COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..383309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1132..2280) product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene recF CDS complement(2423..3541) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAU5 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene dnaN CDS complement(3695..5137) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene dnaA CDS complement(5665..5904) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY9 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene rpsT CDS complement(6098..6874) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(7006..7926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8048..8920) product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene mutM CDS 9017..9694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 9749..10501 product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVY5 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene ubiE CDS 10568..12115 product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A257 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12165..12704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 note possible pseudo, frameshifted CDS 12701..13369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 note possible pseudo, frameshifted CDS 13438..13893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 13917..14366 product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene dut CDS complement(14375..15682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(15766..16206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 16280..17044 product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene moeB CDS complement(17031..17198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(17152..19839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 note possible pseudo, internal stop codon CDS complement(19843..20913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 note possible pseudo, internal stop codon CDS complement(20918..21808) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6F4 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 21957..22679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 22717..23337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921520.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 23337..24167 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918591.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(24174..24956) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 24941..25186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 tRNA 25177..25253 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(25275..25841) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970944.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 26134..27114 product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNR3 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene cysD CDS 27115..29001 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532710.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 29066..29860 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(29871..30752) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(30774..32594) product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59362 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene glmS CDS 32805..34976 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7N2 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene lptD CDS 35088..35774 product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 35803..36555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 36555..37619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 37564..38631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 38628..39215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 39212..39688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 39705..41867 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895558.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 41887..42528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 42560..42955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(42986..43399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(43380..43763) product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 43907..44698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(44695..45894) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(45918..47669) product type II secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(48028..49530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 49909..50547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(50779..51111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 51020..52765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 52929..53981 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKP2 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene rfbB CDS 54051..54932 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU22 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene rmlA CDS complement(54964..55686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(55734..56507) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267576.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(56497..57843) product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531147.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(57860..58021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(58028..59287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55585 transl_table 11 codon_start 1 locus_tag LOCUS_00590 note possible pseudo, internal stop codon CDS complement(59284..59715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(59712..61037) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(61057..61992) product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880030.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene nueM CDS 62233..63774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 63873..65588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 65585..66628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 66643..67749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 67746..70442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 70579..71472 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888F0 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 71462..72874 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(72860..73123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 73029..75011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(75021..76169) product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921438.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(76327..77853) product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(77901..78899) product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(79033..79260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 79517..80242 product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene gpmA CDS 80227..80814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 80885..81169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 81156..81590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(81597..82688) product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 82863..86009 product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Q1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 86289..88169 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2R4 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 88353..89264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(89261..90418) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene metB CDS complement(90415..91377) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V8 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene metA CDS complement(91377..92348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 92624..93073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 93190..95685 product sensor protein DivL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQQ9 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene divL CDS complement(95767..96045) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(96109..97920) product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640463.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 98239..98790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 98922..99071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 99092..99529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 99792..101252 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(101409..101540) product YbgT family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640056.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene ybgT CDS complement(101561..102709) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918649.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene cydB CDS complement(102723..104318) product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918648.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene cydA CDS 105031..106716 product ATP-binding/permease protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29018 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene cydD CDS 106713..108461 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(108465..108701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 108863..109813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(109810..110805) product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene dcd CDS 110964..111356 product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS0 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene apaG CDS 111380..112834 product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU7 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(112844..113812) product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58097 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene hslO CDS complement(113834..115018) product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q7 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene argD CDS complement(115038..115883) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S9 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 116126..116683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920106.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(116755..117441) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene phoB CDS complement(117453..118169) product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV9 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene phoU CDS complement(118222..119043) product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYG4 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene pstB CDS complement(119045..120784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(120777..122480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(122638..124053) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918178.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene phoR CDS 124243..125613 product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 125641..126921 product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 126946..130155 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 130287..132374 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 132546..132674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(132970..133284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(133431..133751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 134090..135097 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene yrbG CDS complement(135108..135314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(135321..136193) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(136263..137360) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DK0 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene ychF CDS complement(137455..138027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(138067..138666) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZU8 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene pth CDS complement(138790..139422) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV8 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene rplY CDS complement(139591..140523) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV6 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene prs CDS complement(140633..141772) product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(141773..142672) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N77 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene lgt CDS 142787..143092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 143198..143695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 143706..144566 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DI5 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene proC CDS complement(144574..145887) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(145898..146614) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090195.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(146711..148066) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388932.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(148178..148777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(148764..150677) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF6 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene uvrC CDS complement(150710..151129) product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4M3 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(151179..151526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 151637..152401 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 152486..153730 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 153801..155255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(155252..156148) product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT07 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene rlmJ CDS 156276..157775 product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(157838..158368) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI44 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene apt CDS complement(158442..158729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(159138..160022) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene mtnP CDS complement(160022..160630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(160732..161535) product ubiquinol cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918362.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(161550..162836) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAW9 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(162851..163504) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXJ6 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene fbcF CDS complement(163703..164200) product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 164313..164894 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230163.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(164891..166339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 166727..167413 product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZX1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene hemF CDS complement(167429..168910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(168910..170154) product poly(A) polymerase/tRNA-nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(170161..170475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(170494..171126) product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(171126..171671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 171773..172771 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969882.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 172783..173679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 173679..176465 product LytTR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338666.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 176462..178516 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 178627..179922 product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(179919..180485) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(180761..181435) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 181546..182442 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 182450..183406 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(183381..184043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 184151..184429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 184449..185021 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(185088..186059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(186129..186548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(186545..186853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 187031..187633 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 187927..188676 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918613.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 188679..189620 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(189679..190176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 190365..190880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531009.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 191118..191471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(191488..192093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 192127..193548 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBQ4 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene argH CDS 193553..193777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 193858..196305 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(196318..197016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 197132..197854 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 197851..198741 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene ftsX CDS 198823..199410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 199503..200192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 200182..201288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920082.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(201290..202369) product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UL9 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene hisC2 CDS complement(202366..203145) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 203257..204021 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene gloB CDS 204021..204473 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918406.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(204479..205207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(205297..206019) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 206214..206798 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(207422..207835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918358.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(207958..208692) product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 208819..210528 product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 210531..211448 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(211445..212380) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(212747..213184) product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene nifU CDS complement(213192..214589) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZS3 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene cysS CDS 214920..215555 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T6 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene folE CDS complement(215628..217472) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4A8 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene sppA CDS complement(217936..218946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(218924..220150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 220517..220918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(221018..221674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(221690..221974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(222071..223783) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(223928..226255) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 226433..227434 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CX17 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene rluD CDS complement(227563..228447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 228590..230269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(230290..230421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(230540..231214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 231328..232215 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3C3 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene rpoH CDS complement(232283..232513) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(232518..233246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 233380..234423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(234420..235694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 235889..236359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(236350..237183) product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(237180..237722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(237820..239439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(239648..240337) product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 240300..240935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(240896..241744) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 241818..242483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 242617..242886 product protein usg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 242967..243548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 243607..244482 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 244563..244856 product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EF0 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 244872..245432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(245539..246822) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(246823..247923) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A434 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene aroB CDS complement(247920..248438) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H331 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene aroK CDS 248606..248746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 248730..250379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 250376..251299 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW3 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene xerC CDS 251396..252382 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2N7 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene accA CDS 252472..254526 product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene nadE CDS complement(254784..255251) product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 255533..256543 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640450.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 256540..257250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(257261..258106) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(258126..258560) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920112.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene staR CDS complement(258645..259517) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066934.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 259673..260041 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 tRNA 260119..260195 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(260275..260712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(260803..261651) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(261724..263523) product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AA58 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene mnmC CDS complement(263639..264505) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene motA CDS 264682..265974 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(266103..267392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 267607..268713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 268836..268961 product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A383 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene rpmJ CDS 268976..269587 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 269685..270221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265501.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(270296..272527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(272811..273584) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 273743..274609 product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(274618..275082) product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(275124..275750) product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921424.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(275930..277429) product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCA2 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(277441..278181) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921427.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(278354..278959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(278956..279627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(279706..280320) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 280526..280915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 281195..282529 product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258112.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 tRNA complement(282749..282835) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 283006..283971 product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(284092..284901) product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene uppP1 CDS complement(284973..285911) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 286042..286596 product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene ahpC CDS 286694..287227 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ANL0 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene ahpD CDS 287427..287744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 287843..289153 product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 289214..289537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(289497..290273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(290270..291223) product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8U7 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene gshB CDS 291773..292090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 292113..292553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 292643..294058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970659.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 294101..294391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 294599..296167 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2B3 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene ffh CDS 296198..296656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 296723..297247 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X39 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene rimM CDS 297249..297950 product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C302 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene trmD CDS 297950..298333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 298479..299741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 299757..300941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 301011..301502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(301614..303074) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(303071..303424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 303666..304313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(304485..305438) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H051 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene htpX CDS 305518..305733 product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(305853..306065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 305952..306308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(306281..306583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(306674..307981) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(307987..308865) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H660 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene accD CDS complement(308896..309687) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12291 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene trpA CDS complement(309687..310898) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ6 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene trpB CDS complement(310985..311593) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TD0 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene trpF CDS complement(311677..312093) product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749E9 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene mscL CDS complement(312163..312447) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCQ1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene ihfB CDS complement(312601..314310) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCW5 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(314618..315889) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene aroA CDS 316086..316595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 tRNA 316715..316790 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 316909..317913 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 318002..318724 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 318766..320598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 320747..321004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(321132..322400) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(322482..323177) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene chrR CDS complement(323278..323859) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 324007..324510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(324548..325825) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(325884..326525) product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 326629..327942 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(328011..328283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 328173..328595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(328592..329053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene mmcB CDS 329143..329550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(329561..330274) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2S6 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene cobB CDS complement(330271..330807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(330874..332277) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB89 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 332495..332998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(333002..334567) product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene sucB CDS complement(334587..337571) product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918228.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene odhA CDS 337870..339114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 339111..339608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(339605..340513) product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LJ5 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene sucD CDS complement(340519..341715) product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDP2 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene sucC CDS complement(341835..342119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(342120..343379) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(343477..344031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(344142..344531) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 344755..345531 product LytTr DNA-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265527.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(345541..345996) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 346078..346389 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(346386..346601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 346955..347167 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530020.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 347393..349624 product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene dcp CDS 349762..351720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(351727..352914) product putative aminotransferase AatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87320 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene aatC CDS complement(352921..354393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(354397..355344) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 355480..355893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(355869..356384) product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(356478..357407) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141938.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 357662..358492 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEH0 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene fabI CDS 358764..359492 product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(359489..360637) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(360637..361608) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene ephA CDS complement(361612..362562) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532555.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(362688..364472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 364540..365529 product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 365574..367355 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 367432..367650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(367731..372245) product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene gltB CDS complement(372242..373669) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene gltD CDS 373953..374267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 374503..374703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 374824..375306 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene bfrB CDS 375498..376394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 376391..377146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 377213..377737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105266.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 378036..378599 product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(378603..379220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 379342..380631 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD8 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene purA CDS complement(380636..381790) product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(381851..382939) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 sequence02 source 1..360000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 1332..1958 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 2158..3198 product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 3346..5769 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene bfeA CDS 6135..6989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 7114..7530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 tRNA complement(7699..7789) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(7938..8627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(8686..10392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 10646..11722 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NU2 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene mrp CDS complement(11727..12662) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(12662..13534) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(13531..14289) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 14420..16636 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 16781..18109 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(18196..18750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(18994..19446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(19496..20443) product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 20596..21315 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 21398..22690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 22866..23138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920291.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(23153..23893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 24055..25572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 25569..26258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 26255..27511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920287.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene hfsC CDS complement(27487..28416) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(28413..29195) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene hfsH CDS complement(29192..30085) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene hfsG CDS complement(30082..31611) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene hfsF CDS 31716..32798 product polysaccharide biosynthesis protein CelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640455.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 32795..33895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(33931..34431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(34638..36185) product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 36226..37356 product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9Y7 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene tgt CDS complement(37360..37680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 37591..37803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(37860..38474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 tRNA 38617..38692 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 38849..39226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 39231..41558 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920326.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene clpA CDS 41732..42934 product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN30 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene kbl CDS 43023..44060 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene tdh CDS 44060..44734 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(44771..45154) product regulator of nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ43 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene rnk CDS complement(45397..46014) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 tRNA 46060..46142 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 46372..47202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 47203..48630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 48633..50462 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 50617..52116 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX17 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene tig CDS 52290..52910 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX16 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene clpP CDS 53147..54424 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU44 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene clpX CDS 54526..55380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 55377..56207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 56216..56992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 57122..57472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 57701..60097 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW0 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene lon tRNA complement(60242..60317) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(60403..61575) product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200116.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene pheA CDS 61846..62484 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(62519..63028) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene capM CDS complement(63479..64162) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(64183..65370) product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(65367..66419) product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(66523..67194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(67191..68294) product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 68501..69853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(70638..71033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(71936..72526) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene wbpD CDS complement(72523..73464) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(73469..74767) product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD94 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene wbpA CDS 74995..75783 product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 75851..76435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918058.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 76442..78337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 78678..79415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918056.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 79587..80054 product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384082.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 80131..80781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(80790..81629) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR8 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(81695..82222) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKZ2 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene ppa CDS 82355..83014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 tRNA 83072..83148 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 83201..83506 product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 tRNA 83539..83615 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(84085..84618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(84863..85987) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(86010..87188) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 87363..88430 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Y7 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene ctaA CDS complement(88414..89292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(89391..90815) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 91078..91545 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H7 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene rplM CDS 91545..92045 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KE5 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rpsI CDS complement(92113..93000) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 93096..93725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 93857..94624 product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene dpm1 CDS 94626..96329 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(96333..98306) product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265707.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 98399..98719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 98768..99727 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C840 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene glpX CDS 99735..101510 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene recJ tRNA 101604..101678 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(101771..101965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 102330..102764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 102849..104147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 104274..106514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 tRNA 106649..106725 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(106755..107006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(107180..108418) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(108415..109104) product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(109104..110693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 110918..111283 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C814 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene nuoA CDS 111290..111868 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWV5 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene nuoB CDS 111898..112503 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA57 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene nuoC2 CDS 112631..113833 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KI9 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene nuoD CDS 113833..114207 product steroid Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 114213..115169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 115169..116470 product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919813.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene nuoF CDS 116475..116771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 116800..118911 product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S6 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene nuoG CDS 118918..119970 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA64 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene nuoH2 CDS 119980..120468 product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Y4 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene nuoI CDS 120571..121179 product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975092.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 121179..121490 product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA67 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene nuoK1 CDS 121501..123474 product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919805.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene nuoL CDS 123477..124991 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640368.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene nuoM CDS 125011..126459 product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7X8 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene nuoN CDS 126460..127197 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 127203..127985 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A7 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene coaX CDS 127989..129662 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 129677..130105 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 130105..130482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 130679..132013 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWT1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene proS CDS 132010..133332 product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 133325..134005 product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z7 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene lolD2 CDS 134324..137782 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWS6 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene dnaE1 CDS 137990..138856 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A703 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene rpsB CDS 138890..139831 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A704 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene tsf CDS 139899..140663 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A705 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene pyrH CDS 140671..141237 product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU06 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene frr CDS 141282..142004 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL9 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene uppS CDS 142001..142816 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7X9 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 142817..144016 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene dxr CDS 144022..145221 product metalloprotease MmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A710 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene mmpA CDS 145256..147628 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9L0 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene bamA CDS 147633..148235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 148247..149302 product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A713 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene lpxD CDS 149325..149798 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR2 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene fabZ CDS 149795..150586 product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A715 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene lpxA CDS 150593..151438 product UDP-2,3-diacylglucosamine pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene lpxI CDS 151455..152624 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919775.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene lpxB CDS complement(152638..153942) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ53 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene cisY CDS complement(153975..155297) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KR5 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene gltX CDS 155477..157630 product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(157663..158334) product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A724 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene lexA CDS complement(158435..159229) product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene trpC CDS complement(159242..160258) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UER8 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene trpD CDS complement(160255..160842) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 160936..161844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(161841..163343) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95646 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene trpE CDS complement(163352..165241) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU2 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 165419..166153 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene tpiA CDS 166229..167221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 167271..167705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 167800..169428 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW64 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene pyrG CDS 169708..169890 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7K2 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene rpmF CDS 170053..171330 product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFH1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene eno CDS 171427..171753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 171886..172932 product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9R9N5 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene pdhA CDS 172951..174384 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 174390..174656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 174718..176085 product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C893 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 176103..177026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 177072..178484 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT67 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 178632..179480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 179529..180785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 180866..181837 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7I8 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene lipA CDS 181852..182340 product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(182308..182808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(182805..183941) product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7I5 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene ispDF CDS 184120..185064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 185061..186101 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 186098..187390 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene ntrC CDS 187507..189687 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene ntrY CDS 189691..191112 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919611.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ntrX CDS 191109..192482 product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535437.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene trkA CDS 192487..193884 product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 193891..194745 product D-alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919612.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 194844..195104 product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW92 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene hfq CDS 195101..196429 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7H6 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene hflX CDS complement(196433..197194) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 197193..197351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(197337..197744) product HTH-type transcriptional regulator HmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X5X4 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene hmrR CDS complement(197755..198498) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(198588..199037) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 199202..199618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 199611..199883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(200013..200873) product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(200870..201658) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(201679..202722) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919689.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(202719..203354) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9D5 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene tmk CDS complement(203362..204507) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(204600..205151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(205252..205752) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 tRNA 206007..206096 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 206237..207832 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(207887..208246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 208477..208632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(208629..209369) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(209446..210267) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(210281..211219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(211219..212640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 212956..214077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803682.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(214135..215523) product HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 215649..216497 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CK2 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene kynA CDS 216516..216779 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 216788..218170 product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene sdaA CDS complement(218171..219868) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085334.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(219993..221990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(222016..222525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(222754..223200) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 223254..225263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(225282..225737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(225748..226395) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene pcaJ CDS complement(226410..227105) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(227419..228267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919706.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(228374..229519) product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 229624..230901 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene popA CDS complement(230898..234395) product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F5 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene mfd CDS complement(234551..234916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919711.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 235197..237290 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 237388..238152 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208103.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene solR CDS 238260..239057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 239057..239962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(240049..240762) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 240880..242079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(242090..243556) product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE81 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene rfaE CDS complement(243564..244427) product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5A9 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene kdsA CDS 244841..246004 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene phrA CDS 246001..247371 product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 247377..248150 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 248220..249470 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(249481..250269) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(250266..251816) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(251816..252499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(252547..253209) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 253317..254330 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(254347..254907) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(254915..255976) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene bztA CDS 256040..257182 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919300.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 tRNA complement(257201..257277) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(257371..257811) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(257824..258126) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THC4 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene ihfA CDS complement(258208..259179) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K89 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene fabH CDS complement(259176..260252) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7B8 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene plsX CDS complement(260382..260921) product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 261043..261546 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(261638..263809) product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K83 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene hppA CDS complement(263965..264444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(264469..265452) product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9B8 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene thiL CDS complement(265452..265937) product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H535 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene nusB CDS complement(265938..266378) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZV0 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene ribH1 CDS complement(266402..267517) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(267517..268134) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene ribE CDS complement(268140..268805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(268805..269287) product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J5 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene nrdR CDS complement(269298..270626) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene glyA CDS 270887..271321 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(271341..271589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(271586..272800) product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6H4 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(272933..273829) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(273860..274909) product 3-hydroxyisobutyryl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(274906..276042) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 276095..277078 product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C809 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(277195..277827) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(277824..278684) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(278706..279176) product nitrilotriacetate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723432.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 279261..280157 product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 280269..280997 product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z5 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene ate CDS 281083..282207 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 282211..282999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 283000..284574 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 284567..285724 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(285670..286674) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB2 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene htpX CDS complement(286702..287250) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(287338..289590) product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K54 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene gyrA CDS complement(289641..290369) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVD0 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene recO CDS complement(290379..291326) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H630 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene era CDS complement(291316..292005) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H627 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene rnc CDS complement(292002..292415) product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69159 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene acpS CDS complement(292412..293158) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene pdxJ CDS complement(293166..293756) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H621 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene pyrE CDS complement(293783..296002) product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919427.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene spoT CDS complement(296006..296371) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58066 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rpoZ CDS complement(296476..296949) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640266.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 297043..297624 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 297626..298273 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 298381..298884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 298924..299625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(299658..300128) product ssrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z9 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene smpB CDS complement(300125..300997) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8Z8 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene dapA CDS 301154..303301 product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(303298..304272) product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 304464..306101 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 306311..306502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(306503..307924) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261057.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(308006..310288) product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(310377..311909) product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9N6 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 312019..312357 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 312424..313827 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9D7 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene glnA CDS 314013..317243 product autotransporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265524.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 tRNA 315029..315125 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 317287..317880 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538057.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 317940..320024 product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9E0 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene parE CDS 320414..320794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 321527..322981 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 322983..324257 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 324418..325872 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 325994..327049 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene dgcB CDS 327126..327842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(327839..328444) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(328507..328866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(328877..329308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(329331..330572) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A766 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(330569..331666) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene sufD CDS complement(331666..332430) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene sufC CDS complement(332518..334023) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(334154..335293) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(335302..335772) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 336008..336682 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919733.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(336782..337900) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A757 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene anmK CDS 338085..339350 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A756 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene tyrS CDS complement(339421..339597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 339697..340236 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(340233..341579) product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK3 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene gltX1 CDS complement(341821..342765) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 342880..343716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 343721..344716 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 344713..345444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 345461..345877 product putative phenylacetic acid degradation-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(345865..346062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 346272..346538 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene hup CDS 346786..347103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 347171..349228 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 349225..350556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(350694..351923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(352053..353330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(353532..354899) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBY3 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(354896..356284) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(356737..357036) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 357516..357908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 357977..359803 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene bipA sequence03 source 1..353257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..1245) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y2 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene queA CDS complement(1542..1988) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene ppiB CDS complement(1994..3001) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(2998..3492) product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE7 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene coaD CDS complement(3492..6374) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZ37 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene gyrA CDS complement(6548..7180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921425.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 7341..8390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(8396..9181) product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(9236..9715) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A7 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 9896..10297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 10294..10632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 10729..13623 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A572 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene uvrA CDS complement(13640..14530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(14600..15529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(15631..16641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(16646..17686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(17754..18608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 18759..20123 product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKD4 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene trmFO CDS complement(20126..20977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 21101..22414 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(22470..23078) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(23192..24166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 note possible pseudo, internal stop codon, frameshifted CDS complement(24183..25814) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L13 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene secD CDS complement(25850..26233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(26327..27271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(27356..27784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(27886..28530) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T6 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene pcm CDS complement(28539..29354) product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX52 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene surE CDS complement(29351..30748) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L00 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene serS CDS complement(30968..32239) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532784.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 32439..33797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(33951..34427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 34308..34724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(34905..35348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(35345..35626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(35623..35967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(35964..37457) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(37457..37852) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(37849..38283) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707329.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(38288..40603) product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971245.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene mnhA CDS complement(40712..41434) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919201.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(41439..41729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(41726..41953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 42261..42470 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene cspA CDS complement(42698..43153) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(43189..45093) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXC4 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene dxs CDS complement(45153..46043) product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(46089..46457) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene csaA CDS complement(46457..46708) product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M3 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene xseB CDS complement(46770..47630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 47702..48475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(48472..49092) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(49116..50027) product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(50086..50523) product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(50673..51104) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(51181..51366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(51407..52549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 52645..53388 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 53412..53873 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K24 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 53870..54787 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 54784..55722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 55787..56749 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K4 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene pyrB CDS 56746..58029 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K3 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene pyrC CDS 58035..58634 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF8 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene plsY CDS 58631..59749 product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene dprA CDS 59906..62542 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene topA CDS 62539..64791 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J4 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene rnr CDS 64806..65531 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920315.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 65528..66160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 66170..67336 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 67439..67606 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4S1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene rpmG CDS complement(67655..69016) product response regulator PleD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I5 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene pleD CDS complement(69033..69410) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene divK CDS 69576..70487 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 70484..71734 product DNA polymerase IV 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QM8 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene dinB1 CDS 71798..72379 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 72376..72624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 72778..73923 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 73925..74995 product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(75081..76292) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0I4 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(76498..76887) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(76891..77547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(77555..78394) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 78421..79137 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919327.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 79134..80117 product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 80163..80759 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 80768..81592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(81589..83613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 83805..84734 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDG1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 84766..85146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 85156..86565 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921218.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 86651..87433 product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A321 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 87525..88325 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 88325..89332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(89341..89745) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene ytfP CDS complement(89742..90950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 91130..91441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 91525..93495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(93497..94147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(94144..95100) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(95104..95868) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(95865..97019) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(97129..98316) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919355.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 98410..99690 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 note possible pseudo, internal stop codon CDS 99687..100406 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 100403..101506 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(101475..102092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(102105..102740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 102864..103835 product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W8Y7 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene pip CDS complement(103846..105201) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(105287..106432) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene rodA CDS complement(106435..108312) product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(108333..108845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(108846..109823) product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919418.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(109861..110901) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene mreB CDS complement(110960..111724) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(111813..112805) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RU74 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene ilvC CDS complement(112805..113734) product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6J5 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene miaA CDS complement(113747..115153) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(115232..115426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(115444..116337) product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(116339..117520) product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(117628..118140) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6G8 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(118150..118992) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene thyA CDS 119129..119902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 120025..120405 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(120402..121067) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(121466..122068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(122170..123558) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971719.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene cyc CDS 123684..124142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919963.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene sspB CDS complement(124162..125190) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene cmaX CDS complement(125217..125555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 125736..127121 product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PB6 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene fumC CDS 127118..127291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(127296..128951) product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706368.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(129035..130222) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(130281..132167) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 132051..132299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 132352..134940 product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(134966..135595) product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06989 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene hisI CDS complement(135592..136359) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMP9 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene hisF CDS complement(136353..137075) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLX1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene hisA CDS complement(137080..137688) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSX0 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene hisH CDS complement(137831..139039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(139041..140354) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QL1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene hisD CDS complement(140626..141510) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLW6 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene hisG CDS complement(141507..141812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 142936..143745 product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140366.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 144117..144344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(144436..145383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(145380..145685) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(146173..146718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 146782..147186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 148091..148282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 148744..149829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 149898..150395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 150457..151647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(151868..153694) product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QV4 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene aspS CDS 154596..154985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(155001..156212) product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(156253..156486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(156585..156791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(156788..157063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(157176..158510) product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 158643..159458 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(159613..161319) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A884 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene metG CDS 161427..161834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 tRNA 161914..161988 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(162268..162522) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(162918..163358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 163745..165100 product peptidase S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(165104..165571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(165582..166472) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(166565..167029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 167323..168198 product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLC0 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene panC CDS 168310..169908 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 170132..171568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(171581..172000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(172065..172997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(172997..173914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920137.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(174246..176228) product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975574.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene mccB CDS complement(176279..177148) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918346.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(177168..177962) product methylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(178136..178495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(178633..178950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(179039..179620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(179696..180403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(180528..182135) product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(182352..183251) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 183348..184214 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 184335..185177 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 185198..187045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 187056..187418 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975978.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 187460..189193 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(189198..189590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(189577..190023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(190151..191269) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene ivdH CDS complement(191372..192997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(193060..194052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 tRNA complement(194244..194328) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(194424..194669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 194772..195452 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6B8 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene lipB CDS complement(195576..196166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(196246..196749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(196833..198857) product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(198953..199465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 199622..200470 product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene tauD CDS complement(200670..201635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(201720..203147) product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9G2 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene xseA CDS 203270..204553 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T902 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene purD CDS complement(204770..205588) product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB8 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene tatC CDS complement(205592..206062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(206084..206305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(206403..207137) product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C850 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene scpB CDS complement(207134..207940) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919871.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene scpA CDS complement(207951..208985) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(208982..209809) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(209924..211099) product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX62 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 211192..211521 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 211551..212222 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(212371..212760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 212812..213603 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(213613..214953) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7Z8 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene astB CDS complement(214953..216407) product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SD7 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene astD CDS complement(216404..217414) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919480.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(217433..218692) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(218730..220022) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene mdeA CDS complement(220019..220273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(220301..221365) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(221521..222738) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(222751..224583) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(224673..226850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(226948..228156) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(228246..229478) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920947.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(229475..231178) product AMP-dependent acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(231286..232773) product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(232754..233674) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 233586..233765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 233855..234841 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 234865..235266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(235336..237540) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene fyuA CDS complement(237698..239383) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 239521..240744 product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 240741..242267 product AMP-dependent acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 242264..242725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 242790..243305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(243309..244580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 note possible pseudo, frameshifted CDS complement(244538..246460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 note possible pseudo, frameshifted CDS complement(246457..247596) product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(247708..248496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(248509..249273) product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z4 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 249458..250672 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(250669..251955) product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(252044..252346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 252251..252880 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7K4 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene nadK CDS 252954..253469 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 253494..253988 product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919102.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(254011..255183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(255257..256087) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene pleA CDS complement(256127..257119) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 257317..257724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(257733..258407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(258637..260700) product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 tRNA complement(260843..260919) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(261026..261844) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918762.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 262001..263995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099208.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 264108..265880 product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene ggt CDS 265975..266955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 267054..267938 product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(267942..268136) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(268149..268553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(268573..269454) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(269611..270576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(270649..271275) product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene popZ CDS complement(271378..272733) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene rsaFb CDS complement(272849..273415) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 tRNA 273667..273740 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(273765..274151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 tRNA 274490..274565 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 274817..275710 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265978.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 275707..276489 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921385.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(276498..276938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(277034..278905) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(278969..279931) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(280117..280656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(280821..281126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 note possible pseudo, internal stop codon CDS complement(281194..282699) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene gatB CDS complement(282778..283770) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969365.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(283767..283994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(284000..285478) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L0 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene gatA CDS complement(285485..285772) product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK8 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene gatC CDS 285931..286662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 286738..287466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 287545..290982 product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C7H0 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene smc CDS 291103..291405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 291501..292277 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CK03 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene atpB CDS 292338..292565 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533642.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene atpE CDS 292677..293237 product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0U9 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene atpF2 CDS 293234..293728 product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RM5 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene atpF1 CDS complement(293801..294076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 294400..295539 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408504.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(295547..297127) product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC5 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene gcvPB CDS complement(297130..298476) product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4V4 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene gcvPA CDS complement(298476..299120) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(299136..299501) product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4V5 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene gcvH CDS complement(299540..300649) product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU9 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 301571..302446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(302564..303346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(303343..303666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(303907..304308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(304395..306158) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4W0 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene argS CDS complement(306173..306736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 306836..307825 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC9 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene ispH CDS 307822..308283 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T805 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene rnhA CDS 308345..309643 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4A7 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene purB CDS 309718..310674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 310779..311279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(311276..311596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 311861..312643 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CB04 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene purC CDS 312657..312899 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene purS CDS complement(312896..313279) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(313343..314434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 314592..315257 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5F3 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene purQ CDS 315257..317494 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5F0 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene purL CDS complement(317588..318067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(318402..320444) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52324 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene rpoD CDS complement(320512..322335) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCD7 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene dnaG CDS complement(322393..322860) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 323029..324234 product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N95 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene carA CDS 324333..326663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 326667..328289 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 328424..331666 product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC22 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene carB CDS 331733..332206 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1V7 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene greA CDS 332328..333263 product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920689.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 note possible pseudo, internal stop codon, frameshifted CDS 333302..333793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 333855..334844 product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4G3 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 334841..335548 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 335545..336804 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 336836..337744 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 338104..338328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 338394..338867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 339033..339527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919164.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 339630..341360 product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(341357..341860) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(341867..342937) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920390.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 343217..344518 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 344515..345585 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(345711..346178) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(346309..347520) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8I0 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 347753..347935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 348045..349055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(349058..349420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(349501..350568) product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3C1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene purK CDS complement(350579..351082) product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC72 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene purE CDS 351234..351965 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene dgcA CDS 352017..353039 product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS46 transl_table 11 codon_start 1 locus_tag LOCUS_10700 sequence04 source 1..238348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..1201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2A3 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1276..1602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1935..2699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 2696..3436 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 3433..5271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 5268..6305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(6307..7038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(7139..7882) product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE36 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(7966..8811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(8811..9974) product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEE0 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene ftsY CDS complement(9971..11305) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(11363..14557) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(14554..15708) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 15931..17685 product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 17685..21794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 21944..24226 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 24301..24990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(24987..26132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 26429..26995 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 26995..28086 product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 28111..31224 product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 31279..32091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 32166..32384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(32406..33293) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(33344..33757) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(33769..34206) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 34337..34690 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121379.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene arsR CDS 34687..35556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 35695..36126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 36139..37851 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(37855..40275) product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXQ0 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene gyrB CDS 40436..43210 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265962.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(43320..44189) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIV8 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene dapB CDS complement(44232..45407) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50018 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene dnaJ CDS complement(45500..47416) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY0 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene dnaK CDS 47690..48310 product alkylated DNA repair dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 48439..48792 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 48977..49345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(49421..49747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 50022..50933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(50930..51583) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63187 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene grpE CDS complement(51637..52707) product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP3 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene hrcA CDS 52871..53266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 53412..54134 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP2 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene rph CDS 54165..55361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(55387..55704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(55790..57175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(57218..57682) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(57719..58285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(58296..59159) product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921556.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(59183..59761) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 59952..60701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 60796..62628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(62673..62906) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(62917..63468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 63880..64503 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 64500..65657 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(65658..67025) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391441.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 67116..67538 product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXN3 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 67702..69267 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918029.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene chlI CDS 69292..71190 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918027.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene shkA CDS 71219..72568 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene ampG CDS complement(72572..74845) product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 75065..77686 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C2I6 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene mutS CDS 77748..78464 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978711.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 78525..79610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 79708..82524 product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWX0 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene glnD CDS 82528..84123 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF00 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene mviN CDS 84239..85276 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3N8 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene trpS CDS 85439..86005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 86224..87186 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8B3 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 87241..88092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 88089..88505 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(88502..90310) product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF57 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene lepA CDS 90470..90925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 91086..91742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(91739..93076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(93077..95470) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8M4 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene pheT CDS complement(95483..96565) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H307 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene pheS CDS complement(96746..97105) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M3 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene rplT CDS complement(97146..97349) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH9 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene rpmI CDS complement(97504..99276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(99420..99881) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9D9 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene infC CDS complement(100105..101091) product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(101097..102245) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 102362..103117 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(103121..103687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(103784..105019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 105339..105824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 105854..106393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 106396..107430 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083456.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene holA CDS complement(107427..108332) product chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW30 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene parB CDS complement(108329..109180) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW31 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene parA CDS complement(109170..109817) product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW32 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene rsmG CDS complement(109817..111715) product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV0 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene mnmG CDS complement(111793..113118) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX2 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene mnmE CDS complement(113141..113377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 113461..114141 product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(114250..114879) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(115036..116364) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG88 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene rho CDS complement(116648..117094) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(117094..118158) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57777 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene hemH CDS complement(118194..119216) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW41 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene hemE CDS 119790..120647 product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C520 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 120644..121231 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC58 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 121228..122064 product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYG9 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene aroE CDS 122061..122669 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58100 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene coaE CDS 122666..123352 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene dnaQ CDS complement(123361..123864) product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A224 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene secB CDS 124113..124790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 124876..125964 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 125968..126525 product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 126522..127640 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2C7 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene queG CDS 127727..129028 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ87 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene hslU CDS complement(129287..129805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 129922..130608 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(130615..131406) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 131573..132130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(132136..132555) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(132658..133248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(133245..134000) product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521491.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(133993..134871) product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3E9 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(134898..135185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(135290..136036) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(136075..136710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921085.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(136710..137369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(137411..138136) product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083847.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(138179..138565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(138676..139434) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(139470..140936) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 141205..141882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 142072..144405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 144410..146413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 146418..148169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(148193..149932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 150148..153084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(153109..153696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 153777..155120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 tRNA complement(155204..155280) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(155371..156243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 156511..159297 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 159395..159790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 159859..160512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 160545..160916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 160916..161296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 161394..162191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(162188..163081) product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529172.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(163279..163797) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(164035..164376) product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918540.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(164458..164748) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(164748..167360) product phosphonate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640026.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 167482..167679 product antitoxin VapB32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 167676..168044 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P2V9 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene vapc32 CDS complement(168041..168844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082993.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 168931..169368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 169480..171171 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(171175..173112) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(173133..174128) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529367.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(174227..175234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(175341..175967) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 176021..176290 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(176408..177550) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(177550..178575) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWX8 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene asd CDS complement(178630..179598) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVT2 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene mdh CDS 179817..180302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 180302..180538 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(180545..181471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 181722..182165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(182181..182876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(182949..184043) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(184222..184692) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(184793..186739) product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDS8 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene acsA CDS 186910..187647 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 187652..188692 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921468.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 188738..189415 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene fzlA CDS 189753..191531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 191537..192058 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 192361..194412 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313934.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene deaD CDS complement(194409..195221) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCU6 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(195231..195926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 195840..196100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 196097..196855 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(196852..197676) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZB6 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene dapF CDS 197841..200069 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(200155..201663) product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(201773..202084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 202340..205786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(205859..206227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(206307..207029) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(207034..208089) product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(208100..208582) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 208679..209044 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 209070..209945 product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265975.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(209999..211417) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TC1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene ahcY CDS 211668..213173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(213174..213449) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene ptsH CDS complement(213446..213850) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(213967..215565) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene chvG CDS complement(215591..216292) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene chvI CDS 216449..218188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(218209..218688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(218685..219011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314414.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(219004..219222) product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW2 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(219271..219933) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336781.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(220008..220934) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(221037..221573) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 tRNA 221712..221786 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(221876..222970) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 note possible pseudo, frameshifted CDS complement(222898..223176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 note possible pseudo, frameshifted CDS complement(223310..223489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(223678..224367) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 224574..229496 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917977.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene gdhZ CDS 229507..230298 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896751.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(230300..230635) product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917957.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(230638..231633) product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4E8 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene gpsA CDS complement(231630..232709) product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABZ9 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene tsaD CDS 232808..233779 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXG1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene hemC CDS 233776..234504 product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639872.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 234542..235792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 235789..237300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917964.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 237304..237951 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4Y5 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene udk sequence05 source 1..177024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..2357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(2433..3050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(3050..3295) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(3413..3757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(3798..4772) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 4863..5153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 5260..6777 product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(6778..7074) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(7079..7708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(7862..8812) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E8 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene xerC CDS complement(8809..9510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 9639..11828 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB85 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene priA CDS 12131..12691 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2V6 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene atpH CDS 12700..14235 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL31 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene atpA CDS 14285..14431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 14460..15344 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S2 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene atpG CDS 15417..16856 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X74 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene atpD CDS 16861..17067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 17060..17467 product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV17 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene atpC CDS complement(17530..18018) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2W6 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene rppH CDS complement(18019..19179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(19311..20624) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(20641..21852) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(21865..22332) product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8W4 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene rlmH CDS complement(22339..22569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 22516..22755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(22783..23799) product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(23876..24505) product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C4 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene nadD CDS complement(24502..25560) product GTPase Obg/CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYI7 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene cgtA CDS complement(25602..26162) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(26318..26587) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB7 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene rpmA CDS complement(26635..27294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 tRNA 27611..27700 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(27915..28871) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 29005..29733 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708340.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 29801..30250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 30252..31055 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085546.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 31231..33912 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(33892..35313) product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(35326..37080) product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709900.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene phbC1 CDS 37241..37672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 37770..38537 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 38534..39715 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RR92 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene ackA CDS 39721..40458 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 40452..42842 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 42847..44055 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(44184..44840) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 45153..47366 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 47389..49383 product FmtA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 49402..50418 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969505.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 50418..51458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 51455..52555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(52875..54431) product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090039.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 54552..55853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 55859..56548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 56597..57187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(57197..58945) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene phyK CDS complement(58951..59574) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene sigT CDS complement(59578..59790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 59991..60761 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene phyR CDS 60780..60953 product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY71 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(61127..61576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(61658..62410) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389540.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(62667..62852) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene csbD CDS 63101..64873 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene asnB CDS 64898..66667 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 66681..67862 product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(67872..68645) product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036286.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 68829..69746 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene tesB CDS complement(69743..70879) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCD5 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(70890..71600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(71680..73602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(73635..74537) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 74669..75751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(75748..77439) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF68 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene ilvD CDS complement(77436..78755) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637168.2 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene thrC CDS complement(78752..79708) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Q0 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene thrB CDS complement(79730..81511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(81619..81765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 82299..83315 product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L5 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene ilvC CDS 83334..85031 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L4 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene ilvG CDS 85035..85295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 85292..86893 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67862 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene leuA CDS 86905..87879 product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene ilvE CDS 87857..89290 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene leuC CDS 89277..89858 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene leuD CDS 89961..92651 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDL5 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene leuS CDS 92733..94457 product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37967 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene pnbA CDS 94538..96040 product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(96041..97450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704726.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 97564..99396 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 99478..100617 product glutamate 5-kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB3 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene proB1 CDS 100614..101879 product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X85 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene proA CDS complement(101876..102853) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF0 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene bioB CDS 102852..103298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 103388..104119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(104121..105650) product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(105742..106299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(106416..107249) product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(107249..108844) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU8 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene purH CDS complement(108881..110623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene fzlC CDS complement(110634..111308) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4H5 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 111466..113508 product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(113536..114834) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene sun CDS complement(114824..115555) product proline hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(115587..116741) product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABT6 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene rlmN CDS 116858..117622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920086.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(117626..118420) product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 118516..119382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(119379..119555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(119581..120477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 note possible pseudo, frameshifted CDS 120707..121315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(121493..121702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 121589..122026 product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVZ8 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene fabA CDS 122023..123234 product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 123811..124098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 124351..125409 product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABG7 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(125838..127757) product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FP0 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene thiC CDS 127681..127878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(128006..128398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(128694..129929) product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(130072..131040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(131086..132510) product carboxypeptidase S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 132622..133539 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(133547..134695) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 134801..135949 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene serC CDS 136047..136241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 136276..136683 product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532390.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(136705..137256) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6B2 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene hslV CDS 137417..139996 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCN6 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene valS CDS 140084..143413 product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(143428..147210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 147354..149177 product peptide ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 149312..152233 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 152304..154229 product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 154229..154759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 154826..155569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 155566..156723 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFT4 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 156863..157873 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J265 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene gapB CDS 157888..159117 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4J9 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene pgk CDS 159178..160200 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 160328..160771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 160902..161525 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene thiE CDS complement(161522..161764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 161654..162634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 note possible pseudo, frameshifted CDS 162684..163202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 163284..163862 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene efp CDS 163831..164661 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene suhB CDS 164803..165825 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388829.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 165829..166824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084326.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene motB CDS complement(166821..167066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 167049..167270 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM38 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene rpmE CDS complement(167386..167928) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(168070..168261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 168385..169371 product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 169563..170234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923245.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(170231..171049) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(171079..171951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(172100..172270) product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265934.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 172369..172995 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD02 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene ubiX CDS 172992..173489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 173617..173826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 173912..175981 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109778.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 176069..176845 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene dhrS4 sequence06 source 1..158319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..1536) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB46 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1533..2492) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 2491..2775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 2826..3641 product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 3821..4978 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 5202..5549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 5549..5911 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3F7 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 6134..6721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 6807..7571 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 7581..8399 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(8403..9755) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABV3 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene glmM CDS complement(9768..10424) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2F1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene tal CDS complement(10441..11052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(11138..12574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(12658..13890) product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(13887..14531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(14531..15310) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene kdsB CDS complement(15307..16032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 16218..16982 product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCU1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 17011..17634 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H6A7 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene cmk CDS complement(17631..18137) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 18263..19075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 19143..20084 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 20096..21631 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GY92 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene pgi CDS 21670..23655 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX58 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene tklB CDS complement(23659..24855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(24849..25421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 25514..26086 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF7 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene ruvC CDS 26083..26739 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAL1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene ruvA CDS 26736..27767 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAL0 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene ruvB CDS 27764..28210 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 28395..29048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 29049..29480 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 29503..30339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 30376..31734 product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q926C2 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene tolB CDS 31847..32359 product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 32583..33455 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(33512..33808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 33755..34720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 34886..36823 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN14 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene ftsH CDS 36829..37143 product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKX3 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 37225..37647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 37819..39036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089771.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 39098..39745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 39749..40057 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(40103..40543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(40546..40866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(40866..41966) product flagellar P-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I01 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene flgI1 CDS 42206..42628 product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32348 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene fliX CDS 42788..43219 product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J325 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene dksA CDS complement(43223..43618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(43602..43994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(44122..44925) product flagellar L-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I09 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene flgH1 CDS complement(44945..45883) product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene flgA CDS complement(45898..46683) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C944 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene flgG CDS complement(46711..47448) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06171 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene flgF CDS 47724..48272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 48313..49461 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXB5 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene fliM CDS 49458..49856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 49871..50554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 50535..53816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(53839..54150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(54171..54587) product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I26 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene flgC CDS complement(54608..55027) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6X7 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene flgB CDS 55202..55534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 55534..56304 product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45980 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene fliP CDS 56359..57000 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(57012..57230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(57160..58692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(58763..59251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 59372..60007 product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 60138..60404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 60414..60833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 60856..61482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 61479..61679 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 61764..63359 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C6 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene lysS CDS 63446..64192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 64294..64716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 64719..64937 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(64941..65567) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 65678..66025 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083958.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 66027..67064 product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C744 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(67025..68383) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 68485..69495 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene yjgB CDS complement(69587..69925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(70224..70541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 70674..71675 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(71672..72079) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(72076..72585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(72644..73456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(73579..73884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(73935..74774) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 75040..76677 product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265611.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 76720..78285 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 78298..78912 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(78938..79876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(79893..82100) product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 82198..84696 product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974364.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 84828..85466 product streptogramin A acetyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 85487..86200 product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083968.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(86214..86696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(86713..87516) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(87513..88454) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S85 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(88464..91658) product localization factor PodJL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXA0 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene podJ CDS complement(91851..93689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 93797..94309 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 94374..96164 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 96195..97370 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 97375..97800 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 97812..98288 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 98288..98755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 98779..99987 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 99993..100256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 100253..102454 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(102488..103084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 103251..103529 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 103517..103807 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(103843..104766) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(104827..105261) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene zur CDS 105467..107584 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 107702..108535 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(108653..108892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 108803..110842 product thio:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918106.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 110889..111512 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(111568..112017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 112155..113630 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2P3 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene hisS CDS complement(114013..114942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 115108..116226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(116377..118014) product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAT9 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene groL CDS complement(118072..118359) product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H164 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene groS CDS 118657..119313 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 120328..121548 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene tipF CDS complement(121559..121894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 122210..122659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 122797..123063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(123207..123947) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB15 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene sodM CDS 124139..124492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(124499..124852) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919000.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 125005..125622 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919008.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 125628..126089 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919010.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(126086..127264) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(127330..127587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(127689..128537) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 128719..129408 product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887052.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene rkpN CDS 129405..130460 product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene rkpO CDS 130453..131028 product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 131025..132074 product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene rkpQ CDS complement(132100..133890) product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene flbA CDS 134077..134487 product flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21297 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene flbT CDS 134496..134870 product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene flaF CDS 135086..135916 product flagellin FljL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18914 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene fljL CDS 136270..137097 product flagellin FljK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18913 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene fljK CDS 137311..137622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 137829..138662 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene fljJ CDS complement(138739..139464) product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(139787..141097) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene amt-2 CDS 141730..142911 product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(142915..144006) product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 144186..146939 product regulatory protein FlaEY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919340.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene flaY CDS complement(147109..148323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(148238..149230) product putative transcription activator protein HfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27343 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene hfaB CDS complement(149233..149769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 149865..150578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(150624..151256) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811288.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(151271..151822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(151819..152910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 152809..153063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 153214..153645 product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 rRNA 154311..155773 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 155999..156075 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 156100..156175 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence07 source 1..155804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 364..2451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(2470..3774) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS2 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 3928..4275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 4280..4696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 4783..6078 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 6107..6952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 note possible pseudo, internal stop codon CDS 6974..7573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 note possible pseudo, internal stop codon CDS 7566..8903 product putative flavin-containing monoamine oxidase AofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63534 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene aofH CDS complement(8900..9991) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 9888..10133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(10138..10995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(11221..11706) product nodulation protein NodN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973543.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene nodN CDS 11902..12378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 12433..12816 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 12764..13339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 13543..16311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 16393..18975 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene fecA CDS 19129..19950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 19947..21887 product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene pulD CDS 21896..23371 product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene xcsE CDS 23358..24587 product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038521.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene xcsF CDS 24607..25056 product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene xcsG CDS 25107..25559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 25549..25917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 25914..26549 product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038517.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene xcsJ CDS 26546..27535 product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5C3 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene xcsK CDS 27532..28752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 28758..29240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 29237..29980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 30016..31032 product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8P7 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene dusA CDS 31032..31844 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 31852..32628 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene paaG CDS 32625..33839 product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 34033..35724 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(35895..36767) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(36809..37600) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(37597..37926) product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 38292..38675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265546.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(38680..39282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(40067..41851) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921222.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 41982..42578 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887576.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 42585..43169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 43205..43750 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(43911..44540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 44539..45591 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene mutY CDS complement(45588..46619) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(46745..47332) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene rnhB CDS complement(47564..48667) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 48753..49520 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 49541..50401 product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 50391..50963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(50960..51568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 51983..53653 product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 53694..55355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919212.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 55352..56248 product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H510 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene ispE CDS 56248..57270 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(57264..58280) product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene ispB CDS 58397..58618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 58615..59394 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 59391..59534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(59531..60286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(60530..63202) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919346.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(63255..65639) product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T912 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene glyS CDS complement(65666..66259) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene gstA CDS complement(66259..66855) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(66855..67736) product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene glyQ CDS complement(67808..68266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 68375..69262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(69266..69760) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968638.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 69857..70309 product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 70321..70881 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970075.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 71066..72196 product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2F3 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene nadA CDS 72313..73842 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920751.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 73839..74672 product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(74850..76541) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 76650..77105 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(77111..79744) product ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 79881..80288 product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 80296..80784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 80853..81380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(81347..81997) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A741 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene aat CDS complement(82002..83354) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(83365..83850) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene accB CDS complement(83862..84323) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWN2 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene aroQ CDS 84461..84691 product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene thiS CDS complement(84697..84885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(84957..85832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(86105..86332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 86419..87231 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWN0 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene thiG CDS 87257..87676 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 87714..88352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(88349..89083) product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(89101..90543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919744.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(90660..93317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 93900..95156 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919742.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 95285..97768 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 98034..98990 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWM3 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene prfB note possible pseudo, internal stop codon CDS complement(99087..99566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(99625..100860) product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919738.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(101025..101648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 note possible pseudo, frameshifted CDS complement(101629..101838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(101835..102305) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 102405..105857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337884.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 105863..107023 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABN3 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene leuB CDS complement(107015..107710) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene hutC CDS complement(107707..109074) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene hutF CDS 109139..110341 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS0 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene hutI CDS 110335..111852 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J289 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene hutH CDS 111849..112649 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887421.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 112646..114325 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J288 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene hutU CDS 114589..115539 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(115582..115788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 115995..116882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 117053..119368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 119368..119520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(119609..121033) product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 121171..122259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 122256..122804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 122804..124063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(124115..124615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(125219..125521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(126821..127009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(127017..127463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(127703..128776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(128773..129780) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(129783..130664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 130790..131530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(131535..131894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(131894..133117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 133293..133607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 133617..134453 product sorbitol 6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 134545..135438 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 135460..136092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 136136..136723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 136822..137643 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 137647..138168 product molybdenum cofactor biosynthesis protein MoeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 138208..139404 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 139528..140679 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 140676..141089 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086934.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 141097..142266 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(142267..143526) product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 143575..144948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 144945..146291 product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 146314..147711 product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 147708..149009 product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCD8 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene gatA CDS 149083..149529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(149550..150605) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 150696..151514 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 151605..152261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 152273..153865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 153871..155283 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQV4 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene gabD2 misc_feature complement(155291..>155804) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061601.1:acyl-CoA dehydrogenase locus_tag LOCUS_17720 sequence08 source 1..151469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 1078..1296 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU4 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene rpsU CDS complement(1374..2096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204853.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(2104..4410) product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337759.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(4491..5912) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLW9 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(5946..7550) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(7550..8872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(8986..10140) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 10304..10744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 10897..13578 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(13764..14636) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 14617..15543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 15560..16063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 16047..17006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(17023..18150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 18395..19480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(19484..19810) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(19816..20073) product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(20165..21064) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(21091..21738) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920739.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(21765..22121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(22154..22768) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(22765..23433) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336778.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 23634..24104 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene yedL CDS complement(24101..24925) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(25123..25899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(25933..27393) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 27506..28096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 tRNA complement(28107..28181) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 28547..28705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 28789..30057 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZB1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene murA CDS 30054..30503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 30500..30985 product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL90 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 30982..31401 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 31534..31752 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAM1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene infA CDS 31768..32361 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V5 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 32358..33416 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920200.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 33416..33589 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V7 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene yacG CDS 33676..35097 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW3 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(35787..38468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 tRNA 38664..38739 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 38932..40122 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 40412..41116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 41281..41499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 41502..41969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 41985..43109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 43320..46478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(46481..46615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 46748..47374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 47414..47722 product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene cas2 repeat_region 47795..49017 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atcatagccgcttagagaacgagggccagccgcaac CDS 49251..49742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 49876..50286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(50355..50975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 note possible pseudo, internal stop codon CDS complement(50986..51765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(51872..52756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(52749..54266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 note possible pseudo, internal stop codon, frameshifted CDS complement(54267..55145) product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIG8 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene ku CDS 55287..56498 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(56563..58050) product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene leuB CDS 58162..59049 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene cztR CDS 59244..60749 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 60760..61614 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 61614..61982 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 62137..62646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 62711..63391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 63337..64539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(64540..66126) product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880701.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(66248..66706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(66771..67475) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(67753..68061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 68137..68931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(68998..69531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 69787..70761 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 70803..71873 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene ansA CDS 72027..73052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(73061..76708) product DNA methyltransferase yeeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 76942..77241 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(77316..77843) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 77966..80170 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A462 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene uvrB CDS 80466..81347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 81349..82314 product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(82296..82907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(82904..84745) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 84905..85780 product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene prmA CDS complement(85791..86435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(86502..88802) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A836 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 89032..89991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(89994..90725) product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8P3 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene rlmE CDS complement(90722..91852) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 92083..92415 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(92516..93529) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536759.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(93560..94204) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEC9 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(94262..94573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880524.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(94578..95579) product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(95603..96751) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene hmgA CDS complement(96874..97443) product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 97636..98178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(98185..99612) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene cenK CDS complement(99637..101058) product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene merA1 CDS complement(101055..101810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 note possible pseudo, internal stop codon, frameshifted CDS 102073..102207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 102219..102617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 102610..104742 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1E8 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene yidC CDS 104841..105404 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1E7 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene engB CDS 105404..106384 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 106381..107076 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 107073..107912 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene dapD CDS 107933..108682 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y582 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene map2 CDS complement(108679..109305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(109410..110114) product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ0 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene rpiA CDS complement(110111..111583) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103085.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene gabD-2 CDS complement(111621..112982) product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5Z3 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene glmU CDS 113081..113782 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAC0 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene gph CDS complement(113786..114010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 tRNA 114260..114334 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 114676..115716 product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene idiA CDS 115815..117374 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 117371..118426 product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975333.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(118444..120174) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639997.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(120235..121188) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 121538..123928 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 124047..125024 product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 125255..125497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 125623..127080 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(127107..128030) product acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene bah CDS complement(128027..128974) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 129057..130553 product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U940 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene glpK CDS 130650..132485 product threonine--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18255 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene thrS CDS complement(132614..132919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(133101..134507) product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9C8 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(134554..134982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(135022..135363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(135492..136616) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(136716..137009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(137096..138019) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 138332..139816 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene tacA CDS 139895..142132 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 142224..142682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 142871..144109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 144138..144638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(144635..145135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 tRNA 145285..145358 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(145429..145866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 146378..146875 product osteoblast specific factor 2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404935.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(146947..148422) product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene rimK CDS 148659..149495 product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58112 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 149541..150467 product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 150607..151095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 sequence09 source 1..139674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 494..817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 1000..2664 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2639..6250) product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene oplaH CDS 6294..6995 product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 7180..7461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 7532..8443 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920424.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 8440..9120 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 9790..10251 product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB94 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene mraZ CDS 10251..11243 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0A2 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene rsmH CDS 11240..11596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 11593..13404 product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 13401..14882 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF49 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene murE CDS 14879..16288 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB89 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene murF CDS 16294..17394 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene mraY CDS 17406..18818 product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A597 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene murD CDS 18815..19963 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920409.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 19960..21057 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF54 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene murG CDS 21082..22491 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H086 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene murC CDS 22488..23423 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU9 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene murB CDS 23420..24337 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5A9 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene ddl CDS 24430..25251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 25257..26570 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene ftsA CDS 26721..28319 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H080 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene ftsZ CDS 28529..29452 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F2 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene lpxC CDS 29563..30402 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8V9 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene bamD CDS 30429..32132 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C835 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 32129..34234 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FV8 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene ligA CDS 34256..34876 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310428.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(35006..36082) product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(36263..36859) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(36859..37188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 37174..37896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(37903..38289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390059.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(38302..39702) product twin-arginine translocation pathway signal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(39761..41041) product sodium dependent nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919950.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 41181..41369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(41473..42366) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 42504..43274 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(43271..44086) product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(44083..45408) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920790.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(45412..46182) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(46340..47839) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C461 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene amn CDS complement(47846..48061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(48264..49544) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 49716..52295 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 52322..53656 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197109.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(53643..54287) product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6V3 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 54483..55265 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227109.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene paaG CDS 55418..56341 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 56369..57571 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 57594..58430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 58472..59296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 59425..59769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 59856..61895 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084021.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(61920..63050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640013.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 tRNA 63294..63370 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(63365..63730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(63950..65929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(65987..67780) product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 68014..68520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(68524..69351) product Flp pilus assembly protein TadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 69461..70831 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 70824..71606 product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(71679..72416) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920772.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(72584..73450) product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 73750..74268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 74413..74640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 74871..76655 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene dnaX CDS 76652..76987 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E465 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 77084..77686 product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYE0 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene recR CDS complement(77696..78841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 79028..80395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 80392..80946 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene def CDS 80943..81716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(81797..82939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(83030..83899) product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 84043..85272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338895.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 85351..86841 product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6F6 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene guaB CDS complement(86859..87623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(87620..88690) product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538001.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 88763..90076 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 90076..90921 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038647.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(90970..91299) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224722.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(91305..91943) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 92056..93621 product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI5 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene guaA CDS 93916..95175 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530374.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 95295..95483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 95480..96646 product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533246.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 96643..97353 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533247.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(97320..98105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533240.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(98077..98763) product peptidase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533239.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(98760..99785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533238.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(99788..100162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(100159..100512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(100675..101025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(101038..101352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(101357..101593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533261.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(101590..102867) product conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(102872..103909) product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920535.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(103915..104607) product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533264.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(104815..106131) product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090990.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene trbL CDS complement(106138..106857) product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533266.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(106870..109341) product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(109335..109601) product conjugal transfer protein TrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(109665..110000) product conjugal transfer protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(109997..110992) product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533270.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 111320..112162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 112615..113565 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 113897..115552 product type II DNA modification methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176597.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 115533..116267 product type-2 restriction enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WR9 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 116617..117183 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 117199..117411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 117408..117884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 117933..119705 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533280.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(119936..120166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(120148..120525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 120574..120969 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 121320..121643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533279.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 121824..122060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 122075..122560 product peptidase S26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538231.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 122793..124727 product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 124776..125114 product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U785 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(125119..128241) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(128255..129499) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(129496..130794) product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(130876..131220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(131327..131776) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 131985..132428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 132573..134534 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 134536..134973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(135064..135498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(135495..138704) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 138811..139572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 sequence10 source 1..125340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(442..1965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 2087..2659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2789..2959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(3034..6225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(6231..7661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331488.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene traH CDS complement(7661..8482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(8475..10946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 11273..11602 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705687.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 11686..12210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(12486..13124) product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(13179..13385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 13521..14432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 14492..14710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 15183..16538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 16597..16827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 16824..17213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(17242..17880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(17864..18370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 18629..18772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 18900..20033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 20030..21727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 21708..24914 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 24911..25348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(25351..25935) product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(25922..26365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(26362..26661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(26915..27994) product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCD5 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene modC CDS complement(27984..28655) product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene modB CDS complement(28648..29448) product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene modA CDS complement(29503..29991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(29993..30442) product preprotein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 30545..30982 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 30979..31704 product NnrU protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene nnrU CDS complement(31676..31879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 32123..33463 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31381 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene hemN CDS complement(33473..34312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(34306..36063) product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294717.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(36060..36680) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI6 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene mobA CDS complement(36677..37309) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2J2 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(37306..37899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(37929..39110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(39107..40231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(40228..40989) product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene narI CDS complement(40995..41687) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene narJ CDS complement(41691..43208) product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene narH CDS complement(43205..46939) product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene narG CDS complement(46936..49677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 49981..50766 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919286.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene ftrB CDS complement(50770..51762) product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC0 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene moaA CDS complement(51972..53135) product protein NnrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(53159..53458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(53460..54362) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090353.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(54353..55318) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(55330..55707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(55761..58001) product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(58118..59305) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene moeA CDS complement(59302..59805) product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC52 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene moaC CDS complement(59802..60338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(60344..60805) product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC50 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene moaE CDS complement(60807..61058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 61367..61822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 62020..62463 product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene nsrR CDS 62917..63120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 note possible pseudo, frameshifted CDS complement(63413..63934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 64040..64285 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 64285..65034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143584.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 65096..65344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 65341..65916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 65913..66104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 66109..66879 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(67368..68054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(68024..69040) product conjugal transfer protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947798.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene traU CDS complement(69037..69690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331481.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene traW CDS complement(69690..70220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(70228..70707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(70707..71144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(71126..71413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(71417..73993) product conjugal transfer protein TraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331477.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene traC CDS complement(73994..74371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(74383..75282) product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689299.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(75297..76559) product conjugative transfer factor, TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331475.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene traB CDS complement(76559..77320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(77307..77669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(77666..78274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(78274..78558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(78651..78926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 79592..80065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 80065..80778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 80837..82708 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082897.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(82674..82988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 83183..83869 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 83881..84276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 84633..87008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 note possible pseudo, frameshifted CDS 87043..89370 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(89380..90048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(90102..90506) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939394.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(90519..91265) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 91478..91879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 91876..92091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(92334..93479) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene nodX CDS 93633..95048 product copper tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene copB CDS 95048..96385 product exported copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538040.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(96405..96980) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJK9 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(96977..97417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(97414..97701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 97883..98629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(98668..99555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 99704..100147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 101080..102030 product antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368621.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 102431..102865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 102941..103180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 103240..103722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 103821..104294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 104451..104798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 104926..105399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 105740..106300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 106797..107693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887141.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 109290..109655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 109655..111838 product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947791.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 111842..114799 product conjugative relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene trwC CDS 114803..116491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 116494..117378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 117679..117864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 117932..118855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 118852..119634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 120052..121125 product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918569.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 121179..123275 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918570.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 123465..123875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969221.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 123875..124564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530548.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(124826..125167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 sequence11 source 1..83206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(751..1203) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 1274..1663 product mercury transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 1681..1986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 1991..2215 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2220..3644 product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0E4 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene merA CDS complement(3880..4305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(4445..5362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091010.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(5682..6722) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082896.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(6812..8869) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082897.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(8998..10194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082898.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 10649..11206 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970322.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 11199..12065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970323.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 12187..14115 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 14556..14996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 14993..16360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 16363..17112 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(17156..17887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(18009..21629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871043.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(21626..22315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(22312..24801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(24798..26309) product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(26313..28691) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(28678..28884) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAU1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(28966..30282) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(30537..31844) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(31963..32376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 32587..34791 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene fyuA CDS 34915..35856 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920948.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 35936..37408 product apocarotenoid-15,15'-oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918661.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(37424..39127) product AMP-dependent acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 39225..40271 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730445.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene dapB CDS complement(40368..41162) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(41184..41942) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640464.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(41948..42478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919683.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(42475..44268) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090526.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(44268..44708) product NTF2 superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265790.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(44978..46204) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640274.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(46278..47012) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919941.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(46999..48588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(48600..50237) product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(50234..51604) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(51604..53862) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 54180..54521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(54551..55645) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(55855..57393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 57617..59794 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887486.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene manC CDS complement(59791..61095) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 61390..61629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 61657..62604 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083062.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 62604..64052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 64049..64834 product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N75 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(64835..65644) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921533.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(65668..66282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(66647..68743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(68912..69922) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 70086..70982 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(70979..71497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 71623..72096 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390254.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 72235..72795 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 72936..73562 product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4V1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 73570..74226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 74223..74666 product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383661.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 74748..75170 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 75183..76577 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U7 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene miaB CDS 76574..77572 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene phoH CDS 77562..78026 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W99 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene ybeY CDS 78062..78934 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene corC CDS 78934..80550 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3N0 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene lnt CDS 80645..81064 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 81149..82321 product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9E5 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene metK CDS 82314..83012 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX04 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene trmB sequence12 source 1..74184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 760..1665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 1668..2651 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 3505..4347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(4360..7083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(7080..7442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(7458..8033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 8114..9070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 9120..9317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 9362..10129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 10153..11259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(11356..12573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 12861..13112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(13100..13522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(13555..13962) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(13959..15053) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3W7 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene aroC CDS complement(15130..15699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 15802..16470 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9Q6 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene pdxH CDS 16502..17314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(17311..18240) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(18237..19178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 19597..20529 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 20529..21434 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(21569..22183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073888.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 22443..24074 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 24080..25192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405252.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(25257..27056) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8B4 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene sppA tRNA complement(27193..27269) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 27427..27501 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 27805..28551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 28565..28810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 29062..29394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 29413..29682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967745.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 29672..30016 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 30598..31314 product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071944.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 31341..32741 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 32756..33277 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 33281..33694 product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 33710..34114 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 34132..34749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 34803..36332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(36480..38786) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083208.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene ptrB CDS complement(38843..39250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(39291..40487) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267319.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 40704..41786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(41854..42633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(42788..43267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(43467..44228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 44242..44433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 44688..45143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 45140..45916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(45913..46329) product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene sufE CDS complement(46416..46763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(46917..47915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 48185..49861 product histidine protein kinase DivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03228 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene divJ CDS complement(49879..50775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(50775..52271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 52225..52437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 52466..52801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 52990..53412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 53465..55069 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9B9 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene prfC CDS 55069..56283 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(56602..57699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640543.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(57799..58212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(58277..59158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 59349..60212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(60218..60841) product FMN-dependent NADH-azoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2E2 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene azoR2 CDS 60902..61858 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene acT CDS complement(61851..63881) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921109.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene pbpC CDS 63912..64355 product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL64 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 64795..65250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 65213..66478 product large terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 66956..68143 product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920629.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 68112..68357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 68602..69093 product peptidase U35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383947.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 69141..70355 product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 70786..71385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 71382..71792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532641.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 71817..72233 product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 72236..72520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 72517..72696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 72723..73211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 73208..73828 product glycoside hydrolase family 24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383957.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 sequence13 source 1..66954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 577..1458 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 1493..3241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 3307..3597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(3831..4970) product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9W0 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene ispG CDS 5238..6443 product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9W8 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 6525..8852 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene ptsP CDS 8944..9828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 9959..10726 product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H209 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene ubiG CDS complement(10737..12215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 12461..12682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(12774..13193) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(13195..13434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 13632..14315 product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 14448..17126 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084982.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene cheA CDS 17138..17593 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084983.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene cheW CDS 17613..17978 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921300.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 17975..19114 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZD2 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene cheB CDS 19114..19959 product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene cheR1 CDS complement(19975..20544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(20776..21471) product cell cycle transcriptional regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H358 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene ctrA CDS 21813..23132 product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H363 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene fliI CDS 23136..23555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(23856..24497) product putative outer-membrane protein y4mB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55561 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(24886..26934) product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096983.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 27044..28147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636161.2 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(28223..28549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(28593..29411) product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(29408..30403) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(30416..32524) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918794.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene flhA CDS complement(32665..34032) product transcriptional regulatory protein FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17899 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene flbD CDS complement(34074..34445) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(34438..35121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(35123..36160) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04955 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene fliG CDS complement(36160..37782) product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6R7 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene fliF CDS complement(38121..38393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527546.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(38577..39971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(40069..40824) product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ4 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(40829..42532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 43052..45184 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918784.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene flaN CDS 45202..46113 product flagellar hook-filament junction protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168813.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene flgL CDS complement(46110..47132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(47217..47669) product nodulation protein NodN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene nodN CDS complement(47707..48807) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 48953..49183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532341.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 49180..49989 product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640449.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(49968..50876) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(50876..51883) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYH3 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene lpxK CDS complement(51883..53172) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918191.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(53169..53846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 53999..54661 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene ctpA CDS 54731..55123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(55111..56916) product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918194.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(56917..57156) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639934.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(57153..57938) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918197.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(57925..59310) product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918198.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(59363..59755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(59833..60171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(60171..60830) product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975554.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(60827..62197) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022902.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(62256..62594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 62682..63998 product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH16 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene mnmA CDS 63995..64333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 64439..65623 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 65698..66159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(66270..66563) product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 sequence14 source 1..66249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 223..1104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 1101..1547 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 1575..5405 product phage host specificity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337519.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 5468..6367 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967060.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 6458..6787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 6819..7505 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527364.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene feuP CDS 7502..8923 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 8978..10309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 10263..11000 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 10997..11953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 11950..12447 product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4R9 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene ccmE CDS 12444..14375 product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920601.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 14372..14743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 14787..16010 product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 16072..17631 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920599.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 17671..18342 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920598.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 18354..19790 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 19812..22703 product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S7 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene glnE CDS 22773..23345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 23314..24024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 24021..24443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 24443..24976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(24978..27512) product non-motile and phage-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene pleC CDS complement(27564..28118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640507.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(28252..29199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(29294..29560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 29766..30059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 30145..30408 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640137.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene fliQ CDS 30416..31174 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C772 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene fliR CDS 31182..32249 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene flhB CDS complement(32246..32680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 32884..35466 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918962.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene cckA CDS 35590..36678 product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33156 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene recA CDS 36794..39457 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5C1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene alaS CDS complement(39561..41705) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920232.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(41702..43555) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(43915..44082) product Flp/Fap pilin component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970010.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(44368..45168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(45213..46160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 46424..48148 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 48176..48811 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 49081..51630 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(51691..53103) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 53255..54550 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971008.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene aceA CDS 54677..55153 product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7H4 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 55218..56825 product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYN3 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 56882..57919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 57932..58384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(58381..59370) product putative GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37895 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 59442..59792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 59865..60179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(60236..61453) product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFE6 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 61562..62320 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640515.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 62524..63141 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5D9 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene rpsD CDS 63268..63663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(63867..64199) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA63 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(64273..64503) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 64613..65602 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 misc_feature complement(65736..>66249) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061601.1:acyl-CoA dehydrogenase locus_tag LOCUS_24540 sequence15 source 1..60009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 474..1193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 1111..2667 product protein ImuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3J2 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene imuB CDS 2664..5603 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3J3 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene dnaE2 CDS 5638..5904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 5941..6405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 6616..7638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 7635..8177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(8183..8746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(8844..10022) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(10033..11193) product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240218.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(11193..11888) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene tptC CDS complement(11930..12982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(13186..13728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143316.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(13796..14620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231174.2 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 14956..16257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(16292..16660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 17044..17736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 17761..18267 product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525107.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(18713..19564) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391414.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(19685..20596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090763.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 20912..22777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 22897..24159 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene ycaD CDS complement(24153..24896) product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZA2 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene ostB CDS 24926..25870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(25873..26124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(26128..26613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(26695..26844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 27003..27305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140226.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(27352..27699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 27828..28307 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 tRNA complement(28406..28482) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(28606..29394) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene phyR CDS 29598..29861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 29858..30457 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920723.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene sigU CDS 30474..32189 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921303.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 32134..33396 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYE7 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene dapE CDS 33396..33980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(33950..34711) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene truA CDS complement(34716..35645) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYF1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene fmt CDS complement(35650..36540) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(36768..37652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 37831..38391 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531342.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 38450..39058 product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975220.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 39230..39730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(39741..40262) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 40607..41359 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(41436..42185) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(43349..44914) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089230.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(44911..45678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(45691..45918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(46007..46822) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene cysE CDS complement(46809..47450) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(47488..50592) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(50589..51770) product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(51799..52485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 52615..53247 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(53281..53760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(53789..54310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(54547..55029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(55107..55619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(55774..56238) product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KV4 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene queF CDS 56354..58057 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene kefB CDS complement(58015..58515) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338436.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 58707..59825 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU3 transl_table 11 codon_start 1 locus_tag LOCUS_25170 sequence16 source 1..59927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(216..647) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51506 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene soxR CDS 787..2643 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(2710..3132) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D0 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene ndk CDS 3231..5117 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532466.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(5123..5806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(6039..6329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(6326..6775) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919563.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(6788..8260) product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7M9 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene pepA CDS 8436..9560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 9557..10651 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919560.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 10738..11991 product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7N3 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 11991..12974 product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA8 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene pdxA CDS 12971..13831 product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2B9 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene rsmA CDS complement(13869..15803) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140180.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(15876..16535) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2A5 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene gmk CDS complement(16540..17430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(17433..18449) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(18536..19825) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA77 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(19841..20077) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7P3 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene acpP CDS complement(20274..21011) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(21013..21966) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7P6 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 22213..22563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 22576..22833 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9B0 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene rpsR CDS 22845..23438 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ0 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene rplI CDS 23529..24008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(24005..24379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(24376..24927) product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 25103..26596 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7A8 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 26601..27650 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7F6 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 27647..28420 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921522.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 28430..29188 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921523.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 29241..30611 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7A4 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene radA CDS 30621..31214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 31235..32713 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8U0 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene purF CDS 32710..33426 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(33470..34834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(34858..36273) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E769 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene bamB CDS complement(36270..37028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919525.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(37112..37939) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVL8 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene panB CDS complement(38007..38345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(38342..38884) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7S1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(38911..39315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(39362..39946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(40019..40573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(40573..40875) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(41089..41523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 41976..42464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088607.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(42548..42841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 43004..43822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 43844..44071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(44078..44596) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89CK0 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 44942..45430 product magnesium transporter MgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(45427..45714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(45699..46451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 note possible pseudo, frameshifted CDS complement(46534..48012) product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZA3 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene otsA CDS complement(48287..48469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532144.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(48620..49822) product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339042.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene fdh CDS complement(49833..50606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(50770..51627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(52129..54042) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037986.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(54218..54418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(54434..54697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 55109..56362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 56413..57003 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 57388..58029 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970322.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 58022..58876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970323.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(59018..59743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971072.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 sequence17 source 1..55143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 505..580 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(599..1189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(1305..1610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 1724..1948 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970277.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(2252..4657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(4654..4923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(5213..5725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(5712..6878) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 7263..8477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(8474..8656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(8637..10979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(10995..11264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(11618..13459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 14149..15720 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(15731..16501) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene csgA CDS complement(16529..16954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(17001..17912) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ9 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene folD CDS complement(17916..18221) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(18311..18721) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene rcp1 CDS complement(18753..19961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 tRNA 20105..20180 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 20561..21739 product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140703.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 21797..23560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 23557..25224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 25312..25734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(25746..26069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(26164..26454) product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABI2 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 26538..26810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(26906..27097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 27035..28042 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene blcB CDS 28039..28476 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(28456..29034) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2A5 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 29136..29810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 29825..31582 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3M7 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene nusA CDS 31579..32226 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917933.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 32352..34910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 35055..35516 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948556.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 35618..35986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 36100..37059 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5T2 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene truB CDS 37206..37475 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC31 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene rpsO CDS 37570..39699 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLU2 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene pnp CDS complement(39789..40844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(41029..43707) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIT7 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 43969..44583 product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33570 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene ccmA CDS 44580..45248 product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N6 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene ccmB CDS 45306..46046 product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 46046..46204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 46201..46746 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336994.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene ccmG CDS complement(46750..47271) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921504.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 47320..47937 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(47931..49058) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(49100..50632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(50648..52150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(52259..54220) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 54426..54644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 54680..54916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 sequence18 source 1..53999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..1241) product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB72 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(1245..2495) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 2712..3512 product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3F1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene phnC CDS 3509..5521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 5647..6786 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 6885..8186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(8197..10956) product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHS0 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene secA CDS 11102..12154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 12203..12622 product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene mutT CDS complement(12762..13676) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene bioC CDS 13733..14458 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918715.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 14500..14766 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 14766..15590 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 15587..16015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 16039..16554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 16881..18794 product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(18853..20859) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918113.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(21010..22434) product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921240.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(22637..23218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 23432..24298 product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF54 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene coxB CDS 24383..25936 product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDH9 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene coxA CDS 25944..26951 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDA3 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene coxE CDS 26958..27149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 27156..27740 product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6U8 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene ctaG CDS 27855..28733 product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921231.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene coxC CDS 28808..29110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 29150..29848 product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F5 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene surf-1 CDS 29889..30467 product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921226.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 30464..31627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(31610..32185) product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5C6 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(32152..32334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 32327..32809 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(32806..33489) product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ6 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(33496..34353) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9H3 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene map CDS complement(34419..35102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(35080..35352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(35587..36345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(36530..38149) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(38275..38784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 38892..39644 product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 39839..40390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 40393..41673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 41670..42371 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089719.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 42375..43586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 43677..44306 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBU1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene clpP tRNA 44327..44415 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(44360..45922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(45922..46173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 46500..47096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 47093..47644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 47757..49181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447105.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 49412..51448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 51470..51862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 51900..52730 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 52811..53770 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 sequence19 source 1..51070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1023 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941163.1:RND transporter locus_tag LOCUS_26930 CDS 1013..1732 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 1786..2949 product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 3165..3560 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene sdhC CDS 3560..3937 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709623.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 3950..5740 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCQ9 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 5766..5990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 6027..6809 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 7176..7757 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749H7 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 7775..8848 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5V3 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene prfA CDS 9146..9988 product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2B7 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene prmC CDS 10258..11010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 note possible pseudo, internal stop codon CDS 11415..13013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339589.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 13000..14082 product DNA/RNA helicase superfamily I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004240.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 14240..16858 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C855 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene clpB CDS 16922..17974 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035337.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 18141..18560 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 18585..18938 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532857.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(18947..21040) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918570.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 21124..22353 product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene hlyD CDS 22427..22801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 23786..24430 product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C8 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 24624..24815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(24812..26371) product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene yhcX CDS complement(26368..27216) product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(27219..28922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(28926..29927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639908.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(30097..33423) product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640052.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 33844..35412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(35406..36038) product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene msrA CDS complement(36133..37074) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J8 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene argC CDS complement(37079..38434) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J6 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene argB CDS complement(38431..39438) product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene argF' CDS complement(39580..41052) product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(41042..42859) product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(42862..43725) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(43722..45698) product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083807.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene mccA CDS complement(45683..46483) product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene atuE CDS complement(46483..47640) product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene atuD CDS complement(47796..49406) product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene atuC CDS complement(49406..50287) product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene atuB CDS 50404..50826 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389066.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 sequence20 source 1..48929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..1518) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW2 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(1521..2528) product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene bkdA2 CDS complement(2541..3770) product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene bkdA1 CDS complement(3944..4831) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(4837..5406) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565041.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene rfbC tRNA complement(5619..5705) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 5857..6585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 6645..7190 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920057.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 7190..7744 product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8N7 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene coq7 CDS 7876..8574 product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58113 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 8690..8917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(8933..9562) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P3 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene queE CDS complement(9559..10287) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P2 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene queC CDS 10349..10696 product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868105.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(10693..12531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 12651..13223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(13233..15158) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(15178..15933) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719559.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(15930..16898) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(16910..17767) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919074.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(18161..19138) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(19150..20136) product secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920778.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(20143..21429) product pilus assembly protein CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920779.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene cpaF CDS complement(21652..23211) product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920780.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene cpaE CDS complement(23242..23895) product type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968382.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(23900..25372) product secretin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084256.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene ctpD CDS complement(25372..26175) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene ctpC CDS complement(26316..26831) product pilus assembly protein CpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920784.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene cpaA CDS complement(26919..27638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(27635..28180) product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(28274..28714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(28772..29512) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(29509..30201) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(30198..31181) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZ66 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene rluC CDS complement(31178..31561) product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KN78 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene crcB CDS complement(31621..32928) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919162.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(32962..34404) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(34602..35018) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5P7 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene rplQ CDS complement(35064..36083) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8S9 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene rpoA CDS complement(36203..36592) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene rpsK CDS complement(36605..36973) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE39 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene rpsM CDS complement(37185..37748) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T2 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene adk CDS complement(37745..39094) product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ9 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene secY CDS complement(39183..39659) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q3 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene rplO CDS complement(39693..39884) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME2 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene rpmD CDS complement(39896..40492) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene rpsE CDS complement(40502..40864) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T7 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene rplR CDS complement(40879..41415) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J99 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene rplF CDS complement(41430..41828) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C3 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene rpsH CDS complement(41842..42147) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C686 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene rpsN CDS complement(42199..42759) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E6 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene rplE CDS complement(42752..43066) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene rplX CDS complement(43069..43437) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U869 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene rplN CDS complement(43484..43720) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE27 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene rpsQ CDS complement(43724..43927) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QG2 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene rpmC CDS complement(43932..44357) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R5 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene rplP CDS complement(44385..45089) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QG4 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene rpsC CDS complement(45089..45469) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D2 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene rplV CDS complement(45474..45752) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4D8 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene rpsS CDS complement(45770..46606) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V0 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene rplB CDS complement(46632..46925) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4D6 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene rplW CDS complement(46925..47563) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V2 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene rplD CDS complement(47560..48378) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5S2 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene rplC CDS complement(48383..48697) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene rpsJ CDS complement(48792..48929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 sequence21 source 1..45171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..1909) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene atsA CDS complement(1890..3551) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 3656..4318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 4342..5379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 5383..6045 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 6042..7286 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(7274..8287) product UDP-glucuronate 5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836238.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(8356..8634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 8880..9641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 9641..10168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(10090..10653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004192.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 10705..11328 product QoxB, Quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004190.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene qoxB CDS 11325..13829 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene qoxA CDS 13826..14185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339036.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(14291..15625) product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 15785..17995 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085213.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene fadE CDS complement(18050..19579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(19625..20791) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 21086..21784 product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365722.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 21797..22429 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082941.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 tRNA complement(22504..22593) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 22784..23482 product protein YebE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529742.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(23506..24426) product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene yrbG CDS 24440..25309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 25339..26010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(26007..26423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083733.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 26547..28721 product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 28893..29936 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 30031..31377 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(31374..32672) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706992.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 32879..33055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 33096..36344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 36505..41406 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921400.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 41445..43466 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923313.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene pbpZ CDS complement(43476..44078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 44215..44976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 sequence22 source 1..44886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..1621 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064988.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 1618..2142 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 2139..3017 product isocitrate lyase-family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(3020..4135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(4119..4520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921255.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(4517..5440) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384693.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(5437..6384) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537829.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(6381..7076) product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537831.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(7090..7698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(7704..8510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 8650..9156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(9195..9887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(10049..11062) product 2-keto-3-deoxygluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035376.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene kdgK CDS complement(11082..12506) product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640251.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(12527..14041) product altronate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919362.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene uxaA CDS 14213..15292 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919363.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 15407..16861 product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5V4 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene uxaC CDS 16886..17734 product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5V5 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene kduI CDS 17744..18502 product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 18735..21470 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene iroN CDS 21547..21912 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIV6 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene mgsA CDS complement(21909..23192) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(23192..23695) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640242.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(23688..24692) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(24702..26336) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 26806..27447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(27444..28079) product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(28076..29941) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726837.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene edd CDS complement(29970..30680) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706901.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(30673..32136) product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene zwf CDS 32299..33597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 34221..34997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 note possible pseudo, frameshifted CDS 34987..36492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 note possible pseudo, frameshifted CDS complement(36505..37344) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528564.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(37395..38498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(38488..40119) product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315345.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene cysI CDS complement(40124..40405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(40402..41829) product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene cysG CDS complement(41972..42928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(43012..44010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(44055..44690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 sequence23 source 1..44657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084751.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 605..1183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 1180..2571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 2555..3745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 3825..4394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 4867..5139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533401.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 5266..5436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(5552..5767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 5717..5986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 6047..6964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 6968..7816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 7995..8279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 8276..8740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 8737..9249 product peptidase S26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538231.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 9253..10014 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 10247..12019 product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388572.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 12042..14048 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 14060..14515 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(14518..15327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 15385..15855 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533927.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 15999..16970 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene trbB1 CDS 16967..17296 product conjugal transfer protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533269.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 17296..17565 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090994.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene trbD CDS 17570..20008 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene trbE CDS 19998..20774 product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 20777..21055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 21057..22343 product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene trbL1 CDS 22340..23029 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 23026..24048 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene trbG CDS 24045..25262 product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 25266..25526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090986.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 25954..26232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(26585..27382) product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140552.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(27470..28297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140551.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(28437..29096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 29279..29962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(30069..31574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(31794..32714) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971752.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(32773..33156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(33283..34260) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531471.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 34649..35215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 35304..36242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 36459..36779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(37242..38318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(38315..38749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 note possible pseudo, internal stop codon CDS complement(38932..39744) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971115.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 39863..40249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 40349..41662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 41663..42637 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719748.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 42643..43152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 43455..44036 product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700856.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 sequence24 source 1..40489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 204..280 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(389..1267) product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(1264..1746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 1799..2683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 2680..3837 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525764.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 4034..4309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(4367..4840) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531005.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 4944..5867 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531004.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 5857..6822 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 6925..7170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(7113..7775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(7816..8811) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598049.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 9051..10451 product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 10564..11334 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(11466..11855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(11852..12547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 12771..13199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(13265..13825) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(13849..14487) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532149.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(14589..15458) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 15590..16489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 16574..17980 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083720.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 18343..18909 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 18911..19387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 19435..21201 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533280.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(21302..21697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 22297..22620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533279.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 23024..23590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 23703..23930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 23927..24427 product peptidase S26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538231.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 24333..24521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 24851..26569 product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 26806..27441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 27724..29694 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 29696..30106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 30226..30918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 31084..32031 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533270.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 32028..32363 product conjugal transfer protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533269.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 32363..32617 product conjugal transfer protein TrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533268.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 32611..35082 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 35094..35798 product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533266.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 35798..37111 product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 37115..37807 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533264.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 37813..38850 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920535.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 38854..40131 product conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 40128..40358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 sequence25 source 1..35809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..1721) product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919841.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 1868..2797 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083349.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 2823..4271 product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 4276..5547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(5544..6182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 6291..7223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(7239..8273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 8528..10150 product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBF9 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene pckA CDS 10161..10622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(10693..12108) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(12226..13536) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(13810..14421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(14418..15062) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 15317..17239 product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene wbfY CDS complement(17299..19236) product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039172.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(19268..20476) product D-mannonate dehydratase CC2812 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4L8 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 20605..21630 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919322.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 21647..23476 product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A667 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(23479..26022) product 1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene celD CDS complement(26079..27230) product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAY5 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene xynA1 CDS complement(27235..28548) product Kef-type K+ transport system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265722.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(28641..31877) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920645.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 32201..33661 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920646.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 33665..35143 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920648.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 sequence26 source 1..34454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..1157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919057.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 1412..3589 product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene katG CDS 3730..3906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 3967..4551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 4520..4816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 4938..5159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(5319..5534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 5702..7144 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 7222..10032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(10038..10193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(10287..10988) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T20 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene nth CDS complement(11111..13555) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A262 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene ftsK CDS complement(13598..14869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(14929..16155) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene argG CDS 16297..17637 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 17705..18532 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene hetN CDS 18529..19218 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW5 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene pyrF CDS complement(19310..19630) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(19704..23396) product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923305.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(23393..26473) product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921366.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(26470..27192) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921365.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(27189..28283) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(28267..28728) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 28847..30073 product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 30115..30435 product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(30443..31225) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(31222..32298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(32387..33592) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS87 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene kynU CDS complement(33592..34236) product kynurenine formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M97 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene kynB sequence27 source 1..32327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 508..720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(724..2223) product 3-polyprenyl-4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918202.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 2541..3176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(3211..3525) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527553.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(3575..4309) product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(4322..5239) product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene ilvE2 CDS complement(5262..6596) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083637.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(6660..7424) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(7466..8683) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 8752..9528 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 9525..10118 product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918577.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 10151..11995 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV5 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene mutL CDS complement(12009..12569) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(12544..13551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 13550..14014 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C334 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene tadA CDS complement(14204..15130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(15127..16050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 16202..16567 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A602 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene panD CDS complement(16669..17337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(17387..17773) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 17926..18366 product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921327.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 18363..19274 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAA3 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 19443..22412 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAA5 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene ileS CDS 22409..22954 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7N8 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene lspA CDS 23048..23587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918585.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 note possible pseudo, internal stop codon CDS complement(23675..24112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(24131..24799) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528903.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(24841..25368) product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404837.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene msrB CDS complement(25426..26367) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBU3 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene ubiA CDS 26448..26957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 26954..27721 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(27718..30249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 30391..31764 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene gsh1 CDS 31786..32097 product alkylphosphonate uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene phnA sequence28 source 1..26036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084751.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(467..685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 859..1134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082886.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 1685..1978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 2037..2900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 3057..3341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 3338..3844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 3841..4419 product peptidase S26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082879.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene traF CDS 4433..4780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 4803..5486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 5734..7491 product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388572.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 7515..9524 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 9533..9955 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(10035..11102) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708578.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(11104..11766) product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082512.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(11778..12302) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208449.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 12552..13535 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene trbB1 CDS 13532..13861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 13861..14130 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388564.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 14134..16593 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 16586..17326 product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 17333..17605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 17609..18904 product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene trbL1 CDS 18904..19587 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 19584..20615 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene trbG CDS 20612..21802 product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 21806..22072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084436.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(22052..22771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(23009..23977) product hypothetical 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(23974..24195) product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A468 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(24199..24579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(24576..25187) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920810.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 25362..25670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 note possible pseudo, frameshifted sequence29 source 1..23867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..2270) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX7 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene fusA CDS complement(2310..2780) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX6 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene rpsG CDS complement(2793..3164) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV5 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene rpsL CDS complement(3519..7727) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4W8 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene rpoC CDS complement(7807..11886) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZW7 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene rpoB CDS complement(12120..12500) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene rplL CDS complement(12551..13066) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZW1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene rplJ CDS complement(13393..14106) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAW8 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene rplA CDS complement(14113..14544) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QI1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene rplK CDS complement(14683..15216) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U846 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene nusG CDS complement(15222..15431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 tRNA complement(15566..15641) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(15937..19194) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036532.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene btuB CDS complement(19528..22368) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(22731..23612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(23730..23867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 sequence30 source 1..18825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(440..667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 626..790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(851..1429) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene purN CDS complement(1426..2457) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C924 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene purM CDS 2641..3750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 3760..4467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 4464..6677 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7L2 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene ppk CDS 6674..8188 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919577.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene ppx1 CDS complement(8185..9372) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAA2 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene rnd CDS complement(9387..10691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(10696..11424) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(11484..12875) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(12925..14583) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 14703..15107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 15128..15745 product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879388.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(15729..16589) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919119.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 tRNA 16715..16800 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 16881..16954 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 17139..18533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920658.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 sequence31 source 1..2901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..817 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920649.1:tryptophan halogenase locus_tag LOCUS_31240 CDS 919..2706 product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250