LOCUS_22430 7850 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 <11617 8756 gene locus_tag LOCUS_22440 <11617 8756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A572:UvrABC system protein A >Feature sequence088 652 1203 gene locus_tag LOCUS_22450 652 1203 CDS product DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904930.1 protein_id gnl|my_center|LOCUS_22450 1493 1774 gene locus_tag LOCUS_22460 1493 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1771 2136 gene locus_tag LOCUS_22470 1771 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_22470 2139 2471 gene locus_tag LOCUS_22480 2139 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3686 2610 gene locus_tag LOCUS_22490 3686 2610 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_22490 5689 4229 gene locus_tag LOCUS_22500 5689 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 6119 6289 gene locus_tag LOCUS_22510 6119 6289 CDS product plasmid-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040057.1 protein_id gnl|my_center|LOCUS_22510 6286 9039 gene locus_tag LOCUS_22520 6286 9039 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124782.1 protein_id gnl|my_center|LOCUS_22520 9036 9869 gene locus_tag LOCUS_22530 9036 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence089 711 307 gene locus_tag LOCUS_22540 gene irr 711 307 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968450.1 protein_id gnl|my_center|LOCUS_22540 2224 749 gene locus_tag LOCUS_22550 2224 749 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_22550 2350 3543 gene locus_tag LOCUS_22560 2350 3543 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_22560 3647 4735 gene locus_tag LOCUS_22570 gene alr 3647 4735 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KQ05 protein_id gnl|my_center|LOCUS_22570 4777 7368 gene locus_tag LOCUS_22580 4777 7368 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_22580 7381 8175 gene locus_tag LOCUS_22590 gene paaG 7381 8175 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227109.1 protein_id gnl|my_center|LOCUS_22590 8172 8564 gene locus_tag LOCUS_22600 8172 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 8571 9713 gene locus_tag LOCUS_22610 8571 9713 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975704.1 protein_id gnl|my_center|LOCUS_22610 <11091 9854 gene locus_tag LOCUS_22620 <11091 9854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919497.1:TonB-dependent receptor >Feature sequence090 49 744 gene locus_tag LOCUS_22630 49 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2017 761 gene locus_tag LOCUS_22640 2017 761 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_22640 2213 2737 gene locus_tag LOCUS_22650 2213 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2918 3433 gene locus_tag LOCUS_22660 2918 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3896 3630 gene locus_tag LOCUS_22670 3896 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 5021 3939 gene locus_tag LOCUS_22680 5021 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_22680 6263 5112 gene locus_tag LOCUS_22690 6263 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967940.1 protein_id gnl|my_center|LOCUS_22690 9170 6585 gene locus_tag LOCUS_22700 9170 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence091 <1 869 gene locus_tag LOCUS_22710 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067008.1:peptidase S41 1650 964 gene locus_tag LOCUS_22720 1650 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3041 1650 gene locus_tag LOCUS_22730 gene fumC 3041 1650 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF0 protein_id gnl|my_center|LOCUS_22730 3122 3502 gene locus_tag LOCUS_22740 gene rusA 3122 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919968.1 protein_id gnl|my_center|LOCUS_22740 4686 3499 gene locus_tag LOCUS_22750 4686 3499 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 protein_id gnl|my_center|LOCUS_22750 5152 4676 gene locus_tag LOCUS_22760 5152 4676 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919964.1 protein_id gnl|my_center|LOCUS_22760 5685 5149 gene locus_tag LOCUS_22770 gene sspB 5685 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919963.1 protein_id gnl|my_center|LOCUS_22770 5821 7176 gene locus_tag LOCUS_22780 gene cyc 5821 7176 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971719.1 protein_id gnl|my_center|LOCUS_22780 7476 7348 gene locus_tag LOCUS_22790 7476 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 8462 7557 gene locus_tag LOCUS_22800 8462 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 8704 8982 gene locus_tag LOCUS_22810 8704 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 9461 9018 gene locus_tag LOCUS_22820 9461 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 9781 9617 gene locus_tag LOCUS_22830 9781 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence092 362 676 gene locus_tag LOCUS_22840 gene rpsJ 362 676 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_22840 680 1465 gene locus_tag LOCUS_22850 gene rplC 680 1465 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW0 protein_id gnl|my_center|LOCUS_22850 1462 2100 gene locus_tag LOCUS_22860 gene rplD 1462 2100 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V2 protein_id gnl|my_center|LOCUS_22860 2100 2405 gene locus_tag LOCUS_22870 gene rplW 2100 2405 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4D6 protein_id gnl|my_center|LOCUS_22870 2410 3246 gene locus_tag LOCUS_22880 gene rplB 2410 3246 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V0 protein_id gnl|my_center|LOCUS_22880 3262 3540 gene locus_tag LOCUS_22890 gene rpsS 3262 3540 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW4 protein_id gnl|my_center|LOCUS_22890 3540 3944 gene locus_tag LOCUS_22900 gene rplV 3540 3944 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D2 protein_id gnl|my_center|LOCUS_22900 3944 4654 gene locus_tag LOCUS_22910 gene rpsC 3944 4654 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD0 protein_id gnl|my_center|LOCUS_22910 4680 5093 gene locus_tag LOCUS_22920 gene rplP 4680 5093 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 protein_id gnl|my_center|LOCUS_22920 5105 5311 gene locus_tag LOCUS_22930 gene rpmC 5105 5311 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QG2 protein_id gnl|my_center|LOCUS_22930 5315 5551 gene locus_tag LOCUS_22940 gene rpsQ 5315 5551 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U4 protein_id gnl|my_center|LOCUS_22940 5586 5954 gene locus_tag LOCUS_22950 gene rplN 5586 5954 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J94 protein_id gnl|my_center|LOCUS_22950 5957 6271 gene locus_tag LOCUS_22960 gene rplX 5957 6271 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U870 protein_id gnl|my_center|LOCUS_22960 6264 6824 gene locus_tag LOCUS_22970 gene rplE 6264 6824 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E6 protein_id gnl|my_center|LOCUS_22970 6874 7179 gene locus_tag LOCUS_22980 gene rpsN 6874 7179 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD7 protein_id gnl|my_center|LOCUS_22980 7203 7595 gene locus_tag LOCUS_22990 gene rpsH 7203 7595 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E8 protein_id gnl|my_center|LOCUS_22990 7607 8140 gene locus_tag LOCUS_23000 gene rplF 7607 8140 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE33 protein_id gnl|my_center|LOCUS_23000 8152 8508 gene locus_tag LOCUS_23010 gene rplR 8152 8508 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF4 protein_id gnl|my_center|LOCUS_23010 8520 9104 gene locus_tag LOCUS_23020 gene rpsE 8520 9104 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T6 protein_id gnl|my_center|LOCUS_23020 9114 9302 gene locus_tag LOCUS_23030 gene rpmD 9114 9302 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T5 protein_id gnl|my_center|LOCUS_23030 9335 9826 gene locus_tag LOCUS_23040 gene rplO 9335 9826 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q3 protein_id gnl|my_center|LOCUS_23040 >Feature sequence093 71 271 gene locus_tag LOCUS_23050 71 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 395 1597 gene locus_tag LOCUS_23060 395 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 3582 1594 gene locus_tag LOCUS_23070 gene tklB 3582 1594 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX58 protein_id gnl|my_center|LOCUS_23070 3727 4821 gene locus_tag LOCUS_23080 3727 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_23080 5696 4818 gene locus_tag LOCUS_23090 5696 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099950.1 protein_id gnl|my_center|LOCUS_23090 6448 5699 gene locus_tag LOCUS_23100 6448 5699 CDS product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 protein_id gnl|my_center|LOCUS_23100 6605 7258 gene locus_tag LOCUS_23110 gene tal 6605 7258 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H6D3 protein_id gnl|my_center|LOCUS_23110 8073 7255 gene locus_tag LOCUS_23120 8073 7255 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_23120 8663 8091 gene locus_tag LOCUS_23130 8663 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 9208 8861 gene locus_tag LOCUS_23140 gene zapA 9208 8861 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCW6 protein_id gnl|my_center|LOCUS_23140 9485 9201 gene locus_tag LOCUS_23150 9485 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 10498 9545 gene locus_tag LOCUS_23160 10498 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence094 1371 2243 gene locus_tag LOCUS_23170 1371 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2304 2594 gene locus_tag LOCUS_23180 2304 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 3154 2591 gene locus_tag LOCUS_23190 3154 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4088 3270 gene locus_tag LOCUS_23200 4088 3270 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_23200 4184 4549 gene locus_tag LOCUS_23210 gene panD 4184 4549 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A602 protein_id gnl|my_center|LOCUS_23210 4592 5017 gene locus_tag LOCUS_23220 4592 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 5709 5014 gene locus_tag LOCUS_23230 5709 5014 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_23230 5857 5933 gene locus_tag LOCUS_t00360 5857 5933 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6166 6819 gene locus_tag LOCUS_23240 6166 6819 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262210.1 protein_id gnl|my_center|LOCUS_23240 6915 8282 gene locus_tag LOCUS_23250 6915 8282 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_23250 10352 8286 gene locus_tag LOCUS_23260 10352 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence095 <1 1316 gene locus_tag LOCUS_23270 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196600.1:long-chain-fatty-acid--CoA ligase 1528 1710 gene locus_tag LOCUS_23280 1528 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2394 1711 gene locus_tag LOCUS_23290 2394 1711 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_23290 3416 2379 gene locus_tag LOCUS_23300 gene tdh 3416 2379 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564818.1 protein_id gnl|my_center|LOCUS_23300 4161 3388 gene locus_tag LOCUS_23310 4161 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 5618 4404 gene locus_tag LOCUS_23320 5618 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976394.1 protein_id gnl|my_center|LOCUS_23320 7044 5830 gene locus_tag LOCUS_23330 gene kbl 7044 5830 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN30 protein_id gnl|my_center|LOCUS_23330 7218 9029 gene locus_tag LOCUS_23340 7218 9029 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence096 <1 2790 gene locus_tag LOCUS_23350 <1 2790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923305.1:double-strand break repair helicase AddA 2869 3204 gene locus_tag LOCUS_23360 2869 3204 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_23360 3297 3578 gene locus_tag LOCUS_23370 3297 3578 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971166.1 protein_id gnl|my_center|LOCUS_23370 3575 3862 gene locus_tag LOCUS_23380 3575 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 4426 3857 gene locus_tag LOCUS_23390 4426 3857 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970944.1 protein_id gnl|my_center|LOCUS_23390 5754 4438 gene locus_tag LOCUS_23400 5754 4438 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 protein_id gnl|my_center|LOCUS_23400 6643 5741 gene locus_tag LOCUS_23410 gene accD 6643 5741 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L5 protein_id gnl|my_center|LOCUS_23410 7440 6655 gene locus_tag LOCUS_23420 gene trpA 7440 6655 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H661 protein_id gnl|my_center|LOCUS_23420 8046 7441 gene locus_tag LOCUS_23430 8046 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 9382 8162 gene locus_tag LOCUS_23440 gene trpB 9382 8162 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12290 protein_id gnl|my_center|LOCUS_23440 8500 8581 gene locus_tag LOCUS_t00370 8500 8581 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 184 645 gene locus_tag LOCUS_23450 184 645 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920328.1 protein_id gnl|my_center|LOCUS_23450 1466 648 gene locus_tag LOCUS_23460 1466 648 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918777.1 protein_id gnl|my_center|LOCUS_23460 1633 2733 gene locus_tag LOCUS_23470 1633 2733 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918776.1 protein_id gnl|my_center|LOCUS_23470 5069 2739 gene locus_tag LOCUS_23480 gene clpA 5069 2739 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920326.1 protein_id gnl|my_center|LOCUS_23480 5402 5073 gene locus_tag LOCUS_23490 gene clpS 5402 5073 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSI5 protein_id gnl|my_center|LOCUS_23490 6321 5647 gene locus_tag LOCUS_23500 6321 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 6474 7748 gene locus_tag LOCUS_23510 6474 7748 CDS product peptidase S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389962.1 protein_id gnl|my_center|LOCUS_23510 8188 7745 gene locus_tag LOCUS_23520 8188 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 9126 8188 gene locus_tag LOCUS_23530 9126 8188 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_23530 9661 9158 gene locus_tag LOCUS_23540 9661 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence098 1407 1562 gene locus_tag LOCUS_23550 1407 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1559 1945 gene locus_tag LOCUS_23560 1559 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 1935 2279 gene locus_tag LOCUS_23570 1935 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2394 2723 gene locus_tag LOCUS_23580 2394 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2911 4296 gene locus_tag LOCUS_23590 2911 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 4307 4232 gene locus_tag LOCUS_t00380 4307 4232 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4467 5660 gene locus_tag LOCUS_23600 4467 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 5657 6103 gene locus_tag LOCUS_23610 gene rcp1 5657 6103 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_23610 6174 6479 gene locus_tag LOCUS_23620 6174 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 6479 6793 gene locus_tag LOCUS_23630 6479 6793 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC38 protein_id gnl|my_center|LOCUS_23630 6790 7686 gene locus_tag LOCUS_23640 gene folD 6790 7686 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Y0 protein_id gnl|my_center|LOCUS_23640 7757 8167 gene locus_tag LOCUS_23650 7757 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 8228 9358 gene locus_tag LOCUS_23660 8228 9358 CDS product polysaccharide biosynthesis protein CelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640455.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence099 414 623 gene locus_tag LOCUS_23670 414 623 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976082.1 protein_id gnl|my_center|LOCUS_23670 733 960 gene locus_tag LOCUS_23680 733 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 2191 1190 gene locus_tag LOCUS_23690 2191 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2536 2955 gene locus_tag LOCUS_23700 2536 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3071 3502 gene locus_tag LOCUS_23710 3071 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 3611 4036 gene locus_tag LOCUS_23720 3611 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4195 5742 gene locus_tag LOCUS_23730 4195 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 6353 6045 gene locus_tag LOCUS_23740 6353 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 6484 6774 gene locus_tag LOCUS_23750 6484 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 7142 6771 gene locus_tag LOCUS_23760 7142 6771 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P4 protein_id gnl|my_center|LOCUS_23760 8160 7156 gene locus_tag LOCUS_23770 8160 7156 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_23770 8502 8191 gene locus_tag LOCUS_23780 8502 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 8395 8838 gene locus_tag LOCUS_23790 8395 8838 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639955.1 protein_id gnl|my_center|LOCUS_23790 8972 8829 gene locus_tag LOCUS_23800 8972 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 9666 9331 gene locus_tag LOCUS_23810 9666 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence100 1042 110 gene locus_tag LOCUS_23820 1042 110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_23820 1649 1155 gene locus_tag LOCUS_23830 1649 1155 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532473.1 protein_id gnl|my_center|LOCUS_23830 1731 2306 gene locus_tag LOCUS_23840 1731 2306 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919980.1 protein_id gnl|my_center|LOCUS_23840 2340 2669 gene locus_tag LOCUS_23850 2340 2669 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_23850 3286 2666 gene locus_tag LOCUS_23860 gene pmtA 3286 2666 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_23860 3580 3296 gene locus_tag LOCUS_23870 3580 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4431 3637 gene locus_tag LOCUS_23880 4431 3637 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640711.1 protein_id gnl|my_center|LOCUS_23880 4997 4431 gene locus_tag LOCUS_23890 gene efp 4997 4431 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_23890 5602 5117 gene locus_tag LOCUS_23900 5602 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 6189 5599 gene locus_tag LOCUS_23910 6189 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530785.1 protein_id gnl|my_center|LOCUS_23910 7479 6265 gene locus_tag LOCUS_23920 gene enhC 7479 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973296.1 protein_id gnl|my_center|LOCUS_23920 8124 7492 gene locus_tag LOCUS_23930 gene thiE 8124 7492 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_23930 8243 8635 gene locus_tag LOCUS_23940 8243 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 <9733 8748 gene locus_tag LOCUS_23950 <9733 8748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EC56:membrane-bound lytic murein transglycosylase F >Feature sequence101 2117 996 gene locus_tag LOCUS_23960 2117 996 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919561.1 protein_id gnl|my_center|LOCUS_23960 2237 3709 gene locus_tag LOCUS_23970 gene pepA 2237 3709 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8R6 protein_id gnl|my_center|LOCUS_23970 3768 4166 gene locus_tag LOCUS_23980 3768 4166 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919563.1 protein_id gnl|my_center|LOCUS_23980 4246 4767 gene locus_tag LOCUS_23990 4246 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 4767 5051 gene locus_tag LOCUS_24000 4767 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383290.1 protein_id gnl|my_center|LOCUS_24000 7007 5160 gene locus_tag LOCUS_24010 7007 5160 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707482.1 protein_id gnl|my_center|LOCUS_24010 7134 7556 gene locus_tag LOCUS_24020 gene ndk 7134 7556 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MS3 protein_id gnl|my_center|LOCUS_24020 8181 7762 gene locus_tag LOCUS_24030 8181 7762 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_24030 8756 8187 gene locus_tag LOCUS_24040 gene purN 8756 8187 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J516 protein_id gnl|my_center|LOCUS_24040 <9673 8753 gene locus_tag LOCUS_24050 <9673 8753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C924:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence102 1447 581 gene locus_tag LOCUS_24060 1447 581 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061736.1 protein_id gnl|my_center|LOCUS_24060 2016 1444 gene locus_tag LOCUS_24070 gene rfbC 2016 1444 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974015.1 protein_id gnl|my_center|LOCUS_24070 2152 3357 gene locus_tag LOCUS_24080 gene wcaG 2152 3357 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 protein_id gnl|my_center|LOCUS_24080 4040 3354 gene locus_tag LOCUS_24090 4040 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 5210 4047 gene locus_tag LOCUS_24100 5210 4047 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2D4 protein_id gnl|my_center|LOCUS_24100 5339 6970 gene locus_tag LOCUS_24110 5339 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532519.1 protein_id gnl|my_center|LOCUS_24110 7078 8562 gene locus_tag LOCUS_24120 7078 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532365.1 protein_id gnl|my_center|LOCUS_24120 9227 8559 gene locus_tag LOCUS_24130 9227 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence103 77 1030 gene locus_tag LOCUS_24140 77 1030 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919326.1 protein_id gnl|my_center|LOCUS_24140 1177 2310 gene locus_tag LOCUS_24150 gene nadA 1177 2310 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4C4 protein_id gnl|my_center|LOCUS_24150 2317 3810 gene locus_tag LOCUS_24160 2317 3810 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUG1 protein_id gnl|my_center|LOCUS_24160 3807 4652 gene locus_tag LOCUS_24170 3807 4652 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_24170 5413 4655 gene locus_tag LOCUS_24180 5413 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 8286 5614 gene locus_tag LOCUS_24190 8286 5614 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640245.1 protein_id gnl|my_center|LOCUS_24190 <9023 8418 gene locus_tag LOCUS_24200 <9023 8418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89S69:glycine--tRNA ligase beta subunit >Feature sequence104 163 1494 gene locus_tag LOCUS_24210 gene gltX 163 1494 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC35 protein_id gnl|my_center|LOCUS_24210 2045 1491 gene locus_tag LOCUS_24220 2045 1491 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI3 protein_id gnl|my_center|LOCUS_24220 2145 3131 gene locus_tag LOCUS_24230 2145 3131 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 protein_id gnl|my_center|LOCUS_24230 4513 3128 gene locus_tag LOCUS_24240 4513 3128 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBY3 protein_id gnl|my_center|LOCUS_24240 5865 4489 gene locus_tag LOCUS_24250 5865 4489 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920161.1 protein_id gnl|my_center|LOCUS_24250 6579 5878 gene locus_tag LOCUS_24260 gene rpiA 6579 5878 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDE7 protein_id gnl|my_center|LOCUS_24260 8045 6576 gene locus_tag LOCUS_24270 gene gabD 8045 6576 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_24270 <8966 8048 gene locus_tag LOCUS_24280 <8966 8048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MCF7:bifunctional protein GlmU >Feature sequence105 2215 341 gene locus_tag LOCUS_24290 2215 341 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 protein_id gnl|my_center|LOCUS_24290 2319 2477 gene locus_tag LOCUS_24300 2319 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2914 2474 gene locus_tag LOCUS_24310 2914 2474 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_24310 3255 2926 gene locus_tag LOCUS_24320 3255 2926 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339060.1 protein_id gnl|my_center|LOCUS_24320 4232 3444 gene locus_tag LOCUS_24330 4232 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 5215 4358 gene locus_tag LOCUS_24340 gene prmA 5215 4358 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 protein_id gnl|my_center|LOCUS_24340 7509 5212 gene locus_tag LOCUS_24350 7509 5212 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A836 protein_id gnl|my_center|LOCUS_24350 7615 7998 gene locus_tag LOCUS_24360 7615 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 <8895 7995 gene locus_tag LOCUS_24370 <8895 7995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389287.1:chloride channel protein >Feature sequence106 3591 1732 gene locus_tag LOCUS_24380 3591 1732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537707.1 protein_id gnl|my_center|LOCUS_24380 3746 5992 gene locus_tag LOCUS_24390 3746 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 6921 5989 gene locus_tag LOCUS_24400 6921 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence107 2468 1128 gene locus_tag LOCUS_24410 gene tilS 2468 1128 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92JY3 protein_id gnl|my_center|LOCUS_24410 3391 2459 gene locus_tag LOCUS_24420 3391 2459 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_24420 4039 3518 gene locus_tag LOCUS_24430 gene pal 4039 3518 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921062.1 protein_id gnl|my_center|LOCUS_24430 5554 4202 gene locus_tag LOCUS_24440 gene tolB 5554 4202 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q926C2 protein_id gnl|my_center|LOCUS_24440 6375 5593 gene locus_tag LOCUS_24450 6375 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 6841 6386 gene locus_tag LOCUS_24460 gene tolR 6841 6386 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527592.1 protein_id gnl|my_center|LOCUS_24460 7513 6845 gene locus_tag LOCUS_24470 gene tolQ 7513 6845 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537914.1 protein_id gnl|my_center|LOCUS_24470 8127 7669 gene locus_tag LOCUS_24480 8127 7669 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence108 740 1495 gene locus_tag LOCUS_24490 740 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1492 2268 gene locus_tag LOCUS_24500 1492 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2352 3101 gene locus_tag LOCUS_24510 gene dpm1 2352 3101 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_24510 3101 4948 gene locus_tag LOCUS_24520 3101 4948 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_24520 5711 4932 gene locus_tag LOCUS_24530 5711 4932 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3I0 protein_id gnl|my_center|LOCUS_24530 5801 6622 gene locus_tag LOCUS_24540 5801 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 6667 7818 gene locus_tag LOCUS_24550 6667 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 <8748 7891 gene locus_tag LOCUS_24560 <8748 7891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TN14:ATP-dependent zinc metalloprotease FtsH >Feature sequence109 1216 395 gene locus_tag LOCUS_24570 gene fabI 1216 395 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEH0 protein_id gnl|my_center|LOCUS_24570 1981 1241 gene locus_tag LOCUS_24580 1981 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3192 1978 gene locus_tag LOCUS_24590 3192 1978 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921546.1 protein_id gnl|my_center|LOCUS_24590 3742 3215 gene locus_tag LOCUS_24600 gene fabA 3742 3215 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVZ8 protein_id gnl|my_center|LOCUS_24600 4490 3816 gene locus_tag LOCUS_24610 4490 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 4489 5388 gene locus_tag LOCUS_24620 4489 5388 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_24620 6156 5410 gene locus_tag LOCUS_24630 6156 5410 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921553.1 protein_id gnl|my_center|LOCUS_24630 6227 7510 gene locus_tag LOCUS_24640 6227 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 8470 7514 gene locus_tag LOCUS_24650 gene cysK 8470 7514 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence110 814 2337 gene locus_tag LOCUS_24660 814 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640002.1 protein_id gnl|my_center|LOCUS_24660 2817 2350 gene locus_tag LOCUS_24670 2817 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 3379 3020 gene locus_tag LOCUS_24680 3379 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 4004 3801 gene locus_tag LOCUS_24690 4004 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 5053 4001 gene locus_tag LOCUS_24700 5053 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 6626 5058 gene locus_tag LOCUS_24710 gene guaA 6626 5058 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N53 protein_id gnl|my_center|LOCUS_24710 <8236 7730 gene locus_tag LOCUS_24720 <8236 7730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919493.1:tRNA/rRNA methyltransferase >Feature sequence111 <1 211 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggctggacctcgatctctaaacggctaaact 590 285 gene locus_tag LOCUS_24730 gene cas2 590 285 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_24730 1527 628 gene locus_tag LOCUS_24740 gene cas1 1527 628 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_24740 4823 1527 gene locus_tag LOCUS_24750 4823 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 5529 5810 gene locus_tag LOCUS_24760 5529 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24760 5879 6988 gene locus_tag LOCUS_24770 5879 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence112 <1 860 gene locus_tag LOCUS_24780 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107656.1:transporter 860 2446 gene locus_tag LOCUS_24790 860 2446 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_24790 2443 5613 gene locus_tag LOCUS_24800 gene cusA 2443 5613 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_24800 5610 6008 gene locus_tag LOCUS_24810 5610 6008 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720046.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence113 1628 870 gene locus_tag LOCUS_24820 1628 870 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639996.1 protein_id gnl|my_center|LOCUS_24820 1710 2480 gene locus_tag LOCUS_24830 gene gloB 1710 2480 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XT5 protein_id gnl|my_center|LOCUS_24830 2477 2905 gene locus_tag LOCUS_24840 2477 2905 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066774.1 protein_id gnl|my_center|LOCUS_24840 3631 2891 gene locus_tag LOCUS_24850 3631 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 4406 3678 gene locus_tag LOCUS_24860 4406 3678 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067323.1 protein_id gnl|my_center|LOCUS_24860 4571 5161 gene locus_tag LOCUS_24870 4571 5161 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529185.1 protein_id gnl|my_center|LOCUS_24870 5287 5598 gene locus_tag LOCUS_24880 5287 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 6223 5678 gene locus_tag LOCUS_24890 6223 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918358.1 protein_id gnl|my_center|LOCUS_24890 6967 6236 gene locus_tag LOCUS_24900 6967 6236 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence114 3271 2501 gene locus_tag LOCUS_24910 gene fliP 3271 2501 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45980 protein_id gnl|my_center|LOCUS_24910 3561 3268 gene locus_tag LOCUS_24920 3561 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3640 4017 gene locus_tag LOCUS_24930 3640 4017 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH2 protein_id gnl|my_center|LOCUS_24930 4028 4441 gene locus_tag LOCUS_24940 gene flgC 4028 4441 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I26 protein_id gnl|my_center|LOCUS_24940 4453 4764 gene locus_tag LOCUS_24950 gene fliE1 4453 4764 CDS product flagellar hook-basal body complex protein FliE 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I27 protein_id gnl|my_center|LOCUS_24950 6668 4767 gene locus_tag LOCUS_24960 6668 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence115 2216 627 gene locus_tag LOCUS_24970 gene purH 2216 627 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU8 protein_id gnl|my_center|LOCUS_24970 4011 2293 gene locus_tag LOCUS_24980 4011 2293 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083409.1 protein_id gnl|my_center|LOCUS_24980 4679 4017 gene locus_tag LOCUS_24990 4679 4017 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4H5 protein_id gnl|my_center|LOCUS_24990 6027 4723 gene locus_tag LOCUS_25000 gene rsmB 6027 4723 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917991.1 protein_id gnl|my_center|LOCUS_25000 6074 6280 gene locus_tag LOCUS_25010 6074 6280 CDS product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083407.1 protein_id gnl|my_center|LOCUS_25010 6344 7534 gene locus_tag LOCUS_25020 6344 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence116 952 2343 gene locus_tag LOCUS_25030 gene ahcY 952 2343 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBA9 protein_id gnl|my_center|LOCUS_25030 2427 2879 gene locus_tag LOCUS_25040 2427 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2885 3475 gene locus_tag LOCUS_25050 2885 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 3488 4303 gene locus_tag LOCUS_25060 3488 4303 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921533.1 protein_id gnl|my_center|LOCUS_25060 4986 4300 gene locus_tag LOCUS_25070 4986 4300 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921570.1 protein_id gnl|my_center|LOCUS_25070 5295 5801 gene locus_tag LOCUS_25080 5295 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 protein_id gnl|my_center|LOCUS_25080 6474 5791 gene locus_tag LOCUS_25090 6474 5791 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970578.1 protein_id gnl|my_center|LOCUS_25090 6473 7090 gene locus_tag LOCUS_25100 6473 7090 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_25100 7506 7087 gene locus_tag LOCUS_25110 7506 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence117 1460 1071 gene locus_tag LOCUS_25120 1460 1071 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531932.1 protein_id gnl|my_center|LOCUS_25120 1632 2534 gene locus_tag LOCUS_25130 1632 2534 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_25130 2531 3793 gene locus_tag LOCUS_25140 gene dinB 2531 3793 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY04 protein_id gnl|my_center|LOCUS_25140 3853 4314 gene locus_tag LOCUS_25150 3853 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_25150 4931 4311 gene locus_tag LOCUS_25160 4931 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764790.1 protein_id gnl|my_center|LOCUS_25160 5671 4928 gene locus_tag LOCUS_25170 5671 4928 CDS product hypothetical short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701575.1 protein_id gnl|my_center|LOCUS_25170 5755 6894 gene locus_tag LOCUS_25180 5755 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531771.1 protein_id gnl|my_center|LOCUS_25180 6917 7363 gene locus_tag LOCUS_25190 6917 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence118 <1 2232 gene locus_tag LOCUS_25200 <1 2232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A217:leucine--tRNA ligase 2235 2726 gene locus_tag LOCUS_25210 2235 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2723 3778 gene locus_tag LOCUS_25220 gene holA 2723 3778 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_25220 3825 3901 gene locus_tag LOCUS_t00390 3825 3901 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4356 4907 gene locus_tag LOCUS_25230 4356 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 4961 5536 gene locus_tag LOCUS_25240 4961 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 5728 7245 gene locus_tag LOCUS_25250 5728 7245 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence119 794 1846 gene locus_tag LOCUS_25260 gene rsgA 794 1846 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1K8 protein_id gnl|my_center|LOCUS_25260 1990 3192 gene locus_tag LOCUS_25270 1990 3192 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_25270 3206 4915 gene locus_tag LOCUS_25280 3206 4915 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_25280 4919 5980 gene locus_tag LOCUS_25290 gene perM 4919 5980 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 protein_id gnl|my_center|LOCUS_25290 5980 6930 gene locus_tag LOCUS_25300 gene yrbG 5980 6930 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence120 647 6 gene locus_tag LOCUS_25310 647 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1487 741 gene locus_tag LOCUS_25320 1487 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2254 1484 gene locus_tag LOCUS_25330 2254 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 3036 2251 gene locus_tag LOCUS_25340 3036 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 4154 3033 gene locus_tag LOCUS_25350 4154 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_25350 5046 4300 gene locus_tag LOCUS_25360 5046 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 5780 5043 gene locus_tag LOCUS_25370 5780 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 6517 5777 gene locus_tag LOCUS_25380 6517 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 7203 6514 gene locus_tag LOCUS_25390 7203 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence121 1441 449 gene locus_tag LOCUS_25400 1441 449 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T0 protein_id gnl|my_center|LOCUS_25400 2116 1490 gene locus_tag LOCUS_25410 gene folE 2116 1490 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T6 protein_id gnl|my_center|LOCUS_25410 2327 3703 gene locus_tag LOCUS_25420 gene cysS 2327 3703 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZS3 protein_id gnl|my_center|LOCUS_25420 3916 4353 gene locus_tag LOCUS_25430 3916 4353 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918350.1 protein_id gnl|my_center|LOCUS_25430 4478 4828 gene locus_tag LOCUS_25440 4478 4828 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8C4 protein_id gnl|my_center|LOCUS_25440 4825 6756 gene locus_tag LOCUS_25450 gene thrS 4825 6756 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_25450 >Feature sequence122 254 2218 gene locus_tag LOCUS_25460 gene acsA 254 2218 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_25460 2411 2983 gene locus_tag LOCUS_25470 2411 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 3044 3979 gene locus_tag LOCUS_25480 gene glsA 3044 3979 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV3 protein_id gnl|my_center|LOCUS_25480 5528 4002 gene locus_tag LOCUS_25490 5528 4002 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110305.1 protein_id gnl|my_center|LOCUS_25490 5799 6644 gene locus_tag LOCUS_25500 5799 6644 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence123 1304 1032 gene locus_tag LOCUS_25510 gene ptsH 1304 1032 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 protein_id gnl|my_center|LOCUS_25510 1711 1304 gene locus_tag LOCUS_25520 1711 1304 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532013.1 protein_id gnl|my_center|LOCUS_25520 3404 1782 gene locus_tag LOCUS_25530 gene chvG 3404 1782 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918127.1 protein_id gnl|my_center|LOCUS_25530 4077 3373 gene locus_tag LOCUS_25540 gene chvI 4077 3373 CDS product transcriptional regulatory protein ChvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50351 protein_id gnl|my_center|LOCUS_25540 4207 5904 gene locus_tag LOCUS_25550 4207 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918125.1 protein_id gnl|my_center|LOCUS_25550 6824 5886 gene locus_tag LOCUS_25560 6824 5886 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920138.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence124 110 508 gene locus_tag LOCUS_25570 110 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703749.1 protein_id gnl|my_center|LOCUS_25570 508 921 gene locus_tag LOCUS_25580 508 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 999 2168 gene locus_tag LOCUS_25590 999 2168 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_25590 2240 2668 gene locus_tag LOCUS_25600 2240 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 4353 2995 gene locus_tag LOCUS_25610 4353 2995 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_25610 4736 4359 gene locus_tag LOCUS_25620 gene gfaA 4736 4359 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071172.1 protein_id gnl|my_center|LOCUS_25620 5437 4733 gene locus_tag LOCUS_25630 5437 4733 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919119.1 protein_id gnl|my_center|LOCUS_25630 5662 5747 gene locus_tag LOCUS_t00400 5662 5747 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5871 5944 gene locus_tag LOCUS_t00410 5871 5944 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence125 1133 867 gene locus_tag LOCUS_25640 1133 867 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974003.1 protein_id gnl|my_center|LOCUS_25640 1221 1718 gene locus_tag LOCUS_25650 1221 1718 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_25650 1927 2139 gene locus_tag LOCUS_25660 1927 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2132 2584 gene locus_tag LOCUS_25670 2132 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3519 3289 gene locus_tag LOCUS_25680 3519 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3980 3774 gene locus_tag LOCUS_25690 3980 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence126 756 238 gene locus_tag LOCUS_25700 756 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 804 1871 gene locus_tag LOCUS_25710 804 1871 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918265.1 protein_id gnl|my_center|LOCUS_25710 3094 1868 gene locus_tag LOCUS_25720 3094 1868 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_25720 4191 3091 gene locus_tag LOCUS_25730 4191 3091 CDS product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_25730 5325 4243 gene locus_tag LOCUS_25740 5325 4243 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6L6 protein_id gnl|my_center|LOCUS_25740 5960 5391 gene locus_tag LOCUS_25750 gene rnhB 5960 5391 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_25750 >Feature sequence127 2420 1773 gene locus_tag LOCUS_25760 2420 1773 CDS product 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884291.1 protein_id gnl|my_center|LOCUS_25760 3072 2473 gene locus_tag LOCUS_25770 3072 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3191 3373 gene locus_tag LOCUS_25780 3191 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3379 3552 gene locus_tag LOCUS_25790 3379 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 4020 3628 gene locus_tag LOCUS_25800 4020 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 4644 4402 gene locus_tag LOCUS_25810 4644 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 5654 5842 gene locus_tag LOCUS_25820 5654 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence128 1282 434 gene locus_tag LOCUS_25830 1282 434 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836683.1 protein_id gnl|my_center|LOCUS_25830 1384 1875 gene locus_tag LOCUS_25840 1384 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 3338 1929 gene locus_tag LOCUS_25850 3338 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 4729 3344 gene locus_tag LOCUS_25860 4729 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence129 <1 1155 gene locus_tag LOCUS_25870 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265663.1:two-component sensor histidine kinase 1995 1141 gene locus_tag LOCUS_25880 1995 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918948.1 protein_id gnl|my_center|LOCUS_25880 3608 2025 gene locus_tag LOCUS_25890 3608 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3713 3982 gene locus_tag LOCUS_25900 3713 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_25900 4051 5640 gene locus_tag LOCUS_25910 gene prfC 4051 5640 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C769 protein_id gnl|my_center|LOCUS_25910 >Feature sequence130 163 441 gene locus_tag LOCUS_25920 163 441 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532600.1 protein_id gnl|my_center|LOCUS_25920 804 1412 gene locus_tag LOCUS_25930 804 1412 CDS product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889208.1 protein_id gnl|my_center|LOCUS_25930 1536 2489 gene locus_tag LOCUS_25940 1536 2489 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970881.1 protein_id gnl|my_center|LOCUS_25940 2567 2821 gene locus_tag LOCUS_25950 2567 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_25950 3410 2922 gene locus_tag LOCUS_25960 3410 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 4582 3464 gene locus_tag LOCUS_25970 gene ald 4582 3464 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_25970 4721 5182 gene locus_tag LOCUS_25980 gene queF 4721 5182 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFQ1 protein_id gnl|my_center|LOCUS_25980 <5812 5179 gene locus_tag LOCUS_25990 <5812 5179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971840.1:nitroreductase >Feature sequence131 920 759 gene locus_tag LOCUS_26000 920 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 889 1899 gene locus_tag LOCUS_26010 889 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2107 2382 gene locus_tag LOCUS_26020 2107 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2422 2844 gene locus_tag LOCUS_26030 gene sufE 2422 2844 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 protein_id gnl|my_center|LOCUS_26030 3586 2834 gene locus_tag LOCUS_26040 3586 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3933 3586 gene locus_tag LOCUS_26050 3933 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 <5549 4065 gene locus_tag LOCUS_26060 <5549 4065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118364.1:Na(+)/H(+) antiporter subunit D >Feature sequence132 2004 769 gene locus_tag LOCUS_26070 2004 769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528915.1 protein_id gnl|my_center|LOCUS_26070 2080 2397 gene locus_tag LOCUS_26080 2080 2397 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_26080 2375 2857 gene locus_tag LOCUS_26090 2375 2857 CDS product ligand-binding SRPBCC domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265689.1 protein_id gnl|my_center|LOCUS_26090 2920 3516 gene locus_tag LOCUS_26100 2920 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 3722 3498 gene locus_tag LOCUS_26110 3722 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640261.1 protein_id gnl|my_center|LOCUS_26110 3785 4453 gene locus_tag LOCUS_26120 3785 4453 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083679.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence133 1275 100 gene locus_tag LOCUS_26130 1275 100 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088709.1 protein_id gnl|my_center|LOCUS_26130 2528 1551 gene locus_tag LOCUS_26140 2528 1551 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 protein_id gnl|my_center|LOCUS_26140 3133 2528 gene locus_tag LOCUS_26150 3133 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 4519 3161 gene locus_tag LOCUS_26160 gene glmM 4519 3161 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L9 protein_id gnl|my_center|LOCUS_26160 4717 5430 gene locus_tag LOCUS_26170 4717 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence134 551 1429 gene locus_tag LOCUS_26180 551 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1426 2451 gene locus_tag LOCUS_26190 1426 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2448 2933 gene locus_tag LOCUS_26200 2448 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2930 3412 gene locus_tag LOCUS_26210 2930 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence135 <1 1730 gene locus_tag LOCUS_26220 <1 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083967.1:DNA ligase-associated DEXH box helicase 1723 2418 gene locus_tag LOCUS_26230 1723 2418 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083968.1 protein_id gnl|my_center|LOCUS_26230 3550 2528 gene locus_tag LOCUS_26240 3550 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 4881 4576 gene locus_tag LOCUS_26250 4881 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 5277 5113 gene locus_tag LOCUS_26260 5277 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence136 1250 120 gene locus_tag LOCUS_26270 1250 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1826 1260 gene locus_tag LOCUS_26280 gene coq7 1826 1260 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8N7 protein_id gnl|my_center|LOCUS_26280 2335 1823 gene locus_tag LOCUS_26290 2335 1823 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920057.1 protein_id gnl|my_center|LOCUS_26290 3035 2397 gene locus_tag LOCUS_26300 3035 2397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384935.1 protein_id gnl|my_center|LOCUS_26300 3136 3220 gene locus_tag LOCUS_t00420 3136 3220 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3409 3993 gene locus_tag LOCUS_26310 3409 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720128.1 protein_id gnl|my_center|LOCUS_26310 4128 4352 gene locus_tag LOCUS_26320 4128 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence137 2117 291 gene locus_tag LOCUS_26330 2117 291 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919191.1 protein_id gnl|my_center|LOCUS_26330 2488 2222 gene locus_tag LOCUS_26340 2488 2222 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_26340 2693 2899 gene locus_tag LOCUS_26350 2693 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 3878 2886 gene locus_tag LOCUS_26360 3878 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 4693 3944 gene locus_tag LOCUS_26370 4693 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 <5229 4690 gene locus_tag LOCUS_26380 <5229 4690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919882.1:NADP-dependent oxidoreductase >Feature sequence138 1283 564 gene locus_tag LOCUS_26390 1283 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2877 1849 gene locus_tag LOCUS_26400 2877 1849 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_26400 4110 2920 gene locus_tag LOCUS_26410 gene pgk 4110 2920 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3F5 protein_id gnl|my_center|LOCUS_26410 5148 4135 gene locus_tag LOCUS_26420 gene gapB 5148 4135 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX57 protein_id gnl|my_center|LOCUS_26420 >Feature sequence139 1283 9 gene locus_tag LOCUS_26430 gene thrC 1283 9 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637168.2 protein_id gnl|my_center|LOCUS_26430 2227 1280 gene locus_tag LOCUS_26440 gene thrB 2227 1280 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4Q3 protein_id gnl|my_center|LOCUS_26440 4039 2249 gene locus_tag LOCUS_26450 4039 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 4274 4143 gene locus_tag LOCUS_26460 4274 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence140 4052 2472 gene locus_tag LOCUS_26470 4052 2472 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence141 952 56 gene locus_tag LOCUS_26480 952 56 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_26480 2091 1018 gene locus_tag LOCUS_26490 2091 1018 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705181.1 protein_id gnl|my_center|LOCUS_26490 2354 2091 gene locus_tag LOCUS_26500 2354 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4046 2436 gene locus_tag LOCUS_26510 4046 2436 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26510 4685 4050 gene locus_tag LOCUS_26520 4685 4050 CDS product potassium transporter KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106276.1 protein_id gnl|my_center|LOCUS_26520 4851 4927 gene locus_tag LOCUS_t00430 4851 4927 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence142 <1 1350 gene locus_tag LOCUS_26530 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to H7C6R5:succinate dehydrogenase flavoprotein subunit 1363 2142 gene locus_tag LOCUS_26540 1363 2142 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC40 protein_id gnl|my_center|LOCUS_26540 2153 3304 gene locus_tag LOCUS_26550 2153 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 3341 4210 gene locus_tag LOCUS_26560 3341 4210 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876262.1 protein_id gnl|my_center|LOCUS_26560 4293 4673 gene locus_tag LOCUS_26570 4293 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence143 <1 1620 gene locus_tag LOCUS_26580 <1 1620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082541.1:recombinase RecB 2058 1969 gene locus_tag LOCUS_t00440 2058 1969 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2327 2971 gene locus_tag LOCUS_26590 gene msrA 2327 2971 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W59 protein_id gnl|my_center|LOCUS_26590 3174 3917 gene locus_tag LOCUS_26600 3174 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence144 30 119 gene locus_tag LOCUS_t00450 30 119 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1493 333 gene locus_tag LOCUS_26610 gene proB 1493 333 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X86 protein_id gnl|my_center|LOCUS_26610 2022 3302 gene locus_tag LOCUS_26620 gene proA 2022 3302 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV06 protein_id gnl|my_center|LOCUS_26620 4241 3537 gene locus_tag LOCUS_26630 4241 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence145 69 1220 gene locus_tag LOCUS_26640 69 1220 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920629.1 protein_id gnl|my_center|LOCUS_26640 1217 1447 gene locus_tag LOCUS_26650 1217 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1474 1926 gene locus_tag LOCUS_26660 1474 1926 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920627.1 protein_id gnl|my_center|LOCUS_26660 1951 3168 gene locus_tag LOCUS_26670 1951 3168 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 protein_id gnl|my_center|LOCUS_26670 3560 3165 gene locus_tag LOCUS_26680 3560 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence146 1507 1289 gene locus_tag LOCUS_26690 gene rpsU 1507 1289 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3A7 protein_id gnl|my_center|LOCUS_26690 1659 2360 gene locus_tag LOCUS_26700 1659 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 protein_id gnl|my_center|LOCUS_26700 3139 2357 gene locus_tag LOCUS_26710 3139 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 <4169 3181 gene locus_tag LOCUS_26720 <4169 3181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CBG8:N5-carboxyaminoimidazole ribonucleotide synthase >Feature sequence147 1370 489 gene locus_tag LOCUS_26730 1370 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1511 2434 gene locus_tag LOCUS_26740 1511 2434 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 protein_id gnl|my_center|LOCUS_26740 2478 4124 gene locus_tag LOCUS_26750 gene nadE2 2478 4124 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708228.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence148 1163 180 gene locus_tag LOCUS_26760 gene accA 1163 180 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A448 protein_id gnl|my_center|LOCUS_26760 2489 1563 gene locus_tag LOCUS_26770 gene xerC 2489 1563 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW3 protein_id gnl|my_center|LOCUS_26770 4084 2486 gene locus_tag LOCUS_26780 4084 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920843.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence149 549 112 gene locus_tag LOCUS_26790 549 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1433 546 gene locus_tag LOCUS_26800 1433 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_26800 2066 1437 gene locus_tag LOCUS_26810 2066 1437 CDS product glycoside hydrolase family 24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 protein_id gnl|my_center|LOCUS_26810 2596 2063 gene locus_tag LOCUS_26820 2596 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920620.1 protein_id gnl|my_center|LOCUS_26820 2777 2586 gene locus_tag LOCUS_26830 2777 2586 CDS product phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640583.1 protein_id gnl|my_center|LOCUS_26830 3055 2774 gene locus_tag LOCUS_26840 3055 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640584.1 protein_id gnl|my_center|LOCUS_26840 3472 3056 gene locus_tag LOCUS_26850 3472 3056 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence150 988 542 gene locus_tag LOCUS_26860 988 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1359 985 gene locus_tag LOCUS_26870 1359 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 protein_id gnl|my_center|LOCUS_26870 1606 2343 gene locus_tag LOCUS_26880 1606 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2405 3508 gene locus_tag LOCUS_26890 gene nodX 2405 3508 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence151 229 1104 gene locus_tag LOCUS_26900 229 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 <3674 1086 gene locus_tag LOCUS_26910 <3674 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917977.1:glutamate dehydrogenase >Feature sequence152 1158 805 gene locus_tag LOCUS_26920 1158 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1455 1955 gene locus_tag LOCUS_26930 gene ruvC 1455 1955 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF7 protein_id gnl|my_center|LOCUS_26930 1952 2593 gene locus_tag LOCUS_26940 gene ruvA 1952 2593 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCT8 protein_id gnl|my_center|LOCUS_26940 2590 3369 gene locus_tag LOCUS_26950 2590 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence153 1472 201 gene locus_tag LOCUS_26960 1472 201 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640633.1 protein_id gnl|my_center|LOCUS_26960 2560 1469 gene locus_tag LOCUS_26970 gene aroB 2560 1469 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H332 protein_id gnl|my_center|LOCUS_26970 3119 2553 gene locus_tag LOCUS_26980 gene aroK 3119 2553 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A435 protein_id gnl|my_center|LOCUS_26980 >Feature sequence154 604 1503 gene locus_tag LOCUS_26990 604 1503 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_26990 2354 1500 gene locus_tag LOCUS_27000 2354 1500 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 protein_id gnl|my_center|LOCUS_27000 <3359 2357 gene locus_tag LOCUS_27010 <3359 2357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389963.1:O-antigen polymerase >Feature sequence155 352 774 gene locus_tag LOCUS_27020 352 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 940 1368 gene locus_tag LOCUS_27030 940 1368 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887213.1 protein_id gnl|my_center|LOCUS_27030 1842 1420 gene locus_tag LOCUS_27040 1842 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708780.1 protein_id gnl|my_center|LOCUS_27040 1978 2418 gene locus_tag LOCUS_27050 1978 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2864 2415 gene locus_tag LOCUS_27060 2864 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3321 2971 gene locus_tag LOCUS_27070 3321 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence156 1915 914 gene locus_tag LOCUS_27080 1915 914 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920857.1 protein_id gnl|my_center|LOCUS_27080 2644 2027 gene locus_tag LOCUS_27090 2644 2027 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_27090 2697 2957 gene locus_tag LOCUS_27100 2697 2957 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence157 747 409 gene locus_tag LOCUS_27110 747 409 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339060.1 protein_id gnl|my_center|LOCUS_27110 1376 822 gene locus_tag LOCUS_27120 1376 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 1503 2354 gene locus_tag LOCUS_27130 1503 2354 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530281.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence158 386 33 gene locus_tag LOCUS_27140 386 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2573 699 gene locus_tag LOCUS_27150 2573 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 3009 2632 gene locus_tag LOCUS_27160 3009 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence159 646 5 gene locus_tag LOCUS_27170 646 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 984 643 gene locus_tag LOCUS_27180 984 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1444 971 gene locus_tag LOCUS_27190 1444 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1817 1416 gene locus_tag LOCUS_27200 1817 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2846 1827 gene locus_tag LOCUS_27210 gene pilC 2846 1827 CDS product pilus assembly protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226293.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence160 477 1934 gene locus_tag LOCUS_27220 477 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 2132 2497 gene locus_tag LOCUS_27230 2132 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence161 1004 570 gene locus_tag LOCUS_27240 1004 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1471 1004 gene locus_tag LOCUS_27250 1471 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2319 1693 gene locus_tag LOCUS_27260 2319 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2630 2319 gene locus_tag LOCUS_27270 2630 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence162 376 792 gene locus_tag LOCUS_27280 gene apaG 376 792 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE6 protein_id gnl|my_center|LOCUS_27280 811 2268 gene locus_tag LOCUS_27290 gene trkH 811 2268 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ30 protein_id gnl|my_center|LOCUS_27290 >Feature sequence163 1 759 gene locus_tag LOCUS_27300 1 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 763 1812 gene locus_tag LOCUS_27310 763 1812 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence164 508 359 gene locus_tag LOCUS_27320 508 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 503 1051 gene locus_tag LOCUS_27330 503 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence165 782 297 gene locus_tag LOCUS_27340 782 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence166 <2068 1063 gene locus_tag LOCUS_27350 <2068 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704178.1:acyltransferase >Feature sequence167 1317 532 gene locus_tag LOCUS_27360 1317 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence168 >Feature sequence169 2 1033 gene locus_tag LOCUS_27370 gene ruvB 2 1033 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H454 protein_id gnl|my_center|LOCUS_27370 <1887 1036 gene locus_tag LOCUS_27380 <1887 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence170 <1 1659 gene locus_tag LOCUS_27390 <1 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89FP0:phosphomethylpyrimidine synthase >Feature sequence171 287 63 gene locus_tag LOCUS_27400 287 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 464 306 gene locus_tag LOCUS_27410 464 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence172 >Feature sequence173 129 989 gene locus_tag LOCUS_27420 129 989 CDS product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_27420 1311 1012 gene locus_tag LOCUS_27430 1311 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence174 1068 280 gene locus_tag LOCUS_27440 1068 280 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921385.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence175 >Feature sequence176 408 1154 gene locus_tag LOCUS_27450 408 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence177 202 129 gene locus_tag LOCUS_t00460 202 129 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <1223 275 gene locus_tag LOCUS_27460 <1223 275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265781.1:2'-deoxycytidine 5'-triphosphate deaminase >Feature sequence178 <1217 238 gene locus_tag LOCUS_27470 <1217 238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CFJ6:tryptophan synthase beta chain >Feature sequence179 540 749 gene locus_tag LOCUS_27480 540 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence180 <1097 347 gene locus_tag LOCUS_27490 <1097 347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119960.1:divalent cation transporter >Feature sequence181 <1093 257 gene locus_tag LOCUS_27500 <1093 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RYN3:malate synthase >Feature sequence182 950 306 gene locus_tag LOCUS_27510 950 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence183 >Feature sequence184 >Feature sequence185 <1067 457 gene locus_tag LOCUS_27520 <1067 457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021346.1:amino acid permease >Feature sequence186 >Feature sequence187 18 776 gene locus_tag LOCUS_27530 18 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence188 790 155 gene locus_tag LOCUS_27540 790 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence189 96 905 gene locus_tag LOCUS_27550 96 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence190 <1003 476 gene locus_tag LOCUS_27560 <1003 476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524980.1:bifunctional enoyl-CoA hydratase/phosphate acetyltransferase note possible pseudo, frameshifted