>Feature sequence001 1563 1868 gene locus_tag LOCUS_00010 1563 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2449 4536 gene locus_tag LOCUS_00020 2449 4536 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918570.1 protein_id gnl|my_center|LOCUS_00020 5160 4570 gene locus_tag LOCUS_00030 5160 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5365 5177 gene locus_tag LOCUS_00040 5365 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5750 8221 gene locus_tag LOCUS_00050 5750 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8214 9035 gene locus_tag LOCUS_00060 8214 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9035 10465 gene locus_tag LOCUS_00070 gene traH 9035 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331488.1 protein_id gnl|my_center|LOCUS_00070 10471 13662 gene locus_tag LOCUS_00080 10471 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13905 13735 gene locus_tag LOCUS_00090 13905 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14379 15206 gene locus_tag LOCUS_00100 14379 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15208 15834 gene locus_tag LOCUS_00110 15208 15834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16382 16194 gene locus_tag LOCUS_00120 16382 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17779 16685 gene locus_tag LOCUS_00130 17779 16685 CDS product His-Xaa-Ser system radical SAM maturase HxsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106270.1 protein_id gnl|my_center|LOCUS_00130 19193 17772 gene locus_tag LOCUS_00140 19193 17772 CDS product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 protein_id gnl|my_center|LOCUS_00140 19501 19193 gene locus_tag LOCUS_00150 19501 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20416 19652 gene locus_tag LOCUS_00160 20416 19652 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084850.1 protein_id gnl|my_center|LOCUS_00160 20609 21082 gene locus_tag LOCUS_00170 20609 21082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22135 21248 gene locus_tag LOCUS_00180 22135 21248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22494 22132 gene locus_tag LOCUS_00190 22494 22132 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942758.1 protein_id gnl|my_center|LOCUS_00190 22648 23559 gene locus_tag LOCUS_00200 22648 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23567 24082 gene locus_tag LOCUS_00210 23567 24082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24082 25020 gene locus_tag LOCUS_00220 24082 25020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25017 25742 gene locus_tag LOCUS_00230 25017 25742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26837 26148 gene locus_tag LOCUS_00240 26837 26148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530548.1 protein_id gnl|my_center|LOCUS_00240 27247 26837 gene locus_tag LOCUS_00250 27247 26837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720621.1 protein_id gnl|my_center|LOCUS_00250 >Feature sequence002 <1 1906 gene locus_tag LOCUS_00260 <1 1906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CA58:phosphoribosylformylglycinamidine synthase subunit PurL 2484 2005 gene locus_tag LOCUS_00270 2484 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 4834 2801 gene locus_tag LOCUS_00280 gene rpoD 4834 2801 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52324 protein_id gnl|my_center|LOCUS_00280 6724 4901 gene locus_tag LOCUS_00290 gene dnaG 6724 4901 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A401 protein_id gnl|my_center|LOCUS_00290 7249 6782 gene locus_tag LOCUS_00300 7249 6782 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 protein_id gnl|my_center|LOCUS_00300 7419 8624 gene locus_tag LOCUS_00310 gene carA 7419 8624 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TK68 protein_id gnl|my_center|LOCUS_00310 8725 11004 gene locus_tag LOCUS_00320 8725 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 11044 12630 gene locus_tag LOCUS_00330 11044 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 12767 16009 gene locus_tag LOCUS_00340 gene carB 12767 16009 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4D6 protein_id gnl|my_center|LOCUS_00340 16113 16571 gene locus_tag LOCUS_00350 gene greA 16113 16571 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1V7 protein_id gnl|my_center|LOCUS_00350 16702 17637 gene locus_tag LOCUS_00360 16702 17637 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920689.1 protein_id gnl|my_center|LOCUS_00360 17676 18179 gene locus_tag LOCUS_00370 17676 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 18241 19230 gene locus_tag LOCUS_00380 18241 19230 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4G3 protein_id gnl|my_center|LOCUS_00380 19227 19934 gene locus_tag LOCUS_00390 19227 19934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261130.1 protein_id gnl|my_center|LOCUS_00390 19931 21190 gene locus_tag LOCUS_00400 19931 21190 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_00400 21222 22130 gene locus_tag LOCUS_00410 21222 22130 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_00410 22424 22777 gene locus_tag LOCUS_00420 22424 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701103.1 protein_id gnl|my_center|LOCUS_00420 22774 22998 gene locus_tag LOCUS_00430 22774 22998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640261.1 protein_id gnl|my_center|LOCUS_00430 23068 23544 gene locus_tag LOCUS_00440 23068 23544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 23549 24034 gene locus_tag LOCUS_00450 23549 24034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 24085 24579 gene locus_tag LOCUS_00460 24085 24579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919164.1 protein_id gnl|my_center|LOCUS_00460 24686 26416 gene locus_tag LOCUS_00470 24686 26416 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_00470 26904 26413 gene locus_tag LOCUS_00480 26904 26413 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_00480 <27809 26911 gene locus_tag LOCUS_00490 <27809 26911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920390.1:4-hydroxyphenylpyruvate dioxygenase >Feature sequence003 75 854 gene locus_tag LOCUS_00500 75 854 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948447.1 protein_id gnl|my_center|LOCUS_00500 1666 851 gene locus_tag LOCUS_00510 1666 851 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920789.1 protein_id gnl|my_center|LOCUS_00510 2985 1663 gene locus_tag LOCUS_00520 2985 1663 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920790.1 protein_id gnl|my_center|LOCUS_00520 3762 2992 gene locus_tag LOCUS_00530 3762 2992 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 protein_id gnl|my_center|LOCUS_00530 3890 5959 gene locus_tag LOCUS_00540 3890 5959 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970510.1 protein_id gnl|my_center|LOCUS_00540 7462 5963 gene locus_tag LOCUS_00550 gene amn 7462 5963 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C461 protein_id gnl|my_center|LOCUS_00550 7694 7479 gene locus_tag LOCUS_00560 7694 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 9079 7799 gene locus_tag LOCUS_00570 9079 7799 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919156.1 protein_id gnl|my_center|LOCUS_00570 9253 11835 gene locus_tag LOCUS_00580 9253 11835 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403080.1 protein_id gnl|my_center|LOCUS_00580 12474 11830 gene locus_tag LOCUS_00590 12474 11830 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6V3 protein_id gnl|my_center|LOCUS_00590 12670 13452 gene locus_tag LOCUS_00600 gene paaG 12670 13452 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227109.1 protein_id gnl|my_center|LOCUS_00600 14269 15192 gene locus_tag LOCUS_00610 14269 15192 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086737.1 protein_id gnl|my_center|LOCUS_00610 16144 15302 gene locus_tag LOCUS_00620 16144 15302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 16973 16134 gene locus_tag LOCUS_00630 16973 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 17183 18385 gene locus_tag LOCUS_00640 17183 18385 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_00640 18409 19263 gene locus_tag LOCUS_00650 18409 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 19305 20123 gene locus_tag LOCUS_00660 19305 20123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 20293 20601 gene locus_tag LOCUS_00670 20293 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 20687 22726 gene locus_tag LOCUS_00680 20687 22726 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084021.1 protein_id gnl|my_center|LOCUS_00680 22842 22918 gene locus_tag LOCUS_t00010 22842 22918 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23586 22951 gene locus_tag LOCUS_00690 23586 22951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 24167 23583 gene locus_tag LOCUS_00700 24167 23583 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921086.1 protein_id gnl|my_center|LOCUS_00700 >Feature sequence004 933 3029 gene locus_tag LOCUS_00710 933 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 4426 3122 gene locus_tag LOCUS_00720 4426 3122 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS2 protein_id gnl|my_center|LOCUS_00720 4584 4931 gene locus_tag LOCUS_00730 4584 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 4936 5367 gene locus_tag LOCUS_00740 4936 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 5434 6729 gene locus_tag LOCUS_00750 5434 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 6756 8222 gene locus_tag LOCUS_00760 6756 8222 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014167.1 protein_id gnl|my_center|LOCUS_00760 8215 9552 gene locus_tag LOCUS_00770 gene aofH 8215 9552 CDS product putative flavin-containing monoamine oxidase AofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQ15 protein_id gnl|my_center|LOCUS_00770 10806 9685 gene locus_tag LOCUS_00780 10806 9685 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465532.1 protein_id gnl|my_center|LOCUS_00780 11781 10927 gene locus_tag LOCUS_00790 11781 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 protein_id gnl|my_center|LOCUS_00790 12433 11960 gene locus_tag LOCUS_00800 gene nodN 12433 11960 CDS product nodulation protein NodN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 protein_id gnl|my_center|LOCUS_00800 13524 12511 gene locus_tag LOCUS_00810 gene kdgK 13524 12511 CDS product 2-keto-3-deoxygluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035376.1 protein_id gnl|my_center|LOCUS_00810 14971 13547 gene locus_tag LOCUS_00820 14971 13547 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640251.1 protein_id gnl|my_center|LOCUS_00820 16506 14992 gene locus_tag LOCUS_00830 gene uxaA 16506 14992 CDS product altronate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919362.1 protein_id gnl|my_center|LOCUS_00830 16676 17755 gene locus_tag LOCUS_00840 16676 17755 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919363.1 protein_id gnl|my_center|LOCUS_00840 17862 19316 gene locus_tag LOCUS_00850 gene uxaC 17862 19316 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A874 protein_id gnl|my_center|LOCUS_00850 19342 20190 gene locus_tag LOCUS_00860 gene kduI 19342 20190 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A873 protein_id gnl|my_center|LOCUS_00860 20202 20960 gene locus_tag LOCUS_00870 20202 20960 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 protein_id gnl|my_center|LOCUS_00870 21191 23926 gene locus_tag LOCUS_00880 gene iroN 21191 23926 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence005 322 2421 gene locus_tag LOCUS_00890 322 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 3260 2418 gene locus_tag LOCUS_00900 3260 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3994 3257 gene locus_tag LOCUS_00910 3994 3257 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143766.1 protein_id gnl|my_center|LOCUS_00910 4938 3994 gene locus_tag LOCUS_00920 4938 3994 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143765.1 protein_id gnl|my_center|LOCUS_00920 5647 4943 gene locus_tag LOCUS_00930 5647 4943 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143764.1 protein_id gnl|my_center|LOCUS_00930 6569 5685 gene locus_tag LOCUS_00940 6569 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143763.1 protein_id gnl|my_center|LOCUS_00940 7288 6575 gene locus_tag LOCUS_00950 7288 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 8568 7339 gene locus_tag LOCUS_00960 8568 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 9320 8571 gene locus_tag LOCUS_00970 9320 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 14938 9440 gene locus_tag LOCUS_00980 14938 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 15653 14961 gene locus_tag LOCUS_00990 15653 14961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 16774 15740 gene locus_tag LOCUS_01000 16774 15740 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_01000 17892 16936 gene locus_tag LOCUS_01010 gene fcl 17892 16936 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5H3 protein_id gnl|my_center|LOCUS_01010 18985 17885 gene locus_tag LOCUS_01020 gene gmd 18985 17885 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXT7 protein_id gnl|my_center|LOCUS_01020 20787 19276 gene locus_tag LOCUS_01030 20787 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 20947 21276 gene locus_tag LOCUS_01040 20947 21276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 21822 22493 gene locus_tag LOCUS_01050 21822 22493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 22753 22935 gene locus_tag LOCUS_01060 22753 22935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence006 2004 406 gene locus_tag LOCUS_01070 2004 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3470 2157 gene locus_tag LOCUS_01080 gene ftsA 3470 2157 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 protein_id gnl|my_center|LOCUS_01080 4273 3476 gene locus_tag LOCUS_01090 4273 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5307 4390 gene locus_tag LOCUS_01100 gene ddl 5307 4390 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA93 protein_id gnl|my_center|LOCUS_01100 6239 5304 gene locus_tag LOCUS_01110 gene murB 6239 5304 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H085 protein_id gnl|my_center|LOCUS_01110 7827 6418 gene locus_tag LOCUS_01120 gene murC 7827 6418 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H086 protein_id gnl|my_center|LOCUS_01120 8950 7853 gene locus_tag LOCUS_01130 gene murG 8950 7853 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF54 protein_id gnl|my_center|LOCUS_01130 10095 8947 gene locus_tag LOCUS_01140 10095 8947 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920409.1 protein_id gnl|my_center|LOCUS_01140 11504 10092 gene locus_tag LOCUS_01150 gene murD 11504 10092 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A597 protein_id gnl|my_center|LOCUS_01150 12615 11515 gene locus_tag LOCUS_01160 gene mraY 12615 11515 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 protein_id gnl|my_center|LOCUS_01160 14030 12621 gene locus_tag LOCUS_01170 gene murF 14030 12621 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A596 protein_id gnl|my_center|LOCUS_01170 15505 14027 gene locus_tag LOCUS_01180 gene murE 15505 14027 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF49 protein_id gnl|my_center|LOCUS_01180 17313 15502 gene locus_tag LOCUS_01190 gene ftsI 17313 15502 CDS product peptidoglycan synthase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0A0 protein_id gnl|my_center|LOCUS_01190 17675 17310 gene locus_tag LOCUS_01200 17675 17310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 18667 17672 gene locus_tag LOCUS_01210 gene rsmH 18667 17672 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ6 protein_id gnl|my_center|LOCUS_01210 19131 18667 gene locus_tag LOCUS_01220 gene mraZ 19131 18667 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB94 protein_id gnl|my_center|LOCUS_01220 20483 19803 gene locus_tag LOCUS_01230 20483 19803 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_01230 21391 20480 gene locus_tag LOCUS_01240 21391 20480 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920424.1 protein_id gnl|my_center|LOCUS_01240 21746 21465 gene locus_tag LOCUS_01250 21746 21465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 22602 21901 gene locus_tag LOCUS_01260 22602 21901 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919995.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence007 1013 177 gene locus_tag LOCUS_01270 1013 177 CDS product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918369.1 protein_id gnl|my_center|LOCUS_01270 1233 2708 gene locus_tag LOCUS_01280 gene rimK 1233 2708 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_01280 3288 2788 gene locus_tag LOCUS_01290 3288 2788 CDS product osteoblast specific factor 2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404935.1 protein_id gnl|my_center|LOCUS_01290 5613 3673 gene locus_tag LOCUS_01300 5613 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 6941 6868 gene locus_tag LOCUS_t00020 6941 6868 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7088 7588 gene locus_tag LOCUS_01310 7088 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_01310 8191 7703 gene locus_tag LOCUS_01320 8191 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 9455 8217 gene locus_tag LOCUS_01330 9455 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 9959 9684 gene locus_tag LOCUS_01340 9959 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 12271 10028 gene locus_tag LOCUS_01350 12271 10028 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_01350 14019 12535 gene locus_tag LOCUS_01360 gene tacA 14019 12535 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 protein_id gnl|my_center|LOCUS_01360 14337 15275 gene locus_tag LOCUS_01370 14337 15275 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_01370 15350 15643 gene locus_tag LOCUS_01380 15350 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 15742 16866 gene locus_tag LOCUS_01390 15742 16866 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_01390 16997 17332 gene locus_tag LOCUS_01400 16997 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 17329 18735 gene locus_tag LOCUS_01410 17329 18735 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9C8 protein_id gnl|my_center|LOCUS_01410 18799 19104 gene locus_tag LOCUS_01420 18799 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 21132 19216 gene locus_tag LOCUS_01430 gene thrS 21132 19216 CDS product threonine--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18255 protein_id gnl|my_center|LOCUS_01430 22644 21148 gene locus_tag LOCUS_01440 gene glpK1 22644 21148 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_01440 >Feature sequence008 1752 703 gene locus_tag LOCUS_01450 1752 703 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919229.1 protein_id gnl|my_center|LOCUS_01450 2185 1778 gene locus_tag LOCUS_01460 2185 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 2439 2182 gene locus_tag LOCUS_01470 2439 2182 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK01 protein_id gnl|my_center|LOCUS_01470 3646 2510 gene locus_tag LOCUS_01480 3646 2510 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919227.1 protein_id gnl|my_center|LOCUS_01480 3698 4681 gene locus_tag LOCUS_01490 3698 4681 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C809 protein_id gnl|my_center|LOCUS_01490 5319 4687 gene locus_tag LOCUS_01500 5319 4687 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388746.1 protein_id gnl|my_center|LOCUS_01500 5777 5316 gene locus_tag LOCUS_01510 5777 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01510 6644 6174 gene locus_tag LOCUS_01520 6644 6174 CDS product nitrilotriacetate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723432.1 protein_id gnl|my_center|LOCUS_01520 6804 7625 gene locus_tag LOCUS_01530 6804 7625 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_01530 7725 8453 gene locus_tag LOCUS_01540 gene ate 7725 8453 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVD8 protein_id gnl|my_center|LOCUS_01540 8538 9653 gene locus_tag LOCUS_01550 8538 9653 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_01550 9926 10702 gene locus_tag LOCUS_01560 9926 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 10703 12277 gene locus_tag LOCUS_01570 10703 12277 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528213.1 protein_id gnl|my_center|LOCUS_01570 12270 13373 gene locus_tag LOCUS_01580 12270 13373 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 protein_id gnl|my_center|LOCUS_01580 14374 13370 gene locus_tag LOCUS_01590 gene htpX 14374 13370 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB2 protein_id gnl|my_center|LOCUS_01590 14948 14400 gene locus_tag LOCUS_01600 14948 14400 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_01600 17422 15170 gene locus_tag LOCUS_01610 gene gyrA 17422 15170 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K54 protein_id gnl|my_center|LOCUS_01610 18201 17473 gene locus_tag LOCUS_01620 gene recO 18201 17473 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVD0 protein_id gnl|my_center|LOCUS_01620 19302 18355 gene locus_tag LOCUS_01630 gene era 19302 18355 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H630 protein_id gnl|my_center|LOCUS_01630 19981 19292 gene locus_tag LOCUS_01640 gene rnc 19981 19292 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H627 protein_id gnl|my_center|LOCUS_01640 20391 19978 gene locus_tag LOCUS_01650 gene acpS 20391 19978 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69159 protein_id gnl|my_center|LOCUS_01650 21134 20388 gene locus_tag LOCUS_01660 gene pdxJ 21134 20388 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_01660 21733 21143 gene locus_tag LOCUS_01670 gene pyrE 21733 21143 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H621 protein_id gnl|my_center|LOCUS_01670 <23216 21760 gene locus_tag LOCUS_01680 <23216 21760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919427.1:guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence009 165 374 gene locus_tag LOCUS_01690 165 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 554 480 gene locus_tag LOCUS_t00030 554 480 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 693 1229 gene locus_tag LOCUS_01700 693 1229 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_01700 1327 2250 gene locus_tag LOCUS_01710 1327 2250 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 protein_id gnl|my_center|LOCUS_01710 2327 2989 gene locus_tag LOCUS_01720 2327 2989 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 protein_id gnl|my_center|LOCUS_01720 2943 3248 gene locus_tag LOCUS_01730 2943 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 3241 3570 gene locus_tag LOCUS_01740 3241 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3632 4114 gene locus_tag LOCUS_01750 3632 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 5884 4139 gene locus_tag LOCUS_01760 5884 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918125.1 protein_id gnl|my_center|LOCUS_01760 6037 6744 gene locus_tag LOCUS_01770 gene chvI 6037 6744 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918126.1 protein_id gnl|my_center|LOCUS_01770 6713 8353 gene locus_tag LOCUS_01780 gene chvG 6713 8353 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918127.1 protein_id gnl|my_center|LOCUS_01780 8456 8860 gene locus_tag LOCUS_01790 8456 8860 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_01790 8881 9132 gene locus_tag LOCUS_01800 8881 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 10692 9133 gene locus_tag LOCUS_01810 10692 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 10937 12355 gene locus_tag LOCUS_01820 gene ahcY 10937 12355 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TC1 protein_id gnl|my_center|LOCUS_01820 13281 12412 gene locus_tag LOCUS_01830 13281 12412 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265975.1 protein_id gnl|my_center|LOCUS_01830 13600 13307 gene locus_tag LOCUS_01840 13600 13307 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085871.1 protein_id gnl|my_center|LOCUS_01840 13748 14251 gene locus_tag LOCUS_01850 13748 14251 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969945.1 protein_id gnl|my_center|LOCUS_01850 14263 15324 gene locus_tag LOCUS_01860 14263 15324 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 protein_id gnl|my_center|LOCUS_01860 15324 16043 gene locus_tag LOCUS_01870 15324 16043 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267058.1 protein_id gnl|my_center|LOCUS_01870 16128 16496 gene locus_tag LOCUS_01880 16128 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 20023 16571 gene locus_tag LOCUS_01890 20023 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 >Feature sequence010 820 1836 gene locus_tag LOCUS_01900 820 1836 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969505.1 protein_id gnl|my_center|LOCUS_01900 1836 2876 gene locus_tag LOCUS_01910 1836 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 protein_id gnl|my_center|LOCUS_01910 2873 3982 gene locus_tag LOCUS_01920 2873 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 protein_id gnl|my_center|LOCUS_01920 4436 3960 gene locus_tag LOCUS_01930 4436 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 4555 5091 gene locus_tag LOCUS_01940 4555 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 6919 5363 gene locus_tag LOCUS_01950 6919 5363 CDS product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090039.1 protein_id gnl|my_center|LOCUS_01950 7056 8342 gene locus_tag LOCUS_01960 7056 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8358 9038 gene locus_tag LOCUS_01970 8358 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 9087 9701 gene locus_tag LOCUS_01980 9087 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 11449 9698 gene locus_tag LOCUS_01990 gene phyK 11449 9698 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923290.1 protein_id gnl|my_center|LOCUS_01990 12078 11455 gene locus_tag LOCUS_02000 gene sigT 12078 11455 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_02000 12294 12082 gene locus_tag LOCUS_02010 12294 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 12495 13265 gene locus_tag LOCUS_02020 gene phyR 12495 13265 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_02020 13284 13457 gene locus_tag LOCUS_02030 13284 13457 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY71 protein_id gnl|my_center|LOCUS_02030 13603 14382 gene locus_tag LOCUS_02040 13603 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 14864 14439 gene locus_tag LOCUS_02050 14864 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 15713 14961 gene locus_tag LOCUS_02060 15713 14961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 16063 15866 gene locus_tag LOCUS_02070 gene csbD 16063 15866 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384941.1 protein_id gnl|my_center|LOCUS_02070 16300 18072 gene locus_tag LOCUS_02080 gene asnB 16300 18072 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_02080 18097 19866 gene locus_tag LOCUS_02090 18097 19866 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969277.1 protein_id gnl|my_center|LOCUS_02090 >Feature sequence011 949 1824 gene locus_tag LOCUS_02100 949 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 1875 2303 gene locus_tag LOCUS_02110 1875 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 2646 2323 gene locus_tag LOCUS_02120 2646 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 3034 2744 gene locus_tag LOCUS_02130 3034 2744 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABI2 protein_id gnl|my_center|LOCUS_02130 3119 3391 gene locus_tag LOCUS_02140 3119 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 3481 4620 gene locus_tag LOCUS_02150 gene blcB 3481 4620 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 protein_id gnl|my_center|LOCUS_02150 4617 5054 gene locus_tag LOCUS_02160 4617 5054 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_02160 5666 5082 gene locus_tag LOCUS_02170 5666 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 6236 5694 gene locus_tag LOCUS_02180 6236 5694 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2A5 protein_id gnl|my_center|LOCUS_02180 6347 6904 gene locus_tag LOCUS_02190 6347 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 protein_id gnl|my_center|LOCUS_02190 6895 7278 gene locus_tag LOCUS_02200 6895 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693479.1 protein_id gnl|my_center|LOCUS_02200 7453 8010 gene locus_tag LOCUS_02210 gene rimP 7453 8010 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y659 protein_id gnl|my_center|LOCUS_02210 8024 9784 gene locus_tag LOCUS_02220 gene nusA 8024 9784 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3M7 protein_id gnl|my_center|LOCUS_02220 9781 10428 gene locus_tag LOCUS_02230 9781 10428 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917933.1 protein_id gnl|my_center|LOCUS_02230 10554 13121 gene locus_tag LOCUS_02240 10554 13121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13285 13746 gene locus_tag LOCUS_02250 13285 13746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948556.1 protein_id gnl|my_center|LOCUS_02250 13849 14217 gene locus_tag LOCUS_02260 13849 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 14224 15183 gene locus_tag LOCUS_02270 gene truB 14224 15183 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5T2 protein_id gnl|my_center|LOCUS_02270 15328 15597 gene locus_tag LOCUS_02280 gene rpsO 15328 15597 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC31 protein_id gnl|my_center|LOCUS_02280 15691 17820 gene locus_tag LOCUS_02290 gene pnp 15691 17820 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC32 protein_id gnl|my_center|LOCUS_02290 17985 19319 gene locus_tag LOCUS_02300 17985 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 >Feature sequence012 1160 465 gene locus_tag LOCUS_02310 1160 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 2215 1157 gene locus_tag LOCUS_02320 2215 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 2475 2942 gene locus_tag LOCUS_02330 2475 2942 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_02330 5261 3207 gene locus_tag LOCUS_02340 gene nadE 5261 3207 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_02340 6334 5348 gene locus_tag LOCUS_02350 gene accA 6334 5348 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2N7 protein_id gnl|my_center|LOCUS_02350 7353 6430 gene locus_tag LOCUS_02360 gene xerD 7353 6430 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHX2 protein_id gnl|my_center|LOCUS_02360 8999 7350 gene locus_tag LOCUS_02370 8999 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 9123 8983 gene locus_tag LOCUS_02380 9123 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 9253 9807 gene locus_tag LOCUS_02390 gene aroK 9253 9807 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H331 protein_id gnl|my_center|LOCUS_02390 9804 10907 gene locus_tag LOCUS_02400 gene aroB 9804 10907 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H332 protein_id gnl|my_center|LOCUS_02400 10908 12191 gene locus_tag LOCUS_02410 10908 12191 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 protein_id gnl|my_center|LOCUS_02410 12264 14063 gene locus_tag LOCUS_02420 12264 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704419.1 protein_id gnl|my_center|LOCUS_02420 14610 14065 gene locus_tag LOCUS_02430 14610 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 14942 14649 gene locus_tag LOCUS_02440 14942 14649 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EF0 protein_id gnl|my_center|LOCUS_02440 16036 15026 gene locus_tag LOCUS_02450 16036 15026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090277.1 protein_id gnl|my_center|LOCUS_02450 16544 15960 gene locus_tag LOCUS_02460 16544 15960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 16895 16626 gene locus_tag LOCUS_02470 16895 16626 CDS product protein usg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530717.1 protein_id gnl|my_center|LOCUS_02470 17685 17020 gene locus_tag LOCUS_02480 17685 17020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 17749 18612 gene locus_tag LOCUS_02490 17749 18612 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918939.1 protein_id gnl|my_center|LOCUS_02490 19172 18573 gene locus_tag LOCUS_02500 19172 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 19171 19860 gene locus_tag LOCUS_02510 19171 19860 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence013 809 621 gene locus_tag LOCUS_02520 809 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 720 1691 gene locus_tag LOCUS_02530 gene plsX 720 1691 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8I5 protein_id gnl|my_center|LOCUS_02530 1688 2650 gene locus_tag LOCUS_02540 gene fabH 1688 2650 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K89 protein_id gnl|my_center|LOCUS_02540 2732 3034 gene locus_tag LOCUS_02550 gene ihfA 2732 3034 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 protein_id gnl|my_center|LOCUS_02550 3047 3490 gene locus_tag LOCUS_02560 3047 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3585 3661 gene locus_tag LOCUS_t00040 3585 3661 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4817 3675 gene locus_tag LOCUS_02570 4817 3675 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919300.1 protein_id gnl|my_center|LOCUS_02570 4881 5942 gene locus_tag LOCUS_02580 gene bztA 4881 5942 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_02580 6698 6162 gene locus_tag LOCUS_02590 6698 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 7660 6695 gene locus_tag LOCUS_02600 7660 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7544 7789 gene locus_tag LOCUS_02610 7544 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 8905 7892 gene locus_tag LOCUS_02620 8905 7892 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919302.1 protein_id gnl|my_center|LOCUS_02620 9016 9672 gene locus_tag LOCUS_02630 9016 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 9710 10387 gene locus_tag LOCUS_02640 9710 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 10387 11937 gene locus_tag LOCUS_02650 gene phrB 10387 11937 CDS product (6-4) photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH39 protein_id gnl|my_center|LOCUS_02650 11934 12722 gene locus_tag LOCUS_02660 11934 12722 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975520.1 protein_id gnl|my_center|LOCUS_02660 13986 12736 gene locus_tag LOCUS_02670 13986 12736 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_02670 14834 14034 gene locus_tag LOCUS_02680 14834 14034 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_02680 16207 14837 gene locus_tag LOCUS_02690 16207 14837 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_02690 17499 16204 gene locus_tag LOCUS_02700 gene phrA 17499 16204 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_02700 17782 18645 gene locus_tag LOCUS_02710 gene kdsA 17782 18645 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8C5 protein_id gnl|my_center|LOCUS_02710 18653 18862 gene locus_tag LOCUS_02720 18653 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 >Feature sequence014 502 1470 gene locus_tag LOCUS_02730 502 1470 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920948.1 protein_id gnl|my_center|LOCUS_02730 1491 1763 gene locus_tag LOCUS_02740 1491 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 4157 1950 gene locus_tag LOCUS_02750 gene fyuA 4157 1950 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_02750 6009 4324 gene locus_tag LOCUS_02760 6009 4324 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 protein_id gnl|my_center|LOCUS_02760 6148 7371 gene locus_tag LOCUS_02770 6148 7371 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_02770 7368 8894 gene locus_tag LOCUS_02780 7368 8894 CDS product AMP-dependent acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225352.1 protein_id gnl|my_center|LOCUS_02780 8891 9352 gene locus_tag LOCUS_02790 8891 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 9412 9903 gene locus_tag LOCUS_02800 9412 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 13053 9913 gene locus_tag LOCUS_02810 13053 9913 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_02810 14189 13050 gene locus_tag LOCUS_02820 14189 13050 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640175.1 protein_id gnl|my_center|LOCUS_02820 15095 14304 gene locus_tag LOCUS_02830 15095 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035917.1 protein_id gnl|my_center|LOCUS_02830 15869 15105 gene locus_tag LOCUS_02840 15869 15105 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z4 protein_id gnl|my_center|LOCUS_02840 16613 15978 gene locus_tag LOCUS_02850 16613 15978 CDS product OmdA-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265685.1 protein_id gnl|my_center|LOCUS_02850 17902 16616 gene locus_tag LOCUS_02860 17902 16616 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence015 1221 2588 gene locus_tag LOCUS_02870 1221 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_02870 2639 3139 gene locus_tag LOCUS_02880 gene def 2639 3139 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_02880 3136 3906 gene locus_tag LOCUS_02890 3136 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 5115 3973 gene locus_tag LOCUS_02900 5115 3973 CDS product polysaccharide biosynthesis protein CelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640455.1 protein_id gnl|my_center|LOCUS_02900 6091 5222 gene locus_tag LOCUS_02910 6091 5222 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_02910 6236 7465 gene locus_tag LOCUS_02920 6236 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338895.1 protein_id gnl|my_center|LOCUS_02920 7544 9034 gene locus_tag LOCUS_02930 gene guaB 7544 9034 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6F6 protein_id gnl|my_center|LOCUS_02930 9034 10347 gene locus_tag LOCUS_02940 9034 10347 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919493.1 protein_id gnl|my_center|LOCUS_02940 10678 10349 gene locus_tag LOCUS_02950 10678 10349 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224722.1 protein_id gnl|my_center|LOCUS_02950 11322 10684 gene locus_tag LOCUS_02960 11322 10684 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086779.1 protein_id gnl|my_center|LOCUS_02960 11535 12239 gene locus_tag LOCUS_02970 11535 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 12289 13854 gene locus_tag LOCUS_02980 gene guaA 12289 13854 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI5 protein_id gnl|my_center|LOCUS_02980 13903 14133 gene locus_tag LOCUS_02990 13903 14133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14130 14522 gene locus_tag LOCUS_03000 gene vapC12 14130 14522 CDS product ribonuclease VapC12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFA3 protein_id gnl|my_center|LOCUS_03000 15174 14584 gene locus_tag LOCUS_03010 15174 14584 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528197.1 protein_id gnl|my_center|LOCUS_03010 15425 15171 gene locus_tag LOCUS_03020 15425 15171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 15406 16188 gene locus_tag LOCUS_03030 15406 16188 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_03030 16393 18567 gene locus_tag LOCUS_03040 16393 18567 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence016 1540 650 gene locus_tag LOCUS_03050 1540 650 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919930.1 protein_id gnl|my_center|LOCUS_03050 1956 1588 gene locus_tag LOCUS_03060 gene csaA 1956 1588 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_03060 2207 1956 gene locus_tag LOCUS_03070 gene xseB 2207 1956 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXC6 protein_id gnl|my_center|LOCUS_03070 2849 2256 gene locus_tag LOCUS_03080 2849 2256 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919932.1 protein_id gnl|my_center|LOCUS_03080 3817 2900 gene locus_tag LOCUS_03090 3817 2900 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338742.1 protein_id gnl|my_center|LOCUS_03090 4303 3869 gene locus_tag LOCUS_03100 4303 3869 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529654.1 protein_id gnl|my_center|LOCUS_03100 4886 4455 gene locus_tag LOCUS_03110 4886 4455 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920328.1 protein_id gnl|my_center|LOCUS_03110 6093 4948 gene locus_tag LOCUS_03120 6093 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_03120 6200 6943 gene locus_tag LOCUS_03130 6200 6943 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531692.1 protein_id gnl|my_center|LOCUS_03130 6969 7430 gene locus_tag LOCUS_03140 6969 7430 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K24 protein_id gnl|my_center|LOCUS_03140 7427 8344 gene locus_tag LOCUS_03150 7427 8344 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_03150 8341 9279 gene locus_tag LOCUS_03160 8341 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_03160 9345 10307 gene locus_tag LOCUS_03170 gene pyrB 9345 10307 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QL5 protein_id gnl|my_center|LOCUS_03170 10304 11587 gene locus_tag LOCUS_03180 gene pyrC 10304 11587 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K3 protein_id gnl|my_center|LOCUS_03180 11592 12191 gene locus_tag LOCUS_03190 gene plsY 11592 12191 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF8 protein_id gnl|my_center|LOCUS_03190 12188 13309 gene locus_tag LOCUS_03200 gene dprA 12188 13309 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920305.1 protein_id gnl|my_center|LOCUS_03200 13501 13298 gene locus_tag LOCUS_03210 13501 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 13698 16325 gene locus_tag LOCUS_03220 gene topA 13698 16325 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA12 protein_id gnl|my_center|LOCUS_03220 >Feature sequence017 1227 556 gene locus_tag LOCUS_03230 1227 556 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 protein_id gnl|my_center|LOCUS_03230 1512 1291 gene locus_tag LOCUS_03240 1512 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 1756 3234 gene locus_tag LOCUS_03250 1756 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4010 3252 gene locus_tag LOCUS_03260 gene ubiG 4010 3252 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9X1 protein_id gnl|my_center|LOCUS_03260 5042 4203 gene locus_tag LOCUS_03270 5042 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 7511 5184 gene locus_tag LOCUS_03280 gene ptsP 7511 5184 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 protein_id gnl|my_center|LOCUS_03280 8797 7592 gene locus_tag LOCUS_03290 8797 7592 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6R1 protein_id gnl|my_center|LOCUS_03290 9330 10469 gene locus_tag LOCUS_03300 gene ispG 9330 10469 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9W0 protein_id gnl|my_center|LOCUS_03300 12644 10896 gene locus_tag LOCUS_03310 12644 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918940.1 protein_id gnl|my_center|LOCUS_03310 13559 12678 gene locus_tag LOCUS_03320 13559 12678 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_03320 14026 14694 gene locus_tag LOCUS_03330 14026 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 14723 15967 gene locus_tag LOCUS_03340 14723 15967 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_03340 15957 16676 gene locus_tag LOCUS_03350 15957 16676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_03350 16673 17893 gene locus_tag LOCUS_03360 16673 17893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence018 770 1102 gene locus_tag LOCUS_03370 770 1102 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 protein_id gnl|my_center|LOCUS_03370 2116 1103 gene locus_tag LOCUS_03380 2116 1103 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536759.1 protein_id gnl|my_center|LOCUS_03380 2789 2145 gene locus_tag LOCUS_03390 2789 2145 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8G0 protein_id gnl|my_center|LOCUS_03390 3146 2835 gene locus_tag LOCUS_03400 3146 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880524.1 protein_id gnl|my_center|LOCUS_03400 4152 3151 gene locus_tag LOCUS_03410 4152 3151 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_03410 5327 4179 gene locus_tag LOCUS_03420 gene hmgA 5327 4179 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_03420 6495 5461 gene locus_tag LOCUS_03430 6495 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7651 6575 gene locus_tag LOCUS_03440 gene ansA 7651 6575 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_03440 8671 7697 gene locus_tag LOCUS_03450 8671 7697 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_03450 9623 8829 gene locus_tag LOCUS_03460 9623 8829 CDS product P44/Msp2 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141205.1 protein_id gnl|my_center|LOCUS_03460 9818 10522 gene locus_tag LOCUS_03470 9818 10522 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640623.1 protein_id gnl|my_center|LOCUS_03470 10583 11668 gene locus_tag LOCUS_03480 10583 11668 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640051.1 protein_id gnl|my_center|LOCUS_03480 11746 13377 gene locus_tag LOCUS_03490 11746 13377 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880701.1 protein_id gnl|my_center|LOCUS_03490 14580 13378 gene locus_tag LOCUS_03500 14580 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 15224 14649 gene locus_tag LOCUS_03510 15224 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 15780 15271 gene locus_tag LOCUS_03520 15780 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 16264 15908 gene locus_tag LOCUS_03530 16264 15908 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_03530 17130 16276 gene locus_tag LOCUS_03540 17130 16276 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_03540 <17738 17141 gene locus_tag LOCUS_03550 <17738 17141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331455.1:sodium-independent anion transporter >Feature sequence019 474 1232 gene locus_tag LOCUS_03560 474 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1298 1822 gene locus_tag LOCUS_03570 1298 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105266.1 protein_id gnl|my_center|LOCUS_03570 2114 1857 gene locus_tag LOCUS_03580 2114 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2113 2676 gene locus_tag LOCUS_03590 2113 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3268 2684 gene locus_tag LOCUS_03600 3268 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 3951 3355 gene locus_tag LOCUS_03610 3951 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4097 5386 gene locus_tag LOCUS_03620 gene purA 4097 5386 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD8 protein_id gnl|my_center|LOCUS_03620 6689 5535 gene locus_tag LOCUS_03630 6689 5535 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 protein_id gnl|my_center|LOCUS_03630 7830 6748 gene locus_tag LOCUS_03640 7830 6748 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_03640 8367 7984 gene locus_tag LOCUS_03650 8367 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9068 8364 gene locus_tag LOCUS_03660 gene trmD 9068 8364 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C302 protein_id gnl|my_center|LOCUS_03660 9597 9073 gene locus_tag LOCUS_03670 gene rimM 9597 9073 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X39 protein_id gnl|my_center|LOCUS_03670 10045 9743 gene locus_tag LOCUS_03680 10045 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_03680 10697 10203 gene locus_tag LOCUS_03690 10697 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 12301 10727 gene locus_tag LOCUS_03700 gene ffh 12301 10727 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2B3 protein_id gnl|my_center|LOCUS_03700 14015 12603 gene locus_tag LOCUS_03710 14015 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970659.1 protein_id gnl|my_center|LOCUS_03710 14904 14113 gene locus_tag LOCUS_03720 14904 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776583.1 protein_id gnl|my_center|LOCUS_03720 15931 14897 gene locus_tag LOCUS_03730 15931 14897 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVR9 protein_id gnl|my_center|LOCUS_03730 16567 17520 gene locus_tag LOCUS_03740 gene gshB 16567 17520 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H2 protein_id gnl|my_center|LOCUS_03740 >Feature sequence020 <1 1325 gene locus_tag LOCUS_03750 <1 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918962.1:hybrid sensor histidine kinase/response regulator 1458 2546 gene locus_tag LOCUS_03760 gene recA 1458 2546 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9N5 protein_id gnl|my_center|LOCUS_03760 2660 5323 gene locus_tag LOCUS_03770 gene alaS 2660 5323 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5C1 protein_id gnl|my_center|LOCUS_03770 7592 5451 gene locus_tag LOCUS_03780 7592 5451 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920232.1 protein_id gnl|my_center|LOCUS_03780 9442 7589 gene locus_tag LOCUS_03790 9442 7589 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222825.1 protein_id gnl|my_center|LOCUS_03790 9743 9579 gene locus_tag LOCUS_03800 gene pilA 9743 9579 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920785.1 protein_id gnl|my_center|LOCUS_03800 10888 10094 gene locus_tag LOCUS_03810 10888 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 11883 10936 gene locus_tag LOCUS_03820 11883 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 12192 13871 gene locus_tag LOCUS_03830 12192 13871 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_03830 13895 14527 gene locus_tag LOCUS_03840 13895 14527 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 protein_id gnl|my_center|LOCUS_03840 14990 17536 gene locus_tag LOCUS_03850 14990 17536 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence021 5473 1415 gene locus_tag LOCUS_03860 5473 1415 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368629.1 protein_id gnl|my_center|LOCUS_03860 6225 5830 gene locus_tag LOCUS_03870 6225 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 6923 6237 gene locus_tag LOCUS_03880 6923 6237 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 protein_id gnl|my_center|LOCUS_03880 7127 7387 gene locus_tag LOCUS_03890 7127 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 9224 7353 gene locus_tag LOCUS_03900 9224 7353 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082897.1 protein_id gnl|my_center|LOCUS_03900 9996 9283 gene locus_tag LOCUS_03910 9996 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 10469 9996 gene locus_tag LOCUS_03920 10469 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 11135 11410 gene locus_tag LOCUS_03930 11135 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 11503 11787 gene locus_tag LOCUS_03940 11503 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 11883 12395 gene locus_tag LOCUS_03950 11883 12395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 12392 12754 gene locus_tag LOCUS_03960 12392 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 12741 13502 gene locus_tag LOCUS_03970 12741 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 13502 14764 gene locus_tag LOCUS_03980 gene traB 13502 14764 CDS product conjugative transfer factor, TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331475.1 protein_id gnl|my_center|LOCUS_03980 14779 15678 gene locus_tag LOCUS_03990 14779 15678 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689299.1 protein_id gnl|my_center|LOCUS_03990 15690 16067 gene locus_tag LOCUS_04000 15690 16067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence022 178 567 gene locus_tag LOCUS_04010 178 567 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067700.1 protein_id gnl|my_center|LOCUS_04010 1917 3626 gene locus_tag LOCUS_04020 1917 3626 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2H4 protein_id gnl|my_center|LOCUS_04020 3777 4061 gene locus_tag LOCUS_04030 gene ihfB 3777 4061 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C3 protein_id gnl|my_center|LOCUS_04030 4148 4564 gene locus_tag LOCUS_04040 gene mscL 4148 4564 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749E9 protein_id gnl|my_center|LOCUS_04040 4605 5249 gene locus_tag LOCUS_04050 gene trpF 4605 5249 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS6 protein_id gnl|my_center|LOCUS_04050 5410 6621 gene locus_tag LOCUS_04060 5410 6621 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0I4 protein_id gnl|my_center|LOCUS_04060 7753 6689 gene locus_tag LOCUS_04070 7753 6689 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 protein_id gnl|my_center|LOCUS_04070 8900 7755 gene locus_tag LOCUS_04080 8900 7755 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_04080 9280 9059 gene locus_tag LOCUS_04090 9280 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 9858 9277 gene locus_tag LOCUS_04100 9858 9277 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338458.1 protein_id gnl|my_center|LOCUS_04100 11102 9924 gene locus_tag LOCUS_04110 gene dinB1 11102 9924 CDS product DNA polymerase IV 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QM8 protein_id gnl|my_center|LOCUS_04110 12079 11171 gene locus_tag LOCUS_04120 12079 11171 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_04120 12245 12622 gene locus_tag LOCUS_04130 12245 12622 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920321.1 protein_id gnl|my_center|LOCUS_04130 12640 14001 gene locus_tag LOCUS_04140 gene pleD 12640 14001 CDS product response regulator PleD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I5 protein_id gnl|my_center|LOCUS_04140 14217 14050 gene locus_tag LOCUS_04150 gene rpmG 14217 14050 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4S1 protein_id gnl|my_center|LOCUS_04150 15851 14685 gene locus_tag LOCUS_04160 15851 14685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707651.1 protein_id gnl|my_center|LOCUS_04160 16493 15861 gene locus_tag LOCUS_04170 16493 15861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence023 26 730 gene locus_tag LOCUS_04180 26 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 727 1785 gene locus_tag LOCUS_04190 727 1785 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975333.1 protein_id gnl|my_center|LOCUS_04190 3894 2164 gene locus_tag LOCUS_04200 3894 2164 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918419.1 protein_id gnl|my_center|LOCUS_04200 4916 3963 gene locus_tag LOCUS_04210 4916 3963 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919001.1 protein_id gnl|my_center|LOCUS_04210 5268 7658 gene locus_tag LOCUS_04220 5268 7658 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_04220 7775 8755 gene locus_tag LOCUS_04230 7775 8755 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708061.1 protein_id gnl|my_center|LOCUS_04230 8989 9282 gene locus_tag LOCUS_04240 8989 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 9417 10925 gene locus_tag LOCUS_04250 9417 10925 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_04250 11155 12162 gene locus_tag LOCUS_04260 gene argF' 11155 12162 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 protein_id gnl|my_center|LOCUS_04260 12159 13514 gene locus_tag LOCUS_04270 gene argB 12159 13514 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J6 protein_id gnl|my_center|LOCUS_04270 13519 14460 gene locus_tag LOCUS_04280 gene argC 13519 14460 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J8 protein_id gnl|my_center|LOCUS_04280 14553 15185 gene locus_tag LOCUS_04290 gene msrA 14553 15185 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_04290 >Feature sequence024 1915 1526 gene locus_tag LOCUS_04300 1915 1526 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP9 protein_id gnl|my_center|LOCUS_04300 2184 1912 gene locus_tag LOCUS_04310 2184 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 2096 3403 gene locus_tag LOCUS_04320 2096 3403 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391441.1 protein_id gnl|my_center|LOCUS_04320 4555 3404 gene locus_tag LOCUS_04330 4555 3404 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 protein_id gnl|my_center|LOCUS_04330 5175 4552 gene locus_tag LOCUS_04340 5175 4552 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_04340 5587 6138 gene locus_tag LOCUS_04350 5587 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639889.1 protein_id gnl|my_center|LOCUS_04350 6151 6387 gene locus_tag LOCUS_04360 6151 6387 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_04360 7249 6500 gene locus_tag LOCUS_04370 7249 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7457 8017 gene locus_tag LOCUS_04380 7457 8017 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_04380 8040 8903 gene locus_tag LOCUS_04390 8040 8903 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921556.1 protein_id gnl|my_center|LOCUS_04390 8914 9504 gene locus_tag LOCUS_04400 8914 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 9556 10002 gene locus_tag LOCUS_04410 9556 10002 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_04410 10074 10391 gene locus_tag LOCUS_04420 10074 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 11603 10413 gene locus_tag LOCUS_04430 11603 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 12354 11632 gene locus_tag LOCUS_04440 gene rph 12354 11632 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP2 protein_id gnl|my_center|LOCUS_04440 12494 13564 gene locus_tag LOCUS_04450 gene hrcA 12494 13564 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP3 protein_id gnl|my_center|LOCUS_04450 13621 14283 gene locus_tag LOCUS_04460 gene grpE 13621 14283 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCN8 protein_id gnl|my_center|LOCUS_04460 14722 14351 gene locus_tag LOCUS_04470 14722 14351 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923312.1 protein_id gnl|my_center|LOCUS_04470 15225 14872 gene locus_tag LOCUS_04480 15225 14872 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923312.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence025 409 960 gene locus_tag LOCUS_04490 409 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 957 1331 gene locus_tag LOCUS_04500 957 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1807 1328 gene locus_tag LOCUS_04510 1807 1328 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059855.1 protein_id gnl|my_center|LOCUS_04510 2491 1898 gene locus_tag LOCUS_04520 gene rplI 2491 1898 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ0 protein_id gnl|my_center|LOCUS_04520 2760 2503 gene locus_tag LOCUS_04530 gene rpsR 2760 2503 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9B0 protein_id gnl|my_center|LOCUS_04530 3123 2773 gene locus_tag LOCUS_04540 3123 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 3599 3300 gene locus_tag LOCUS_04550 3599 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3855 3586 gene locus_tag LOCUS_04560 3855 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 4007 4258 gene locus_tag LOCUS_04570 4007 4258 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527850.1 protein_id gnl|my_center|LOCUS_04570 4251 4541 gene locus_tag LOCUS_04580 gene parE1 4251 4541 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9T8 protein_id gnl|my_center|LOCUS_04580 4626 5579 gene locus_tag LOCUS_04590 4626 5579 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C853 protein_id gnl|my_center|LOCUS_04590 5581 6318 gene locus_tag LOCUS_04600 5581 6318 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_04600 6518 6754 gene locus_tag LOCUS_04610 gene acpP 6518 6754 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7P3 protein_id gnl|my_center|LOCUS_04610 6769 8058 gene locus_tag LOCUS_04620 6769 8058 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA77 protein_id gnl|my_center|LOCUS_04620 8084 9154 gene locus_tag LOCUS_04630 8084 9154 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 protein_id gnl|my_center|LOCUS_04630 9157 10047 gene locus_tag LOCUS_04640 9157 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919551.1 protein_id gnl|my_center|LOCUS_04640 10106 10711 gene locus_tag LOCUS_04650 gene gmk 10106 10711 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2A5 protein_id gnl|my_center|LOCUS_04650 11578 10715 gene locus_tag LOCUS_04660 gene rsmA 11578 10715 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2B9 protein_id gnl|my_center|LOCUS_04660 12558 11575 gene locus_tag LOCUS_04670 gene pdxA 12558 11575 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8R1 protein_id gnl|my_center|LOCUS_04670 13811 12558 gene locus_tag LOCUS_04680 13811 12558 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8Y4 protein_id gnl|my_center|LOCUS_04680 14990 13896 gene locus_tag LOCUS_04690 14990 13896 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919560.1 protein_id gnl|my_center|LOCUS_04690 <15849 14987 gene locus_tag LOCUS_04700 <15849 14987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919561.1:LPS export ABC transporter permease LptF >Feature sequence026 2046 2243 gene locus_tag LOCUS_04710 2046 2243 CDS product antitoxin VapB32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_04710 2240 2608 gene locus_tag LOCUS_04720 gene vapC 2240 2608 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W1H7 protein_id gnl|my_center|LOCUS_04720 3408 2605 gene locus_tag LOCUS_04730 3408 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082993.1 protein_id gnl|my_center|LOCUS_04730 3383 3928 gene locus_tag LOCUS_04740 3383 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4042 5733 gene locus_tag LOCUS_04750 4042 5733 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918544.1 protein_id gnl|my_center|LOCUS_04750 7675 5741 gene locus_tag LOCUS_04760 7675 5741 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_04760 7812 8078 gene locus_tag LOCUS_04770 7812 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 8075 8455 gene locus_tag LOCUS_04780 8075 8455 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_04780 9454 8459 gene locus_tag LOCUS_04790 9454 8459 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529367.1 protein_id gnl|my_center|LOCUS_04790 10209 9547 gene locus_tag LOCUS_04800 10209 9547 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_04800 10227 10496 gene locus_tag LOCUS_04810 10227 10496 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 protein_id gnl|my_center|LOCUS_04810 11795 10653 gene locus_tag LOCUS_04820 11795 10653 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_04820 12820 11795 gene locus_tag LOCUS_04830 gene asd 12820 11795 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X21 protein_id gnl|my_center|LOCUS_04830 13964 12996 gene locus_tag LOCUS_04840 gene mdh 13964 12996 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2B1 protein_id gnl|my_center|LOCUS_04840 15173 14085 gene locus_tag LOCUS_04850 15173 14085 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence027 <1 764 gene locus_tag LOCUS_04860 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A3J2:protein ImuB 761 4030 gene locus_tag LOCUS_04870 gene dnaE2 761 4030 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3J3 protein_id gnl|my_center|LOCUS_04870 4442 4038 gene locus_tag LOCUS_04880 4442 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4870 4442 gene locus_tag LOCUS_04890 4870 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6120 4876 gene locus_tag LOCUS_04900 6120 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531999.1 protein_id gnl|my_center|LOCUS_04900 6341 7360 gene locus_tag LOCUS_04910 6341 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 7360 7902 gene locus_tag LOCUS_04920 7360 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 8476 7907 gene locus_tag LOCUS_04930 8476 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 9935 8532 gene locus_tag LOCUS_04940 9935 8532 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_04940 11255 10077 gene locus_tag LOCUS_04950 11255 10077 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 protein_id gnl|my_center|LOCUS_04950 12427 11267 gene locus_tag LOCUS_04960 12427 11267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228946.1 protein_id gnl|my_center|LOCUS_04960 13122 12427 gene locus_tag LOCUS_04970 gene tptC 13122 12427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_04970 14234 13167 gene locus_tag LOCUS_04980 14234 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 15301 14456 gene locus_tag LOCUS_04990 15301 14456 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence028 1421 1110 gene locus_tag LOCUS_05000 1421 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1857 1441 gene locus_tag LOCUS_05010 gene flgC 1857 1441 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I26 protein_id gnl|my_center|LOCUS_05010 2298 1879 gene locus_tag LOCUS_05020 gene flgB 2298 1879 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6X7 protein_id gnl|my_center|LOCUS_05020 2430 2807 gene locus_tag LOCUS_05030 2430 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 2807 3577 gene locus_tag LOCUS_05040 gene fliP 2807 3577 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45980 protein_id gnl|my_center|LOCUS_05040 3631 4272 gene locus_tag LOCUS_05050 3631 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5949 4297 gene locus_tag LOCUS_05060 5949 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265680.1 protein_id gnl|my_center|LOCUS_05060 6508 6020 gene locus_tag LOCUS_05070 6508 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 6629 7264 gene locus_tag LOCUS_05080 6629 7264 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_05080 7908 7642 gene locus_tag LOCUS_05090 7908 7642 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529822.1 protein_id gnl|my_center|LOCUS_05090 8063 8329 gene locus_tag LOCUS_05100 8063 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 8338 8754 gene locus_tag LOCUS_05110 8338 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 8751 8954 gene locus_tag LOCUS_05120 8751 8954 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_05120 9034 10629 gene locus_tag LOCUS_05130 gene lysS 9034 10629 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C6 protein_id gnl|my_center|LOCUS_05130 10646 11470 gene locus_tag LOCUS_05140 10646 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 11550 12008 gene locus_tag LOCUS_05150 11550 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223906.1 protein_id gnl|my_center|LOCUS_05150 12011 12229 gene locus_tag LOCUS_05160 12011 12229 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_05160 13028 12402 gene locus_tag LOCUS_05170 13028 12402 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974351.1 protein_id gnl|my_center|LOCUS_05170 13139 13486 gene locus_tag LOCUS_05180 13139 13486 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083958.1 protein_id gnl|my_center|LOCUS_05180 13486 14523 gene locus_tag LOCUS_05190 13486 14523 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C744 protein_id gnl|my_center|LOCUS_05190 <15290 14484 gene locus_tag LOCUS_05200 <15290 14484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533618.1:MATE family efflux transporter >Feature sequence029 2255 102 gene locus_tag LOCUS_05210 gene lptD 2255 102 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA88 protein_id gnl|my_center|LOCUS_05210 2488 4308 gene locus_tag LOCUS_05220 gene glmS 2488 4308 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC54 protein_id gnl|my_center|LOCUS_05220 4331 5209 gene locus_tag LOCUS_05230 4331 5209 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923328.1 protein_id gnl|my_center|LOCUS_05230 5913 5416 gene locus_tag LOCUS_05240 5913 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 6077 5910 gene locus_tag LOCUS_05250 6077 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 6628 6552 gene locus_tag LOCUS_t00050 6628 6552 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6869 7648 gene locus_tag LOCUS_05260 6869 7648 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_05260 8488 7658 gene locus_tag LOCUS_05270 8488 7658 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265598.1 protein_id gnl|my_center|LOCUS_05270 9096 8488 gene locus_tag LOCUS_05280 9096 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921520.1 protein_id gnl|my_center|LOCUS_05280 9868 9146 gene locus_tag LOCUS_05290 9868 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 10043 10933 gene locus_tag LOCUS_05300 10043 10933 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A8 protein_id gnl|my_center|LOCUS_05300 10937 12007 gene locus_tag LOCUS_05310 10937 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05310 12011 14698 gene locus_tag LOCUS_05320 12011 14698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05320 <15285 14650 gene locus_tag LOCUS_05330 <15285 14650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923352.1:thiamine biosynthesis protein ThiF >Feature sequence030 <1 1176 gene locus_tag LOCUS_05340 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331477.1:conjugal transfer protein TraC 1180 1467 gene locus_tag LOCUS_05350 1180 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1449 1886 gene locus_tag LOCUS_05360 1449 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 1886 2365 gene locus_tag LOCUS_05370 1886 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 2373 2903 gene locus_tag LOCUS_05380 2373 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2903 3556 gene locus_tag LOCUS_05390 gene traW 2903 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331481.1 protein_id gnl|my_center|LOCUS_05390 3553 4569 gene locus_tag LOCUS_05400 gene traU 3553 4569 CDS product conjugal transfer protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947798.1 protein_id gnl|my_center|LOCUS_05400 4539 5219 gene locus_tag LOCUS_05410 4539 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5277 5522 gene locus_tag LOCUS_05420 5277 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 5522 5917 gene locus_tag LOCUS_05430 gene vapC 5522 5917 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5B9 protein_id gnl|my_center|LOCUS_05430 6186 5938 gene locus_tag LOCUS_05440 6186 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 6641 6183 gene locus_tag LOCUS_05450 6641 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 6775 6647 gene locus_tag LOCUS_05460 6775 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 8002 7565 gene locus_tag LOCUS_05470 gene nsrR 8002 7565 CDS product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 protein_id gnl|my_center|LOCUS_05470 8661 8200 gene locus_tag LOCUS_05480 8661 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8709 9098 gene locus_tag LOCUS_05490 8709 9098 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084495.1 protein_id gnl|my_center|LOCUS_05490 9104 9463 gene locus_tag LOCUS_05500 9104 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05500 9536 10099 gene locus_tag LOCUS_05510 9536 10099 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533377.1 protein_id gnl|my_center|LOCUS_05510 13382 10263 gene locus_tag LOCUS_05520 gene czcA 13382 10263 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_05520 14541 13396 gene locus_tag LOCUS_05530 14541 13396 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269235.1 protein_id gnl|my_center|LOCUS_05530 <15130 14538 gene locus_tag LOCUS_05540 <15130 14538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205515.1:cobalt-zinc-cadmium resistance protein >Feature sequence031 884 396 gene locus_tag LOCUS_05550 884 396 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 protein_id gnl|my_center|LOCUS_05550 1022 3052 gene locus_tag LOCUS_05560 1022 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3299 6442 gene locus_tag LOCUS_05570 gene podJ 3299 6442 CDS product localization factor PodJL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXA0 protein_id gnl|my_center|LOCUS_05570 6452 7393 gene locus_tag LOCUS_05580 6452 7393 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_05580 7390 8193 gene locus_tag LOCUS_05590 7390 8193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968644.1 protein_id gnl|my_center|LOCUS_05590 8204 8686 gene locus_tag LOCUS_05600 8204 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 8795 9472 gene locus_tag LOCUS_05610 8795 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 10170 9469 gene locus_tag LOCUS_05620 10170 9469 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083968.1 protein_id gnl|my_center|LOCUS_05620 10841 10203 gene locus_tag LOCUS_05630 10841 10203 CDS product streptogramin A acetyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528498.1 protein_id gnl|my_center|LOCUS_05630 13468 10976 gene locus_tag LOCUS_05640 13468 10976 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706760.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence032 <1 1053 gene locus_tag LOCUS_05650 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A238:ATP-dependent protease ATPase subunit HslU 1652 1149 gene locus_tag LOCUS_05660 1652 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 protein_id gnl|my_center|LOCUS_05660 1770 2456 gene locus_tag LOCUS_05670 gene cenR 1770 2456 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266002.1 protein_id gnl|my_center|LOCUS_05670 3261 2470 gene locus_tag LOCUS_05680 3261 2470 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_05680 3427 3981 gene locus_tag LOCUS_05690 3427 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4407 3988 gene locus_tag LOCUS_05700 4407 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 4635 4559 gene locus_tag LOCUS_t00060 4635 4559 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5581 4721 gene locus_tag LOCUS_05710 5581 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5864 8650 gene locus_tag LOCUS_05720 5864 8650 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_05720 8766 9128 gene locus_tag LOCUS_05730 8766 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 9198 9851 gene locus_tag LOCUS_05740 9198 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 9883 10257 gene locus_tag LOCUS_05750 9883 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 10257 10637 gene locus_tag LOCUS_05760 10257 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 10805 11530 gene locus_tag LOCUS_05770 10805 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 12430 11537 gene locus_tag LOCUS_05780 12430 11537 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529172.1 protein_id gnl|my_center|LOCUS_05780 13153 12635 gene locus_tag LOCUS_05790 13153 12635 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918539.1 protein_id gnl|my_center|LOCUS_05790 13733 13392 gene locus_tag LOCUS_05800 13733 13392 CDS product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918540.1 protein_id gnl|my_center|LOCUS_05800 14124 13813 gene locus_tag LOCUS_05810 14124 13813 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918542.1 protein_id gnl|my_center|LOCUS_05810 <14811 14121 gene locus_tag LOCUS_05820 <14811 14121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383620.1:disulfide oxidoreductase >Feature sequence033 85 693 gene locus_tag LOCUS_05830 gene tlpA 85 693 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 protein_id gnl|my_center|LOCUS_05830 1440 925 gene locus_tag LOCUS_05840 1440 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531009.1 protein_id gnl|my_center|LOCUS_05840 1632 2129 gene locus_tag LOCUS_05850 1632 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2654 2178 gene locus_tag LOCUS_05860 2654 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3707 2766 gene locus_tag LOCUS_05870 3707 2766 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918612.1 protein_id gnl|my_center|LOCUS_05870 4534 3710 gene locus_tag LOCUS_05880 4534 3710 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918613.1 protein_id gnl|my_center|LOCUS_05880 5355 4753 gene locus_tag LOCUS_05890 5355 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947374.1 protein_id gnl|my_center|LOCUS_05890 5536 5847 gene locus_tag LOCUS_05900 5536 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5844 6263 gene locus_tag LOCUS_05910 5844 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 6877 6305 gene locus_tag LOCUS_05920 6877 6305 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709194.1 protein_id gnl|my_center|LOCUS_05920 6978 8048 gene locus_tag LOCUS_05930 6978 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 8251 8045 gene locus_tag LOCUS_05940 8251 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265605.1 protein_id gnl|my_center|LOCUS_05940 8470 9096 gene locus_tag LOCUS_05950 8470 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9961 9071 gene locus_tag LOCUS_05960 9961 9071 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066636.1 protein_id gnl|my_center|LOCUS_05960 10925 10014 gene locus_tag LOCUS_05970 10925 10014 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640436.1 protein_id gnl|my_center|LOCUS_05970 11039 11713 gene locus_tag LOCUS_05980 11039 11713 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_05980 11984 12553 gene locus_tag LOCUS_05990 11984 12553 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 protein_id gnl|my_center|LOCUS_05990 13890 12550 gene locus_tag LOCUS_06000 13890 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 <14641 13947 gene locus_tag LOCUS_06010 <14641 13947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139976.1:membrane protein >Feature sequence034 1019 147 gene locus_tag LOCUS_06020 1019 147 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_06020 1853 1062 gene locus_tag LOCUS_06030 1853 1062 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 protein_id gnl|my_center|LOCUS_06030 2179 1850 gene locus_tag LOCUS_06040 2179 1850 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_06040 2481 2176 gene locus_tag LOCUS_06050 2481 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2541 2924 gene locus_tag LOCUS_06060 2541 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265546.1 protein_id gnl|my_center|LOCUS_06060 5187 3403 gene locus_tag LOCUS_06070 5187 3403 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921222.1 protein_id gnl|my_center|LOCUS_06070 5438 6034 gene locus_tag LOCUS_06080 5438 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228210.1 protein_id gnl|my_center|LOCUS_06080 6041 6625 gene locus_tag LOCUS_06090 6041 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6661 7206 gene locus_tag LOCUS_06100 6661 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 7924 7358 gene locus_tag LOCUS_06110 7924 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 7986 9038 gene locus_tag LOCUS_06120 gene mutY 7986 9038 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971157.1 protein_id gnl|my_center|LOCUS_06120 10198 9167 gene locus_tag LOCUS_06130 10198 9167 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 protein_id gnl|my_center|LOCUS_06130 10911 10324 gene locus_tag LOCUS_06140 gene rnhB 10911 10324 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_06140 12227 11124 gene locus_tag LOCUS_06150 12227 11124 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_06150 12295 13026 gene locus_tag LOCUS_06160 12295 13026 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_06160 13023 13592 gene locus_tag LOCUS_06170 13023 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_06170 14383 13589 gene locus_tag LOCUS_06180 14383 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence035 964 74 gene locus_tag LOCUS_06190 964 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_06190 1109 2788 gene locus_tag LOCUS_06200 1109 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2942 2811 gene locus_tag LOCUS_06210 2942 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3613 3056 gene locus_tag LOCUS_06220 3613 3056 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968500.1 protein_id gnl|my_center|LOCUS_06220 3571 3840 gene locus_tag LOCUS_06230 3571 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3843 4730 gene locus_tag LOCUS_06240 gene rpoH 3843 4730 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW9 protein_id gnl|my_center|LOCUS_06240 5113 4727 gene locus_tag LOCUS_06250 5113 4727 CDS product VapC ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64774 protein_id gnl|my_center|LOCUS_06250 5343 5110 gene locus_tag LOCUS_06260 5343 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 6116 5397 gene locus_tag LOCUS_06270 6116 5397 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600787.1 protein_id gnl|my_center|LOCUS_06270 6248 7309 gene locus_tag LOCUS_06280 6248 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 8666 7320 gene locus_tag LOCUS_06290 8666 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9624 8791 gene locus_tag LOCUS_06300 9624 8791 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_06300 10175 9621 gene locus_tag LOCUS_06310 10175 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 11876 10278 gene locus_tag LOCUS_06320 11876 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 13747 12689 gene locus_tag LOCUS_06330 13747 12689 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4U9 protein_id gnl|my_center|LOCUS_06330 >Feature sequence036 3526 1583 gene locus_tag LOCUS_06340 3526 1583 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_06340 3735 3953 gene locus_tag LOCUS_06350 3735 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3919 4224 gene locus_tag LOCUS_06360 3919 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 4351 5583 gene locus_tag LOCUS_06370 4351 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 5593 6774 gene locus_tag LOCUS_06380 5593 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6863 7354 gene locus_tag LOCUS_06390 6863 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 8811 7351 gene locus_tag LOCUS_06400 8811 7351 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389995.1 protein_id gnl|my_center|LOCUS_06400 9158 8808 gene locus_tag LOCUS_06410 9158 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 9402 9983 gene locus_tag LOCUS_06420 9402 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 11111 10158 gene locus_tag LOCUS_06430 gene htpX 11111 10158 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H051 protein_id gnl|my_center|LOCUS_06430 11227 11385 gene locus_tag LOCUS_06440 11227 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 12071 12532 gene locus_tag LOCUS_06450 12071 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 12807 12505 gene locus_tag LOCUS_06460 12807 12505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 <14102 12900 gene locus_tag LOCUS_06470 <14102 12900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921370.1:bifunctional folylpolyglutamate synthase/dihydrofolate synthase >Feature sequence037 <1 2477 gene locus_tag LOCUS_06480 <1 2477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404296.1:peptidase M14 3133 2504 gene locus_tag LOCUS_06490 gene hisI 3133 2504 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N8 protein_id gnl|my_center|LOCUS_06490 3897 3130 gene locus_tag LOCUS_06500 gene hisF 3897 3130 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N9 protein_id gnl|my_center|LOCUS_06500 4613 3891 gene locus_tag LOCUS_06510 gene hisA 4613 3891 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QK7 protein_id gnl|my_center|LOCUS_06510 5225 4617 gene locus_tag LOCUS_06520 gene hisH 5225 4617 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSX0 protein_id gnl|my_center|LOCUS_06520 5470 5222 gene locus_tag LOCUS_06530 5470 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 6678 5470 gene locus_tag LOCUS_06540 6678 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 7993 6680 gene locus_tag LOCUS_06550 gene hisD 7993 6680 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKB8 protein_id gnl|my_center|LOCUS_06550 8877 7993 gene locus_tag LOCUS_06560 gene hisG 8877 7993 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5K1 protein_id gnl|my_center|LOCUS_06560 9179 8874 gene locus_tag LOCUS_06570 9179 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 10263 10078 gene locus_tag LOCUS_06580 10263 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 10564 11061 gene locus_tag LOCUS_06590 10564 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919756.1 protein_id gnl|my_center|LOCUS_06590 11123 12316 gene locus_tag LOCUS_06600 11123 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 12319 12855 gene locus_tag LOCUS_06610 12319 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 <13968 12924 gene locus_tag LOCUS_06620 <13968 12924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92QV4:aspartate--tRNA(Asp/Asn) ligase >Feature sequence038 534 73 gene locus_tag LOCUS_06630 gene mmcB 534 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 protein_id gnl|my_center|LOCUS_06630 626 1036 gene locus_tag LOCUS_06640 626 1036 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265965.1 protein_id gnl|my_center|LOCUS_06640 1758 1045 gene locus_tag LOCUS_06650 gene cobB 1758 1045 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2S6 protein_id gnl|my_center|LOCUS_06650 2324 1755 gene locus_tag LOCUS_06660 2324 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3766 2363 gene locus_tag LOCUS_06670 3766 2363 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB89 protein_id gnl|my_center|LOCUS_06670 3984 4502 gene locus_tag LOCUS_06680 3984 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 6072 4507 gene locus_tag LOCUS_06690 gene sucB 6072 4507 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 protein_id gnl|my_center|LOCUS_06690 9089 6105 gene locus_tag LOCUS_06700 gene odhA 9089 6105 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918228.1 protein_id gnl|my_center|LOCUS_06700 9433 10644 gene locus_tag LOCUS_06710 9433 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 11564 10656 gene locus_tag LOCUS_06720 gene sucD 11564 10656 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LJ5 protein_id gnl|my_center|LOCUS_06720 12001 11582 gene locus_tag LOCUS_06730 12001 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 12266 11982 gene locus_tag LOCUS_06740 12266 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 12921 12322 gene locus_tag LOCUS_06750 12921 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 <13944 13145 gene locus_tag LOCUS_06760 <13944 13145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9EYG9:succinate--CoA ligase [ADP-forming] subunit beta >Feature sequence039 2990 882 gene locus_tag LOCUS_06770 gene flhA 2990 882 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918794.1 protein_id gnl|my_center|LOCUS_06770 4453 3092 gene locus_tag LOCUS_06780 gene flbD 4453 3092 CDS product transcriptional regulatory protein FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17899 protein_id gnl|my_center|LOCUS_06780 4866 4495 gene locus_tag LOCUS_06790 gene fliN 4866 4495 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03593 protein_id gnl|my_center|LOCUS_06790 5533 4859 gene locus_tag LOCUS_06800 5533 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6578 5544 gene locus_tag LOCUS_06810 gene fliG 6578 5544 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6V1 protein_id gnl|my_center|LOCUS_06810 8186 6582 gene locus_tag LOCUS_06820 gene fliF 8186 6582 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6R7 protein_id gnl|my_center|LOCUS_06820 8910 8638 gene locus_tag LOCUS_06830 8910 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527546.1 protein_id gnl|my_center|LOCUS_06830 10664 9270 gene locus_tag LOCUS_06840 10664 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 11494 10739 gene locus_tag LOCUS_06850 11494 10739 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ4 protein_id gnl|my_center|LOCUS_06850 13283 11499 gene locus_tag LOCUS_06860 13283 11499 CDS product flagellar hook-length control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388306.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence040 823 107 gene locus_tag LOCUS_06870 823 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 906 1931 gene locus_tag LOCUS_06880 906 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143497.1 protein_id gnl|my_center|LOCUS_06880 1928 3463 gene locus_tag LOCUS_06890 1928 3463 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX68 protein_id gnl|my_center|LOCUS_06890 3869 3630 gene locus_tag LOCUS_06900 3869 3630 CDS product HTH transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265840.1 protein_id gnl|my_center|LOCUS_06900 4145 5050 gene locus_tag LOCUS_06910 4145 5050 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106385.1 protein_id gnl|my_center|LOCUS_06910 5181 5495 gene locus_tag LOCUS_06920 5181 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6974 6123 gene locus_tag LOCUS_06930 6974 6123 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084850.1 protein_id gnl|my_center|LOCUS_06930 7273 7010 gene locus_tag LOCUS_06940 7273 7010 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970544.1 protein_id gnl|my_center|LOCUS_06940 7640 8074 gene locus_tag LOCUS_06950 7640 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 8150 8389 gene locus_tag LOCUS_06960 8150 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 8449 8931 gene locus_tag LOCUS_06970 8449 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 9030 9503 gene locus_tag LOCUS_06980 9030 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 9660 10007 gene locus_tag LOCUS_06990 9660 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 10135 10608 gene locus_tag LOCUS_07000 10135 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 10949 11503 gene locus_tag LOCUS_07010 10949 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 12683 13579 gene locus_tag LOCUS_07020 12683 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887141.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence041 1557 211 gene locus_tag LOCUS_07030 gene gcvPA 1557 211 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A353 protein_id gnl|my_center|LOCUS_07030 1957 1592 gene locus_tag LOCUS_07040 gene gcvH 1957 1592 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I87 protein_id gnl|my_center|LOCUS_07040 3098 1989 gene locus_tag LOCUS_07050 3098 1989 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A351 protein_id gnl|my_center|LOCUS_07050 5220 3457 gene locus_tag LOCUS_07060 gene argS 5220 3457 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A347 protein_id gnl|my_center|LOCUS_07060 5797 5234 gene locus_tag LOCUS_07070 5797 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 5953 6888 gene locus_tag LOCUS_07080 gene ispH 5953 6888 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC9 protein_id gnl|my_center|LOCUS_07080 6888 7316 gene locus_tag LOCUS_07090 6888 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 7313 7774 gene locus_tag LOCUS_07100 gene rnhA 7313 7774 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T805 protein_id gnl|my_center|LOCUS_07100 7836 9134 gene locus_tag LOCUS_07110 gene purB 7836 9134 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4A7 protein_id gnl|my_center|LOCUS_07110 9763 9170 gene locus_tag LOCUS_07120 9763 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088532.1 protein_id gnl|my_center|LOCUS_07120 9925 10434 gene locus_tag LOCUS_07130 9925 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 10751 10431 gene locus_tag LOCUS_07140 10751 10431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530104.1 protein_id gnl|my_center|LOCUS_07140 11015 11797 gene locus_tag LOCUS_07150 gene purC1 11015 11797 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5F9 protein_id gnl|my_center|LOCUS_07150 11811 12053 gene locus_tag LOCUS_07160 gene purS 11811 12053 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_07160 12441 12058 gene locus_tag LOCUS_07170 12441 12058 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_07170 12587 13252 gene locus_tag LOCUS_07180 gene purQ 12587 13252 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9G6 protein_id gnl|my_center|LOCUS_07180 >Feature sequence042 <1 1248 gene locus_tag LOCUS_07190 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C7A8:replicative DNA helicase 1271 2305 gene locus_tag LOCUS_07200 1271 2305 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C843 protein_id gnl|my_center|LOCUS_07200 2302 3075 gene locus_tag LOCUS_07210 2302 3075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921522.1 protein_id gnl|my_center|LOCUS_07210 3087 3833 gene locus_tag LOCUS_07220 3087 3833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921523.1 protein_id gnl|my_center|LOCUS_07220 3857 5227 gene locus_tag LOCUS_07230 gene radA 3857 5227 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R0 protein_id gnl|my_center|LOCUS_07230 5238 5831 gene locus_tag LOCUS_07240 5238 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 5852 7330 gene locus_tag LOCUS_07250 gene purF 5852 7330 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R2 protein_id gnl|my_center|LOCUS_07250 7327 8043 gene locus_tag LOCUS_07260 7327 8043 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 protein_id gnl|my_center|LOCUS_07260 9673 8309 gene locus_tag LOCUS_07270 9673 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 11112 9697 gene locus_tag LOCUS_07280 11112 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 11867 11109 gene locus_tag LOCUS_07290 11867 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919525.1 protein_id gnl|my_center|LOCUS_07290 12778 11951 gene locus_tag LOCUS_07300 gene panB 12778 11951 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R9 protein_id gnl|my_center|LOCUS_07300 13185 12847 gene locus_tag LOCUS_07310 13185 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence043 1730 2278 gene locus_tag LOCUS_07320 1730 2278 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 protein_id gnl|my_center|LOCUS_07320 2436 3524 gene locus_tag LOCUS_07330 2436 3524 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073563.1 protein_id gnl|my_center|LOCUS_07330 3672 6095 gene locus_tag LOCUS_07340 gene bfeA 3672 6095 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_07340 6336 6247 gene locus_tag LOCUS_t00070 6336 6247 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6526 7017 gene locus_tag LOCUS_07350 6526 7017 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920110.1 protein_id gnl|my_center|LOCUS_07350 7125 7673 gene locus_tag LOCUS_07360 7125 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 7767 8912 gene locus_tag LOCUS_07370 7767 8912 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_07370 8921 9553 gene locus_tag LOCUS_07380 gene tmk 8921 9553 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ9 protein_id gnl|my_center|LOCUS_07380 9553 10596 gene locus_tag LOCUS_07390 9553 10596 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919689.1 protein_id gnl|my_center|LOCUS_07390 10617 11405 gene locus_tag LOCUS_07400 10617 11405 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919688.1 protein_id gnl|my_center|LOCUS_07400 11402 12262 gene locus_tag LOCUS_07410 11402 12262 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919687.1 protein_id gnl|my_center|LOCUS_07410 12331 12822 gene locus_tag LOCUS_07420 12331 12822 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence044 790 116 gene locus_tag LOCUS_07430 790 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2914 2838 gene locus_tag LOCUS_t00080 2914 2838 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3838 3020 gene locus_tag LOCUS_07440 3838 3020 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918762.1 protein_id gnl|my_center|LOCUS_07440 3998 5989 gene locus_tag LOCUS_07450 gene amsA 3998 5989 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337150.1 protein_id gnl|my_center|LOCUS_07450 6102 7874 gene locus_tag LOCUS_07460 6102 7874 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_07460 7969 8937 gene locus_tag LOCUS_07470 7969 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 9034 9918 gene locus_tag LOCUS_07480 9034 9918 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_07480 10119 9925 gene locus_tag LOCUS_07490 10119 9925 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889079.1 protein_id gnl|my_center|LOCUS_07490 10537 10133 gene locus_tag LOCUS_07500 10537 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 11438 10554 gene locus_tag LOCUS_07510 11438 10554 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 protein_id gnl|my_center|LOCUS_07510 12554 11589 gene locus_tag LOCUS_07520 12554 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence045 2 892 gene locus_tag LOCUS_07530 2 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1051 1179 gene locus_tag LOCUS_07540 1051 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 1277 1405 gene locus_tag LOCUS_07550 1277 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1800 1486 gene locus_tag LOCUS_07560 1800 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2267 1947 gene locus_tag LOCUS_07570 2267 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2608 2456 gene locus_tag LOCUS_07580 2608 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 2598 3611 gene locus_tag LOCUS_07590 gene yrbG 2598 3611 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07590 3825 3619 gene locus_tag LOCUS_07600 3825 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4704 3832 gene locus_tag LOCUS_07610 4704 3832 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_07610 5180 4701 gene locus_tag LOCUS_07620 5180 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071754.1 protein_id gnl|my_center|LOCUS_07620 6352 5255 gene locus_tag LOCUS_07630 gene ychF 6352 5255 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DK0 protein_id gnl|my_center|LOCUS_07630 6827 6438 gene locus_tag LOCUS_07640 6827 6438 CDS product VapC ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67243 protein_id gnl|my_center|LOCUS_07640 7075 6824 gene locus_tag LOCUS_07650 7075 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 7744 7145 gene locus_tag LOCUS_07660 gene pth 7744 7145 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV9 protein_id gnl|my_center|LOCUS_07660 8508 7870 gene locus_tag LOCUS_07670 gene rplY 8508 7870 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV8 protein_id gnl|my_center|LOCUS_07670 9595 8663 gene locus_tag LOCUS_07680 gene prs 9595 8663 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZV1 protein_id gnl|my_center|LOCUS_07680 10836 9709 gene locus_tag LOCUS_07690 10836 9709 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_07690 11738 10839 gene locus_tag LOCUS_07700 gene lgt 11738 10839 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N77 protein_id gnl|my_center|LOCUS_07700 11739 12158 gene locus_tag LOCUS_07710 11739 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 12265 12762 gene locus_tag LOCUS_07720 12265 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918381.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence046 747 451 gene locus_tag LOCUS_07730 747 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 1044 859 gene locus_tag LOCUS_07740 1044 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 979 1371 gene locus_tag LOCUS_07750 979 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 1915 1433 gene locus_tag LOCUS_07760 1915 1433 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_07760 2044 2637 gene locus_tag LOCUS_07770 2044 2637 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A311 protein_id gnl|my_center|LOCUS_07770 3780 2623 gene locus_tag LOCUS_07780 3780 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4355 3777 gene locus_tag LOCUS_07790 4355 3777 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921226.1 protein_id gnl|my_center|LOCUS_07790 5095 4397 gene locus_tag LOCUS_07800 5095 4397 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T808 protein_id gnl|my_center|LOCUS_07800 5496 5128 gene locus_tag LOCUS_07810 5496 5128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 protein_id gnl|my_center|LOCUS_07810 6384 5506 gene locus_tag LOCUS_07820 gene coxC 6384 5506 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921231.1 protein_id gnl|my_center|LOCUS_07820 7084 6500 gene locus_tag LOCUS_07830 gene ctaG 7084 6500 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6U8 protein_id gnl|my_center|LOCUS_07830 7256 7092 gene locus_tag LOCUS_07840 7256 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 8270 7263 gene locus_tag LOCUS_07850 gene coxE 8270 7263 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDA3 protein_id gnl|my_center|LOCUS_07850 9832 8279 gene locus_tag LOCUS_07860 gene coxA 9832 8279 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDH9 protein_id gnl|my_center|LOCUS_07860 10783 9917 gene locus_tag LOCUS_07870 gene coxB 10783 9917 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6E5 protein_id gnl|my_center|LOCUS_07870 11000 11581 gene locus_tag LOCUS_07880 11000 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence047 <1 973 gene locus_tag LOCUS_07890 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388279.1:ATPase 983 1438 gene locus_tag LOCUS_07900 gene cheW 983 1438 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084983.1 protein_id gnl|my_center|LOCUS_07900 1460 1825 gene locus_tag LOCUS_07910 1460 1825 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921300.1 protein_id gnl|my_center|LOCUS_07910 1839 2957 gene locus_tag LOCUS_07920 gene cheB2 1839 2957 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 2 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAK0 protein_id gnl|my_center|LOCUS_07920 2957 3796 gene locus_tag LOCUS_07930 gene cheR1 2957 3796 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_07930 4370 3804 gene locus_tag LOCUS_07940 4370 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 5297 4602 gene locus_tag LOCUS_07950 5297 4602 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 protein_id gnl|my_center|LOCUS_07950 5638 6957 gene locus_tag LOCUS_07960 gene fliI 5638 6957 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H363 protein_id gnl|my_center|LOCUS_07960 6961 7380 gene locus_tag LOCUS_07970 6961 7380 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 protein_id gnl|my_center|LOCUS_07970 10301 8184 gene locus_tag LOCUS_07980 10301 8184 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096983.1 protein_id gnl|my_center|LOCUS_07980 10411 11514 gene locus_tag LOCUS_07990 10411 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 12086 11760 gene locus_tag LOCUS_08000 12086 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 12945 12127 gene locus_tag LOCUS_08010 12945 12127 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 protein_id gnl|my_center|LOCUS_08010 >Feature sequence048 271 1548 gene locus_tag LOCUS_08020 gene serS 271 1548 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEQ2 protein_id gnl|my_center|LOCUS_08020 1545 2360 gene locus_tag LOCUS_08030 gene surE 1545 2360 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX52 protein_id gnl|my_center|LOCUS_08030 2369 3013 gene locus_tag LOCUS_08040 gene pcm 2369 3013 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX51 protein_id gnl|my_center|LOCUS_08040 3108 3536 gene locus_tag LOCUS_08050 3108 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 3660 4556 gene locus_tag LOCUS_08060 3660 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4651 5034 gene locus_tag LOCUS_08070 4651 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5070 6701 gene locus_tag LOCUS_08080 gene secD 5070 6701 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L13 protein_id gnl|my_center|LOCUS_08080 6717 7691 gene locus_tag LOCUS_08090 6717 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08090 9090 7777 gene locus_tag LOCUS_08100 9090 7777 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_08100 9217 10068 gene locus_tag LOCUS_08110 9217 10068 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389512.1 protein_id gnl|my_center|LOCUS_08110 12035 10080 gene locus_tag LOCUS_08120 12035 10080 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 protein_id gnl|my_center|LOCUS_08120 <13010 12118 gene locus_tag LOCUS_08130 <13010 12118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MBV5:methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO >Feature sequence049 1251 577 gene locus_tag LOCUS_08140 1251 577 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_08140 2288 1251 gene locus_tag LOCUS_08150 gene tdh 2288 1251 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564818.1 protein_id gnl|my_center|LOCUS_08150 3375 2530 gene locus_tag LOCUS_08160 3375 2530 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527951.1 protein_id gnl|my_center|LOCUS_08160 4574 3372 gene locus_tag LOCUS_08170 gene kbl 4574 3372 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN30 protein_id gnl|my_center|LOCUS_08170 7074 4747 gene locus_tag LOCUS_08180 gene clpA 7074 4747 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920326.1 protein_id gnl|my_center|LOCUS_08180 7444 7079 gene locus_tag LOCUS_08190 gene clpS 7444 7079 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I0 protein_id gnl|my_center|LOCUS_08190 7677 7602 gene locus_tag LOCUS_t00090 7677 7602 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7821 8426 gene locus_tag LOCUS_08200 7821 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8532 8927 gene locus_tag LOCUS_08210 8532 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 9039 9608 gene locus_tag LOCUS_08220 9039 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 10793 9663 gene locus_tag LOCUS_08230 gene tgt 10793 9663 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9Y7 protein_id gnl|my_center|LOCUS_08230 10834 12381 gene locus_tag LOCUS_08240 10834 12381 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence050 232 1644 gene locus_tag LOCUS_08250 232 1644 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919713.1 protein_id gnl|my_center|LOCUS_08250 1780 2823 gene locus_tag LOCUS_08260 gene dgcB 1780 2823 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919716.1 protein_id gnl|my_center|LOCUS_08260 2901 3620 gene locus_tag LOCUS_08270 2901 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4222 3617 gene locus_tag LOCUS_08280 4222 3617 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_08280 4642 4283 gene locus_tag LOCUS_08290 4642 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_08290 5082 4651 gene locus_tag LOCUS_08300 5082 4651 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532157.1 protein_id gnl|my_center|LOCUS_08300 6346 5105 gene locus_tag LOCUS_08310 6346 5105 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAQ0 protein_id gnl|my_center|LOCUS_08310 7440 6343 gene locus_tag LOCUS_08320 gene sufD 7440 6343 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919727.1 protein_id gnl|my_center|LOCUS_08320 8204 7440 gene locus_tag LOCUS_08330 gene sufC 8204 7440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_08330 9899 8394 gene locus_tag LOCUS_08340 9899 8394 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531481.1 protein_id gnl|my_center|LOCUS_08340 11125 9986 gene locus_tag LOCUS_08350 11125 9986 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 protein_id gnl|my_center|LOCUS_08350 11604 11134 gene locus_tag LOCUS_08360 11604 11134 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence051 1360 521 gene locus_tag LOCUS_08370 1360 521 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085546.1 protein_id gnl|my_center|LOCUS_08370 1344 2102 gene locus_tag LOCUS_08380 1344 2102 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919327.1 protein_id gnl|my_center|LOCUS_08380 2099 3082 gene locus_tag LOCUS_08390 2099 3082 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919326.1 protein_id gnl|my_center|LOCUS_08390 3179 3712 gene locus_tag LOCUS_08400 3179 3712 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705130.1 protein_id gnl|my_center|LOCUS_08400 3721 4545 gene locus_tag LOCUS_08410 3721 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 6566 4542 gene locus_tag LOCUS_08420 6566 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_08420 6725 7699 gene locus_tag LOCUS_08430 6725 7699 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RK2 protein_id gnl|my_center|LOCUS_08430 7730 8104 gene locus_tag LOCUS_08440 7730 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 8121 9530 gene locus_tag LOCUS_08450 8121 9530 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923265.1 protein_id gnl|my_center|LOCUS_08450 9635 10417 gene locus_tag LOCUS_08460 9635 10417 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5B6 protein_id gnl|my_center|LOCUS_08460 10511 11311 gene locus_tag LOCUS_08470 10511 11311 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921213.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence052 1341 391 gene locus_tag LOCUS_08480 1341 391 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537829.1 protein_id gnl|my_center|LOCUS_08480 2225 1338 gene locus_tag LOCUS_08490 2225 1338 CDS product isocitrate lyase-family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 protein_id gnl|my_center|LOCUS_08490 2719 2222 gene locus_tag LOCUS_08500 2719 2222 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878133.1 protein_id gnl|my_center|LOCUS_08500 4005 2716 gene locus_tag LOCUS_08510 4005 2716 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064988.1 protein_id gnl|my_center|LOCUS_08510 4134 5324 gene locus_tag LOCUS_08520 4134 5324 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_08520 5414 5890 gene locus_tag LOCUS_08530 5414 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5946 6329 gene locus_tag LOCUS_08540 5946 6329 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975942.1 protein_id gnl|my_center|LOCUS_08540 6292 6837 gene locus_tag LOCUS_08550 6292 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7071 9839 gene locus_tag LOCUS_08560 7071 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence053 914 456 gene locus_tag LOCUS_08570 gene nodN 914 456 CDS product nodulation protein NodN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 protein_id gnl|my_center|LOCUS_08570 2044 944 gene locus_tag LOCUS_08580 2044 944 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 protein_id gnl|my_center|LOCUS_08580 2153 2422 gene locus_tag LOCUS_08590 2153 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532341.1 protein_id gnl|my_center|LOCUS_08590 2419 3228 gene locus_tag LOCUS_08600 2419 3228 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920109.1 protein_id gnl|my_center|LOCUS_08600 4097 3207 gene locus_tag LOCUS_08610 4097 3207 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_08610 5122 4115 gene locus_tag LOCUS_08620 gene lpxK 5122 4115 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYH3 protein_id gnl|my_center|LOCUS_08620 6411 5122 gene locus_tag LOCUS_08630 6411 5122 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639932.1 protein_id gnl|my_center|LOCUS_08630 7136 6408 gene locus_tag LOCUS_08640 7136 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_08640 7237 7899 gene locus_tag LOCUS_08650 gene ctpA 7237 7899 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_08650 7968 8360 gene locus_tag LOCUS_08660 7968 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 9973 8348 gene locus_tag LOCUS_08670 9973 8348 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918194.1 protein_id gnl|my_center|LOCUS_08670 10393 10154 gene locus_tag LOCUS_08680 10393 10154 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639934.1 protein_id gnl|my_center|LOCUS_08680 11109 10390 gene locus_tag LOCUS_08690 11109 10390 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532346.1 protein_id gnl|my_center|LOCUS_08690 <12292 11162 gene locus_tag LOCUS_08700 <12292 11162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918198.1:modulator protein >Feature sequence054 <1 795 gene locus_tag LOCUS_08710 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0C0F6:sensory/regulatory protein RpfC 1139 792 gene locus_tag LOCUS_08720 gene cutA 1139 792 CDS product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_08720 1203 1931 gene locus_tag LOCUS_08730 gene queC 1203 1931 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3X3 protein_id gnl|my_center|LOCUS_08730 1928 2557 gene locus_tag LOCUS_08740 gene queE 1928 2557 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBX3 protein_id gnl|my_center|LOCUS_08740 3902 3204 gene locus_tag LOCUS_08750 3902 3204 CDS product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58113 protein_id gnl|my_center|LOCUS_08750 4571 4017 gene locus_tag LOCUS_08760 gene coq7 4571 4017 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8N7 protein_id gnl|my_center|LOCUS_08760 5116 4571 gene locus_tag LOCUS_08770 5116 4571 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920057.1 protein_id gnl|my_center|LOCUS_08770 5904 5176 gene locus_tag LOCUS_08780 5904 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 6057 6143 gene locus_tag LOCUS_t00100 6057 6143 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10546 6725 gene locus_tag LOCUS_08790 10546 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963924.1 protein_id gnl|my_center|LOCUS_08790 11663 10629 gene locus_tag LOCUS_08800 11663 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence055 340 1425 gene locus_tag LOCUS_08810 340 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1478 2005 gene locus_tag LOCUS_08820 1478 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225286.1 protein_id gnl|my_center|LOCUS_08820 2805 2002 gene locus_tag LOCUS_08830 2805 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3545 2802 gene locus_tag LOCUS_08840 3545 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3724 4302 gene locus_tag LOCUS_08850 gene efp 3724 4302 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_08850 4304 5101 gene locus_tag LOCUS_08860 gene suhB 4304 5101 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084333.1 protein_id gnl|my_center|LOCUS_08860 5194 6207 gene locus_tag LOCUS_08870 5194 6207 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388829.1 protein_id gnl|my_center|LOCUS_08870 6211 7206 gene locus_tag LOCUS_08880 6211 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709323.1 protein_id gnl|my_center|LOCUS_08880 7430 7651 gene locus_tag LOCUS_08890 gene rpmE 7430 7651 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM38 protein_id gnl|my_center|LOCUS_08890 8558 8016 gene locus_tag LOCUS_08900 gene rcdA 8558 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 protein_id gnl|my_center|LOCUS_08900 8893 8702 gene locus_tag LOCUS_08910 8893 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 9019 10005 gene locus_tag LOCUS_08920 9019 10005 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921125.1 protein_id gnl|my_center|LOCUS_08920 10195 10866 gene locus_tag LOCUS_08930 10195 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923245.1 protein_id gnl|my_center|LOCUS_08930 12014 11196 gene locus_tag LOCUS_08940 12014 11196 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence056 895 1509 gene locus_tag LOCUS_08950 895 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073888.1 protein_id gnl|my_center|LOCUS_08950 2411 1506 gene locus_tag LOCUS_08960 2411 1506 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_08960 3343 2411 gene locus_tag LOCUS_08970 gene OppB 3343 2411 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336773.1 protein_id gnl|my_center|LOCUS_08970 3690 3436 gene locus_tag LOCUS_08980 3690 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3765 4709 gene locus_tag LOCUS_08990 3765 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4811 5635 gene locus_tag LOCUS_09000 4811 5635 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_09000 6444 5632 gene locus_tag LOCUS_09010 6444 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7144 6476 gene locus_tag LOCUS_09020 gene pdxH 7144 6476 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9Q6 protein_id gnl|my_center|LOCUS_09020 7246 7815 gene locus_tag LOCUS_09030 7246 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 7893 8987 gene locus_tag LOCUS_09040 gene aroC 7893 8987 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P8 protein_id gnl|my_center|LOCUS_09040 8984 9391 gene locus_tag LOCUS_09050 8984 9391 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_09050 9585 9376 gene locus_tag LOCUS_09060 9585 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 9508 9831 gene locus_tag LOCUS_09070 9508 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 10081 10356 gene locus_tag LOCUS_09080 10081 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 10353 10619 gene locus_tag LOCUS_09090 10353 10619 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972002.1 protein_id gnl|my_center|LOCUS_09090 <11890 10862 gene locus_tag LOCUS_09100 <11890 10862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4E3:propionyl-CoA carboxylase beta chain >Feature sequence057 127 2133 gene locus_tag LOCUS_09110 127 2133 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918113.1 protein_id gnl|my_center|LOCUS_09110 4096 2183 gene locus_tag LOCUS_09120 4096 2183 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 protein_id gnl|my_center|LOCUS_09120 4923 4495 gene locus_tag LOCUS_09130 4923 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 protein_id gnl|my_center|LOCUS_09130 5744 4920 gene locus_tag LOCUS_09140 5744 4920 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918713.1 protein_id gnl|my_center|LOCUS_09140 6010 5744 gene locus_tag LOCUS_09150 6010 5744 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 protein_id gnl|my_center|LOCUS_09150 6776 6051 gene locus_tag LOCUS_09160 6776 6051 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918715.1 protein_id gnl|my_center|LOCUS_09160 6824 7747 gene locus_tag LOCUS_09170 gene bioC 6824 7747 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_09170 8097 7759 gene locus_tag LOCUS_09180 8097 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 9223 8807 gene locus_tag LOCUS_09190 gene mutT 9223 8807 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_09190 10282 9275 gene locus_tag LOCUS_09200 10282 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence058 871 1650 gene locus_tag LOCUS_09210 871 1650 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265978.1 protein_id gnl|my_center|LOCUS_09210 1647 2438 gene locus_tag LOCUS_09220 1647 2438 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921385.1 protein_id gnl|my_center|LOCUS_09220 2879 2442 gene locus_tag LOCUS_09230 2879 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4840 2969 gene locus_tag LOCUS_09240 4840 2969 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919191.1 protein_id gnl|my_center|LOCUS_09240 5864 4902 gene locus_tag LOCUS_09250 5864 4902 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 protein_id gnl|my_center|LOCUS_09250 7539 6034 gene locus_tag LOCUS_09260 gene gatB 7539 6034 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L1 protein_id gnl|my_center|LOCUS_09260 8776 7784 gene locus_tag LOCUS_09270 8776 7784 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975262.1 protein_id gnl|my_center|LOCUS_09270 9000 8773 gene locus_tag LOCUS_09280 9000 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 9183 9031 gene locus_tag LOCUS_09290 9183 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 9373 9176 gene locus_tag LOCUS_09300 9373 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 9639 9373 gene locus_tag LOCUS_09310 9639 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 9890 9636 gene locus_tag LOCUS_09320 9890 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 10213 9893 gene locus_tag LOCUS_09330 10213 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 11682 10204 gene locus_tag LOCUS_09340 gene gatA 11682 10204 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L0 protein_id gnl|my_center|LOCUS_09340 >Feature sequence059 987 574 gene locus_tag LOCUS_09350 987 574 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086934.1 protein_id gnl|my_center|LOCUS_09350 1982 993 gene locus_tag LOCUS_09360 1982 993 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_09360 2092 2322 gene locus_tag LOCUS_09370 2092 2322 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_09370 2397 2729 gene locus_tag LOCUS_09380 gene grlA 2397 2729 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IC8 protein_id gnl|my_center|LOCUS_09380 3359 2967 gene locus_tag LOCUS_09390 3359 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 4116 3499 gene locus_tag LOCUS_09400 gene rpsD 4116 3499 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5D9 protein_id gnl|my_center|LOCUS_09400 5181 4423 gene locus_tag LOCUS_09410 5181 4423 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640515.1 protein_id gnl|my_center|LOCUS_09410 5290 6507 gene locus_tag LOCUS_09420 5290 6507 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFE6 protein_id gnl|my_center|LOCUS_09420 7054 6740 gene locus_tag LOCUS_09430 7054 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 7477 7127 gene locus_tag LOCUS_09440 7477 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 7559 8536 gene locus_tag LOCUS_09450 7559 8536 CDS product LAO/AO transport system kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 protein_id gnl|my_center|LOCUS_09450 8982 8533 gene locus_tag LOCUS_09460 8982 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 10045 8999 gene locus_tag LOCUS_09470 10045 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 <11816 10306 gene locus_tag LOCUS_09480 <11816 10306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q81GR0:malate synthase >Feature sequence060 1217 171 gene locus_tag LOCUS_09490 gene rfbB 1217 171 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5T6 protein_id gnl|my_center|LOCUS_09490 2767 1241 gene locus_tag LOCUS_09500 2767 1241 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532684.1 protein_id gnl|my_center|LOCUS_09500 3817 2819 gene locus_tag LOCUS_09510 3817 2819 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 protein_id gnl|my_center|LOCUS_09510 4159 3932 gene locus_tag LOCUS_09520 4159 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4420 5145 gene locus_tag LOCUS_09530 gene gpmA 4420 5145 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A1 protein_id gnl|my_center|LOCUS_09530 5130 5717 gene locus_tag LOCUS_09540 5130 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 6805 5714 gene locus_tag LOCUS_09550 6805 5714 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921174.1 protein_id gnl|my_center|LOCUS_09550 6983 10129 gene locus_tag LOCUS_09560 6983 10129 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Q1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence061 <1 904 gene locus_tag LOCUS_09570 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705803.1:Rhs family protein 925 1392 gene locus_tag LOCUS_09580 925 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1773 1420 gene locus_tag LOCUS_09590 1773 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2774 1959 gene locus_tag LOCUS_09600 2774 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4641 2743 gene locus_tag LOCUS_09610 gene gspD 4641 2743 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708827.1 protein_id gnl|my_center|LOCUS_09610 5069 4641 gene locus_tag LOCUS_09620 5069 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 5524 5066 gene locus_tag LOCUS_09630 5524 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6270 5521 gene locus_tag LOCUS_09640 6270 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6620 6267 gene locus_tag LOCUS_09650 6620 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7005 6607 gene locus_tag LOCUS_09660 7005 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8183 7005 gene locus_tag LOCUS_09670 8183 7005 CDS product type II secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460314.1 protein_id gnl|my_center|LOCUS_09670 9764 8187 gene locus_tag LOCUS_09680 9764 8187 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088762.1 protein_id gnl|my_center|LOCUS_09680 10237 9764 gene locus_tag LOCUS_09690 10237 9764 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533582.1 protein_id gnl|my_center|LOCUS_09690 10873 10385 gene locus_tag LOCUS_09700 10873 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 11277 10870 gene locus_tag LOCUS_09710 11277 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence062 280 660 gene locus_tag LOCUS_09720 280 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09720 1278 670 gene locus_tag LOCUS_09730 1278 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1405 2163 gene locus_tag LOCUS_09740 1405 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3032 2370 gene locus_tag LOCUS_09750 3032 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921128.1 protein_id gnl|my_center|LOCUS_09750 3274 3492 gene locus_tag LOCUS_09760 3274 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 4293 3571 gene locus_tag LOCUS_09770 4293 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204853.1 protein_id gnl|my_center|LOCUS_09770 6617 4308 gene locus_tag LOCUS_09780 6617 4308 CDS product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337759.1 protein_id gnl|my_center|LOCUS_09780 8120 6699 gene locus_tag LOCUS_09790 8120 6699 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLW9 protein_id gnl|my_center|LOCUS_09790 9758 8154 gene locus_tag LOCUS_09800 9758 8154 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_09800 11077 9758 gene locus_tag LOCUS_09810 11077 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence063 36 1538 gene locus_tag LOCUS_09820 36 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2460 1552 gene locus_tag LOCUS_09830 gene hemF 2460 1552 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZX1 protein_id gnl|my_center|LOCUS_09830 2641 4089 gene locus_tag LOCUS_09840 2641 4089 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_09840 4654 4076 gene locus_tag LOCUS_09850 4654 4076 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230163.1 protein_id gnl|my_center|LOCUS_09850 4751 5266 gene locus_tag LOCUS_09860 4751 5266 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889457.1 protein_id gnl|my_center|LOCUS_09860 5502 6119 gene locus_tag LOCUS_09870 gene fbcF 5502 6119 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXJ6 protein_id gnl|my_center|LOCUS_09870 6134 7420 gene locus_tag LOCUS_09880 6134 7420 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C607 protein_id gnl|my_center|LOCUS_09880 7435 8238 gene locus_tag LOCUS_09890 7435 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09890 8336 8944 gene locus_tag LOCUS_09900 8336 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8944 9828 gene locus_tag LOCUS_09910 gene mtnP 8944 9828 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 protein_id gnl|my_center|LOCUS_09910 10161 10508 gene locus_tag LOCUS_09920 10161 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 10582 11112 gene locus_tag LOCUS_09930 gene apt 10582 11112 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB5 protein_id gnl|my_center|LOCUS_09930 >Feature sequence064 127 3543 gene locus_tag LOCUS_09940 127 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337884.1 protein_id gnl|my_center|LOCUS_09940 4078 3569 gene locus_tag LOCUS_09950 4078 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5207 4185 gene locus_tag LOCUS_09960 5207 4185 CDS product FeaR-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265602.1 protein_id gnl|my_center|LOCUS_09960 5394 6476 gene locus_tag LOCUS_09970 gene leuB 5394 6476 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABN3 protein_id gnl|my_center|LOCUS_09970 7175 6468 gene locus_tag LOCUS_09980 gene hutC 7175 6468 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 protein_id gnl|my_center|LOCUS_09980 8539 7172 gene locus_tag LOCUS_09990 gene hutF 8539 7172 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 protein_id gnl|my_center|LOCUS_09990 8604 9806 gene locus_tag LOCUS_10000 gene hutI 8604 9806 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS0 protein_id gnl|my_center|LOCUS_10000 9800 11317 gene locus_tag LOCUS_10010 gene hutH 9800 11317 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J289 protein_id gnl|my_center|LOCUS_10010 >Feature sequence065 161 1486 gene locus_tag LOCUS_10020 161 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3085 1556 gene locus_tag LOCUS_10030 3085 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4300 3125 gene locus_tag LOCUS_10040 4300 3125 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_10040 4616 4527 gene locus_tag LOCUS_t00110 4616 4527 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5807 4908 gene locus_tag LOCUS_10050 gene yrbG 5807 4908 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_10050 6046 6714 gene locus_tag LOCUS_10060 gene msrA1 6046 6714 CDS product peptide methionine sulfoxide reductase MsrA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9I6 protein_id gnl|my_center|LOCUS_10060 6743 7414 gene locus_tag LOCUS_10070 6743 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 7653 7411 gene locus_tag LOCUS_10080 7653 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 8116 7700 gene locus_tag LOCUS_10090 8116 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083733.1 protein_id gnl|my_center|LOCUS_10090 8223 10391 gene locus_tag LOCUS_10100 8223 10391 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918909.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence066 948 109 gene locus_tag LOCUS_10110 948 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2699 942 gene locus_tag LOCUS_10120 2699 942 CDS product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294717.1 protein_id gnl|my_center|LOCUS_10120 3316 2696 gene locus_tag LOCUS_10130 gene mobA 3316 2696 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI6 protein_id gnl|my_center|LOCUS_10130 3945 3313 gene locus_tag LOCUS_10140 3945 3313 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2J2 protein_id gnl|my_center|LOCUS_10140 4535 3942 gene locus_tag LOCUS_10150 4535 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5746 4565 gene locus_tag LOCUS_10160 5746 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6360 5743 gene locus_tag LOCUS_10170 6360 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 7043 7933 gene locus_tag LOCUS_10180 7043 7933 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263170.1 protein_id gnl|my_center|LOCUS_10180 8747 7971 gene locus_tag LOCUS_10190 8747 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 9563 8826 gene locus_tag LOCUS_10200 9563 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9699 9968 gene locus_tag LOCUS_10210 9699 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 10219 10554 gene locus_tag LOCUS_10220 10219 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence067 316 98 gene locus_tag LOCUS_10230 gene infA 316 98 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAM1 protein_id gnl|my_center|LOCUS_10230 868 449 gene locus_tag LOCUS_10240 868 449 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 protein_id gnl|my_center|LOCUS_10240 1350 865 gene locus_tag LOCUS_10250 1350 865 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL90 protein_id gnl|my_center|LOCUS_10250 1796 1347 gene locus_tag LOCUS_10260 1796 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265795.1 protein_id gnl|my_center|LOCUS_10260 3061 1793 gene locus_tag LOCUS_10270 gene murA 3061 1793 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5U7 protein_id gnl|my_center|LOCUS_10270 3367 3134 gene locus_tag LOCUS_10280 3367 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3681 3755 gene locus_tag LOCUS_t00120 3681 3755 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4359 3769 gene locus_tag LOCUS_10290 4359 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4828 4379 gene locus_tag LOCUS_10300 4828 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 5133 6572 gene locus_tag LOCUS_10310 5133 6572 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887228.1 protein_id gnl|my_center|LOCUS_10310 6606 7382 gene locus_tag LOCUS_10320 6606 7382 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039912.1 protein_id gnl|my_center|LOCUS_10320 7400 8404 gene locus_tag LOCUS_10330 7400 8404 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M844 protein_id gnl|my_center|LOCUS_10330 8871 8401 gene locus_tag LOCUS_10340 gene yedL 8871 8401 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494160.1 protein_id gnl|my_center|LOCUS_10340 9086 9754 gene locus_tag LOCUS_10350 9086 9754 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336778.1 protein_id gnl|my_center|LOCUS_10350 9751 10365 gene locus_tag LOCUS_10360 9751 10365 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_10360 10399 10815 gene locus_tag LOCUS_10370 10399 10815 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530024.1 protein_id gnl|my_center|LOCUS_10370 10850 11206 gene locus_tag LOCUS_10380 10850 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence068 1628 453 gene locus_tag LOCUS_10390 1628 453 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX62 protein_id gnl|my_center|LOCUS_10390 1712 2050 gene locus_tag LOCUS_10400 1712 2050 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_10400 2080 2751 gene locus_tag LOCUS_10410 2080 2751 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_10410 3267 2884 gene locus_tag LOCUS_10420 3267 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3321 4115 gene locus_tag LOCUS_10430 3321 4115 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919877.1 protein_id gnl|my_center|LOCUS_10430 5548 4208 gene locus_tag LOCUS_10440 gene astB2 5548 4208 CDS product N-succinylarginine dihydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7W1 protein_id gnl|my_center|LOCUS_10440 7014 5548 gene locus_tag LOCUS_10450 gene astD 7014 5548 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C761 protein_id gnl|my_center|LOCUS_10450 8009 6999 gene locus_tag LOCUS_10460 8009 6999 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919480.1 protein_id gnl|my_center|LOCUS_10460 9287 8028 gene locus_tag LOCUS_10470 9287 8028 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_10470 10611 9319 gene locus_tag LOCUS_10480 gene mdeA 10611 9319 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313410.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence069 <1 771 gene locus_tag LOCUS_10490 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090991.1:citronellol catabolism dehydrogenase 771 2381 gene locus_tag LOCUS_10500 gene atuC 771 2381 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_10500 2402 3559 gene locus_tag LOCUS_10510 2402 3559 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529278.1 protein_id gnl|my_center|LOCUS_10510 3559 4359 gene locus_tag LOCUS_10520 gene atuE 3559 4359 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_10520 4508 6472 gene locus_tag LOCUS_10530 gene mccA 4508 6472 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083807.1 protein_id gnl|my_center|LOCUS_10530 6469 7332 gene locus_tag LOCUS_10540 6469 7332 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_10540 7334 9151 gene locus_tag LOCUS_10550 7334 9151 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_10550 9141 10613 gene locus_tag LOCUS_10560 9141 10613 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence070 <1 1034 gene locus_tag LOCUS_10570 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390412.1:serine protease 1056 2375 gene locus_tag LOCUS_10580 1056 2375 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919162.1 protein_id gnl|my_center|LOCUS_10580 2465 2854 gene locus_tag LOCUS_10590 2465 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2939 3322 gene locus_tag LOCUS_10600 gene crcB 2939 3322 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMF4 protein_id gnl|my_center|LOCUS_10600 3319 4302 gene locus_tag LOCUS_10610 3319 4302 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6V3 protein_id gnl|my_center|LOCUS_10610 4299 6092 gene locus_tag LOCUS_10620 4299 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920658.1 protein_id gnl|my_center|LOCUS_10620 6089 6781 gene locus_tag LOCUS_10630 6089 6781 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_10630 6778 7518 gene locus_tag LOCUS_10640 6778 7518 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 protein_id gnl|my_center|LOCUS_10640 7575 8021 gene locus_tag LOCUS_10650 7575 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 8116 8661 gene locus_tag LOCUS_10660 8116 8661 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920787.1 protein_id gnl|my_center|LOCUS_10660 8658 9443 gene locus_tag LOCUS_10670 8658 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 9545 10048 gene locus_tag LOCUS_10680 gene cpaA 9545 10048 CDS product pilus assembly protein CpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920784.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence071 1763 5545 gene locus_tag LOCUS_10690 1763 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8137 5558 gene locus_tag LOCUS_10700 gene valS 8137 5558 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCN6 protein_id gnl|my_center|LOCUS_10700 8298 8849 gene locus_tag LOCUS_10710 gene hslV 8298 8849 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6B2 protein_id gnl|my_center|LOCUS_10710 10148 8997 gene locus_tag LOCUS_10720 gene serC 10148 8997 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence072 854 588 gene locus_tag LOCUS_10730 gene hup 854 588 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_10730 1064 1261 gene locus_tag LOCUS_10740 1064 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1665 1249 gene locus_tag LOCUS_10750 1665 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529289.1 protein_id gnl|my_center|LOCUS_10750 2410 1679 gene locus_tag LOCUS_10760 2410 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3402 2407 gene locus_tag LOCUS_10770 3402 2407 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 protein_id gnl|my_center|LOCUS_10770 4240 3407 gene locus_tag LOCUS_10780 4240 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4377 5300 gene locus_tag LOCUS_10790 4377 5300 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 protein_id gnl|my_center|LOCUS_10790 5387 6733 gene locus_tag LOCUS_10800 gene gltX 5387 6733 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC35 protein_id gnl|my_center|LOCUS_10800 7385 6858 gene locus_tag LOCUS_10810 7385 6858 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_10810 7487 7663 gene locus_tag LOCUS_10820 7487 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 8944 7709 gene locus_tag LOCUS_10830 gene tyrS 8944 7709 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A756 protein_id gnl|my_center|LOCUS_10830 9039 10148 gene locus_tag LOCUS_10840 gene anmK 9039 10148 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A757 protein_id gnl|my_center|LOCUS_10840 10149 10469 gene locus_tag LOCUS_10850 10149 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence073 2428 1103 gene locus_tag LOCUS_10860 gene mnmE 2428 1103 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW34 protein_id gnl|my_center|LOCUS_10860 2678 2439 gene locus_tag LOCUS_10870 2678 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921584.1 protein_id gnl|my_center|LOCUS_10870 2760 3440 gene locus_tag LOCUS_10880 2760 3440 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_10880 4268 3639 gene locus_tag LOCUS_10890 4268 3639 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_10890 5745 4417 gene locus_tag LOCUS_10900 gene rho 5745 4417 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A211 protein_id gnl|my_center|LOCUS_10900 6465 6019 gene locus_tag LOCUS_10910 6465 6019 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_10910 7529 6465 gene locus_tag LOCUS_10920 gene hemH 7529 6465 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57777 protein_id gnl|my_center|LOCUS_10920 8583 7558 gene locus_tag LOCUS_10930 gene hemE 8583 7558 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW41 protein_id gnl|my_center|LOCUS_10930 9137 9994 gene locus_tag LOCUS_10940 9137 9994 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 protein_id gnl|my_center|LOCUS_10940 >Feature sequence074 <1 511 gene locus_tag LOCUS_10950 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262221.1:MFS transporter 526 1713 gene locus_tag LOCUS_10960 gene rnd 526 1713 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7M5 protein_id gnl|my_center|LOCUS_10960 3224 1710 gene locus_tag LOCUS_10970 gene ppx1 3224 1710 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919577.1 protein_id gnl|my_center|LOCUS_10970 5434 3221 gene locus_tag LOCUS_10980 gene ppk1 5434 3221 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7E3 protein_id gnl|my_center|LOCUS_10980 6132 5431 gene locus_tag LOCUS_10990 6132 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 protein_id gnl|my_center|LOCUS_10990 7251 6142 gene locus_tag LOCUS_11000 7251 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7537 8568 gene locus_tag LOCUS_11010 gene purM 7537 8568 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKG8 protein_id gnl|my_center|LOCUS_11010 8565 9143 gene locus_tag LOCUS_11020 gene purN 8565 9143 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 protein_id gnl|my_center|LOCUS_11020 9195 9554 gene locus_tag LOCUS_11030 9195 9554 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_11030 10145 9714 gene locus_tag LOCUS_11040 gene soxR 10145 9714 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51506 protein_id gnl|my_center|LOCUS_11040 >Feature sequence075 423 1895 gene locus_tag LOCUS_11050 gene pepA 423 1895 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8R6 protein_id gnl|my_center|LOCUS_11050 1906 2355 gene locus_tag LOCUS_11060 1906 2355 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919563.1 protein_id gnl|my_center|LOCUS_11060 2352 2645 gene locus_tag LOCUS_11070 2352 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2751 3434 gene locus_tag LOCUS_11080 2751 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3582 4226 gene locus_tag LOCUS_11090 3582 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6119 4233 gene locus_tag LOCUS_11100 6119 4233 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532466.1 protein_id gnl|my_center|LOCUS_11100 6217 6639 gene locus_tag LOCUS_11110 gene ndk 6217 6639 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D0 protein_id gnl|my_center|LOCUS_11110 8091 6706 gene locus_tag LOCUS_11120 8091 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8250 9536 gene locus_tag LOCUS_11130 8250 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 <10445 9549 gene locus_tag LOCUS_11140 <10445 9549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529979.1:multidrug ABC transporter ATP-binding protein >Feature sequence076 2185 3558 gene locus_tag LOCUS_11150 gene gsh1 2185 3558 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_11150 4749 3703 gene locus_tag LOCUS_11160 4749 3703 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB72 protein_id gnl|my_center|LOCUS_11160 6003 4753 gene locus_tag LOCUS_11170 6003 4753 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_11170 6221 7021 gene locus_tag LOCUS_11180 gene phnC 6221 7021 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3F1 protein_id gnl|my_center|LOCUS_11180 7018 9021 gene locus_tag LOCUS_11190 7018 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 9144 10286 gene locus_tag LOCUS_11200 gene pstS 9144 10286 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383001.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence077 1249 410 gene locus_tag LOCUS_11210 1249 410 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_11210 2157 1342 gene locus_tag LOCUS_11220 2157 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2329 3936 gene locus_tag LOCUS_11230 2329 3936 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920031.1 protein_id gnl|my_center|LOCUS_11230 4481 5062 gene locus_tag LOCUS_11240 4481 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918166.1 protein_id gnl|my_center|LOCUS_11240 5159 5476 gene locus_tag LOCUS_11250 5159 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 5612 5971 gene locus_tag LOCUS_11260 5612 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 6145 6939 gene locus_tag LOCUS_11270 6145 6939 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920030.1 protein_id gnl|my_center|LOCUS_11270 6958 7827 gene locus_tag LOCUS_11280 6958 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 protein_id gnl|my_center|LOCUS_11280 7878 9854 gene locus_tag LOCUS_11290 7878 9854 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920029.1 protein_id gnl|my_center|LOCUS_11290 10024 9851 gene locus_tag LOCUS_11300 10024 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence078 1134 688 gene locus_tag LOCUS_11310 gene ppiB 1134 688 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_11310 2141 1140 gene locus_tag LOCUS_11320 2141 1140 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640279.1 protein_id gnl|my_center|LOCUS_11320 2632 2138 gene locus_tag LOCUS_11330 gene coaD 2632 2138 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE7 protein_id gnl|my_center|LOCUS_11330 5490 2632 gene locus_tag LOCUS_11340 gene gyrA 5490 2632 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZ37 protein_id gnl|my_center|LOCUS_11340 5871 6911 gene locus_tag LOCUS_11350 5871 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_11350 7299 6919 gene locus_tag LOCUS_11360 7299 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 7866 7390 gene locus_tag LOCUS_11370 7866 7390 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A7 protein_id gnl|my_center|LOCUS_11370 >Feature sequence079 725 36 gene locus_tag LOCUS_11380 725 36 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_11380 932 5857 gene locus_tag LOCUS_11390 gene gdhZ 932 5857 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917977.1 protein_id gnl|my_center|LOCUS_11390 6315 5980 gene locus_tag LOCUS_11400 6315 5980 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917957.1 protein_id gnl|my_center|LOCUS_11400 7313 6318 gene locus_tag LOCUS_11410 gene gpsA 7313 6318 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58141 protein_id gnl|my_center|LOCUS_11410 8389 7310 gene locus_tag LOCUS_11420 gene tsaD 8389 7310 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C563 protein_id gnl|my_center|LOCUS_11420 8488 9459 gene locus_tag LOCUS_11430 gene hemC 8488 9459 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABZ8 protein_id gnl|my_center|LOCUS_11430 9456 10184 gene locus_tag LOCUS_11440 9456 10184 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639872.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence080 <1 873 gene locus_tag LOCUS_11450 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9AC53:bifunctional uridylyltransferase/uridylyl-removing enzyme 878 2479 gene locus_tag LOCUS_11460 gene mviN 878 2479 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF00 protein_id gnl|my_center|LOCUS_11460 2584 3621 gene locus_tag LOCUS_11470 gene trpS 2584 3621 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3N8 protein_id gnl|my_center|LOCUS_11470 3800 4474 gene locus_tag LOCUS_11480 3800 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391168.1 protein_id gnl|my_center|LOCUS_11480 4600 5568 gene locus_tag LOCUS_11490 4600 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 protein_id gnl|my_center|LOCUS_11490 5680 5937 gene locus_tag LOCUS_11500 5680 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7742 5934 gene locus_tag LOCUS_11510 gene lepA 7742 5934 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF57 protein_id gnl|my_center|LOCUS_11510 7892 8353 gene locus_tag LOCUS_11520 7892 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 8507 9160 gene locus_tag LOCUS_11530 8507 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence081 2 412 gene locus_tag LOCUS_11540 2 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 409 1479 gene locus_tag LOCUS_11550 409 1479 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_11550 2138 1671 gene locus_tag LOCUS_11560 gene dps 2138 1671 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658301.1 protein_id gnl|my_center|LOCUS_11560 3477 2266 gene locus_tag LOCUS_11570 3477 2266 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8I0 protein_id gnl|my_center|LOCUS_11570 3707 3874 gene locus_tag LOCUS_11580 3707 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4001 4984 gene locus_tag LOCUS_11590 4001 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6037 4970 gene locus_tag LOCUS_11600 gene purK 6037 4970 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBG8 protein_id gnl|my_center|LOCUS_11600 6506 6048 gene locus_tag LOCUS_11610 gene purE 6506 6048 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC72 protein_id gnl|my_center|LOCUS_11610 6736 7434 gene locus_tag LOCUS_11620 gene dgcA 6736 7434 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_11620 7487 8509 gene locus_tag LOCUS_11630 7487 8509 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS46 protein_id gnl|my_center|LOCUS_11630 8767 9486 gene locus_tag LOCUS_11640 8767 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence082 1495 47 gene locus_tag LOCUS_11650 1495 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2403 1495 gene locus_tag LOCUS_11660 2403 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2707 2468 gene locus_tag LOCUS_11670 2707 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 3004 4308 gene locus_tag LOCUS_11680 3004 4308 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920240.1 protein_id gnl|my_center|LOCUS_11680 6483 4318 gene locus_tag LOCUS_11690 gene manC 6483 4318 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887486.1 protein_id gnl|my_center|LOCUS_11690 6778 9237 gene locus_tag LOCUS_11700 6778 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 9952 9281 gene locus_tag LOCUS_11710 9952 9281 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence083 702 310 gene locus_tag LOCUS_11720 702 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1109 780 gene locus_tag LOCUS_11730 1109 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1768 1109 gene locus_tag LOCUS_11740 gene dsb 1768 1109 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708016.1 protein_id gnl|my_center|LOCUS_11740 2145 1831 gene locus_tag LOCUS_11750 2145 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2324 3574 gene locus_tag LOCUS_11760 gene mnmA 2324 3574 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH16 protein_id gnl|my_center|LOCUS_11760 3571 3909 gene locus_tag LOCUS_11770 3571 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4015 5199 gene locus_tag LOCUS_11780 4015 5199 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_11780 5328 5789 gene locus_tag LOCUS_11790 5328 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_11790 7349 6012 gene locus_tag LOCUS_11800 7349 6012 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB46 protein_id gnl|my_center|LOCUS_11800 8305 7346 gene locus_tag LOCUS_11810 8305 7346 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_11810 9102 8362 gene locus_tag LOCUS_11820 9102 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 9214 10041 gene locus_tag LOCUS_11830 gene gcvT 9214 10041 CDS product folate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085341.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence084 <1 831 gene locus_tag LOCUS_11840 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721383.1:ATPase 842 1303 gene locus_tag LOCUS_11850 842 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2668 1307 gene locus_tag LOCUS_11860 2668 1307 CDS product peptidase S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389962.1 protein_id gnl|my_center|LOCUS_11860 2819 3499 gene locus_tag LOCUS_11870 2819 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4071 4145 gene locus_tag LOCUS_t00130 4071 4145 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4637 4230 gene locus_tag LOCUS_11880 4637 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5054 4647 gene locus_tag LOCUS_11890 5054 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5162 6868 gene locus_tag LOCUS_11900 gene metG 5162 6868 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5U4 protein_id gnl|my_center|LOCUS_11900 7857 7183 gene locus_tag LOCUS_11910 7857 7183 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 protein_id gnl|my_center|LOCUS_11910 8077 9399 gene locus_tag LOCUS_11920 8077 9399 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_11920 9490 9765 gene locus_tag LOCUS_11930 9490 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 9816 9968 gene locus_tag LOCUS_11940 9816 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence085 689 1528 gene locus_tag LOCUS_11950 gene rpsB 689 1528 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A703 protein_id gnl|my_center|LOCUS_11950 1562 2503 gene locus_tag LOCUS_11960 gene tsf 1562 2503 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A704 protein_id gnl|my_center|LOCUS_11960 2571 3335 gene locus_tag LOCUS_11970 gene pyrH 2571 3335 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A705 protein_id gnl|my_center|LOCUS_11970 3343 3909 gene locus_tag LOCUS_11980 gene frr 3343 3909 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU06 protein_id gnl|my_center|LOCUS_11980 3953 4675 gene locus_tag LOCUS_11990 gene uppS 3953 4675 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL9 protein_id gnl|my_center|LOCUS_11990 4672 5499 gene locus_tag LOCUS_12000 4672 5499 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A708 protein_id gnl|my_center|LOCUS_12000 5500 6699 gene locus_tag LOCUS_12010 gene dxr 5500 6699 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_12010 6706 7905 gene locus_tag LOCUS_12020 gene mmpA 6706 7905 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640363.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence086 2651 825 gene locus_tag LOCUS_12030 gene bipA 2651 825 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074056.1 protein_id gnl|my_center|LOCUS_12030 3097 3468 gene locus_tag LOCUS_12040 3097 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3905 5293 gene locus_tag LOCUS_12050 3905 5293 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920161.1 protein_id gnl|my_center|LOCUS_12050 5290 6657 gene locus_tag LOCUS_12060 5290 6657 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5Z7 protein_id gnl|my_center|LOCUS_12060 6834 8135 gene locus_tag LOCUS_12070 6834 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 9884 8190 gene locus_tag LOCUS_12080 9884 8190 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390237.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence087 <1 779 gene locus_tag LOCUS_12090 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917969.1:acyl-CoA dehydrogenase 927 2102 gene locus_tag LOCUS_12100 927 2102 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 protein_id gnl|my_center|LOCUS_12100 2140 3348 gene locus_tag LOCUS_12110 2140 3348 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_12110 3482 5680 gene locus_tag LOCUS_12120 3482 5680 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_12120 6361 5924 gene locus_tag LOCUS_12130 6361 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 7298 6375 gene locus_tag LOCUS_12140 7298 6375 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_12140 7793 7359 gene locus_tag LOCUS_12150 gene zur 7793 7359 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 protein_id gnl|my_center|LOCUS_12150 7702 7890 gene locus_tag LOCUS_12160 7702 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence088 764 2473 gene locus_tag LOCUS_12170 gene divJ 764 2473 CDS product histidine protein kinase DivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03228 protein_id gnl|my_center|LOCUS_12170 3373 2483 gene locus_tag LOCUS_12180 3373 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4986 3385 gene locus_tag LOCUS_12190 4986 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 5082 5417 gene locus_tag LOCUS_12200 5082 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_12200 5602 6006 gene locus_tag LOCUS_12210 5602 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6059 7663 gene locus_tag LOCUS_12220 gene prfC 6059 7663 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9B9 protein_id gnl|my_center|LOCUS_12220 7660 8877 gene locus_tag LOCUS_12230 7660 8877 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence089 836 1303 gene locus_tag LOCUS_12240 gene sspB 836 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919963.1 protein_id gnl|my_center|LOCUS_12240 2358 1330 gene locus_tag LOCUS_12250 gene cmaX 2358 1330 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382467.1 protein_id gnl|my_center|LOCUS_12250 2794 2387 gene locus_tag LOCUS_12260 2794 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 2895 4286 gene locus_tag LOCUS_12270 gene fumC 2895 4286 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PB6 protein_id gnl|my_center|LOCUS_12270 4286 4459 gene locus_tag LOCUS_12280 4286 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6256 4601 gene locus_tag LOCUS_12290 6256 4601 CDS product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706368.1 protein_id gnl|my_center|LOCUS_12290 7507 6335 gene locus_tag LOCUS_12300 7507 6335 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_12300 9605 7581 gene locus_tag LOCUS_12310 9605 7581 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence090 2899 416 gene locus_tag LOCUS_12320 gene pleC 2899 416 CDS product non-motile and phage-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920340.1 protein_id gnl|my_center|LOCUS_12320 3565 3011 gene locus_tag LOCUS_12330 3565 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640507.1 protein_id gnl|my_center|LOCUS_12330 4626 3700 gene locus_tag LOCUS_12340 4626 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 4995 4729 gene locus_tag LOCUS_12350 4995 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5202 5495 gene locus_tag LOCUS_12360 5202 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 5580 5843 gene locus_tag LOCUS_12370 gene fliQ 5580 5843 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640137.1 protein_id gnl|my_center|LOCUS_12370 5851 6609 gene locus_tag LOCUS_12380 gene fliR 5851 6609 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C772 protein_id gnl|my_center|LOCUS_12380 6617 7684 gene locus_tag LOCUS_12390 gene flhB 6617 7684 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_12390 8115 7681 gene locus_tag LOCUS_12400 8115 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence091 485 1129 gene locus_tag LOCUS_12410 485 1129 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_12410 1188 2465 gene locus_tag LOCUS_12420 1188 2465 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 protein_id gnl|my_center|LOCUS_12420 2664 2948 gene locus_tag LOCUS_12430 2664 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2948 3853 gene locus_tag LOCUS_12440 2948 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963206.1 protein_id gnl|my_center|LOCUS_12440 4215 3904 gene locus_tag LOCUS_12450 4215 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4222 4434 gene locus_tag LOCUS_12460 4222 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4554 5135 gene locus_tag LOCUS_12470 4554 5135 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_12470 5233 5931 gene locus_tag LOCUS_12480 gene chrR 5233 5931 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918533.1 protein_id gnl|my_center|LOCUS_12480 5991 7259 gene locus_tag LOCUS_12490 5991 7259 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 protein_id gnl|my_center|LOCUS_12490 7722 7465 gene locus_tag LOCUS_12500 7722 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921422.1 protein_id gnl|my_center|LOCUS_12500 9536 7869 gene locus_tag LOCUS_12510 9536 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence092 1699 980 gene locus_tag LOCUS_12520 gene pgl 1699 980 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S1 protein_id gnl|my_center|LOCUS_12520 3146 1683 gene locus_tag LOCUS_12530 gene zwf 3146 1683 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_12530 3883 4284 gene locus_tag LOCUS_12540 3883 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4281 5243 gene locus_tag LOCUS_12550 4281 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5301 6494 gene locus_tag LOCUS_12560 gene czcC 5301 6494 CDS product cobalt-zinc-cadmium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205515.1 protein_id gnl|my_center|LOCUS_12560 6494 8137 gene locus_tag LOCUS_12570 6494 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 6827 6920 gene locus_tag LOCUS_t00140 6827 6920 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 <1 1189 gene locus_tag LOCUS_12580 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UFH1:enolase 1286 1612 gene locus_tag LOCUS_12590 1286 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1745 2767 gene locus_tag LOCUS_12600 gene pdhA 1745 2767 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E8 protein_id gnl|my_center|LOCUS_12600 2786 4222 gene locus_tag LOCUS_12610 2786 4222 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919595.1 protein_id gnl|my_center|LOCUS_12610 4228 5592 gene locus_tag LOCUS_12620 4228 5592 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C893 protein_id gnl|my_center|LOCUS_12620 5629 7041 gene locus_tag LOCUS_12630 5629 7041 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y975 protein_id gnl|my_center|LOCUS_12630 7305 8153 gene locus_tag LOCUS_12640 7305 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 8201 9457 gene locus_tag LOCUS_12650 8201 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence094 1585 854 gene locus_tag LOCUS_12660 1585 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265989.1 protein_id gnl|my_center|LOCUS_12660 2401 1682 gene locus_tag LOCUS_12670 2401 1682 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE36 protein_id gnl|my_center|LOCUS_12670 3328 2483 gene locus_tag LOCUS_12680 3328 2483 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338321.1 protein_id gnl|my_center|LOCUS_12680 4488 3328 gene locus_tag LOCUS_12690 4488 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 5819 4485 gene locus_tag LOCUS_12700 5819 4485 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 protein_id gnl|my_center|LOCUS_12700 9072 5878 gene locus_tag LOCUS_12710 9072 5878 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence095 3147 2374 gene locus_tag LOCUS_12720 3147 2374 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_12720 3304 4170 gene locus_tag LOCUS_12730 3304 4170 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917986.1 protein_id gnl|my_center|LOCUS_12730 4643 4179 gene locus_tag LOCUS_12740 4643 4179 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 protein_id gnl|my_center|LOCUS_12740 5311 4685 gene locus_tag LOCUS_12750 5311 4685 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921424.1 protein_id gnl|my_center|LOCUS_12750 7007 5508 gene locus_tag LOCUS_12760 gene rpoN 7007 5508 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03408 protein_id gnl|my_center|LOCUS_12760 7759 7019 gene locus_tag LOCUS_12770 7759 7019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921427.1 protein_id gnl|my_center|LOCUS_12770 8527 7934 gene locus_tag LOCUS_12780 8527 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921428.1 protein_id gnl|my_center|LOCUS_12780 9195 8524 gene locus_tag LOCUS_12790 9195 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence096 <1 851 gene locus_tag LOCUS_12800 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035527.1:methyltransferase 2078 1230 gene locus_tag LOCUS_12810 gene tauD 2078 1230 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_12810 4104 2149 gene locus_tag LOCUS_12820 4104 2149 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097075.1 protein_id gnl|my_center|LOCUS_12820 6089 4128 gene locus_tag LOCUS_12830 6089 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_12830 8795 6246 gene locus_tag LOCUS_12840 8795 6246 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence097 339 1340 gene locus_tag LOCUS_12850 339 1340 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_12850 1761 1354 gene locus_tag LOCUS_12860 1761 1354 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_12860 2267 1758 gene locus_tag LOCUS_12870 2267 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3138 2326 gene locus_tag LOCUS_12880 3138 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3548 3243 gene locus_tag LOCUS_12890 3548 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4439 3600 gene locus_tag LOCUS_12900 4439 3600 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_12900 4706 6343 gene locus_tag LOCUS_12910 4706 6343 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265611.1 protein_id gnl|my_center|LOCUS_12910 6406 7020 gene locus_tag LOCUS_12920 6406 7020 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_12920 7361 7017 gene locus_tag LOCUS_12930 7361 7017 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_12930 7650 7354 gene locus_tag LOCUS_12940 7650 7354 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920916.1 protein_id gnl|my_center|LOCUS_12940 8642 7689 gene locus_tag LOCUS_12950 8642 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 <9309 8647 gene locus_tag LOCUS_12960 <9309 8647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140627.1:prolyl endopeptidase >Feature sequence098 3905 693 gene locus_tag LOCUS_12970 3905 693 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_12970 5210 3930 gene locus_tag LOCUS_12980 5210 3930 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_12980 6605 5238 gene locus_tag LOCUS_12990 6605 5238 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 protein_id gnl|my_center|LOCUS_12990 6796 8226 gene locus_tag LOCUS_13000 gene phoR 6796 8226 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918178.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence099 941 1129 gene locus_tag LOCUS_13010 941 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1567 2583 gene locus_tag LOCUS_13020 gene ilvC 1567 2583 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L5 protein_id gnl|my_center|LOCUS_13020 2599 4296 gene locus_tag LOCUS_13030 gene ilvG 2599 4296 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L4 protein_id gnl|my_center|LOCUS_13030 4300 4560 gene locus_tag LOCUS_13040 4300 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4557 6158 gene locus_tag LOCUS_13050 gene leuA 4557 6158 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI51 protein_id gnl|my_center|LOCUS_13050 6169 7143 gene locus_tag LOCUS_13060 gene ilvE 6169 7143 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_13060 7121 8554 gene locus_tag LOCUS_13070 gene leuC 7121 8554 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 protein_id gnl|my_center|LOCUS_13070 8541 9122 gene locus_tag LOCUS_13080 gene leuD 8541 9122 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 protein_id gnl|my_center|LOCUS_13080 >Feature sequence100 388 1119 gene locus_tag LOCUS_13090 388 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918263.1 protein_id gnl|my_center|LOCUS_13090 1211 4648 gene locus_tag LOCUS_13100 gene smc 1211 4648 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZ28 protein_id gnl|my_center|LOCUS_13100 4769 5071 gene locus_tag LOCUS_13110 4769 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5167 5943 gene locus_tag LOCUS_13120 gene atpB 5167 5943 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 protein_id gnl|my_center|LOCUS_13120 6005 6232 gene locus_tag LOCUS_13130 gene atpE 6005 6232 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533642.1 protein_id gnl|my_center|LOCUS_13130 6345 6905 gene locus_tag LOCUS_13140 gene atpF2 6345 6905 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0U9 protein_id gnl|my_center|LOCUS_13140 6902 7396 gene locus_tag LOCUS_13150 gene atpF1 6902 7396 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RM5 protein_id gnl|my_center|LOCUS_13150 7757 7476 gene locus_tag LOCUS_13160 7757 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 8050 9195 gene locus_tag LOCUS_13170 8050 9195 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408504.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence101 <1 1242 gene locus_tag LOCUS_13180 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SIY0:dihydroxy-acid dehydratase 2327 1239 gene locus_tag LOCUS_13190 2327 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2463 3365 gene locus_tag LOCUS_13200 2463 3365 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_13200 3398 5314 gene locus_tag LOCUS_13210 3398 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65531 protein_id gnl|my_center|LOCUS_13210 5389 6522 gene locus_tag LOCUS_13220 5389 6522 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCD5 protein_id gnl|my_center|LOCUS_13220 7443 6526 gene locus_tag LOCUS_13230 gene tesB 7443 6526 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_13230 7674 8393 gene locus_tag LOCUS_13240 7674 8393 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036286.1 protein_id gnl|my_center|LOCUS_13240 <9215 8390 gene locus_tag LOCUS_13250 <9215 8390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969301.1:peptidase M42 >Feature sequence102 347 1834 gene locus_tag LOCUS_13260 gene leuB 347 1834 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_13260 3113 1896 gene locus_tag LOCUS_13270 3113 1896 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_13270 3253 3178 gene locus_tag LOCUS_t00150 3253 3178 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3450 6131 gene locus_tag LOCUS_13280 3450 6131 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_13280 7759 6338 gene locus_tag LOCUS_13290 7759 6338 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW3 protein_id gnl|my_center|LOCUS_13290 8012 7839 gene locus_tag LOCUS_13300 gene yacG 8012 7839 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYW7 protein_id gnl|my_center|LOCUS_13300 9070 8012 gene locus_tag LOCUS_13310 9070 8012 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920200.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence103 452 9 gene locus_tag LOCUS_13320 452 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1330 527 gene locus_tag LOCUS_13330 gene flgH1 1330 527 CDS product flagellar L-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I09 protein_id gnl|my_center|LOCUS_13330 2301 1363 gene locus_tag LOCUS_13340 gene flgA 2301 1363 CDS product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 protein_id gnl|my_center|LOCUS_13340 3101 2316 gene locus_tag LOCUS_13350 gene flgG 3101 2316 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C944 protein_id gnl|my_center|LOCUS_13350 3864 3127 gene locus_tag LOCUS_13360 gene flgF 3864 3127 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06171 protein_id gnl|my_center|LOCUS_13360 4141 4689 gene locus_tag LOCUS_13370 4141 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 4730 5878 gene locus_tag LOCUS_13380 gene fliM 4730 5878 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXB5 protein_id gnl|my_center|LOCUS_13380 5875 6273 gene locus_tag LOCUS_13390 5875 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6288 6974 gene locus_tag LOCUS_13400 6288 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence104 106 945 gene locus_tag LOCUS_13410 gene dapD 106 945 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_13410 967 1725 gene locus_tag LOCUS_13420 gene map2 967 1725 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y582 protein_id gnl|my_center|LOCUS_13420 2540 1836 gene locus_tag LOCUS_13430 gene rpiA 2540 1836 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9T4 protein_id gnl|my_center|LOCUS_13430 4009 2537 gene locus_tag LOCUS_13440 gene gabD-2 4009 2537 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103085.1 protein_id gnl|my_center|LOCUS_13440 5411 4056 gene locus_tag LOCUS_13450 gene glmU 5411 4056 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5Z3 protein_id gnl|my_center|LOCUS_13450 5577 6215 gene locus_tag LOCUS_13460 gene gph 5577 6215 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5Z2 protein_id gnl|my_center|LOCUS_13460 6436 6218 gene locus_tag LOCUS_13470 6436 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 6693 6767 gene locus_tag LOCUS_t00160 6693 6767 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7118 8158 gene locus_tag LOCUS_13480 gene idiA 7118 8158 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_13480 >Feature sequence105 <1 1327 gene locus_tag LOCUS_13490 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921249.1:multidrug ABC transporter permease 1333 1854 gene locus_tag LOCUS_13500 1333 1854 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_13500 1925 2176 gene locus_tag LOCUS_13510 1925 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2180 2491 gene locus_tag LOCUS_13520 2180 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2640 4670 gene locus_tag LOCUS_13530 2640 4670 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640248.1 protein_id gnl|my_center|LOCUS_13530 5446 4667 gene locus_tag LOCUS_13540 5446 4667 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3I0 protein_id gnl|my_center|LOCUS_13540 6175 5483 gene locus_tag LOCUS_13550 6175 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6298 7095 gene locus_tag LOCUS_13560 6298 7095 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_13560 7916 7092 gene locus_tag LOCUS_13570 gene dapF 7916 7092 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZB6 protein_id gnl|my_center|LOCUS_13570 >Feature sequence106 <1 998 gene locus_tag LOCUS_13580 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919750.1:acetyl-CoA carboxylase biotin carboxylase subunit 1002 1652 gene locus_tag LOCUS_13590 gene aat 1002 1652 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWN5 protein_id gnl|my_center|LOCUS_13590 2137 1619 gene locus_tag LOCUS_13600 2137 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2670 2215 gene locus_tag LOCUS_13610 2670 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3085 2678 gene locus_tag LOCUS_13620 3085 2678 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640357.1 protein_id gnl|my_center|LOCUS_13620 3528 3175 gene locus_tag LOCUS_13630 3528 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967147.1 protein_id gnl|my_center|LOCUS_13630 3728 6265 gene locus_tag LOCUS_13640 3728 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6727 6272 gene locus_tag LOCUS_13650 6727 6272 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918312.1 protein_id gnl|my_center|LOCUS_13650 6836 8527 gene locus_tag LOCUS_13660 6836 8527 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence107 2519 3127 gene locus_tag LOCUS_13670 gene ccmA 2519 3127 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33570 protein_id gnl|my_center|LOCUS_13670 3124 3792 gene locus_tag LOCUS_13680 gene ccmB 3124 3792 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z04 protein_id gnl|my_center|LOCUS_13680 4013 4744 gene locus_tag LOCUS_13690 4013 4744 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_13690 4896 5456 gene locus_tag LOCUS_13700 gene ccmG 4896 5456 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336994.1 protein_id gnl|my_center|LOCUS_13700 5984 5460 gene locus_tag LOCUS_13710 5984 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 6115 6654 gene locus_tag LOCUS_13720 6115 6654 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_13720 7775 6648 gene locus_tag LOCUS_13730 7775 6648 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_13730 8530 7817 gene locus_tag LOCUS_13740 8530 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528989.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence108 285 857 gene locus_tag LOCUS_13750 285 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004192.1 protein_id gnl|my_center|LOCUS_13750 1306 770 gene locus_tag LOCUS_13760 1306 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383493.1 protein_id gnl|my_center|LOCUS_13760 2067 1306 gene locus_tag LOCUS_13770 2067 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383492.1 protein_id gnl|my_center|LOCUS_13770 2258 2446 gene locus_tag LOCUS_13780 2258 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014762197.1 protein_id gnl|my_center|LOCUS_13780 2507 2785 gene locus_tag LOCUS_13790 2507 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2854 3867 gene locus_tag LOCUS_13800 2854 3867 CDS product UDP-glucuronate 5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836238.1 protein_id gnl|my_center|LOCUS_13800 5098 3836 gene locus_tag LOCUS_13810 5098 3836 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_13810 5757 5095 gene locus_tag LOCUS_13820 5757 5095 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_13820 6798 5761 gene locus_tag LOCUS_13830 6798 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 7511 6822 gene locus_tag LOCUS_13840 7511 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence109 681 295 gene locus_tag LOCUS_13850 681 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1285 884 gene locus_tag LOCUS_13860 1285 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3303 1411 gene locus_tag LOCUS_13870 3303 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 protein_id gnl|my_center|LOCUS_13870 5277 3484 gene locus_tag LOCUS_13880 5277 3484 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_13880 5510 6022 gene locus_tag LOCUS_13890 5510 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6855 6025 gene locus_tag LOCUS_13900 6855 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067560.1 protein_id gnl|my_center|LOCUS_13900 6972 8342 gene locus_tag LOCUS_13910 6972 8342 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence110 755 351 gene locus_tag LOCUS_13920 755 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1184 771 gene locus_tag LOCUS_13930 1184 771 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_13930 1709 1188 gene locus_tag LOCUS_13940 1709 1188 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_13940 3121 1724 gene locus_tag LOCUS_13950 3121 1724 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_13950 3918 3148 gene locus_tag LOCUS_13960 3918 3148 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071944.1 protein_id gnl|my_center|LOCUS_13960 4463 4389 gene locus_tag LOCUS_t00170 4463 4389 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4621 4697 gene locus_tag LOCUS_t00180 4621 4697 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4834 6630 gene locus_tag LOCUS_13970 gene sppA 4834 6630 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8B4 protein_id gnl|my_center|LOCUS_13970 7794 6712 gene locus_tag LOCUS_13980 7794 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405252.1 protein_id gnl|my_center|LOCUS_13980 <8788 7800 gene locus_tag LOCUS_13990 <8788 7800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388350.1:peptide ABC transporter substrate-binding protein >Feature sequence111 57 365 gene locus_tag LOCUS_14000 57 365 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085795.1 protein_id gnl|my_center|LOCUS_14000 518 372 gene locus_tag LOCUS_14010 518 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2449 668 gene locus_tag LOCUS_14020 2449 668 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_14020 3384 2446 gene locus_tag LOCUS_14030 3384 2446 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_14030 3534 5276 gene locus_tag LOCUS_14040 3534 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_14040 5404 6351 gene locus_tag LOCUS_14050 5404 6351 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532555.1 protein_id gnl|my_center|LOCUS_14050 6352 7323 gene locus_tag LOCUS_14060 gene ephA 6352 7323 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085665.1 protein_id gnl|my_center|LOCUS_14060 7323 8471 gene locus_tag LOCUS_14070 7323 8471 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087109.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence112 301 627 gene locus_tag LOCUS_14080 301 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 659 1345 gene locus_tag LOCUS_14090 gene feuP 659 1345 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527364.1 protein_id gnl|my_center|LOCUS_14090 1342 2763 gene locus_tag LOCUS_14100 1342 2763 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_14100 2812 4149 gene locus_tag LOCUS_14110 2812 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4190 4840 gene locus_tag LOCUS_14120 4190 4840 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_14120 4837 5793 gene locus_tag LOCUS_14130 4837 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5790 6287 gene locus_tag LOCUS_14140 gene ccmE 5790 6287 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8M7 protein_id gnl|my_center|LOCUS_14140 6284 8212 gene locus_tag LOCUS_14150 6284 8212 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920601.1 protein_id gnl|my_center|LOCUS_14150 8209 8580 gene locus_tag LOCUS_14160 8209 8580 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920600.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence113 1247 129 gene locus_tag LOCUS_14170 gene dnaN 1247 129 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP6 protein_id gnl|my_center|LOCUS_14170 2895 1402 gene locus_tag LOCUS_14180 gene dnaA 2895 1402 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 protein_id gnl|my_center|LOCUS_14180 3610 3371 gene locus_tag LOCUS_14190 gene rpsT 3610 3371 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5D1 protein_id gnl|my_center|LOCUS_14190 4557 3781 gene locus_tag LOCUS_14200 4557 3781 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_14200 5609 4689 gene locus_tag LOCUS_14210 5609 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_14210 6605 5733 gene locus_tag LOCUS_14220 gene mutM 6605 5733 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_14220 6704 7381 gene locus_tag LOCUS_14230 6704 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 7437 8189 gene locus_tag LOCUS_14240 gene ubiE 7437 8189 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A258 protein_id gnl|my_center|LOCUS_14240 >Feature sequence114 605 201 gene locus_tag LOCUS_14250 605 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1234 650 gene locus_tag LOCUS_14260 1234 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551457.1 protein_id gnl|my_center|LOCUS_14260 1859 1305 gene locus_tag LOCUS_14270 1859 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2188 1859 gene locus_tag LOCUS_14280 2188 1859 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_14280 2371 2799 gene locus_tag LOCUS_14290 2371 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2792 3004 gene locus_tag LOCUS_14300 2792 3004 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_14300 4696 3011 gene locus_tag LOCUS_14310 gene trxB 4696 3011 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636459.2 protein_id gnl|my_center|LOCUS_14310 6707 4785 gene locus_tag LOCUS_14320 6707 4785 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037986.1 protein_id gnl|my_center|LOCUS_14320 6991 6791 gene locus_tag LOCUS_14330 6991 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 7785 7042 gene locus_tag LOCUS_14340 7785 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 8276 7782 gene locus_tag LOCUS_14350 8276 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence115 1220 336 gene locus_tag LOCUS_14360 gene atpG 1220 336 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S2 protein_id gnl|my_center|LOCUS_14360 1396 1250 gene locus_tag LOCUS_14370 1396 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2981 1446 gene locus_tag LOCUS_14380 gene atpA 2981 1446 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL31 protein_id gnl|my_center|LOCUS_14380 3550 2990 gene locus_tag LOCUS_14390 gene atpH 3550 2990 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5I3 protein_id gnl|my_center|LOCUS_14390 4048 3752 gene locus_tag LOCUS_14400 4048 3752 CDS product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 protein_id gnl|my_center|LOCUS_14400 4295 4041 gene locus_tag LOCUS_14410 4295 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 6549 4360 gene locus_tag LOCUS_14420 gene priA 6549 4360 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB85 protein_id gnl|my_center|LOCUS_14420 6679 7380 gene locus_tag LOCUS_14430 6679 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7377 8309 gene locus_tag LOCUS_14440 gene xerC 7377 8309 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E8 protein_id gnl|my_center|LOCUS_14440 >Feature sequence116 <1 1452 gene locus_tag LOCUS_14450 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920158.1:long-chain-acyl-CoA synthetase 4069 1577 gene locus_tag LOCUS_14460 gene divL 4069 1577 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921313.1 protein_id gnl|my_center|LOCUS_14460 4528 4184 gene locus_tag LOCUS_14470 4528 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4903 5874 gene locus_tag LOCUS_14480 4903 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5874 6836 gene locus_tag LOCUS_14490 gene metA 5874 6836 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V8 protein_id gnl|my_center|LOCUS_14490 6833 7990 gene locus_tag LOCUS_14500 gene metB 6833 7990 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_14500 8262 7987 gene locus_tag LOCUS_14510 8262 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence117 445 263 gene locus_tag LOCUS_14520 gene rpmF 445 263 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7K2 protein_id gnl|my_center|LOCUS_14520 2507 879 gene locus_tag LOCUS_14530 gene pyrG 2507 879 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW64 protein_id gnl|my_center|LOCUS_14530 3027 2593 gene locus_tag LOCUS_14540 3027 2593 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974585.1 protein_id gnl|my_center|LOCUS_14540 3466 3035 gene locus_tag LOCUS_14550 3466 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4508 3516 gene locus_tag LOCUS_14560 4508 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 5320 4586 gene locus_tag LOCUS_14570 gene cbbJ 5320 4586 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J536 protein_id gnl|my_center|LOCUS_14570 5499 7388 gene locus_tag LOCUS_14580 gene ppiD 5499 7388 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8U9 protein_id gnl|my_center|LOCUS_14580 >Feature sequence118 1383 238 gene locus_tag LOCUS_14590 gene rodA 1383 238 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_14590 3263 1386 gene locus_tag LOCUS_14600 3263 1386 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_14600 3797 3285 gene locus_tag LOCUS_14610 3797 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4796 3798 gene locus_tag LOCUS_14620 4796 3798 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919418.1 protein_id gnl|my_center|LOCUS_14620 5875 4835 gene locus_tag LOCUS_14630 gene mreB 5875 4835 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919417.1 protein_id gnl|my_center|LOCUS_14630 6727 5933 gene locus_tag LOCUS_14640 6727 5933 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919412.1 protein_id gnl|my_center|LOCUS_14640 7778 6786 gene locus_tag LOCUS_14650 gene ilvC 7778 6786 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RU74 protein_id gnl|my_center|LOCUS_14650 >Feature sequence119 <1 532 gene locus_tag LOCUS_14660 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920680.1:aminopeptidase 710 1624 gene locus_tag LOCUS_14670 710 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1693 2553 gene locus_tag LOCUS_14680 gene map 1693 2553 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BI2 protein_id gnl|my_center|LOCUS_14680 2560 3243 gene locus_tag LOCUS_14690 2560 3243 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ6 protein_id gnl|my_center|LOCUS_14690 3417 4832 gene locus_tag LOCUS_14700 gene cysG 3417 4832 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 protein_id gnl|my_center|LOCUS_14700 4829 5110 gene locus_tag LOCUS_14710 4829 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5115 6746 gene locus_tag LOCUS_14720 5115 6746 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975275.1 protein_id gnl|my_center|LOCUS_14720 6736 7839 gene locus_tag LOCUS_14730 6736 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence120 673 1194 gene locus_tag LOCUS_14740 673 1194 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 protein_id gnl|my_center|LOCUS_14740 1856 1356 gene locus_tag LOCUS_14750 1856 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2634 2026 gene locus_tag LOCUS_14760 2634 2026 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975220.1 protein_id gnl|my_center|LOCUS_14760 3253 2693 gene locus_tag LOCUS_14770 3253 2693 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531342.1 protein_id gnl|my_center|LOCUS_14770 3588 4316 gene locus_tag LOCUS_14780 3588 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920491.1 protein_id gnl|my_center|LOCUS_14780 4592 5482 gene locus_tag LOCUS_14790 4592 5482 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931482.1 protein_id gnl|my_center|LOCUS_14790 5487 6416 gene locus_tag LOCUS_14800 gene fmt 5487 6416 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABE9 protein_id gnl|my_center|LOCUS_14800 6419 7180 gene locus_tag LOCUS_14810 gene truA 6419 7180 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP1 protein_id gnl|my_center|LOCUS_14810 7734 7150 gene locus_tag LOCUS_14820 7734 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence121 1745 411 gene locus_tag LOCUS_14830 gene proS 1745 411 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z5 protein_id gnl|my_center|LOCUS_14830 2214 1837 gene locus_tag LOCUS_14840 2214 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2642 2214 gene locus_tag LOCUS_14850 2642 2214 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_14850 4330 2657 gene locus_tag LOCUS_14860 4330 2657 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_14860 5116 4334 gene locus_tag LOCUS_14870 gene coaX 5116 4334 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A7 protein_id gnl|my_center|LOCUS_14870 5859 5122 gene locus_tag LOCUS_14880 5859 5122 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_14880 7311 5860 gene locus_tag LOCUS_14890 gene nuoN 7311 5860 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH96 protein_id gnl|my_center|LOCUS_14890 8029 7331 gene locus_tag LOCUS_14900 8029 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence122 293 1021 gene locus_tag LOCUS_14910 293 1021 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 protein_id gnl|my_center|LOCUS_14910 1018 2127 gene locus_tag LOCUS_14920 1018 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920082.1 protein_id gnl|my_center|LOCUS_14920 3196 2117 gene locus_tag LOCUS_14930 gene hisC2 3196 2117 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UL9 protein_id gnl|my_center|LOCUS_14930 3972 3193 gene locus_tag LOCUS_14940 3972 3193 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918408.1 protein_id gnl|my_center|LOCUS_14940 4083 4847 gene locus_tag LOCUS_14950 gene gloB 4083 4847 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_14950 4847 5302 gene locus_tag LOCUS_14960 4847 5302 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918406.1 protein_id gnl|my_center|LOCUS_14960 6045 5317 gene locus_tag LOCUS_14970 6045 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6858 6136 gene locus_tag LOCUS_14980 6858 6136 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067323.1 protein_id gnl|my_center|LOCUS_14980 7053 7637 gene locus_tag LOCUS_14990 7053 7637 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence123 482 1429 gene locus_tag LOCUS_15000 482 1429 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 protein_id gnl|my_center|LOCUS_15000 1475 1927 gene locus_tag LOCUS_15010 1475 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2219 2773 gene locus_tag LOCUS_15020 2219 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4176 2848 gene locus_tag LOCUS_15030 4176 2848 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_15030 6591 4333 gene locus_tag LOCUS_15040 gene fyuA 6591 4333 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_15040 6723 7481 gene locus_tag LOCUS_15050 6723 7481 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918223.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence124 1209 256 gene locus_tag LOCUS_15060 gene prfB 1209 256 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWM3 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15060 3961 1478 gene locus_tag LOCUS_15070 3961 1478 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_15070 5345 4086 gene locus_tag LOCUS_15080 5345 4086 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919742.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence125 151 780 gene locus_tag LOCUS_15090 151 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 785 1081 gene locus_tag LOCUS_15100 785 1081 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 protein_id gnl|my_center|LOCUS_15100 2599 1082 gene locus_tag LOCUS_15110 2599 1082 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_15110 2938 2702 gene locus_tag LOCUS_15120 2938 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3084 4064 gene locus_tag LOCUS_15130 3084 4064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 protein_id gnl|my_center|LOCUS_15130 4108 4458 gene locus_tag LOCUS_15140 4108 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 4578 4823 gene locus_tag LOCUS_15150 4578 4823 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_15150 4823 5440 gene locus_tag LOCUS_15160 4823 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 7437 5437 gene locus_tag LOCUS_15170 7437 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 7603 7679 gene locus_tag LOCUS_t00190 7603 7679 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence126 1143 823 gene locus_tag LOCUS_15180 1143 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1887 1354 gene locus_tag LOCUS_15190 gene ahpD 1887 1354 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ANL0 protein_id gnl|my_center|LOCUS_15190 2541 1987 gene locus_tag LOCUS_15200 gene ahpC 2541 1987 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084586.1 protein_id gnl|my_center|LOCUS_15200 2674 3612 gene locus_tag LOCUS_15210 2674 3612 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 protein_id gnl|my_center|LOCUS_15210 3682 4491 gene locus_tag LOCUS_15220 gene uppP 3682 4491 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SL0 protein_id gnl|my_center|LOCUS_15220 5615 4653 gene locus_tag LOCUS_15230 5615 4653 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_15230 5785 5871 gene locus_tag LOCUS_t00200 5785 5871 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6344 5955 gene locus_tag LOCUS_15240 6344 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 7186 6494 gene locus_tag LOCUS_15250 7186 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence127 541 2457 gene locus_tag LOCUS_15260 gene dnaK 541 2457 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY0 protein_id gnl|my_center|LOCUS_15260 2511 3728 gene locus_tag LOCUS_15270 gene dnaJ 2511 3728 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM8 protein_id gnl|my_center|LOCUS_15270 3802 4635 gene locus_tag LOCUS_15280 gene dapB 3802 4635 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_15280 7406 4632 gene locus_tag LOCUS_15290 7406 4632 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265962.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence128 680 342 gene locus_tag LOCUS_15300 680 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1075 710 gene locus_tag LOCUS_15310 1075 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3152 6250 gene locus_tag LOCUS_15320 3152 6250 CDS product type I endonuclease-methyltransferase fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_15320 6250 6903 gene locus_tag LOCUS_15330 6250 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 7327 7566 gene locus_tag LOCUS_15340 7327 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence129 505 3243 gene locus_tag LOCUS_15350 505 3243 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_15350 4467 3517 gene locus_tag LOCUS_15360 4467 3517 CDS product antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368621.1 protein_id gnl|my_center|LOCUS_15360 5843 5400 gene locus_tag LOCUS_15370 5843 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5992 6879 gene locus_tag LOCUS_15380 5992 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 7199 6918 gene locus_tag LOCUS_15390 7199 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence130 187 420 gene locus_tag LOCUS_15400 187 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 519 1865 gene locus_tag LOCUS_15410 519 1865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_15410 3163 1862 gene locus_tag LOCUS_15420 3163 1862 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706992.1 protein_id gnl|my_center|LOCUS_15420 4563 3163 gene locus_tag LOCUS_15430 4563 3163 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968992.1 protein_id gnl|my_center|LOCUS_15430 4581 5168 gene locus_tag LOCUS_15440 4581 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence131 1 384 gene locus_tag LOCUS_15450 1 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 534 884 gene locus_tag LOCUS_15460 534 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 933 1349 gene locus_tag LOCUS_15470 gene sufE 933 1349 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 protein_id gnl|my_center|LOCUS_15470 2128 1346 gene locus_tag LOCUS_15480 2128 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2538 2119 gene locus_tag LOCUS_15490 2538 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3859 2786 gene locus_tag LOCUS_15500 3859 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 protein_id gnl|my_center|LOCUS_15500 3999 5267 gene locus_tag LOCUS_15510 3999 5267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267319.1 protein_id gnl|my_center|LOCUS_15510 5295 5702 gene locus_tag LOCUS_15520 5295 5702 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389660.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence132 136 1455 gene locus_tag LOCUS_15530 gene cysS 136 1455 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY2 protein_id gnl|my_center|LOCUS_15530 1464 1898 gene locus_tag LOCUS_15540 gene nifU 1464 1898 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 protein_id gnl|my_center|LOCUS_15540 1911 2231 gene locus_tag LOCUS_15550 1911 2231 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8C4 protein_id gnl|my_center|LOCUS_15550 2265 3200 gene locus_tag LOCUS_15560 2265 3200 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 protein_id gnl|my_center|LOCUS_15560 4114 3197 gene locus_tag LOCUS_15570 4114 3197 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_15570 5817 4111 gene locus_tag LOCUS_15580 5817 4111 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_15580 5944 6678 gene locus_tag LOCUS_15590 5944 6678 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 protein_id gnl|my_center|LOCUS_15590 6802 7215 gene locus_tag LOCUS_15600 6802 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918358.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence133 <1 2124 gene locus_tag LOCUS_15610 <1 2124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205034.1:outer membrane protein 2268 2423 gene locus_tag LOCUS_15620 2268 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5236 2429 gene locus_tag LOCUS_15630 5236 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6750 5293 gene locus_tag LOCUS_15640 6750 5293 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_15640 <7514 6899 gene locus_tag LOCUS_15650 <7514 6899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87I38:catalase-peroxidase 2 >Feature sequence134 504 944 gene locus_tag LOCUS_15660 504 944 CDS product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384082.1 protein_id gnl|my_center|LOCUS_15660 2046 1024 gene locus_tag LOCUS_15670 2046 1024 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_15670 3317 2103 gene locus_tag LOCUS_15680 gene pgk 3317 2103 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIJ2 protein_id gnl|my_center|LOCUS_15680 4343 3333 gene locus_tag LOCUS_15690 gene gapB 4343 3333 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX57 protein_id gnl|my_center|LOCUS_15690 4522 4752 gene locus_tag LOCUS_15700 4522 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6241 5084 gene locus_tag LOCUS_15710 6241 5084 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2D4 protein_id gnl|my_center|LOCUS_15710 6987 6238 gene locus_tag LOCUS_15720 6987 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence135 2044 1622 gene locus_tag LOCUS_15730 gene infC 2044 1622 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9D9 protein_id gnl|my_center|LOCUS_15730 3293 2307 gene locus_tag LOCUS_15740 3293 2307 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 protein_id gnl|my_center|LOCUS_15740 4447 3290 gene locus_tag LOCUS_15750 4447 3290 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_15750 4560 5315 gene locus_tag LOCUS_15760 4560 5315 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_15760 5885 5319 gene locus_tag LOCUS_15770 5885 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 7138 5981 gene locus_tag LOCUS_15780 7138 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence136 914 123 gene locus_tag LOCUS_15790 914 123 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_15790 2143 926 gene locus_tag LOCUS_15800 2143 926 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_15800 2309 2133 gene locus_tag LOCUS_15810 2309 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2245 2979 gene locus_tag LOCUS_15820 2245 2979 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_15820 3228 5072 gene locus_tag LOCUS_15830 gene mutL 3228 5072 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H173 protein_id gnl|my_center|LOCUS_15830 5784 5224 gene locus_tag LOCUS_15840 5784 5224 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_15840 6724 5759 gene locus_tag LOCUS_15850 6724 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 6765 7229 gene locus_tag LOCUS_15860 gene tadA 6765 7229 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABJ6 protein_id gnl|my_center|LOCUS_15860 >Feature sequence137 1483 1845 gene locus_tag LOCUS_15870 1483 1845 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975978.1 protein_id gnl|my_center|LOCUS_15870 1887 3620 gene locus_tag LOCUS_15880 1887 3620 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920032.1 protein_id gnl|my_center|LOCUS_15880 4017 3625 gene locus_tag LOCUS_15890 4017 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_15890 4450 4004 gene locus_tag LOCUS_15900 4450 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640072.1 protein_id gnl|my_center|LOCUS_15900 4621 4824 gene locus_tag LOCUS_15910 4621 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 6287 5169 gene locus_tag LOCUS_15920 6287 5169 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947550.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence138 2622 1249 gene locus_tag LOCUS_15930 gene trkA 2622 1249 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535437.1 protein_id gnl|my_center|LOCUS_15930 4046 2622 gene locus_tag LOCUS_15940 gene ntrX 4046 2622 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919611.1 protein_id gnl|my_center|LOCUS_15940 6269 4050 gene locus_tag LOCUS_15950 gene ntrY 6269 4050 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640318.1 protein_id gnl|my_center|LOCUS_15950 <7404 6349 gene locus_tag LOCUS_15960 <7404 6349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099377.1:nitrogen regulation protein NR(I) >Feature sequence139 1083 115 gene locus_tag LOCUS_15970 gene hslO 1083 115 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58097 protein_id gnl|my_center|LOCUS_15970 2290 1106 gene locus_tag LOCUS_15980 gene argD 2290 1106 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q7 protein_id gnl|my_center|LOCUS_15980 3159 2314 gene locus_tag LOCUS_15990 3159 2314 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A651 protein_id gnl|my_center|LOCUS_15990 3403 3960 gene locus_tag LOCUS_16000 3403 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920106.1 protein_id gnl|my_center|LOCUS_16000 4703 4017 gene locus_tag LOCUS_16010 gene phoB 4703 4017 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_16010 5455 4715 gene locus_tag LOCUS_16020 gene phoU 5455 4715 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV9 protein_id gnl|my_center|LOCUS_16020 6306 5485 gene locus_tag LOCUS_16030 gene pstB 6306 5485 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYG4 protein_id gnl|my_center|LOCUS_16030 <7354 6308 gene locus_tag LOCUS_16040 <7354 6308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWU1:phosphate transport system permease protein PstA >Feature sequence140 1198 191 gene locus_tag LOCUS_16050 1198 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1418 1343 gene locus_tag LOCUS_t00210 1418 1343 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2041 1538 gene locus_tag LOCUS_16060 2041 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2157 3509 gene locus_tag LOCUS_16070 gene aroA 2157 3509 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 protein_id gnl|my_center|LOCUS_16070 3584 4807 gene locus_tag LOCUS_16080 gene trpB 3584 4807 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ6 protein_id gnl|my_center|LOCUS_16080 4848 5135 gene locus_tag LOCUS_16090 4848 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_16090 5107 5412 gene locus_tag LOCUS_16100 5107 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678786.1 protein_id gnl|my_center|LOCUS_16100 5513 6304 gene locus_tag LOCUS_16110 gene trpA 5513 6304 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12291 protein_id gnl|my_center|LOCUS_16110 6335 7213 gene locus_tag LOCUS_16120 gene accD 6335 7213 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L5 protein_id gnl|my_center|LOCUS_16120 >Feature sequence141 2485 818 gene locus_tag LOCUS_16130 gene phyK 2485 818 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923290.1 protein_id gnl|my_center|LOCUS_16130 3143 2544 gene locus_tag LOCUS_16140 gene sigU 3143 2544 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920723.1 protein_id gnl|my_center|LOCUS_16140 3402 3130 gene locus_tag LOCUS_16150 3402 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3612 4400 gene locus_tag LOCUS_16160 gene phyR 3612 4400 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_16160 4527 4603 gene locus_tag LOCUS_t00220 4527 4603 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4958 4659 gene locus_tag LOCUS_16170 4958 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 5004 5132 gene locus_tag LOCUS_16180 5004 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 5280 7283 gene locus_tag LOCUS_16190 5280 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence142 1563 799 gene locus_tag LOCUS_16200 1563 799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_16200 2714 1560 gene locus_tag LOCUS_16210 2714 1560 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920177.1 protein_id gnl|my_center|LOCUS_16210 4018 2819 gene locus_tag LOCUS_16220 4018 2819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919355.1 protein_id gnl|my_center|LOCUS_16220 4142 5383 gene locus_tag LOCUS_16230 4142 5383 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_16230 5380 6099 gene locus_tag LOCUS_16240 5380 6099 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_16240 6096 7199 gene locus_tag LOCUS_16250 6096 7199 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence143 <1 641 gene locus_tag LOCUS_16260 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920777.1:type II secretion system protein 780 995 gene locus_tag LOCUS_16270 780 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1055 1891 gene locus_tag LOCUS_16280 1055 1891 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919074.1 protein_id gnl|my_center|LOCUS_16280 1888 2871 gene locus_tag LOCUS_16290 1888 2871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 protein_id gnl|my_center|LOCUS_16290 2868 3623 gene locus_tag LOCUS_16300 2868 3623 CDS product iron ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228313.1 protein_id gnl|my_center|LOCUS_16300 3645 5570 gene locus_tag LOCUS_16310 3645 5570 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_16310 6151 5579 gene locus_tag LOCUS_16320 6151 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence144 832 611 gene locus_tag LOCUS_16330 832 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 948 1964 gene locus_tag LOCUS_16340 gene ispB 948 1964 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971026.1 protein_id gnl|my_center|LOCUS_16340 2986 1961 gene locus_tag LOCUS_16350 2986 1961 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_16350 3882 2986 gene locus_tag LOCUS_16360 gene ispE 3882 2986 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8L7 protein_id gnl|my_center|LOCUS_16360 5540 3879 gene locus_tag LOCUS_16370 5540 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919212.1 protein_id gnl|my_center|LOCUS_16370 <7180 5581 gene locus_tag LOCUS_16380 <7180 5581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971317.1:electron transfer flavoprotein-ubiquinone oxidoreductase >Feature sequence145 <1 722 gene locus_tag LOCUS_16390 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZI8:laccase domain protein 981 739 gene locus_tag LOCUS_16400 981 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1347 1066 gene locus_tag LOCUS_16410 1347 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_16410 2249 1440 gene locus_tag LOCUS_16420 2249 1440 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921533.1 protein_id gnl|my_center|LOCUS_16420 2889 2275 gene locus_tag LOCUS_16430 2889 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 5314 3218 gene locus_tag LOCUS_16440 5314 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6470 5460 gene locus_tag LOCUS_16450 6470 5460 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083626.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence146 705 1256 gene locus_tag LOCUS_16460 705 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1407 1850 gene locus_tag LOCUS_16470 1407 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2084 3544 gene locus_tag LOCUS_16480 2084 3544 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_16480 4987 3839 gene locus_tag LOCUS_16490 gene cydB 4987 3839 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918649.1 protein_id gnl|my_center|LOCUS_16490 6596 5001 gene locus_tag LOCUS_16500 gene cydA 6596 5001 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918648.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence147 4868 4161 gene locus_tag LOCUS_16510 4868 4161 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707362.1 protein_id gnl|my_center|LOCUS_16510 6349 4910 gene locus_tag LOCUS_16520 6349 4910 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339151.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence148 2055 1090 gene locus_tag LOCUS_16530 2055 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_16530 2509 2039 gene locus_tag LOCUS_16540 2509 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 3378 2563 gene locus_tag LOCUS_16550 3378 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 3469 4344 gene locus_tag LOCUS_16560 3469 4344 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_16560 <6938 4636 gene locus_tag LOCUS_16570 <6938 4636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918875.1:TonB-dependent receptor >Feature sequence149 3887 666 gene locus_tag LOCUS_16580 3887 666 CDS product autotransporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265524.1 protein_id gnl|my_center|LOCUS_16580 5476 4073 gene locus_tag LOCUS_16590 gene glnA 5476 4073 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9D7 protein_id gnl|my_center|LOCUS_16590 5913 5545 gene locus_tag LOCUS_16600 gene glnB 5913 5545 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_16600 >Feature sequence150 54 818 gene locus_tag LOCUS_16610 gene mvrA 54 818 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971635.1 protein_id gnl|my_center|LOCUS_16610 828 1646 gene locus_tag LOCUS_16620 828 1646 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_16620 3132 1780 gene locus_tag LOCUS_16630 gene glmM 3132 1780 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXK7 protein_id gnl|my_center|LOCUS_16630 3801 3139 gene locus_tag LOCUS_16640 gene tal 3801 3139 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2F1 protein_id gnl|my_center|LOCUS_16640 4431 3820 gene locus_tag LOCUS_16650 4431 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5923 4517 gene locus_tag LOCUS_16660 5923 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 <6739 6024 gene locus_tag LOCUS_16670 <6739 6024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920160.1:polymerase >Feature sequence151 1065 49 gene locus_tag LOCUS_16680 1065 49 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_16680 1724 1104 gene locus_tag LOCUS_16690 gene nadD 1724 1104 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2X5 protein_id gnl|my_center|LOCUS_16690 2779 1721 gene locus_tag LOCUS_16700 gene obg 2779 1721 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CB41 protein_id gnl|my_center|LOCUS_16700 3379 2819 gene locus_tag LOCUS_16710 3379 2819 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918206.1 protein_id gnl|my_center|LOCUS_16710 3806 3537 gene locus_tag LOCUS_16720 gene rpmA 3806 3537 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB7 protein_id gnl|my_center|LOCUS_16720 4512 3853 gene locus_tag LOCUS_16730 4512 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4827 4916 gene locus_tag LOCUS_t00230 4827 4916 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5045 6310 gene locus_tag LOCUS_16740 5045 6310 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339202.1 protein_id gnl|my_center|LOCUS_16740 6471 6280 gene locus_tag LOCUS_16750 6471 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 6656 6468 gene locus_tag LOCUS_16760 6656 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence152 1447 554 gene locus_tag LOCUS_16770 1447 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919706.1 protein_id gnl|my_center|LOCUS_16770 2662 1517 gene locus_tag LOCUS_16780 2662 1517 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_16780 2767 4044 gene locus_tag LOCUS_16790 gene popA 2767 4044 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919708.1 protein_id gnl|my_center|LOCUS_16790 <6716 4041 gene locus_tag LOCUS_16800 <6716 4041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C9F5:transcription-repair-coupling factor >Feature sequence153 1688 1071 gene locus_tag LOCUS_16810 1688 1071 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_16810 2370 1705 gene locus_tag LOCUS_16820 2370 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2852 2370 gene locus_tag LOCUS_16830 gene nrdR 2852 2370 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J5 protein_id gnl|my_center|LOCUS_16830 4168 2864 gene locus_tag LOCUS_16840 gene glyA 4168 2864 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_16840 4421 4849 gene locus_tag LOCUS_16850 4421 4849 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919233.1 protein_id gnl|my_center|LOCUS_16850 5112 4867 gene locus_tag LOCUS_16860 5112 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 6326 5112 gene locus_tag LOCUS_16870 6326 5112 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J8 protein_id gnl|my_center|LOCUS_16870 >Feature sequence154 88 648 gene locus_tag LOCUS_16880 gene rplE 88 648 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U1 protein_id gnl|my_center|LOCUS_16880 700 1005 gene locus_tag LOCUS_16890 gene rpsN 700 1005 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C686 protein_id gnl|my_center|LOCUS_16890 1019 1417 gene locus_tag LOCUS_16900 gene rpsH 1019 1417 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C3 protein_id gnl|my_center|LOCUS_16900 1432 1968 gene locus_tag LOCUS_16910 gene rplF 1432 1968 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J99 protein_id gnl|my_center|LOCUS_16910 1983 2345 gene locus_tag LOCUS_16920 gene rplR 1983 2345 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T7 protein_id gnl|my_center|LOCUS_16920 2355 2951 gene locus_tag LOCUS_16930 gene rpsE 2355 2951 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F1 protein_id gnl|my_center|LOCUS_16930 2963 3154 gene locus_tag LOCUS_16940 gene rpmD 2963 3154 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME2 protein_id gnl|my_center|LOCUS_16940 3187 3663 gene locus_tag LOCUS_16950 gene rplO 3187 3663 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q3 protein_id gnl|my_center|LOCUS_16950 3752 5101 gene locus_tag LOCUS_16960 gene secY 3752 5101 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ9 protein_id gnl|my_center|LOCUS_16960 5098 5661 gene locus_tag LOCUS_16970 gene adk 5098 5661 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F5 protein_id gnl|my_center|LOCUS_16970 5874 6242 gene locus_tag LOCUS_16980 gene rpsM 5874 6242 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE39 protein_id gnl|my_center|LOCUS_16980 6255 6644 gene locus_tag LOCUS_16990 gene rpsK 6255 6644 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 protein_id gnl|my_center|LOCUS_16990 >Feature sequence155 622 2349 gene locus_tag LOCUS_17000 622 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4136 2352 gene locus_tag LOCUS_17010 4136 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6471 4141 gene locus_tag LOCUS_17020 6471 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence156 <1 1177 gene locus_tag LOCUS_17030 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WPS3:putative copper-exporting P-type ATPase V 1855 1187 gene locus_tag LOCUS_17040 1855 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2310 1906 gene locus_tag LOCUS_17050 gene hmrR2 2310 1906 CDS product heavy metal-dependent transcription regulator 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58379 protein_id gnl|my_center|LOCUS_17050 3058 2312 gene locus_tag LOCUS_17060 3058 2312 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_17060 3271 3672 gene locus_tag LOCUS_17070 3271 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5272 4127 gene locus_tag LOCUS_17080 gene nodX 5272 4127 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence157 1464 625 gene locus_tag LOCUS_17090 gene prmC 1464 625 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG70 protein_id gnl|my_center|LOCUS_17090 2796 1723 gene locus_tag LOCUS_17100 gene prfA 2796 1723 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9V5 protein_id gnl|my_center|LOCUS_17100 3395 2814 gene locus_tag LOCUS_17110 3395 2814 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749H7 protein_id gnl|my_center|LOCUS_17110 4749 3970 gene locus_tag LOCUS_17120 4749 3970 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N1 protein_id gnl|my_center|LOCUS_17120 6567 4777 gene locus_tag LOCUS_17130 6567 4777 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N0 protein_id gnl|my_center|LOCUS_17130 >Feature sequence158 <1 2536 gene locus_tag LOCUS_17140 <1 2536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265799.1:N-methylhydantoinase HyuB 2621 3697 gene locus_tag LOCUS_17150 2621 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 5626 3962 gene locus_tag LOCUS_17160 5626 3962 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920009.1 protein_id gnl|my_center|LOCUS_17160 6569 5721 gene locus_tag LOCUS_17170 6569 5721 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence159 1311 3560 gene locus_tag LOCUS_17180 1311 3560 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_17180 5192 3765 gene locus_tag LOCUS_17190 5192 3765 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_17190 <6512 5251 gene locus_tag LOCUS_17200 <6512 5251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072087.1:bifunctional metallophosphatase/5'-nucleotidase >Feature sequence160 819 448 gene locus_tag LOCUS_17210 819 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1802 975 gene locus_tag LOCUS_17220 gene fljK 1802 975 CDS product flagellin FljK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18913 protein_id gnl|my_center|LOCUS_17220 2988 2158 gene locus_tag LOCUS_17230 gene fljL 2988 2158 CDS product flagellin FljL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18914 protein_id gnl|my_center|LOCUS_17230 3625 3251 gene locus_tag LOCUS_17240 gene flaF 3625 3251 CDS product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 protein_id gnl|my_center|LOCUS_17240 4043 3633 gene locus_tag LOCUS_17250 gene flbT 4043 3633 CDS product flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21297 protein_id gnl|my_center|LOCUS_17250 4229 6019 gene locus_tag LOCUS_17260 gene flbA 4229 6019 CDS product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21296 protein_id gnl|my_center|LOCUS_17260 >Feature sequence161 1133 630 gene locus_tag LOCUS_17270 1133 630 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640242.1 protein_id gnl|my_center|LOCUS_17270 2130 1126 gene locus_tag LOCUS_17280 2130 1126 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919322.1 protein_id gnl|my_center|LOCUS_17280 3765 2140 gene locus_tag LOCUS_17290 3765 2140 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 protein_id gnl|my_center|LOCUS_17290 4039 4866 gene locus_tag LOCUS_17300 gene mhpD 4039 4866 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035403.1 protein_id gnl|my_center|LOCUS_17300 5517 4879 gene locus_tag LOCUS_17310 5517 4879 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_17310 <6421 5514 gene locus_tag LOCUS_17320 <6421 5514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004406660.1:phosphogluconate dehydratase >Feature sequence162 285 932 gene locus_tag LOCUS_17330 285 932 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C8 protein_id gnl|my_center|LOCUS_17330 2182 929 gene locus_tag LOCUS_17340 2182 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2289 2789 gene locus_tag LOCUS_17350 2289 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2901 3080 gene locus_tag LOCUS_17360 2901 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4665 3106 gene locus_tag LOCUS_17370 gene yhcX 4665 3106 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_17370 5510 4662 gene locus_tag LOCUS_17380 5510 4662 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 protein_id gnl|my_center|LOCUS_17380 6394 5513 gene locus_tag LOCUS_17390 6394 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence163 576 2882 gene locus_tag LOCUS_17400 gene uvrD 576 2882 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7U0 protein_id gnl|my_center|LOCUS_17400 2951 3595 gene locus_tag LOCUS_17410 2951 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 4474 3602 gene locus_tag LOCUS_17420 gene prmA 4474 3602 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 protein_id gnl|my_center|LOCUS_17420 5326 4493 gene locus_tag LOCUS_17430 5326 4493 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA53 protein_id gnl|my_center|LOCUS_17430 6321 5323 gene locus_tag LOCUS_17440 6321 5323 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence164 457 1560 gene locus_tag LOCUS_17450 457 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1789 1586 gene locus_tag LOCUS_17460 1789 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1760 2449 gene locus_tag LOCUS_17470 1760 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2514 3554 gene locus_tag LOCUS_17480 2514 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3559 4569 gene locus_tag LOCUS_17490 3559 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4669 5577 gene locus_tag LOCUS_17500 4669 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 <6339 5574 gene locus_tag LOCUS_17510 <6339 5574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CB72:UvrABC system protein A >Feature sequence165 <1 740 gene locus_tag LOCUS_17520 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918932.1:prolyl oligopeptidase 2146 1187 gene locus_tag LOCUS_17530 2146 1187 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_17530 3063 2230 gene locus_tag LOCUS_17540 3063 2230 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531461.1 protein_id gnl|my_center|LOCUS_17540 3452 3060 gene locus_tag LOCUS_17550 3452 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 6316 3485 gene locus_tag LOCUS_17560 6316 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence166 <1 1154 gene locus_tag LOCUS_17570 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921366.1:double-strand break repair protein AddB 1151 4840 gene locus_tag LOCUS_17580 1151 4840 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923305.1 protein_id gnl|my_center|LOCUS_17580 4915 5235 gene locus_tag LOCUS_17590 4915 5235 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_17590 6240 5551 gene locus_tag LOCUS_17600 gene pyrF 6240 5551 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXJ5 protein_id gnl|my_center|LOCUS_17600 >Feature sequence167 166 1029 gene locus_tag LOCUS_17610 166 1029 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_17610 1020 2312 gene locus_tag LOCUS_17620 1020 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2460 4397 gene locus_tag LOCUS_17630 gene ftsH 2460 4397 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN14 protein_id gnl|my_center|LOCUS_17630 4403 4717 gene locus_tag LOCUS_17640 4403 4717 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKX3 protein_id gnl|my_center|LOCUS_17640 4811 5233 gene locus_tag LOCUS_17650 4811 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5677 5237 gene locus_tag LOCUS_17660 5677 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 6000 5674 gene locus_tag LOCUS_17670 6000 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence168 1218 718 gene locus_tag LOCUS_17680 gene rpsI 1218 718 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KE5 protein_id gnl|my_center|LOCUS_17680 1685 1218 gene locus_tag LOCUS_17690 gene rplM 1685 1218 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H7 protein_id gnl|my_center|LOCUS_17690 1946 3370 gene locus_tag LOCUS_17700 1946 3370 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_17700 3340 4344 gene locus_tag LOCUS_17710 3340 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 5425 4328 gene locus_tag LOCUS_17720 gene ctaA 5425 4328 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KD9 protein_id gnl|my_center|LOCUS_17720 >Feature sequence169 927 91 gene locus_tag LOCUS_17730 927 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1781 936 gene locus_tag LOCUS_17740 1781 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3155 1878 gene locus_tag LOCUS_17750 gene clpX 3155 1878 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU44 protein_id gnl|my_center|LOCUS_17750 3990 3394 gene locus_tag LOCUS_17760 gene clpP 3990 3394 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX16 protein_id gnl|my_center|LOCUS_17760 5706 4189 gene locus_tag LOCUS_17770 gene tig 5706 4189 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX17 protein_id gnl|my_center|LOCUS_17770 >Feature sequence170 354 560 gene locus_tag LOCUS_17780 354 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_17780 1532 582 gene locus_tag LOCUS_17790 1532 582 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527946.1 protein_id gnl|my_center|LOCUS_17790 1852 3780 gene locus_tag LOCUS_17800 1852 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 5456 3777 gene locus_tag LOCUS_17810 gene hutU 5456 3777 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8Z9 protein_id gnl|my_center|LOCUS_17810 <6135 5453 gene locus_tag LOCUS_17820 <6135 5453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887421.1:N-formylglutamate deformylase >Feature sequence171 2474 1356 gene locus_tag LOCUS_17830 2474 1356 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU3 protein_id gnl|my_center|LOCUS_17830 2671 3177 gene locus_tag LOCUS_17840 2671 3177 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383049.1 protein_id gnl|my_center|LOCUS_17840 4838 3135 gene locus_tag LOCUS_17850 gene kefB 4838 3135 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 protein_id gnl|my_center|LOCUS_17850 4960 5424 gene locus_tag LOCUS_17860 gene queF 4960 5424 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KV4 protein_id gnl|my_center|LOCUS_17860 5581 6093 gene locus_tag LOCUS_17870 5581 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence172 339 794 gene locus_tag LOCUS_17880 339 794 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 protein_id gnl|my_center|LOCUS_17880 2199 799 gene locus_tag LOCUS_17890 2199 799 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919894.1 protein_id gnl|my_center|LOCUS_17890 2866 2255 gene locus_tag LOCUS_17900 2866 2255 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225701.1 protein_id gnl|my_center|LOCUS_17900 3202 2993 gene locus_tag LOCUS_17910 3202 2993 CDS product putative cold shock protein y4cH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55390 protein_id gnl|my_center|LOCUS_17910 3465 4166 gene locus_tag LOCUS_17920 3465 4166 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919201.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence173 2432 321 gene locus_tag LOCUS_17930 2432 321 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Y0 protein_id gnl|my_center|LOCUS_17930 2757 2461 gene locus_tag LOCUS_17940 2757 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810208.1 protein_id gnl|my_center|LOCUS_17940 4066 2765 gene locus_tag LOCUS_17950 gene nuoF 4066 2765 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919813.1 protein_id gnl|my_center|LOCUS_17950 5004 4066 gene locus_tag LOCUS_17960 gene nuoE 5004 4066 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919816.1 protein_id gnl|my_center|LOCUS_17960 5384 5010 gene locus_tag LOCUS_17970 5384 5010 CDS product steroid Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971114.1 protein_id gnl|my_center|LOCUS_17970 <6049 5384 gene locus_tag LOCUS_17980 <6049 5384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89KI9:NADH-quinone oxidoreductase subunit D >Feature sequence174 905 582 gene locus_tag LOCUS_17990 905 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1177 902 gene locus_tag LOCUS_18000 1177 902 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969603.1 protein_id gnl|my_center|LOCUS_18000 2354 1227 gene locus_tag LOCUS_18010 2354 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_18010 2515 4137 gene locus_tag LOCUS_18020 gene pckA 2515 4137 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ94 protein_id gnl|my_center|LOCUS_18020 4153 4608 gene locus_tag LOCUS_18030 4153 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 <6012 4798 gene locus_tag LOCUS_18040 <6012 4798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918720.1:DEAD/DEAH box helicase >Feature sequence175 757 2187 gene locus_tag LOCUS_18050 757 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919744.1 protein_id gnl|my_center|LOCUS_18050 2205 2939 gene locus_tag LOCUS_18060 2205 2939 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 protein_id gnl|my_center|LOCUS_18060 3396 2977 gene locus_tag LOCUS_18070 3396 2977 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 protein_id gnl|my_center|LOCUS_18070 4403 3591 gene locus_tag LOCUS_18080 gene thiG 4403 3591 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWN0 protein_id gnl|my_center|LOCUS_18080 4487 4672 gene locus_tag LOCUS_18090 4487 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4913 4677 gene locus_tag LOCUS_18100 gene thiS 4913 4677 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_18100 5053 5514 gene locus_tag LOCUS_18110 gene aroQ 5053 5514 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A744 protein_id gnl|my_center|LOCUS_18110 >Feature sequence176 137 577 gene locus_tag LOCUS_18120 137 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 658 1965 gene locus_tag LOCUS_18130 658 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2418 1969 gene locus_tag LOCUS_18140 gene dut 2418 1969 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_18140 2898 2443 gene locus_tag LOCUS_18150 2898 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3628 2963 gene locus_tag LOCUS_18160 3628 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18160 4164 3625 gene locus_tag LOCUS_18170 4164 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18170 4556 4161 gene locus_tag LOCUS_18180 4556 4161 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142729.1 protein_id gnl|my_center|LOCUS_18180 4780 4553 gene locus_tag LOCUS_18190 4780 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 <5982 4817 gene locus_tag LOCUS_18200 <5982 4817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CCL8:putative protein kinase UbiB >Feature sequence177 1209 25 gene locus_tag LOCUS_18210 gene metK2 1209 25 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_18210 1702 1283 gene locus_tag LOCUS_18220 1702 1283 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083612.1 protein_id gnl|my_center|LOCUS_18220 3410 1764 gene locus_tag LOCUS_18230 gene lnt 3410 1764 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC16 protein_id gnl|my_center|LOCUS_18230 4321 3410 gene locus_tag LOCUS_18240 gene corC 4321 3410 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 protein_id gnl|my_center|LOCUS_18240 4782 4318 gene locus_tag LOCUS_18250 gene ybeY 4782 4318 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W99 protein_id gnl|my_center|LOCUS_18250 5770 4772 gene locus_tag LOCUS_18260 gene phoH 5770 4772 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639866.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence178 2198 252 gene locus_tag LOCUS_18270 gene acsA 2198 252 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_18270 2379 3116 gene locus_tag LOCUS_18280 2379 3116 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_18280 3168 4163 gene locus_tag LOCUS_18290 3168 4163 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921468.1 protein_id gnl|my_center|LOCUS_18290 4209 4886 gene locus_tag LOCUS_18300 gene fzlA 4209 4886 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921466.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence179 <1 691 gene locus_tag LOCUS_18310 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZG9:4-hydroxy-tetrahydrodipicolinate synthase 688 1158 gene locus_tag LOCUS_18320 gene smpB 688 1158 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H482 protein_id gnl|my_center|LOCUS_18320 1512 2663 gene locus_tag LOCUS_18330 1512 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3310 2660 gene locus_tag LOCUS_18340 3310 2660 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919423.1 protein_id gnl|my_center|LOCUS_18340 3881 3300 gene locus_tag LOCUS_18350 3881 3300 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919424.1 protein_id gnl|my_center|LOCUS_18350 3926 4444 gene locus_tag LOCUS_18360 3926 4444 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919425.1 protein_id gnl|my_center|LOCUS_18360 4451 4918 gene locus_tag LOCUS_18370 gene rpoZ 4451 4918 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58066 protein_id gnl|my_center|LOCUS_18370 >Feature sequence180 <1 1991 gene locus_tag LOCUS_18380 <1 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921109.1:penicillin-binding protein 1A 2904 1984 gene locus_tag LOCUS_18390 2904 1984 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816435.1 protein_id gnl|my_center|LOCUS_18390 3000 3623 gene locus_tag LOCUS_18400 gene azoR2 3000 3623 CDS product FMN-dependent NADH-azoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2E2 protein_id gnl|my_center|LOCUS_18400 4504 3629 gene locus_tag LOCUS_18410 4504 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4801 5214 gene locus_tag LOCUS_18420 4801 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence181 269 1387 gene locus_tag LOCUS_18430 269 1387 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_18430 2209 1586 gene locus_tag LOCUS_18440 2209 1586 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_18440 4291 2255 gene locus_tag LOCUS_18450 4291 2255 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_18450 5404 4568 gene locus_tag LOCUS_18460 5404 4568 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence182 976 92 gene locus_tag LOCUS_18470 976 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1140 2258 gene locus_tag LOCUS_18480 1140 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 4354 2717 gene locus_tag LOCUS_18490 gene groL 4354 2717 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAT9 protein_id gnl|my_center|LOCUS_18490 4699 4412 gene locus_tag LOCUS_18500 gene groES 4699 4412 CDS product co-chaperonin GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001314660.1 protein_id gnl|my_center|LOCUS_18500 4998 5654 gene locus_tag LOCUS_18510 4998 5654 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence183 2359 2150 gene locus_tag LOCUS_18520 2359 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383748.1 protein_id gnl|my_center|LOCUS_18520 2976 2482 gene locus_tag LOCUS_18530 2976 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921121.1 protein_id gnl|my_center|LOCUS_18530 3602 2976 gene locus_tag LOCUS_18540 gene ubiX 3602 2976 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD02 protein_id gnl|my_center|LOCUS_18540 3700 3870 gene locus_tag LOCUS_18550 3700 3870 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265934.1 protein_id gnl|my_center|LOCUS_18550 4024 4389 gene locus_tag LOCUS_18560 4024 4389 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489271.1 protein_id gnl|my_center|LOCUS_18560 4480 5364 gene locus_tag LOCUS_18570 4480 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence184 257 2758 gene locus_tag LOCUS_18580 gene qoxA 257 2758 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 protein_id gnl|my_center|LOCUS_18580 2755 3114 gene locus_tag LOCUS_18590 2755 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4547 3213 gene locus_tag LOCUS_18600 4547 3213 CDS product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence185 173 2509 gene locus_tag LOCUS_18610 173 2509 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 protein_id gnl|my_center|LOCUS_18610 2581 3255 gene locus_tag LOCUS_18620 2581 3255 CDS product type I-C CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_18620 3252 3479 gene locus_tag LOCUS_18630 3252 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18630 3495 5057 gene locus_tag LOCUS_18640 3495 5057 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence186 456 175 gene locus_tag LOCUS_18650 456 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1715 453 gene locus_tag LOCUS_18660 1715 453 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709316.1 protein_id gnl|my_center|LOCUS_18660 2345 1818 gene locus_tag LOCUS_18670 2345 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2868 2479 gene locus_tag LOCUS_18680 2868 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3368 2865 gene locus_tag LOCUS_18690 3368 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3545 4315 gene locus_tag LOCUS_18700 3545 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918219.1 protein_id gnl|my_center|LOCUS_18700 4778 4323 gene locus_tag LOCUS_18710 4778 4323 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974893.1 protein_id gnl|my_center|LOCUS_18710 4860 5171 gene locus_tag LOCUS_18720 4860 5171 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529112.1 protein_id gnl|my_center|LOCUS_18720 5467 5168 gene locus_tag LOCUS_18730 5467 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence187 1947 232 gene locus_tag LOCUS_18740 1947 232 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 protein_id gnl|my_center|LOCUS_18740 4410 2086 gene locus_tag LOCUS_18750 4410 2086 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence188 472 1110 gene locus_tag LOCUS_18760 472 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2375 1107 gene locus_tag LOCUS_18770 2375 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3829 2381 gene locus_tag LOCUS_18780 3829 2381 CDS product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_18780 4786 3857 gene locus_tag LOCUS_18790 4786 3857 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083349.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence189 64 1203 gene locus_tag LOCUS_18800 gene proB 64 1203 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYI6 protein_id gnl|my_center|LOCUS_18800 1200 2465 gene locus_tag LOCUS_18810 gene proA 1200 2465 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X85 protein_id gnl|my_center|LOCUS_18810 3034 2501 gene locus_tag LOCUS_18820 3034 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 3766 3035 gene locus_tag LOCUS_18830 3766 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390638.1 protein_id gnl|my_center|LOCUS_18830 4854 3877 gene locus_tag LOCUS_18840 gene bioB 4854 3877 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF0 protein_id gnl|my_center|LOCUS_18840 4853 5299 gene locus_tag LOCUS_18850 4853 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence190 731 87 gene locus_tag LOCUS_18860 731 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1510 731 gene locus_tag LOCUS_18870 gene kdsB 1510 731 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385423.1 protein_id gnl|my_center|LOCUS_18870 2292 1507 gene locus_tag LOCUS_18880 2292 1507 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_18880 2408 3172 gene locus_tag LOCUS_18890 2408 3172 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCU1 protein_id gnl|my_center|LOCUS_18890 3201 3821 gene locus_tag LOCUS_18900 gene cmk 3201 3821 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H6A7 protein_id gnl|my_center|LOCUS_18900 3867 4694 gene locus_tag LOCUS_18910 3867 4694 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224955.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence191 2162 657 gene locus_tag LOCUS_18920 2162 657 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_18920 3248 2214 gene locus_tag LOCUS_18930 3248 2214 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709507.1 protein_id gnl|my_center|LOCUS_18930 3369 3956 gene locus_tag LOCUS_18940 3369 3956 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709508.1 protein_id gnl|my_center|LOCUS_18940 <5386 3957 gene locus_tag LOCUS_18950 <5386 3957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37967:para-nitrobenzyl esterase >Feature sequence192 1114 353 gene locus_tag LOCUS_18960 gene nth 1114 353 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T20 protein_id gnl|my_center|LOCUS_18960 3678 1231 gene locus_tag LOCUS_18970 gene ftsK 3678 1231 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923345.1 protein_id gnl|my_center|LOCUS_18970 4993 3722 gene locus_tag LOCUS_18980 4993 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence193 1517 330 gene locus_tag LOCUS_18990 gene aatC 1517 330 CDS product putative aminotransferase AatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87320 protein_id gnl|my_center|LOCUS_18990 2996 1524 gene locus_tag LOCUS_19000 2996 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 protein_id gnl|my_center|LOCUS_19000 3941 3000 gene locus_tag LOCUS_19010 3941 3000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_19010 4081 4497 gene locus_tag LOCUS_19020 4081 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4970 4473 gene locus_tag LOCUS_19030 4970 4473 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974971.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence194 2043 1264 gene locus_tag LOCUS_19040 2043 1264 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_19040 2139 2486 gene locus_tag LOCUS_19050 2139 2486 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC1 protein_id gnl|my_center|LOCUS_19050 2528 2947 gene locus_tag LOCUS_19060 2528 2947 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4M3 protein_id gnl|my_center|LOCUS_19060 2931 4889 gene locus_tag LOCUS_19070 gene uvrC 2931 4889 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4F3 protein_id gnl|my_center|LOCUS_19070 >Feature sequence195 518 3667 gene locus_tag LOCUS_19080 518 3667 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_19080 4569 3964 gene locus_tag LOCUS_19090 4569 3964 CDS product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921307.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence196 444 157 gene locus_tag LOCUS_19100 444 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1221 490 gene locus_tag LOCUS_19110 1221 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1406 2563 gene locus_tag LOCUS_19120 1406 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2566 3951 gene locus_tag LOCUS_19130 2566 3951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210842.1 protein_id gnl|my_center|LOCUS_19130 <5212 3939 gene locus_tag LOCUS_19140 <5212 3939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967730.1:ABC transporter substrate-binding protein >Feature sequence197 1278 2792 gene locus_tag LOCUS_19150 1278 2792 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095454.1 protein_id gnl|my_center|LOCUS_19150 3489 2794 gene locus_tag LOCUS_19160 3489 2794 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_19160 4405 3497 gene locus_tag LOCUS_19170 4405 3497 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence198 2060 1689 gene locus_tag LOCUS_19180 2060 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2595 2521 gene locus_tag LOCUS_t00240 2595 2521 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4468 2690 gene locus_tag LOCUS_19190 gene recJ 4468 2690 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919262.1 protein_id gnl|my_center|LOCUS_19190 <5135 4474 gene locus_tag LOCUS_19200 <5135 4474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C840:fructose-1,6-bisphosphatase >Feature sequence199 221 730 gene locus_tag LOCUS_19210 221 730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_19210 755 1249 gene locus_tag LOCUS_19220 755 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265683.1 protein_id gnl|my_center|LOCUS_19220 2485 1277 gene locus_tag LOCUS_19230 2485 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920182.1 protein_id gnl|my_center|LOCUS_19230 3364 2534 gene locus_tag LOCUS_19240 gene pleA 3364 2534 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640469.1 protein_id gnl|my_center|LOCUS_19240 4396 3431 gene locus_tag LOCUS_19250 gene thiO 4396 3431 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403986.1 protein_id gnl|my_center|LOCUS_19250 4594 5007 gene locus_tag LOCUS_19260 4594 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence200 306 2459 gene locus_tag LOCUS_19270 306 2459 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640172.1 protein_id gnl|my_center|LOCUS_19270 3430 2456 gene locus_tag LOCUS_19280 3430 2456 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_19280 4812 3460 gene locus_tag LOCUS_19290 4812 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence201 3069 1411 gene locus_tag LOCUS_19300 3069 1411 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_19300 3189 3593 gene locus_tag LOCUS_19310 3189 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3614 4231 gene locus_tag LOCUS_19320 3614 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 <5028 4215 gene locus_tag LOCUS_19330 <5028 4215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919119.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB >Feature sequence202 3122 2031 gene locus_tag LOCUS_19340 3122 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_19340 <5005 3166 gene locus_tag LOCUS_19350 <5005 3166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89VX1:DNA mismatch repair protein MutS >Feature sequence203 1215 2063 gene locus_tag LOCUS_19360 gene kynA 1215 2063 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CK2 protein_id gnl|my_center|LOCUS_19360 2082 2345 gene locus_tag LOCUS_19370 2082 2345 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 protein_id gnl|my_center|LOCUS_19370 2360 3742 gene locus_tag LOCUS_19380 gene sdaA 2360 3742 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_19380 4516 3869 gene locus_tag LOCUS_19390 gene pcaJ 4516 3869 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence204 899 3676 gene locus_tag LOCUS_19400 899 3676 CDS product LytTR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338666.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence205 1597 389 gene locus_tag LOCUS_19410 1597 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265603.1 protein_id gnl|my_center|LOCUS_19410 1778 2089 gene locus_tag LOCUS_19420 1778 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2174 4150 gene locus_tag LOCUS_19430 2174 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4794 4147 gene locus_tag LOCUS_19440 4794 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence206 75 569 gene locus_tag LOCUS_19450 75 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 815 1336 gene locus_tag LOCUS_19460 815 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 1368 1859 gene locus_tag LOCUS_19470 1368 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2524 1892 gene locus_tag LOCUS_19480 2524 1892 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707822.1 protein_id gnl|my_center|LOCUS_19480 2656 3339 gene locus_tag LOCUS_19490 2656 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3410 4549 gene locus_tag LOCUS_19500 3410 4549 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence207 195 1451 gene locus_tag LOCUS_19510 gene hfsC 195 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920287.1 protein_id gnl|my_center|LOCUS_19510 2356 1427 gene locus_tag LOCUS_19520 2356 1427 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920138.1 protein_id gnl|my_center|LOCUS_19520 3135 2353 gene locus_tag LOCUS_19530 gene hfsH 3135 2353 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920286.1 protein_id gnl|my_center|LOCUS_19530 4025 3132 gene locus_tag LOCUS_19540 gene hfsG 4025 3132 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920285.1 protein_id gnl|my_center|LOCUS_19540 <4867 4022 gene locus_tag LOCUS_19550 <4867 4022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640489.1:polysaccharide biosynthesis protein >Feature sequence208 487 571 gene locus_tag LOCUS_t00250 487 571 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 809 1495 gene locus_tag LOCUS_19560 gene dnaQ 809 1495 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917896.1 protein_id gnl|my_center|LOCUS_19560 2009 1506 gene locus_tag LOCUS_19570 gene secB 2009 1506 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU3 protein_id gnl|my_center|LOCUS_19570 2264 2947 gene locus_tag LOCUS_19580 2264 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2997 4121 gene locus_tag LOCUS_19590 2997 4121 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 protein_id gnl|my_center|LOCUS_19590 4128 4685 gene locus_tag LOCUS_19600 4128 4685 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067423.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence209 4184 1962 gene locus_tag LOCUS_19610 gene dcp 4184 1962 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 protein_id gnl|my_center|LOCUS_19610 4622 4410 gene locus_tag LOCUS_19620 4622 4410 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530020.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence210 221 748 gene locus_tag LOCUS_19630 gene ppa 221 748 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKZ2 protein_id gnl|my_center|LOCUS_19630 812 1651 gene locus_tag LOCUS_19640 812 1651 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970849.1 protein_id gnl|my_center|LOCUS_19640 2305 1838 gene locus_tag LOCUS_19650 2305 1838 CDS product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384082.1 protein_id gnl|my_center|LOCUS_19650 3361 2477 gene locus_tag LOCUS_19660 3361 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918056.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence211 <1 526 gene locus_tag LOCUS_19670 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CBQ4:argininosuccinate lyase 531 755 gene locus_tag LOCUS_19680 531 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 797 3283 gene locus_tag LOCUS_19690 797 3283 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338443.1 protein_id gnl|my_center|LOCUS_19690 3978 3280 gene locus_tag LOCUS_19700 3978 3280 CDS product MJ0042 family finger-like domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265776.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence212 <1 2042 gene locus_tag LOCUS_19710 <1 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O54479:DNA topoisomerase 4 subunit B 2191 3603 gene locus_tag LOCUS_19720 2191 3603 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence213 2745 2263 gene locus_tag LOCUS_19730 2745 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3753 2770 gene locus_tag LOCUS_19740 gene thiL 3753 2770 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J2 protein_id gnl|my_center|LOCUS_19740 4238 3753 gene locus_tag LOCUS_19750 gene nusB 4238 3753 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H535 protein_id gnl|my_center|LOCUS_19750 4676 4239 gene locus_tag LOCUS_19760 gene ribH1 4676 4239 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZV0 protein_id gnl|my_center|LOCUS_19760 >Feature sequence214 1606 368 gene locus_tag LOCUS_19770 1606 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 protein_id gnl|my_center|LOCUS_19770 1863 2975 gene locus_tag LOCUS_19780 1863 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 3242 3859 gene locus_tag LOCUS_19790 3242 3859 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 protein_id gnl|my_center|LOCUS_19790 3958 4479 gene locus_tag LOCUS_19800 3958 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918014.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence215 <1 709 gene locus_tag LOCUS_19810 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A6S9:segregation and condensation protein B 805 1026 gene locus_tag LOCUS_19820 805 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1049 1471 gene locus_tag LOCUS_19830 1049 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1475 2293 gene locus_tag LOCUS_19840 gene tatC 1475 2293 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q23 protein_id gnl|my_center|LOCUS_19840 3773 2490 gene locus_tag LOCUS_19850 gene purD 3773 2490 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T902 protein_id gnl|my_center|LOCUS_19850 >Feature sequence216 1900 3222 gene locus_tag LOCUS_19860 gene gltX 1900 3222 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KR5 protein_id gnl|my_center|LOCUS_19860 3255 4559 gene locus_tag LOCUS_19870 gene gltA 3255 4559 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33915 protein_id gnl|my_center|LOCUS_19870 >Feature sequence217 128 1375 gene locus_tag LOCUS_19880 128 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1679 1287 gene locus_tag LOCUS_19890 1679 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 3099 1876 gene locus_tag LOCUS_19900 3099 1876 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246323.1 protein_id gnl|my_center|LOCUS_19900 <4583 3183 gene locus_tag LOCUS_19910 <4583 3183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918622.1:peptidase M20 >Feature sequence218 <1 715 gene locus_tag LOCUS_19920 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256139.1:sodium-independent anion transporter 3248 828 gene locus_tag LOCUS_19930 gene gyrB 3248 828 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAX1 protein_id gnl|my_center|LOCUS_19930 3444 3851 gene locus_tag LOCUS_19940 3444 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence219 578 210 gene locus_tag LOCUS_19950 gene rplN 578 210 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U869 protein_id gnl|my_center|LOCUS_19950 862 626 gene locus_tag LOCUS_19960 gene rpsQ 862 626 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE27 protein_id gnl|my_center|LOCUS_19960 1069 866 gene locus_tag LOCUS_19970 gene rpmC 1069 866 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QG2 protein_id gnl|my_center|LOCUS_19970 1499 1074 gene locus_tag LOCUS_19980 gene rplP 1499 1074 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R5 protein_id gnl|my_center|LOCUS_19980 2232 1528 gene locus_tag LOCUS_19990 gene rpsC 2232 1528 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U865 protein_id gnl|my_center|LOCUS_19990 2612 2232 gene locus_tag LOCUS_20000 gene rplV 2612 2232 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D2 protein_id gnl|my_center|LOCUS_20000 2895 2617 gene locus_tag LOCUS_20010 gene rpsS 2895 2617 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4D8 protein_id gnl|my_center|LOCUS_20010 3749 2913 gene locus_tag LOCUS_20020 gene rplB 3749 2913 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4D7 protein_id gnl|my_center|LOCUS_20020 4069 3776 gene locus_tag LOCUS_20030 gene rplW 4069 3776 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence220 3985 3305 gene locus_tag LOCUS_20040 gene lolD2 3985 3305 CDS product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z7 protein_id gnl|my_center|LOCUS_20040 >Feature sequence221 281 2209 gene locus_tag LOCUS_20050 gene pulD 281 2209 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 protein_id gnl|my_center|LOCUS_20050 2218 3693 gene locus_tag LOCUS_20060 gene xcsE 2218 3693 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038522.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence222 421 1020 gene locus_tag LOCUS_20070 421 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1017 1427 gene locus_tag LOCUS_20080 1017 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532641.1 protein_id gnl|my_center|LOCUS_20080 1456 1872 gene locus_tag LOCUS_20090 1456 1872 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 protein_id gnl|my_center|LOCUS_20090 1875 2159 gene locus_tag LOCUS_20100 1875 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640584.1 protein_id gnl|my_center|LOCUS_20100 2156 2335 gene locus_tag LOCUS_20110 2156 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2362 2850 gene locus_tag LOCUS_20120 2362 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920620.1 protein_id gnl|my_center|LOCUS_20120 2847 3467 gene locus_tag LOCUS_20130 2847 3467 CDS product glycoside hydrolase family 24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383957.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence223 3 209 gene locus_tag LOCUS_20140 3 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 234 2132 gene locus_tag LOCUS_20150 234 2132 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529573.1 protein_id gnl|my_center|LOCUS_20150 2160 3587 gene locus_tag LOCUS_20160 gene ampG 2160 3587 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence224 <1 657 gene locus_tag LOCUS_20170 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531033.1:serine protease 695 1366 gene locus_tag LOCUS_20180 695 1366 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920598.1 protein_id gnl|my_center|LOCUS_20180 1363 2814 gene locus_tag LOCUS_20190 1363 2814 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920596.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence225 <1 1452 gene locus_tag LOCUS_20200 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A6V0:DNA repair protein RecN 1449 3584 gene locus_tag LOCUS_20210 gene ligA 1449 3584 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FV8 protein_id gnl|my_center|LOCUS_20210 4361 3768 gene locus_tag LOCUS_20220 4361 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence226 742 3099 gene locus_tag LOCUS_20230 gene fyuA 742 3099 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence227 712 116 gene locus_tag LOCUS_20240 712 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 816 1715 gene locus_tag LOCUS_20250 816 1715 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404104.1 protein_id gnl|my_center|LOCUS_20250 1741 1914 gene locus_tag LOCUS_20260 1741 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2616 2302 gene locus_tag LOCUS_20270 2616 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 3634 2777 gene locus_tag LOCUS_20280 3634 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence228 2306 1632 gene locus_tag LOCUS_20290 2306 1632 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 protein_id gnl|my_center|LOCUS_20290 3616 2351 gene locus_tag LOCUS_20300 gene sun 3616 2351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence229 1186 1926 gene locus_tag LOCUS_20310 1186 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920290.1 protein_id gnl|my_center|LOCUS_20310 2213 1941 gene locus_tag LOCUS_20320 2213 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920291.1 protein_id gnl|my_center|LOCUS_20320 3668 2388 gene locus_tag LOCUS_20330 3668 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 4315 3914 gene locus_tag LOCUS_20340 4315 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence230 308 1900 gene locus_tag LOCUS_20350 308 1900 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384433.1 protein_id gnl|my_center|LOCUS_20350 3107 1905 gene locus_tag LOCUS_20360 3107 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 protein_id gnl|my_center|LOCUS_20360 3765 3133 gene locus_tag LOCUS_20370 3765 3133 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082941.1 protein_id gnl|my_center|LOCUS_20370 4308 3784 gene locus_tag LOCUS_20380 4308 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence231 135 1289 gene locus_tag LOCUS_20390 135 1289 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083637.1 protein_id gnl|my_center|LOCUS_20390 1286 2203 gene locus_tag LOCUS_20400 gene ilvE2 1286 2203 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_20400 2204 2938 gene locus_tag LOCUS_20410 2204 2938 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_20410 2970 3281 gene locus_tag LOCUS_20420 2970 3281 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840431.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence232 1042 71 gene locus_tag LOCUS_20430 gene cysD 1042 71 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_20430 3069 1144 gene locus_tag LOCUS_20440 gene wbfY 3069 1144 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_20440 3312 3953 gene locus_tag LOCUS_20450 3312 3953 CDS product 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884291.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence233 118 1569 gene locus_tag LOCUS_20460 118 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114010.1 protein_id gnl|my_center|LOCUS_20460 2459 1566 gene locus_tag LOCUS_20470 gene rlmJ 2459 1566 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKL4 protein_id gnl|my_center|LOCUS_20470 2588 4087 gene locus_tag LOCUS_20480 2588 4087 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence234 303 106 gene locus_tag LOCUS_20490 303 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 430 1710 gene locus_tag LOCUS_20500 430 1710 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_20500 2667 1945 gene locus_tag LOCUS_20510 2667 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2689 2952 gene locus_tag LOCUS_20520 2689 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389896.1 protein_id gnl|my_center|LOCUS_20520 2945 3541 gene locus_tag LOCUS_20530 2945 3541 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_20530 3724 3551 gene locus_tag LOCUS_20540 3724 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence235 586 1794 gene locus_tag LOCUS_20550 586 1794 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730738.1 protein_id gnl|my_center|LOCUS_20550 1888 4095 gene locus_tag LOCUS_20560 1888 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence236 1456 620 gene locus_tag LOCUS_20570 1456 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1910 1479 gene locus_tag LOCUS_20580 1910 1479 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_20580 2564 1911 gene locus_tag LOCUS_20590 2564 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3020 2775 gene locus_tag LOCUS_20600 3020 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3939 3490 gene locus_tag LOCUS_20610 3939 3490 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence237 1905 58 gene locus_tag LOCUS_20620 1905 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2083 3924 gene locus_tag LOCUS_20630 2083 3924 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence238 3 2276 gene locus_tag LOCUS_20640 gene ileS 3 2276 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4H2 protein_id gnl|my_center|LOCUS_20640 2273 2818 gene locus_tag LOCUS_20650 gene lspA 2273 2818 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7N8 protein_id gnl|my_center|LOCUS_20650 2912 3451 gene locus_tag LOCUS_20660 2912 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918585.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence239 <1 781 gene locus_tag LOCUS_20670 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A9E4:phenylalanine--tRNA ligase alpha subunit 783 1376 gene locus_tag LOCUS_20680 783 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1394 3787 gene locus_tag LOCUS_20690 gene pheT 1394 3787 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8M4 protein_id gnl|my_center|LOCUS_20690 >Feature sequence240 1605 2684 gene locus_tag LOCUS_20700 1605 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 3623 2691 gene locus_tag LOCUS_20710 3623 2691 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence241 2 253 gene locus_tag LOCUS_20720 2 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 837 250 gene locus_tag LOCUS_20730 837 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 893 1366 gene locus_tag LOCUS_20740 893 1366 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390254.1 protein_id gnl|my_center|LOCUS_20740 1474 2034 gene locus_tag LOCUS_20750 1474 2034 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917951.1 protein_id gnl|my_center|LOCUS_20750 2290 2916 gene locus_tag LOCUS_20760 2290 2916 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4V1 protein_id gnl|my_center|LOCUS_20760 2924 3580 gene locus_tag LOCUS_20770 2924 3580 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence242 1258 53 gene locus_tag LOCUS_20780 1258 53 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 protein_id gnl|my_center|LOCUS_20780 2031 1255 gene locus_tag LOCUS_20790 gene paaG 2031 1255 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 protein_id gnl|my_center|LOCUS_20790 2319 2035 gene locus_tag LOCUS_20800 2319 2035 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971832.1 protein_id gnl|my_center|LOCUS_20800 3150 2338 gene locus_tag LOCUS_20810 3150 2338 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 protein_id gnl|my_center|LOCUS_20810 <3857 3150 gene locus_tag LOCUS_20820 <3857 3150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A8P7:tRNA-dihydrouridine(20/20a) synthase >Feature sequence243 945 1181 gene locus_tag LOCUS_20830 945 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2918 1185 gene locus_tag LOCUS_20840 gene cydC 2918 1185 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202234.1 protein_id gnl|my_center|LOCUS_20840 <3807 2915 gene locus_tag LOCUS_20850 <3807 2915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918647.1:thiol reductant ABC exporter subunit CydD >Feature sequence244 834 400 gene locus_tag LOCUS_20860 gene staR 834 400 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920112.1 protein_id gnl|my_center|LOCUS_20860 1796 921 gene locus_tag LOCUS_20870 1796 921 CDS product formiminoglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918629.1 protein_id gnl|my_center|LOCUS_20870 1953 2321 gene locus_tag LOCUS_20880 1953 2321 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 protein_id gnl|my_center|LOCUS_20880 2410 2486 gene locus_tag LOCUS_t00260 2410 2486 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2610 3329 gene locus_tag LOCUS_20890 2610 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence245 <1 1309 gene locus_tag LOCUS_20900 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55577:putative peptidase y4nA 1736 1395 gene locus_tag LOCUS_20910 1736 1395 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972232.1 protein_id gnl|my_center|LOCUS_20910 2050 1733 gene locus_tag LOCUS_20920 2050 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3594 2086 gene locus_tag LOCUS_20930 3594 2086 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence246 66 989 gene locus_tag LOCUS_20940 66 989 CDS product glutathione ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_20940 989 1801 gene locus_tag LOCUS_20950 989 1801 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731601.1 protein_id gnl|my_center|LOCUS_20950 1798 2595 gene locus_tag LOCUS_20960 1798 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20960 2592 3479 gene locus_tag LOCUS_20970 2592 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20970 >Feature sequence247 1089 334 gene locus_tag LOCUS_20980 1089 334 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706675.1 protein_id gnl|my_center|LOCUS_20980 1278 1484 gene locus_tag LOCUS_20990 1278 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1553 1879 gene locus_tag LOCUS_21000 1553 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence248 <1 1119 gene locus_tag LOCUS_21010 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090688.1:D-3-phosphoglycerate dehydrogenase 1125 2144 gene locus_tag LOCUS_21020 1125 2144 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_21020 2898 2104 gene locus_tag LOCUS_21030 2898 2104 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061494.1 protein_id gnl|my_center|LOCUS_21030 3043 3390 gene locus_tag LOCUS_21040 3043 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence249 2651 2103 gene locus_tag LOCUS_21050 gene spdR 2651 2103 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918136.1 protein_id gnl|my_center|LOCUS_21050 3668 2757 gene locus_tag LOCUS_21060 3668 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence250 202 699 gene locus_tag LOCUS_21070 202 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 1836 736 gene locus_tag LOCUS_21080 1836 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2915 1833 gene locus_tag LOCUS_21090 2915 1833 CDS product polysaccharide biosynthesis protein CelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640455.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence251 <1 1021 gene locus_tag LOCUS_21100 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876856.1:homoserine dehydrogenase 1052 1999 gene locus_tag LOCUS_21110 gene thrB 1052 1999 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4Q3 protein_id gnl|my_center|LOCUS_21110 1996 3315 gene locus_tag LOCUS_21120 gene thrC 1996 3315 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637168.2 protein_id gnl|my_center|LOCUS_21120 >Feature sequence252 2746 350 gene locus_tag LOCUS_21130 gene lon 2746 350 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW0 protein_id gnl|my_center|LOCUS_21130 >Feature sequence253 1827 733 gene locus_tag LOCUS_21140 1827 733 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_21140 2390 1824 gene locus_tag LOCUS_21150 2390 1824 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084031.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence254 <1 508 gene locus_tag LOCUS_21160 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085732.1:acyl-CoA synthetase 1264 518 gene locus_tag LOCUS_21170 gene csgA 1264 518 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 protein_id gnl|my_center|LOCUS_21170 1742 1317 gene locus_tag LOCUS_21180 1742 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2700 1789 gene locus_tag LOCUS_21190 gene folD 2700 1789 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ9 protein_id gnl|my_center|LOCUS_21190 3012 2707 gene locus_tag LOCUS_21200 3012 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3523 3113 gene locus_tag LOCUS_21210 3523 3113 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence255 1370 1295 gene locus_tag LOCUS_t00270 1370 1295 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2469 1822 gene locus_tag LOCUS_21220 gene udk 2469 1822 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y727 protein_id gnl|my_center|LOCUS_21220 >Feature sequence256 791 423 gene locus_tag LOCUS_21230 791 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1440 808 gene locus_tag LOCUS_21240 1440 808 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918295.1 protein_id gnl|my_center|LOCUS_21240 2015 1440 gene locus_tag LOCUS_21250 2015 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 protein_id gnl|my_center|LOCUS_21250 2088 3086 gene locus_tag LOCUS_21260 2088 3086 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969882.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence257 2491 788 gene locus_tag LOCUS_21270 2491 788 CDS product AMP-dependent acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 protein_id gnl|my_center|LOCUS_21270 <3582 2604 gene locus_tag LOCUS_21280 <3582 2604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228721.1:carotenoid cleavage dioxygenase >Feature sequence258 <1 1193 gene locus_tag LOCUS_21290 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89S69:glycine--tRNA ligase beta subunit >Feature sequence259 1396 101 gene locus_tag LOCUS_21300 1396 101 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921264.1 protein_id gnl|my_center|LOCUS_21300 2623 1412 gene locus_tag LOCUS_21310 2623 1412 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_21310 3102 2635 gene locus_tag LOCUS_21320 gene rlmH 3102 2635 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8W4 protein_id gnl|my_center|LOCUS_21320 >Feature sequence260 55 576 gene locus_tag LOCUS_21330 55 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1266 586 gene locus_tag LOCUS_21340 gene lipB 1266 586 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8M0 protein_id gnl|my_center|LOCUS_21340 1369 1614 gene locus_tag LOCUS_21350 1369 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920036.1 protein_id gnl|my_center|LOCUS_21350 1722 1806 gene locus_tag LOCUS_t00280 1722 1806 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1999 2997 gene locus_tag LOCUS_21360 1999 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence261 1536 796 gene locus_tag LOCUS_21370 1536 796 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_21370 2300 1533 gene locus_tag LOCUS_21380 2300 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2559 2960 gene locus_tag LOCUS_21390 2559 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3443 3036 gene locus_tag LOCUS_21400 3443 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence262 994 3267 gene locus_tag LOCUS_21410 994 3267 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence263 385 1074 gene locus_tag LOCUS_21420 385 1074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_21420 1071 2441 gene locus_tag LOCUS_21430 1071 2441 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_21430 2460 2384 gene locus_tag LOCUS_t00290 2460 2384 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence264 278 18 gene locus_tag LOCUS_21440 278 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2646 364 gene locus_tag LOCUS_21450 2646 364 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 protein_id gnl|my_center|LOCUS_21450 <3422 2733 gene locus_tag LOCUS_21460 <3422 2733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A6W7:bifunctional NAD(P)H-hydrate repair enzyme >Feature sequence265 762 115 gene locus_tag LOCUS_21470 762 115 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528903.1 protein_id gnl|my_center|LOCUS_21470 1318 803 gene locus_tag LOCUS_21480 gene msrB 1318 803 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404837.1 protein_id gnl|my_center|LOCUS_21480 2239 1391 gene locus_tag LOCUS_21490 gene ubiA 2239 1391 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2Y5 protein_id gnl|my_center|LOCUS_21490 2425 3192 gene locus_tag LOCUS_21500 2425 3192 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 protein_id gnl|my_center|LOCUS_21500 >Feature sequence266 16 501 gene locus_tag LOCUS_21510 16 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266005.1 protein_id gnl|my_center|LOCUS_21510 534 1076 gene locus_tag LOCUS_21520 534 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1070 2104 gene locus_tag LOCUS_21530 1070 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 3006 2101 gene locus_tag LOCUS_21540 gene parB 3006 2101 CDS product chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW30 protein_id gnl|my_center|LOCUS_21540 >Feature sequence267 870 1076 gene locus_tag LOCUS_21550 870 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1970 1107 gene locus_tag LOCUS_21560 1970 1107 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_21560 2463 2050 gene locus_tag LOCUS_21570 2463 2050 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_21570 2911 2474 gene locus_tag LOCUS_21580 2911 2474 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence268 1252 500 gene locus_tag LOCUS_21590 1252 500 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 protein_id gnl|my_center|LOCUS_21590 2956 1397 gene locus_tag LOCUS_21600 2956 1397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089230.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence269 551 126 gene locus_tag LOCUS_21610 551 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1087 548 gene locus_tag LOCUS_21620 gene sigW 1087 548 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CRJ8 protein_id gnl|my_center|LOCUS_21620 1818 1225 gene locus_tag LOCUS_21630 1818 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 <3244 1889 gene locus_tag LOCUS_21640 <3244 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UGQ4:glutamate-ammonia-ligase adenylyltransferase >Feature sequence270 1183 701 gene locus_tag LOCUS_21650 1183 701 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L47 protein_id gnl|my_center|LOCUS_21650 1505 1305 gene locus_tag LOCUS_21660 1505 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1739 3175 gene locus_tag LOCUS_21670 gene gltD 1739 3175 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence271 1058 2401 gene locus_tag LOCUS_21680 1058 2401 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence272 1785 2708 gene locus_tag LOCUS_21690 1785 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919057.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence273 484 8 gene locus_tag LOCUS_21700 484 8 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUN7 protein_id gnl|my_center|LOCUS_21700 1945 650 gene locus_tag LOCUS_21710 gene aceA 1945 650 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971008.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence274 698 471 gene locus_tag LOCUS_21720 698 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1625 810 gene locus_tag LOCUS_21730 gene cysE 1625 810 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 protein_id gnl|my_center|LOCUS_21730 2253 1612 gene locus_tag LOCUS_21740 2253 1612 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_21740 <3202 2293 gene locus_tag LOCUS_21750 <3202 2293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120142.1:acriflavine resistance protein B >Feature sequence275 <1 1188 gene locus_tag LOCUS_21760 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958644.1:sodium-dependent transporter 2226 1255 gene locus_tag LOCUS_21770 2226 1255 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M991 protein_id gnl|my_center|LOCUS_21770 2386 2985 gene locus_tag LOCUS_21780 2386 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence276 1412 576 gene locus_tag LOCUS_21790 1412 576 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917976.1 protein_id gnl|my_center|LOCUS_21790 3007 1412 gene locus_tag LOCUS_21800 gene purH 3007 1412 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU8 protein_id gnl|my_center|LOCUS_21800 >Feature sequence277 185 1324 gene locus_tag LOCUS_21810 185 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 1516 1325 gene locus_tag LOCUS_21820 1516 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 <3167 1818 gene locus_tag LOCUS_21830 <3167 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539668.1:long-chain-fatty-acid--CoA ligase >Feature sequence278 <1 1499 gene locus_tag LOCUS_21840 <1 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920490.1:peptidase M16 >Feature sequence279 448 113 gene locus_tag LOCUS_21850 448 113 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM9 protein_id gnl|my_center|LOCUS_21850 2235 445 gene locus_tag LOCUS_21860 gene dnaX 2235 445 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918156.1 protein_id gnl|my_center|LOCUS_21860 2699 2466 gene locus_tag LOCUS_21870 2699 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence280 2 178 gene locus_tag LOCUS_21880 2 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 175 519 gene locus_tag LOCUS_21890 175 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 525 797 gene locus_tag LOCUS_21900 525 797 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883000.1 protein_id gnl|my_center|LOCUS_21900 794 1237 gene locus_tag LOCUS_21910 794 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2029 1310 gene locus_tag LOCUS_21920 2029 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2751 2164 gene locus_tag LOCUS_21930 2751 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence281 338 1009 gene locus_tag LOCUS_21940 338 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1386 1006 gene locus_tag LOCUS_21950 1386 1006 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_21950 1569 2411 gene locus_tag LOCUS_21960 gene thyA 1569 2411 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_21960 2408 2917 gene locus_tag LOCUS_21970 2408 2917 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6G8 protein_id gnl|my_center|LOCUS_21970 >Feature sequence282 2854 2420 gene locus_tag LOCUS_21980 2854 2420 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564474.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence283 429 2453 gene locus_tag LOCUS_21990 429 2453 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920040.1 protein_id gnl|my_center|LOCUS_21990 2592 2981 gene locus_tag LOCUS_22000 2592 2981 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence284 1155 2156 gene locus_tag LOCUS_22010 1155 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639908.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence285 106 18 gene locus_tag LOCUS_t00300 106 18 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 755 129 gene locus_tag LOCUS_22020 gene clpP 755 129 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBU1 protein_id gnl|my_center|LOCUS_22020 1595 843 gene locus_tag LOCUS_22030 1595 843 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_22030 1705 2214 gene locus_tag LOCUS_22040 1705 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence286 134 1978 gene locus_tag LOCUS_22050 gene sppA 134 1978 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4A8 protein_id gnl|my_center|LOCUS_22050 2675 2040 gene locus_tag LOCUS_22060 gene folE 2675 2040 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY3 protein_id gnl|my_center|LOCUS_22060 >Feature sequence287 167 1468 gene locus_tag LOCUS_22070 167 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_22070 <2942 1561 gene locus_tag LOCUS_22080 <2942 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0CAW7:protein translocase subunit SecA >Feature sequence288 <1 670 gene locus_tag LOCUS_22090 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62M97:kynurenine formamidase 670 1875 gene locus_tag LOCUS_22100 gene kynU 670 1875 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I235 protein_id gnl|my_center|LOCUS_22100 >Feature sequence289 231 1361 gene locus_tag LOCUS_22110 gene nadA 231 1361 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2F3 protein_id gnl|my_center|LOCUS_22110 >Feature sequence290 1809 898 gene locus_tag LOCUS_22120 1809 898 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_22120 2237 1806 gene locus_tag LOCUS_22130 2237 1806 CDS product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921327.1 protein_id gnl|my_center|LOCUS_22130 2399 2785 gene locus_tag LOCUS_22140 2399 2785 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence291 6 172 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtttcgatccacgctcccgcgaagggagcgac 683 393 gene locus_tag LOCUS_22150 gene cas 683 393 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8P1 protein_id gnl|my_center|LOCUS_22150 1727 687 gene locus_tag LOCUS_22160 gene cas1-2 1727 687 CDS product CRISPR-associated endonuclease Cas1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RW61 protein_id gnl|my_center|LOCUS_22160 2378 1746 gene locus_tag LOCUS_22170 2378 1746 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence292 <1 598 gene locus_tag LOCUS_22180 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919488.1:exopolyphosphatase 595 1326 gene locus_tag LOCUS_22190 gene rlmE 595 1326 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8P3 protein_id gnl|my_center|LOCUS_22190 2099 1329 gene locus_tag LOCUS_22200 2099 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 <2794 2188 gene locus_tag LOCUS_22210 <2794 2188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640051.1:(2Fe-2S) ferredoxin >Feature sequence293 3 449 gene locus_tag LOCUS_22220 3 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1161 490 gene locus_tag LOCUS_22230 gene lexA 1161 490 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9K1 protein_id gnl|my_center|LOCUS_22230 2054 1260 gene locus_tag LOCUS_22240 gene trpC 2054 1260 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWP9 protein_id gnl|my_center|LOCUS_22240 <2791 2067 gene locus_tag LOCUS_22250 <2791 2067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RT49:anthranilate phosphoribosyltransferase >Feature sequence294 1714 629 gene locus_tag LOCUS_22260 1714 629 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 protein_id gnl|my_center|LOCUS_22260 2216 1707 gene locus_tag LOCUS_22270 2216 1707 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence295 <1 2656 gene locus_tag LOCUS_22280 <1 2656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RDL5:leucine--tRNA ligase >Feature sequence296 501 426 gene locus_tag LOCUS_t00310 501 426 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 837 1223 gene locus_tag LOCUS_22290 837 1223 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_22290 1323 1250 gene locus_tag LOCUS_t00320 1323 1250 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1489 2142 gene locus_tag LOCUS_22300 1489 2142 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720416.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence297 753 442 gene locus_tag LOCUS_22310 gene nuoK1 753 442 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7X5 protein_id gnl|my_center|LOCUS_22310 1361 753 gene locus_tag LOCUS_22320 1361 753 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975092.1 protein_id gnl|my_center|LOCUS_22320 1952 1464 gene locus_tag LOCUS_22330 gene nuoI 1952 1464 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Y4 protein_id gnl|my_center|LOCUS_22330 <2716 1962 gene locus_tag LOCUS_22340 <2716 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TH90:NADH-quinone oxidoreductase subunit H >Feature sequence298 <1 769 gene locus_tag LOCUS_22350 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQ44:glycine--tRNA ligase alpha subunit 769 1368 gene locus_tag LOCUS_22360 769 1368 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090583.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence299 925 161 gene locus_tag LOCUS_22370 925 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920086.1 protein_id gnl|my_center|LOCUS_22370 1091 2206 gene locus_tag LOCUS_22380 gene rlmN 1091 2206 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABT6 protein_id gnl|my_center|LOCUS_22380 >Feature sequence300 475 68 gene locus_tag LOCUS_22390 gene atpC 475 68 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV17 protein_id gnl|my_center|LOCUS_22390 1397 543 gene locus_tag LOCUS_22400 1397 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 <2690 1519 gene locus_tag LOCUS_22410 <2690 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CDP4:ATP synthase subunit beta >Feature sequence301 1016 363 gene locus_tag LOCUS_22420 1016 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2493 1021 gene locus_tag LOCUS_22430 gene ctpD 2493 1021 CDS product secretin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084256.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence302 30 743 gene locus_tag LOCUS_22440 30 743 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314298.1 protein_id gnl|my_center|LOCUS_22440 <2686 753 gene locus_tag LOCUS_22450 <2686 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531908.1:ATP-dependent DNA helicase RecG >Feature sequence303 1682 1284 gene locus_tag LOCUS_22460 1682 1284 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398830.1 protein_id gnl|my_center|LOCUS_22460 2113 1682 gene locus_tag LOCUS_22470 2113 1682 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707329.1 protein_id gnl|my_center|LOCUS_22470 <2667 2117 gene locus_tag LOCUS_22480 <2667 2117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707328.1:Na(+)/H(+) antiporter subunit A >Feature sequence304 2567 765 gene locus_tag LOCUS_22490 2567 765 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence305 632 1486 gene locus_tag LOCUS_22500 632 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22500 >Feature sequence306 1222 2088 gene locus_tag LOCUS_22510 gene motA 1222 2088 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence307 <2597 825 gene locus_tag LOCUS_22520 <2597 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919805.1:NADH:ubiquinone oxidoreductase subunit L >Feature sequence308 1046 309 gene locus_tag LOCUS_22530 1046 309 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920772.1 protein_id gnl|my_center|LOCUS_22530 2084 1218 gene locus_tag LOCUS_22540 2084 1218 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence309 124 978 gene locus_tag LOCUS_22550 124 978 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707858.1 protein_id gnl|my_center|LOCUS_22550 1076 1342 gene locus_tag LOCUS_22560 gene hfq 1076 1342 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW92 protein_id gnl|my_center|LOCUS_22560 >Feature sequence310 <1 564 gene locus_tag LOCUS_22570 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083842.1:isovaleryl-CoA dehydrogenase 895 1419 gene locus_tag LOCUS_22580 895 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1499 1423 gene locus_tag LOCUS_t00330 1499 1423 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1839 1534 gene locus_tag LOCUS_22590 1839 1534 CDS product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_22590 1969 1893 gene locus_tag LOCUS_t00340 1969 1893 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence311 <1 831 gene locus_tag LOCUS_22600 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975592.1:adenylyl-sulfate kinase 2137 863 gene locus_tag LOCUS_22610 2137 863 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942497.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence312 1385 954 gene locus_tag LOCUS_22620 1385 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2406 1537 gene locus_tag LOCUS_22630 2406 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence313 <1 502 gene locus_tag LOCUS_22640 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918820.1:prolyl oligopeptidase 2190 658 gene locus_tag LOCUS_22650 2190 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence314 1516 854 gene locus_tag LOCUS_22660 gene ruvA 1516 854 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAL1 protein_id gnl|my_center|LOCUS_22660 2046 1513 gene locus_tag LOCUS_22670 gene ruvC 2046 1513 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF7 protein_id gnl|my_center|LOCUS_22670 >Feature sequence315 2163 808 gene locus_tag LOCUS_22680 2163 808 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388932.1 protein_id gnl|my_center|LOCUS_22680 2501 2259 gene locus_tag LOCUS_22690 2501 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence316 95 1294 gene locus_tag LOCUS_22700 95 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_22700 <2495 1284 gene locus_tag LOCUS_22710 <2495 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CE81:bifunctional protein HldE >Feature sequence317 <2490 81 gene locus_tag LOCUS_22720 <2490 81 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478902.1:multidrug transporter AcrB >Feature sequence318 1063 1485 gene locus_tag LOCUS_22730 gene fliX 1063 1485 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32348 protein_id gnl|my_center|LOCUS_22730 1645 2076 gene locus_tag LOCUS_22740 gene dksA 1645 2076 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0C0 protein_id gnl|my_center|LOCUS_22740 2475 2080 gene locus_tag LOCUS_22750 2475 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence319 <1 1483 gene locus_tag LOCUS_22760 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C855:chaperone protein ClpB 1703 2122 gene locus_tag LOCUS_22770 1703 2122 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence320 <1 1023 gene locus_tag LOCUS_22780 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A7I8:lipoyl synthase 1038 1526 gene locus_tag LOCUS_22790 1038 1526 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919604.1 protein_id gnl|my_center|LOCUS_22790 1994 1494 gene locus_tag LOCUS_22800 1994 1494 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531490.1 protein_id gnl|my_center|LOCUS_22800 2458 1991 gene locus_tag LOCUS_22810 2458 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence321 279 1019 gene locus_tag LOCUS_22820 gene sodM 279 1019 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB15 protein_id gnl|my_center|LOCUS_22820 2013 1387 gene locus_tag LOCUS_22830 2013 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence322 136 756 gene locus_tag LOCUS_22840 136 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1247 753 gene locus_tag LOCUS_22850 gene rppH 1247 753 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5H3 protein_id gnl|my_center|LOCUS_22850 1492 1244 gene locus_tag LOCUS_22860 1492 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22860 >Feature sequence323 <2441 272 gene locus_tag LOCUS_22870 <2441 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921434.1:glutamate synthase >Feature sequence324 <1 667 gene locus_tag LOCUS_22880 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709348.1:NADH dehydrogenase 2199 670 gene locus_tag LOCUS_22890 2199 670 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence325 14 1390 gene locus_tag LOCUS_22900 14 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1463 2311 gene locus_tag LOCUS_22910 1463 2311 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391464.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence326 1803 889 gene locus_tag LOCUS_22920 1803 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1954 2319 gene locus_tag LOCUS_22930 gene panD 1954 2319 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYS2 protein_id gnl|my_center|LOCUS_22930 >Feature sequence327 <1 1191 gene locus_tag LOCUS_22940 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919935.1:VWA domain-containing protein 2139 1522 gene locus_tag LOCUS_22950 2139 1522 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919008.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence328 491 1525 gene locus_tag LOCUS_22960 491 1525 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087522.1 protein_id gnl|my_center|LOCUS_22960 1522 2328 gene locus_tag LOCUS_22970 gene scpA 1522 2328 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919871.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence329 937 1983 gene locus_tag LOCUS_22980 937 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence330 628 1020 gene locus_tag LOCUS_22990 gene apaG 628 1020 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS0 protein_id gnl|my_center|LOCUS_22990 >Feature sequence331 321 1406 gene locus_tag LOCUS_23000 321 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence332 <1 508 gene locus_tag LOCUS_23010 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003706646.1:endonuclease 886 1788 gene locus_tag LOCUS_23020 gene ardC 886 1788 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974367.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence333 473 919 gene locus_tag LOCUS_23030 gene xcsG 473 919 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038520.1 protein_id gnl|my_center|LOCUS_23030 916 1413 gene locus_tag LOCUS_23040 916 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1403 1771 gene locus_tag LOCUS_23050 1403 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence334 1240 365 gene locus_tag LOCUS_23060 gene panC 1240 365 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLC0 protein_id gnl|my_center|LOCUS_23060 1421 2101 gene locus_tag LOCUS_23070 1421 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence335 87 1106 gene locus_tag LOCUS_23080 gene rpoA 87 1106 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F8 protein_id gnl|my_center|LOCUS_23080 1152 1568 gene locus_tag LOCUS_23090 gene rplQ 1152 1568 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB04 protein_id gnl|my_center|LOCUS_23090 >Feature sequence336 1281 490 gene locus_tag LOCUS_23100 gene lpxA 1281 490 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A715 protein_id gnl|my_center|LOCUS_23100 1751 1281 gene locus_tag LOCUS_23110 gene fabZ 1751 1281 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR2 protein_id gnl|my_center|LOCUS_23110 >Feature sequence337 >Feature sequence338 1372 719 gene locus_tag LOCUS_23120 gene rsmG 1372 719 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW32 protein_id gnl|my_center|LOCUS_23120 <2235 1372 gene locus_tag LOCUS_23130 <2235 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GW33:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence339 >Feature sequence340 2156 465 gene locus_tag LOCUS_23140 2156 465 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640285.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence341 1032 838 gene locus_tag LOCUS_23150 1032 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 1943 1050 gene locus_tag LOCUS_23160 1943 1050 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_23160 >Feature sequence342 <2136 969 gene locus_tag LOCUS_23170 <2136 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970426.1:osmotically inducible protein C >Feature sequence343 1928 930 gene locus_tag LOCUS_23180 1928 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence344 39 2024 gene locus_tag LOCUS_23190 39 2024 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE98 protein_id gnl|my_center|LOCUS_23190 >Feature sequence345 131 1048 gene locus_tag LOCUS_23200 131 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640454.1 protein_id gnl|my_center|LOCUS_23200 1048 1980 gene locus_tag LOCUS_23210 1048 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence346 >Feature sequence347 963 1793 gene locus_tag LOCUS_23220 gene fabI 963 1793 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEH0 protein_id gnl|my_center|LOCUS_23220 1848 2057 gene locus_tag LOCUS_23230 1848 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence348 148 930 gene locus_tag LOCUS_23240 148 930 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_23240 1255 935 gene locus_tag LOCUS_23250 gene fdxB 1255 935 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 protein_id gnl|my_center|LOCUS_23250 <2028 1294 gene locus_tag LOCUS_23260 <2028 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064425.1:ferredoxin reductase >Feature sequence349 837 193 gene locus_tag LOCUS_23270 837 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 932 1147 gene locus_tag LOCUS_23280 932 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1601 1221 gene locus_tag LOCUS_23290 1601 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence350 400 8 gene locus_tag LOCUS_23300 400 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703749.1 protein_id gnl|my_center|LOCUS_23300 469 1197 gene locus_tag LOCUS_23310 469 1197 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence351 <1 793 gene locus_tag LOCUS_23320 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y751:glucose-1-phosphate thymidylyltransferase >Feature sequence352 1136 297 gene locus_tag LOCUS_23330 gene bamD 1136 297 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8V9 protein_id gnl|my_center|LOCUS_23330 <1965 1248 gene locus_tag LOCUS_23340 <1965 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87SF9:UDP-3-O-acyl-N-acetylglucosamine deacetylase >Feature sequence353 639 1913 gene locus_tag LOCUS_23350 639 1913 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532784.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence354 255 677 gene locus_tag LOCUS_23360 255 677 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence355 1217 1555 gene locus_tag LOCUS_23370 1217 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence356 82 1068 gene locus_tag LOCUS_23380 gene xcsK 82 1068 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5C3 protein_id gnl|my_center|LOCUS_23380 >Feature sequence357 <1 692 gene locus_tag LOCUS_23390 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003641836.1:cystathionine beta-synthase 1630 719 gene locus_tag LOCUS_23400 gene flgL 1630 719 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943668.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence358 241 663 gene locus_tag LOCUS_23410 241 663 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389066.1 protein_id gnl|my_center|LOCUS_23410 <1885 763 gene locus_tag LOCUS_23420 <1885 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0CAW1:DNA replication and repair protein RecF >Feature sequence359 249 974 gene locus_tag LOCUS_23430 gene nnrU 249 974 CDS product NnrU protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707556.1 protein_id gnl|my_center|LOCUS_23430 1149 946 gene locus_tag LOCUS_23440 1149 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence360 630 540 gene locus_tag LOCUS_t00350 630 540 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1393 707 gene locus_tag LOCUS_23450 1393 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence361 1324 725 gene locus_tag LOCUS_23460 1324 725 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence362 <1800 1163 gene locus_tag LOCUS_23470 <1800 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921339.1:LysR family transcriptional regulator >Feature sequence363 >Feature sequence364 142 1128 gene locus_tag LOCUS_23480 142 1128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090824.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence365 753 1151 gene locus_tag LOCUS_23490 753 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence366 580 1386 gene locus_tag LOCUS_23500 580 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1553 1383 gene locus_tag LOCUS_23510 1553 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence367 >Feature sequence368 >Feature sequence369 >Feature sequence370 456 295 gene locus_tag LOCUS_23520 456 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence371 >Feature sequence372 234 680 gene locus_tag LOCUS_23530 234 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence373 931 92 gene locus_tag LOCUS_23540 931 92 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_23540 1386 982 gene locus_tag LOCUS_23550 1386 982 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816523.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence374 242 1444 gene locus_tag LOCUS_23560 242 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence375 >Feature sequence376 281 817 gene locus_tag LOCUS_23570 gene fabA 281 817 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 protein_id gnl|my_center|LOCUS_23570 >Feature sequence377 185 760 gene locus_tag LOCUS_23580 185 760 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJK9 protein_id gnl|my_center|LOCUS_23580 1550 780 gene locus_tag LOCUS_23590 1550 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence378 348 956 gene locus_tag LOCUS_23600 348 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence379 287 607 gene locus_tag LOCUS_23610 287 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919711.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence380 >Feature sequence381 <1 791 gene locus_tag LOCUS_23620 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CCV1:protein TolB 906 1418 gene locus_tag LOCUS_23630 906 1418 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence382 <1473 974 gene locus_tag LOCUS_23640 <1473 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971897.1:rhamnosyltransferase >Feature sequence383 <1 698 gene locus_tag LOCUS_23650 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971719.1:cytochrome P450 794 1405 gene locus_tag LOCUS_23660 794 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence384 544 1272 gene locus_tag LOCUS_23670 544 1272 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence385 >Feature sequence386 1442 951 gene locus_tag LOCUS_23680 1442 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence387 247 828 gene locus_tag LOCUS_23690 247 828 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869396.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence388 1150 302 gene locus_tag LOCUS_23700 1150 302 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence389 1421 633 gene locus_tag LOCUS_23710 1421 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence390 <1 1011 gene locus_tag LOCUS_23720 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708827.1:type II secretion system protein GspD >Feature sequence391 1031 213 gene locus_tag LOCUS_23730 gene rplC 1031 213 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V3 protein_id gnl|my_center|LOCUS_23730 1350 1036 gene locus_tag LOCUS_23740 gene rpsJ 1350 1036 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_23740 >Feature sequence392 <1407 380 gene locus_tag LOCUS_23750 <1407 380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TFP6:epoxyqueuosine reductase >Feature sequence393 1245 340 gene locus_tag LOCUS_23760 1245 340 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence394 >Feature sequence395 1357 767 gene locus_tag LOCUS_23770 gene rkpN 1357 767 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887052.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence396 >Feature sequence397 >Feature sequence398 >Feature sequence399 >Feature sequence400 <1 919 gene locus_tag LOCUS_23780 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920078.1:cell division protein >Feature sequence401 >Feature sequence402 >Feature sequence403 <1222 83 gene locus_tag LOCUS_23790 <1222 83 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067101.1:translocation/assembly module TamB >Feature sequence404 <1214 568 gene locus_tag LOCUS_23800 <1214 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GX04:tRNA (guanine-N(7)-)-methyltransferase >Feature sequence405 >Feature sequence406 >Feature sequence407 <1 570 gene locus_tag LOCUS_23810 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083841.1:acyl-CoA dehydrogenase >Feature sequence408 485 688 gene locus_tag LOCUS_23820 gene rpmI 485 688 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH9 protein_id gnl|my_center|LOCUS_23820 733 1092 gene locus_tag LOCUS_23830 gene rplT 733 1092 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M3 protein_id gnl|my_center|LOCUS_23830 >Feature sequence409 <1120 489 gene locus_tag LOCUS_23840 <1120 489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089246.1:serine protease >Feature sequence410 >Feature sequence411 <1 775 gene locus_tag LOCUS_23850 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920779.1:pilus assembly protein CpaF >Feature sequence412 >Feature sequence413 >Feature sequence414 >Feature sequence415 55 924 gene locus_tag LOCUS_23860 55 924 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence416 >Feature sequence417 >Feature sequence418 <1 674 gene locus_tag LOCUS_23870 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920778.1:secretion protein F >Feature sequence419