COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..691103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(731..1135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1139..1522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1533..2609) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9E4 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene pheS CDS complement(2736..3092) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rplT CDS complement(3104..3304) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M2 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene rpmI CDS 3732..4706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 4746..6056 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(6065..7270) product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7320..10430) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(10724..11182) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809010.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 11309..11596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 11624..12634 product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE45 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 12746..13708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 13715..14167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(14178..14645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 14539..14742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 14846..15289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 15291..15626 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 15630..17417 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N0 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 17507..18175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(18225..19346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 19512..20348 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(20343..22205) product spermidine dehydrogenase SpdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene spdH CDS complement(22265..22897) product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(22894..25134) product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 25516..26382 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ72 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene sdhB CDS 26387..27313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(27324..29285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 29327..29977 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(30024..30545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(30784..31344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(31479..31769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 32194..33522 product ammonium transporter channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33663..33992 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969946.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 33992..34432 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 34438..35667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 35660..36142 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 36162..37199 product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 37233..38360 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 38432..39700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(39697..41457) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(41466..41744) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 41851..43092 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 43089..43703 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ03 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene rimM CDS 43719..44480 product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X36 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene trmD CDS 44477..44854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 45019..45576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 45708..46256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(46253..47260) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFL1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene bioB CDS complement(47275..48075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(48161..49591) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(49693..50160) product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529654.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(50290..50826) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(50823..51956) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390855.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 52079..52492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(52540..53502) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EYJ6 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene mdh CDS complement(53580..54236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(54310..55002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(55094..56539) product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 56807..57208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(57374..57565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(57703..58602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(58752..59138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(59166..60701) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAG5 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene ffh CDS complement(60701..61021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 61383..62252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(62259..62663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(62744..63142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(63576..64154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(64189..65457) product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(65514..65915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(65912..68041) product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 68244..68840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(68854..69402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(69547..71031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(71115..71825) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5E0 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene rph CDS 71974..72999 product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9REF2 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene hrcA CDS 73118..73666 product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCN8 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene grpE CDS complement(73739..75328) product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBF9 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene pckA CDS 75550..75801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 75886..76779 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(76763..79003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(79095..80045) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 80228..80413 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721359.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(80425..82074) product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(82171..82497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 82561..82935 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388090.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(82943..83371) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(83502..85022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(85019..85978) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(86072..86512) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(86522..87064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(87103..87648) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 87766..88518 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WJ8 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene nth CDS 88654..89346 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT0 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene pyrF CDS complement(89361..89942) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 90141..90650 product Nex18 symbiotically induced protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene nex18 CDS 90975..92708 product acyl-ACP synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919601.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(92802..94307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(94315..95850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(95903..96622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 note possible pseudo, internal stop codon, frameshifted CDS complement(96619..97569) product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV6 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene hemC CDS 97678..98772 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV5 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene tsaD CDS complement(98820..99263) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(99868..100503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 100583..101593 product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4E8 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene gpsA CDS complement(101756..102145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 102326..103063 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 103068..103667 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(103664..104887) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene argG CDS complement(105024..105440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(105570..106895) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(106952..107971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(108148..109155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(109399..109560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(109684..110106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(110297..110632) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224722.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(110650..111279) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 111447..111893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 111890..112327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(112324..113553) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ6 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene trpB CDS complement(113610..114236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(114248..114919) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS6 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene trpF CDS complement(114928..115305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(115351..115674) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C3 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene ihfB CDS 115802..116581 product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A258 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene ubiE CDS complement(116578..117240) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K52 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene sipF CDS 117330..118862 product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCL8 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene ubiB CDS 118940..119545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 119599..120828 product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 120836..121204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(121255..121932) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(121929..122543) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 122618..123226 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 123242..123514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(123531..124049) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5H3 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene rppH CDS complement(124077..125357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(125506..126939) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene ctpA CDS complement(126991..128196) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(128220..128702) product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV09 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rlmH CDS complement(128724..129275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(129277..130872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(130962..132035) product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV04 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene obg CDS 132155..133255 product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 133277..133945 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 134045..134797 product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WR1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 135111..135707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(135694..136464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 136632..137435 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(137430..138539) product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074059.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene kynU CDS complement(138542..139042) product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310195.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 139152..139661 product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(139723..140238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 140592..141125 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(141122..141811) product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30961 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(141808..142890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(142904..144184) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(144243..144647) product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene flbT CDS complement(144744..145835) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(145832..147013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(147165..148127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(148142..149362) product sulfolipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403223.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(149487..150431) product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFD2 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene gshB CDS complement(150455..150997) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(151077..151460) product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP9 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(151457..152302) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK8 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene rsmI CDS 152481..153827 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 153865..154581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 154620..154820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 154836..155306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(155345..155914) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene dut CDS complement(156025..156372) product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL34 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene atpC CDS complement(156508..158127) product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene atpD CDS complement(158267..159148) product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S2 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene atpG CDS complement(159169..159654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(159681..161210) product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5I2 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene atpA CDS complement(161215..161787) product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X71 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene atpH CDS complement(162056..162610) product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969460.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(162745..165054) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB85 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene priA CDS 165054..166088 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 166140..166859 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 166877..167722 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene dapD CDS complement(167719..168183) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918163.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 168231..169394 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF3 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene dapE CDS complement(169391..170128) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SH4 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene truA CDS 170164..170904 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W2 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(170907..171827) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYF1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene fmt CDS complement(171859..172377) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ4 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene def CDS 172537..174330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(174327..175760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 175854..177059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(177155..177760) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF8 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene recR CDS complement(177764..178213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(178188..178457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(178608..179528) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257720.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(179541..179861) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44711 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(179861..181678) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene dnaX CDS complement(181749..182009) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(182023..182430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 182776..183282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 183321..184226 product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(184229..185086) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 185306..185989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(185996..186319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811819.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(186424..186858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(186868..188151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 188432..188584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(188588..189334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(189374..190831) product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN18 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 190930..192150 product L-threonine dehydratase catabolic TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2D0 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 192297..193019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(193016..195160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 195361..196896 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 196901..197209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 197255..198004 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(198029..199768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039109.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 200283..202604 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene fyuA CDS 202723..202998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 203199..204506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 204518..205591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 205771..206286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 tRNA complement(206348..206432) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(206495..207817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388514.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 207970..208605 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 208670..209224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 209221..209769 product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A697 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene coq7 CDS 209841..211709 product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(211757..212092) product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50935 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene hisE CDS complement(212103..212873) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50937 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene hisF CDS complement(212879..214417) product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(214489..215232) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBC2 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene hisA CDS complement(215217..215861) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58788 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene hisH CDS complement(216012..216266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(216290..216550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 216713..216970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(216979..217572) product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW12 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene hisB CDS 217724..218254 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBH2 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene hslV CDS 218526..219215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 219364..220671 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN2 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene hslU CDS 220911..222734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(222783..223343) product smr protein/Muts2-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(223340..224701) product membrane-bound lytic murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CK4 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(224748..225401) product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 225475..225858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 225940..226449 product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN7 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene secB CDS complement(226446..227165) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene dnaQ CDS complement(227214..229895) product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 230126..231046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(231050..231397) product putative arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44589 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene arsC CDS complement(231464..232153) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385542.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(232232..232957) product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 232934..233578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(233579..233929) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene mmcA CDS complement(234147..235466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 235779..236249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 236289..236657 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 236685..239261 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A217 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene leuS CDS 239319..239954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 239959..241014 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene holA CDS 241045..242490 product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 242513..243004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 243068..243715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(243739..244692) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(244704..245519) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(245509..246132) product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene rsmG CDS complement(246129..248102) product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV0 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene mnmG CDS 248435..248686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(248728..250083) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW34 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene mnmE CDS complement(250181..250414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(250513..252048) product amino-acid transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(252147..253139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 253254..253631 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811198.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 253660..254631 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 254698..255177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 255242..256216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 256363..256710 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene arsR CDS 256743..257189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 257206..257916 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 257944..258597 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920739.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 258620..259045 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 259092..259571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 259585..259941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 note possible pseudo, frameshifted CDS 259968..260498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918963.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(260495..261661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(261702..262319) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(262448..262828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 263197..263667 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 263664..265925 product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(265931..266884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(266957..268228) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KW0 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene rho CDS complement(268396..268842) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(268842..269879) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene hemE CDS 270268..271146 product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C520 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 271164..271766 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEF4 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 271766..272617 product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene aroE CDS 272614..273216 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58100 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene coaE CDS complement(273226..274224) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 274382..274747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(274744..276087) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene ampG CDS complement(276130..278037) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083486.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(278193..278888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 278951..279403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 279491..280537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(280731..280922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 280958..281224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 281229..281702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 281713..282111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(282108..283064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 283146..283436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 283679..283909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(283872..284138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(284132..285085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 285318..287138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 287227..288867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(289101..290675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(290672..291586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 291960..293885 product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42374 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene dnaK CDS 294041..295201 product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNE7 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene dnaJ CDS 295205..295453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 295635..295925 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 296196..297326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(297335..298615) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918291.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 298735..299421 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 299433..299888 product putative N-acetyltransferase YsnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94562 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene ysnE CDS 299898..300245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 300363..301169 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK2 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene dapB CDS 301334..301867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(301874..302671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(302696..303940) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 304105..305388 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene amt-2 CDS 305479..307914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 308148..309587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(309584..311056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 311204..312073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 tRNA complement(312201..312275) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 312361..312930 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 313000..313938 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 313935..314600 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 314629..314841 product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXJ8 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 314925..316073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 316070..316921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 317000..318466 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9C8 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene amn CDS complement(318463..319236) product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(319233..320384) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331688.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(320462..320956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(321098..322306) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(322310..322585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(322616..323545) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(323542..325338) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 325815..326591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 326832..328958 product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K83 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene hppA CDS complement(329025..330815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 331188..331922 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 331919..332971 product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF70 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene gly1 CDS complement(332968..333432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(333462..334238) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(334272..335318) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIN3 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene hemH CDS 335495..336481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(336494..336871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 336915..337754 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene hetN CDS complement(337767..338159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(338174..340468) product malic protein NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 340660..341244 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 341311..341520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 341565..342149 product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4V1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 342159..342950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(342947..343531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 343600..344277 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917948.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 344274..344720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 344816..345232 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 345390..346511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(346515..347168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 347255..348211 product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7R9 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 348367..348513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 348592..348861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 348984..349883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(349932..350123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(350257..350874) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(350874..351302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(351461..352216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 352379..353755 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U7 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene miaB CDS 353752..354726 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene phoH CDS 354723..355172 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9E2 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene ybeY CDS 355190..356089 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene corC CDS 356096..357706 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene lnt CDS 357788..358258 product putative HTH-type transcriptional regulator R00410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C5S2 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 358374..359594 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(359601..360290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 360631..360984 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 361019..361699 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene trmB CDS 361759..363078 product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 363160..363564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 363635..364501 product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFD9 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene ttcA CDS complement(364498..364992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(365090..365821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(365882..366829) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 367067..367636 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX01 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene rimP CDS 367633..369261 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC64 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene nusA CDS 369338..369892 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917933.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 370048..372672 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SW4 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene infB CDS 372833..373891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 373979..374374 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWZ3 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene rbfA CDS 374371..375468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 375566..376498 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58063 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene truB CDS 376558..378591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 378667..379224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 379283..380044 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 380145..382259 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLU2 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene pnp CDS 382429..384336 product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 384417..385523 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140175.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 385663..386511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(386508..386936) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(386933..387757) product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A249 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(387788..387976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(387981..388748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(388752..389966) product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene fabB CDS complement(390009..390560) product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene fabA CDS complement(390656..391231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 391376..392383 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(392388..393404) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 393779..394249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(394250..394876) product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(394891..395649) product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(395658..396104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(396121..397269) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(397266..398036) product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AW2 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(398036..398644) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 398969..399103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 399307..399819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 399832..400407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 400407..400631 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(400633..401943) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(401971..402141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 402074..402571 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 402626..403774 product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABT6 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene rlmN CDS 403840..404532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(404550..404858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970194.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 404974..405396 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 405496..406125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 406207..407748 product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 408010..408693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 408626..409831 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene glpQ CDS 409843..410700 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 410697..411533 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(411577..412041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(412124..412912) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(412912..413853) product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58097 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene hslO CDS complement(413863..414723) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 414965..415471 product cell cycle regulatory protein GcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene gcrA CDS complement(415527..416216) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene phoB CDS complement(416234..416968) product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(417103..418497) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene phoR CDS complement(418551..420335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(420349..420783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 420900..422120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(422140..422592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene mmcB CDS complement(422646..422966) product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 423101..423559 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 423571..424650 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 424647..425381 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 425381..428398 product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921366.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 428395..431868 product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 431920..432255 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(432309..433610) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(433651..434622) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7R7 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene accD CDS complement(434675..435517) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE4 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene trpA CDS complement(435654..436289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 436492..436851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(436861..437787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 438057..438926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 438940..440877 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene thrS CDS 440921..442159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 442185..443159 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(443156..444634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(444656..446299) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 446402..447148 product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 447256..447672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(447732..447965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 448101..449876 product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(449883..450494) product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 450720..451895 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 451954..452679 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 452859..453668 product DUF4908 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639994.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 453746..454147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(454144..454788) product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI22 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(454908..456563) product 60 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35471 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene groL5 CDS complement(456609..456896) product 10 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35474 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene groS5 CDS 457254..457922 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 458171..459280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 459342..460190 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918591.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 460184..461080 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIK2 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 461206..461877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 462007..462465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 462489..462890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 463404..466421 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIJ9 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene ileS CDS 466418..466945 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAA6 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene lspA CDS 467076..467618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918585.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(467795..468187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(468400..469128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(469245..469964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 470191..472047 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV5 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene mutL CDS complement(472044..472661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 472836..473429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 473429..474112 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 474260..474664 product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSV9 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene mscL CDS 474975..475385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 475515..477314 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BJ8 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene lepA CDS complement(477311..477919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 478049..479038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(479035..479598) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene efp CDS complement(479716..481941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(482055..482801) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9K1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 482923..483669 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709510.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(483657..483917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(483982..484857) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 485006..485644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(485711..486922) product CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 487188..487448 product UPF0386 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABK1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 487553..489496 product FmtA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(489493..490605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(490607..492037) product alginate regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(492057..492869) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(492918..493502) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG0 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(493512..493994) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene lrp CDS complement(494320..494601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(494708..495271) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(495278..495535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(495616..495795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(495792..496544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(496608..497798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 497943..498392 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C334 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene tadA CDS 498407..498820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 498885..500108 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918576.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 500266..500724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 500873..501283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 501345..501761 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(501758..502693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(502806..505937) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(505942..507108) product secretion protein HylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972024.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 507505..507834 product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 507860..508681 product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 508784..510172 product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PZ0 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene norM CDS complement(510169..510981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 511243..511887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(511903..513315) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(513426..513773) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532197.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(513777..514304) product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(514314..515006) product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(515021..515320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(515440..516411) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3C3 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene rpoH CDS complement(516674..518194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(518321..518740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 518901..519482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(519484..520665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(520745..521824) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T0 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 521894..522307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(522308..522865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 522981..523634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 523637..523954 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(523955..524311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(524338..525204) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 525410..526819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(526822..527334) product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(527394..528332) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWW9 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene ubiA CDS 528542..529324 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF65 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 529385..530806 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921243.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 530816..531217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 531266..531901 product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920062.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 532083..532649 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 532747..533538 product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 tRNA 533622..533698 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(533715..535076) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(535224..536366) product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 536498..537013 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKL0 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene gntK CDS complement(537045..538088) product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919106.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(538085..540370) product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038895.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene bglX CDS complement(540459..541691) product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(541941..543083) product glycosyltransferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene cps1B CDS complement(543147..544700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 544835..546229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 546539..548041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 548031..549812 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene rtxB CDS 549816..551135 product HlyD family type I secretion membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010239.2 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 551412..552110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 552120..552557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 552606..552845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(552988..554007) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 554089..554964 product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KV0 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene kdsA CDS complement(554961..556316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(556391..556990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(556987..557808) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 558024..560390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(560392..561177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(561174..562274) product putative epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704838.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(562377..563303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 563589..564545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 564637..566088 product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230408.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 566097..567296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(567364..567957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(568163..568990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(568996..569724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(569721..570677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(570719..571564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(571557..572867) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 573249..574169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(574238..574486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 574394..575353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 575367..576446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 576502..577485 product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 577619..578170 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565041.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene rfbC CDS 578454..579155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 579294..580415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 580549..581538 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 581721..582779 product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABG7 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 582945..584168 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(584175..586538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 586734..586946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(586973..588148) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 588420..589862 product AGCS sodium/alanine/glycine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113731.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(589935..590786) product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 590892..591551 product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 591582..591887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 591899..593041 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(593042..593326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(593450..594418) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene ephA CDS 594538..594969 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(594973..595899) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(595972..596997) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABH4 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene asd CDS 597203..598471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(598493..599338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 599389..600780 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDM9 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene murC CDS 600813..601487 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709430.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 601561..602754 product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ84 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene sucC CDS 602760..603242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 603246..603665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 603678..604526 product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9F0 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene rlmJ CDS complement(604543..604905) product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531477.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 605007..605375 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 605646..606545 product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 606648..609614 product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene sucA CDS 609648..611177 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene sucB CDS 611201..611806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 611827..613233 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB89 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 613235..613498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 613568..614035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 614260..616056 product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 616125..616688 product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 616706..617011 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(617012..617767) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(617764..618762) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(618759..619577) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919074.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(619574..621379) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(621724..621852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(622045..623409) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 623668..624819 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(624927..625553) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 625841..627685 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(627692..628423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 628581..631271 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene mutS CDS 631318..631992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 632088..634817 product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T787 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene glnD CDS 634928..636526 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5G2 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 636569..637597 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC05 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene trpS CDS 637752..638705 product bactoprenol glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(638706..639974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 640082..640654 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 640641..641003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(641000..641911) product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 642024..642758 product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYN6 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene gpmA CDS complement(642761..643090) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U91 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(643087..643335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 643476..645491 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX58 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene tklB CDS 645504..646511 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 646569..647009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 647024..648217 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M79 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene pgk CDS 648240..649271 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 649427..650293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 650334..650981 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene thiE CDS 650956..651186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 651220..652188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 652235..652735 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U82 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene ruvC CDS 652736..653368 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U81 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene ruvA CDS 653365..653874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 653867..654901 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF5 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene ruvB CDS 654981..655496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(655493..656539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 656604..657017 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 657282..657992 product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 657992..658426 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 658456..659340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 659383..660714 product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene tolB CDS 661012..661518 product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 661697..662506 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 662628..663830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 663988..665922 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE6 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene ftsH CDS complement(666002..667126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(667184..667855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 667775..667957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 668117..668938 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCU6 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 668995..670362 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L9 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene glmM CDS complement(670423..670965) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene mip CDS 671110..671679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(671738..672259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 672305..672928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(672925..673119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 673243..674019 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(674771..676135) product NTPase KAP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(676245..676493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(676620..678593) product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC10 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(678836..680248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(680368..681816) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 681945..682730 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 682727..683110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(683272..685083) product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 685146..685739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 685959..686273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 686387..686686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(686670..687587) product acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene bah CDS complement(687789..688844) product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB72 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(688985..690178) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 690473..690742 product protein usg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 sequence02 source 1..406971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1287..2930 product heme utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088867.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(2966..3286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 3568..5832 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 5836..7215 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 7215..8858 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 8852..10444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 tRNA 9997..10091 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 10441..11238 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918223.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 11328..12218 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene fox2 CDS 12386..13312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(13334..13948) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 14333..15982 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene atsA CDS complement(16057..16281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 16190..19117 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene btuB CDS 19395..20540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 20528..21325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 21327..22025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 22093..22851 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 22898..23893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(23901..25040) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(25092..26504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(26701..27723) product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(27739..28518) product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 28768..29916 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 30007..30819 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene pcaR CDS 31009..33261 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 33338..33979 product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UK86 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 34041..34574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 34605..35432 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 35661..35918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(35988..36179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532144.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 36294..37172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 37434..38672 product putative hydrolase/peptidase y4tM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55667 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(38781..39272) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 39633..40160 product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene ectA CDS 40163..41452 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene ectB CDS 41463..41855 product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ8 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene ectC CDS 41858..42793 product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 42809..44263 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263925.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 44325..44636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 44643..46088 product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene opuE CDS complement(46103..46720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(46793..47446) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F0 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene tal CDS complement(47464..48783) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44398 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene xylA CDS complement(48783..50240) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(50407..52275) product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A667 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(52385..53665) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(53656..54153) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(54146..55138) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919322.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 55339..56562 product D-mannonate dehydratase CC2812 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 56697..58133 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene xylE CDS complement(58195..59256) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920901.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene xylR CDS complement(59378..60496) product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4M7 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 60683..62383 product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(62371..63891) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(63901..65427) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(65427..66905) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(66914..68377) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 68712..72053 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 72234..73298 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(73446..76385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 76654..77571 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 77634..80153 product 1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene celD CDS complement(80372..82351) product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039172.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(82335..83828) product mannitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969872.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(83828..85246) product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0M5 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene uxaC CDS 85393..86292 product ketodeoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 86350..87189 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(87386..89683) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene fhuA CDS complement(89652..89825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(89914..90948) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038454.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene cebR CDS complement(90965..92551) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 92891..94117 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(94193..95209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 95449..96666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 96806..98557 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(98707..99219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 99342..100289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 100570..101691 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971966.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(101701..102684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 102900..103235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(103392..104555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 104723..105373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(105441..105650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(105835..106854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636161.2 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 107114..109249 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096983.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 109342..109533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 109533..110039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(110036..110599) product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(110629..111543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 111903..113534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(113537..114691) product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(114871..116979) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970655.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene pbpC CDS complement(117164..117928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(117925..118695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(118695..119450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(119447..120220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(120220..120912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(120912..121667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(121664..122431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(122428..123168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(123168..123947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(123995..124762) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142852.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(124855..125628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(125628..126380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(126377..127084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(127093..128160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(128239..129234) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(129330..130091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(130104..131924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(131978..132511) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(132717..133172) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 133253..133951 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(133955..134644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 134878..136326 product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(136329..136814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(136879..137958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 138153..138599 product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3C8 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 138720..140834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 141082..142053 product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(142050..143117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 143718..144311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(144247..144447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 144528..144980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 144955..146166 product large terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(146289..148040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 148402..149346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 149493..150911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 150999..152201 product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 152318..153835 product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532632.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 153959..154642 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 154751..156175 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 156236..156520 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene hupB CDS 156696..159578 product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R86 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene glnE CDS 159609..160934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 160927..162525 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 162522..163700 product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 163745..164152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 164220..164822 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S9 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 164794..165270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 165255..165788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(165785..167074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(167305..169545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 169776..170786 product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene argF' CDS 170783..171592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 171607..172926 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J6 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene argB CDS 172987..173379 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 173413..174360 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J8 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene argC CDS 174383..176134 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene kefB CDS complement(176131..177294) product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(177291..178238) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(178418..179773) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK8 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 179937..180848 product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(180962..181240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 181441..182154 product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227762.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(182151..182804) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(182804..183508) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 183645..185051 product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 185048..185425 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 185460..187130 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971777.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene nadE CDS 187225..187569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 187615..188487 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(188488..189030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(189049..190938) product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(191105..191788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 191920..193248 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC35 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene gltX CDS complement(193394..193948) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D018 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 194052..195020 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(195023..198322) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(198319..199389) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(199565..200383) product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061715.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(200420..202048) product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(202316..203941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 204401..205621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 205687..208113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 208180..210306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 tRNA 210066..210148 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 210357..211550 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 211550..212527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 212547..214697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 214925..218050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(218029..219171) product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH3 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene queG CDS complement(219171..219854) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene Gst CDS 220029..221669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(221680..222477) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(222529..222753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 222905..224365 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532222.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 224484..225809 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene ugdH CDS complement(225816..226325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(226523..227881) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene lplT CDS complement(227878..228654) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(228667..229290) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(229537..231009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(231013..232488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 232751..233083 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene YajC CDS 233137..234771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 note possible pseudo, internal stop codon, frameshifted CDS 234782..235750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 note possible pseudo, internal stop codon, frameshifted CDS 236033..239575 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036532.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene btuB CDS complement(239671..240270) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDA9 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene sodB CDS 240481..241200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(241210..242781) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 242983..245802 product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene glnE CDS complement(245799..246017) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(246138..246362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(246489..247880) product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJJ3 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene fumC CDS complement(247984..248496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 249098..249406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(249403..250893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 251048..251842 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDS3 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene thyA CDS 251839..252327 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 252324..252851 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TG76 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 253012..254214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(254215..255324) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0V6 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 255472..256650 product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 256652..257527 product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G39 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 257665..259065 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(259068..259946) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene serB CDS 259965..260852 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6J5 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene miaA CDS 260958..261425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(261422..262111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 262456..263181 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 263344..264384 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 264457..265392 product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX69 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 265395..265907 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 265911..267854 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 267859..269007 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene rodA CDS complement(269128..269448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 269653..271200 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 271693..271989 product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PF1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 272088..272783 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918126.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene chvI CDS 272790..274511 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene chvG CDS 274589..274999 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 275000..275290 product phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(275287..276414) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(276428..279523) product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(279676..281985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(281985..282368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(282533..283354) product 2-hydroxymuconic semialdehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528313.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 283283..283561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 tRNA 283552..283628 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 284229..285086 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A8 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 285083..286150 product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919999.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 286156..288798 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(288786..289775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(289797..292301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 292754..293743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 293740..294651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 294651..295844 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 295832..297046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 297043..297783 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 297744..298703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 298700..299623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 299625..300692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 300685..301602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 301656..302639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 302641..303954 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(303888..304988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 305232..306722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(306697..307299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(307357..308394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(308398..309516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(309550..310773) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(310794..312002) product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene ddhC CDS complement(311995..313089) product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene rfbG CDS complement(313070..313855) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(314004..314891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(314920..315963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(315963..316997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 317193..317858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(317877..319526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(319673..320365) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene hutC CDS complement(320362..321732) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene hutF CDS 321827..323365 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8Z7 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene hutH CDS 323362..324165 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061587.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 324165..325832 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V80 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene hutU CDS 325920..326495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(326529..327233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 327630..328025 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6X0 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene nuoA CDS 328016..328585 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWV5 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene nuoB CDS 328598..328843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 328836..329447 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7W5 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene nuoC CDS 329450..330670 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9C5 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene nuoD CDS 330667..331086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 331219..331899 product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene nuoE CDS 331922..332428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 332446..333756 product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene nuoF CDS 333753..334316 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 334440..334820 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene hup CDS complement(334890..335975) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(336051..336683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 336804..337031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 337178..339283 product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH89 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 339547..340074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 340175..340828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 340998..341690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(341746..343836) product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 344047..345126 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C802 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene nuoH CDS 345126..345614 product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F0 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene nuoI1 CDS complement(345636..346355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 346681..347319 product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene nuoJ CDS 347333..347641 product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KJ8 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene nuoK CDS 347656..349797 product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 349794..351377 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975094.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 351377..352822 product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH96 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene nuoN CDS 352825..353547 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537944.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 353564..354343 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A7 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene coaX CDS 354343..355998 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 355995..356240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 356349..357809 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6C0 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(357810..358031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(358178..358399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 358837..359808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 359939..360370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 360367..361149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 361323..361994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(361991..362809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 362928..363767 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 363816..364283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(364296..365360) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(365491..366993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 367338..367670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 367687..368262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 368433..369014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(369105..370403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(370709..372478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 372633..375485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 375630..375836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 375850..376224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 376291..376947 product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 377045..377458 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene cheY CDS 377552..378367 product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUJ4 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene uppP CDS 378459..379469 product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 379717..380013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(380046..380381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 380313..380504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(380682..381260) product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921424.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(381338..382852) product RNA polymerase sigma-54 factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30333 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene rpoN2 CDS complement(382873..383688) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(383736..384242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(384239..385003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(385135..385749) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(385786..386943) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(387011..387610) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene tag CDS complement(387622..388032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(388076..388876) product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918273.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 388972..390045 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN45 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene pyrC CDS complement(390054..390488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(390521..390955) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 390974..391669 product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(391666..392358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(392355..392693) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(392735..392905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 392868..394322 product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9N6 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(394350..394646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 394717..395289 product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21861 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene bar tRNA 395400..395484 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 395551..396918 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX17 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene tig CDS 397209..397835 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGD9 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene clpP CDS 398036..399319 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA45 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene clpX CDS 399605..401992 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW0 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene lon CDS 402266..402538 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 tRNA 402680..402755 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 402935..403951 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 403956..404546 product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337853.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 404694..405155 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561349.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 sequence03 source 1..367613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..719) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(739..1452) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1479..2315) product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920259.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 2952..3887 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 4385..6874 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 6971..7504 product 2,4'-dihydroxyacetophenone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 7508..7912 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 7922..8461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 8465..9286 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533089.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 9288..10295 product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 10338..11225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(11793..12557) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207075.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(12561..13358) product putative oxidoreductase YxbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46331 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene yxbG CDS complement(13355..14224) product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(14296..15135) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(15125..16606) product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(16599..17945) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188081.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(17948..18424) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228456.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(18428..19480) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(19491..21305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 21462..22391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 22526..23539 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(23694..25259) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(25358..26212) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE68 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene purU CDS 26554..27951 product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene gcvT CDS complement(28176..29042) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIN8 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene metF CDS complement(29177..30916) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 31092..32297 product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGW3 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene kbl CDS 32360..32920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 32990..33142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(33150..34751) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 34885..35919 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2F4 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene tdh CDS 35951..37090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 37147..37608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 37608..38762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 38772..38993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 38990..39424 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 39785..41044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 41096..41926 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 42097..42660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(42748..45072) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(45076..45420) product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSI5 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene clpS CDS complement(45650..46288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 46528..47844 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969214.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(47849..48850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(48986..51796) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 52047..53999 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2I0 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene acsA CDS 54084..55592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 55596..57473 product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(57470..58531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(58524..59642) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 59729..60220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 60217..61353 product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene solA CDS complement(61362..62093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(62219..63211) product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I9 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene pdhAa CDS complement(63287..63616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(63786..64247) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(64252..65526) product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBJ9 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene eno CDS complement(65595..66542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(66618..68306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(68432..68614) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ26 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene rpmF CDS 68872..69279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(69290..69574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(69790..70164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(70225..70629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(70751..71800) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(72029..72571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(72629..74134) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC0 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene gatB CDS complement(74161..74946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 75077..75958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 75983..76420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(76473..77954) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAA3 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene gatA CDS complement(77951..78337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(78421..78720) product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K9 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene gatC CDS complement(78760..80115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 80134..80628 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Z5 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(80603..80911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 81044..82003 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ49 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene pyrB CDS 82149..83708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 83843..84439 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ47 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene plsY CDS complement(84464..85051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 85241..86359 product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene dprA CDS 86535..89225 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene topA CDS 89464..89937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 90045..92381 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U806 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene rnr CDS complement(92558..94789) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 94989..95585 product peptide methionine sulfoxide reductase MsrA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LI5 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene msrA2 CDS complement(95736..97991) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(98194..99252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918100.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 99695..102085 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 102237..103463 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(103525..106896) product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene oar CDS complement(107142..108905) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A347 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene argS CDS complement(108902..109459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 109626..110579 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5X0 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene ispH CDS 110591..111019 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU3 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rnhA CDS complement(111037..111525) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 111645..112271 product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5C6 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(112392..114449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(114736..115335) product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene rimJ CDS complement(115388..116854) product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene sthA CDS complement(116931..118181) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084001.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene mpp CDS complement(118178..119584) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene thrC CDS complement(119601..120716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 120841..121065 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I5 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene rpmE CDS complement(121276..121779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene rcdA CDS 121915..122655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(122660..123619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(123644..125002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 125124..126527 product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene trmFO CDS 126711..127469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(127475..128128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 128277..129200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083635.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 129550..129945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 129952..131520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 131517..131927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 132167..134491 product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV5 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene katG2 CDS 134797..135162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(135223..137103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040060.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(137169..137363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 137584..138576 product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 138714..139406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(139403..140182) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 140608..141201 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD02 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene ubiX CDS 141198..141740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 141737..142078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(142156..142878) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene dgcA CDS 143321..143821 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3C0 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene purE CDS 143955..145073 product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIL4 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene purK CDS 145392..145865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 145980..146147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(146144..148330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(148394..149191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 149369..149578 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU4 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene rpsU CDS 149656..149778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 150169..151176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(151330..152259) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(152388..153788) product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EG1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene pntB CDS complement(153798..154271) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(154306..155529) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921137.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(155560..155787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(155915..156964) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 157249..158733 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene tacA CDS 158816..159679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(159845..160111) product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4R9 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(160238..160765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(161557..162270) product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533672.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(162338..162760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(162974..165451) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene lhr CDS complement(165557..167242) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(167278..167943) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(167958..168323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 168600..169073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(169143..169751) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(169917..170876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 171010..172209 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene hutI CDS 172498..173394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 173394..174368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 174686..176878 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene fyuA CDS complement(177027..177929) product AttM/AiiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729411.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 178051..179541 product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAY7 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene glpK CDS complement(179538..180605) product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVV9 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene selD CDS 180687..181775 product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW76 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 181762..182493 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(182490..183863) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R6 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene der CDS complement(183892..185295) product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(185299..186138) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(186271..187605) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(187619..189112) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(189125..189955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(190050..192365) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036237.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene fyuA CDS complement(192638..194233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(194332..194655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 194536..196398 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(196549..197280) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 197598..198947 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene spuB CDS 198950..200317 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 200314..201699 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969984.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 201705..202988 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(202985..204367) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(204360..204620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 204673..205986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 206077..207045 product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 207053..207559 product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene crtZ CDS complement(207556..208533) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54905 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene crtB CDS complement(208535..210034) product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene crtI CDS complement(210035..211228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 211285..212052 product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(212061..213029) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB2 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene htpX CDS complement(213026..213637) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(213643..214206) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(214374..215147) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(215218..215841) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(215870..216193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 216470..217246 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD65 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene purC CDS 217341..217907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(217919..219334) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 219369..219728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 219725..220435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 220453..221136 product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58760 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene rutB CDS 221147..221809 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFC6 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene purQ CDS complement(221806..223293) product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919200.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 223377..224615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 224729..225724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 225791..226861 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 226969..227784 product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640300.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(228103..230151) product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene shc-1 CDS complement(230221..231426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(231603..232010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(232014..232436) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 232593..232865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 232868..233731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 233743..235485 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 235512..237017 product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(236984..237535) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(237538..239301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 239492..239941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(240027..241820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(241872..242768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 242908..243801 product chemotaxis MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene motB1 CDS 243894..245204 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4I1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene flgE CDS 245229..246698 product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene flgK CDS 246701..247702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 247704..248816 product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4H8 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene flgI CDS complement(249003..249788) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ0 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene recO CDS complement(249769..251022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(251204..252139) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H630 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene era CDS complement(252132..252830) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A805 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene rnc CDS complement(252827..253633) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(253678..254076) product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ6 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene acpS CDS complement(254084..254380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(254380..255138) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene pdxJ CDS complement(255281..255865) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A810 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene pyrE CDS complement(255852..258128) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(258212..258577) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R52 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene rpoZ CDS complement(258707..259204) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919425.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 259271..259903 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 259900..260568 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 260633..261130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(261127..261600) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7A0 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene smpB CDS complement(261600..262481) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZG9 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene dapA CDS 262616..265390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 tRNA 265506..265596 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 265722..266093 product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(266145..267464) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(267465..268421) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(268506..270887) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(271003..272097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(272115..272744) product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(272734..273717) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR64 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene glk CDS complement(273710..275554) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene edd CDS complement(275565..276278) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706901.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(276268..277803) product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGK2 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene zwf CDS 277950..278489 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 278586..279965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(279971..286546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 286767..288485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 288482..290710 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114950.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 290734..292083 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040402.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(292123..294366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(294363..295346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 295459..295848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 295851..296603 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(296604..298088) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(298132..298635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(298814..299242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(299288..300700) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 300902..301429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 301534..303006 product carotenoid oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(303022..303453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(303450..305021) product 4-cresol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 305147..305569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 305575..306099 product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R297 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 306161..307039 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(307061..308404) product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 308766..311138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(311154..311867) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533045.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(312003..313001) product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(313008..313937) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 314012..315253 product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene dadA CDS 315264..316463 product X-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene pepQ CDS complement(316585..319581) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(319671..321050) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729390.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 321201..322670 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102291.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(322681..324054) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(324105..325748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 325947..327782 product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 327779..329383 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64W90 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 329383..330372 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 330369..332333 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 332335..333222 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 333257..334294 product trans-3-hydroxy-L-proline dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WR9 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(334298..335833) product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(335892..337388) product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(337471..339237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(339611..339868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(340608..340823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(340932..343520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(345482..345790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970276.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(345796..346032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(346029..346982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 347685..347879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(347941..350223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(350220..350765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 350814..351020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 351231..352241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707169.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(352252..354390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(354398..357115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(357210..358283) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920554.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(358280..358819) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(359064..360161) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090895.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 tRNA complement(360428..360504) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 360701..361411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(361456..363129) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 363355..364179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 364273..364485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(364498..365049) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(365152..365487) product UPF0339 protein YegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76402 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene yegP sequence04 source 1..288163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..796 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89DR2:carbamoyl-phosphate synthase large chain locus_tag LOCUS_13950 CDS 987..1460 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4I3 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene greA CDS complement(1554..2315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(2426..3070) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene gmk CDS complement(3080..3991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(3988..5055) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(5099..6385) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV7 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene fabF CDS complement(6519..6755) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVP4 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene acpP CDS complement(6967..7704) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene fabG CDS complement(7741..8676) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 8819..9856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 10036..10488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 10504..10728 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q2 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene rpsR CDS 10734..11327 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ0 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene rplI CDS 11428..12909 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J556 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene dnaB CDS complement(12906..13331) product flavin-containing amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208381.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(13398..13739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(13729..14178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(14246..14533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 14671..15309 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 15302..15484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 15557..16645 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q9 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene alr CDS 16668..17441 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 17448..18227 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 18235..19017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 19168..19779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(19847..20407) product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919514.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(20423..21961) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(22340..23800) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 23980..26274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 26351..27457 product muconate-lactonizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(27536..29110) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI5 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene guaA CDS complement(29229..30596) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(30694..31026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(31108..32583) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C768 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene guaB CDS complement(32594..33163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(33253..33708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(33705..34538) product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Q5 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene rlmE CDS 34767..35135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 35162..35752 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8T2 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 35742..36068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 36180..36770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 36929..37525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 37546..37977 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(38041..38244) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(38712..39128) product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0C0 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene dksA CDS complement(39210..39443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 39590..39922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 40100..41080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(41077..41706) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(41788..42180) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(42180..43466) product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 43660..45159 product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(45179..45433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(45499..45717) product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAH9 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene slyX CDS complement(45774..46469) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 46568..47392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(47399..48130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(48258..49235) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7X2 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene fabH CDS complement(49346..50173) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDI9 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(50176..51156) product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8P7 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene dusA CDS complement(51600..52457) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(52496..53398) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene parB CDS complement(53398..54984) product serine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 55677..56843 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 57343..58629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 58648..59793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(59822..61714) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(61714..64041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113491.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(64044..67736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(67907..68149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 68461..68748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(68758..70170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(70160..70498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 70688..70855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(70980..71441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(71493..71789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(71786..72109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(72106..72369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 72670..74160 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene traG CDS 74160..74717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 74732..74962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(75235..75831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(75964..76221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(76258..76548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 76838..77386 product DNA-invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_457172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(77395..77577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(77567..78562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(79086..80309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(80588..81592) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(81617..81967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(82054..83334) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(83325..83831) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(83831..84850) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(84847..86373) product altronate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene uxaA CDS complement(86522..87541) product 2-keto-3-deoxygluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035376.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene kdgK CDS complement(87557..88315) product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(88322..89167) product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE32 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene kduI CDS complement(89276..90352) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(90434..91807) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 91933..92787 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919383.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 92784..93338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(93343..94956) product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE40 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene estA1 CDS complement(95018..96664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(96760..99432) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene iroN CDS complement(100011..101180) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 101245..102195 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 tRNA complement(102359..102432) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 102579..102821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(102818..103450) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388746.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(103469..103981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(103983..105140) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917968.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(105249..106595) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene ompP1 CDS complement(106760..107623) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969533.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(107620..108102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 108270..110117 product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 110188..110964 product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K72 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene ate CDS 111081..111437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 111474..112589 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 112593..113363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 113363..114985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(115148..116362) product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 116513..118660 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM9 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene glcB CDS complement(119132..120538) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707979.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 120709..122301 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(122450..124252) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(124477..125289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(125289..127172) product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(127333..127668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 127817..128086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 128283..129116 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene bdhA1 CDS 129143..130276 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 130215..131603 product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 131684..132265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 132262..133599 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(133675..134904) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(135062..135517) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886665.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 135769..136479 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085558.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(136487..137374) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085559.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(137555..139636) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(139720..141138) product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(141155..142855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(142986..144032) product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920281.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(144029..145171) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920280.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(145168..145980) product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920279.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(145977..147167) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920278.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(147164..149587) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(149596..149880) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(149885..150190) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(150483..152480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(152514..153650) product putative membrane protein YjcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31634 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene yjcL CDS complement(153703..154695) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(154695..155783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(155770..156885) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393376.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(157067..159421) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene fyuA CDS complement(159666..160358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 160515..161702 product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 161731..163293 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 163360..164343 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(164350..165675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(165716..166840) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286711.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene arcT CDS complement(167128..167595) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(167744..168997) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980220.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 169206..170669 product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 170717..172333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 172368..173870 product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(174108..174302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 174220..177126 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036532.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene btuB CDS 177313..179055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 179158..180648 product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(180658..182364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(182401..183963) product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229918.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(183980..184933) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(184933..186975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(187270..187716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(187726..188772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(188817..189269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(189271..191583) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene fyuA CDS complement(191731..192339) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531384.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 192486..192878 product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 192917..193903 product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A0 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene acoA CDS 193896..194951 product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 194948..195169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 195251..195439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(195536..198205) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene fyuA CDS complement(198368..199510) product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(199461..200003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(200200..200481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(200483..201955) product 4-coumarate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(201970..202806) product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(202831..204228) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9W8 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 204302..204760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(205306..207150) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(207281..209386) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(209803..211125) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(211140..211790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(211883..213103) product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC36 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene mct CDS complement(213128..214336) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(214336..215787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(215784..216620) product 3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(216622..217533) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(217552..218352) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 218581..219450 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 219477..220724 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 221226..222071 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 222420..224645 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene fyuA CDS complement(224848..225285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 225391..225990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 225994..226755 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 226805..227503 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729502.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(227592..227990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(228038..229660) product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(229738..230811) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 230976..232412 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 232409..233569 product succinyl-CoA--D-citramalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGE3 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(233628..234506) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(234523..235668) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(235674..236477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(236496..236918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888054.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(237028..237999) product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(238002..238844) product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 238806..238958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(238984..239223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(239298..239696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(239730..241250) product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNG1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 241698..243425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 243647..243913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 tRNA complement(243931..244016) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 244512..245156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 245187..245810 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090583.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 245811..246194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 246195..246842 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083783.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 246963..247415 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89D50 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 247425..248312 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 248364..250016 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(250046..250453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 250961..252352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(252355..252810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(253366..253554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(253557..254141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(254138..254368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(254840..255088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 255275..255535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(256407..257513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(257503..257727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 tRNA complement(258034..258110) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(258252..258758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(258804..259121) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene ihfA CDS complement(259346..260317) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K89 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene fabH CDS complement(260314..261393) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8I5 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene plsX CDS complement(261501..262034) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919244.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(262031..262567) product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 262761..263228 product SmpA/OmlA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640219.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene bamE CDS complement(263237..263485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(263587..264573) product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9B8 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene thiL CDS complement(264603..265088) product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J3 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene nusB CDS complement(265100..265561) product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THE3 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene nrdR CDS complement(265658..266953) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene glyA CDS 267335..267799 product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 268339..268629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 268851..269945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(270058..271266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(271379..272152) product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T5 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene surE CDS complement(272164..272850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(272898..274232) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEQ2 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene serS CDS complement(274354..275184) product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB8 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene tatC CDS complement(275181..275606) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene tatB note possible pseudo, internal stop codon, frameshifted CDS complement(275657..275884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(275946..276812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(276809..277669) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(277743..278762) product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(278784..279626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(279783..281030) product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG5 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(281039..281644) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967878.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 281793..282134 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 282131..282586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 282670..283146 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927249.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(283188..283661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(283873..284505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 284677..285348 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 285411..285644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 285694..286212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 286335..287117 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337637.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene xthA sequence05 source 1..213073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 654..1346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 1566..2867 product teichoic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(2864..3583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(3717..4784) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(4803..5081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(5119..5964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(5990..6874) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(6871..8145) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHE2 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene purD CDS 8214..9632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 9733..9939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(9946..10365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(10410..11645) product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(11718..13511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975356.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 13718..15145 product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9G2 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene xseA CDS 15163..15417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 15414..16430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(16437..16730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(16679..17059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(17049..17426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 17716..17907 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 18031..18507 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSI8 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 18510..18836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(18837..19787) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(19784..20758) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV9 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene lpxK CDS complement(20758..22062) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene kdtA CDS complement(22071..22784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 22897..24687 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(25155..25850) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene ctpA CDS complement(25858..26091) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(26111..27454) product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918198.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 27526..28377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799764.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(28374..29015) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(29019..29732) product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 29834..30613 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(30617..31624) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(31706..31972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 32234..33772 product 3-polyprenyl-4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 33975..35249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 35253..35729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 35726..36163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967820.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 36557..36973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 37151..38257 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(38283..39125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 39304..40212 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(40218..41744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(41804..42538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(42535..44748) product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RA63 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene clpB CDS complement(44777..46456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 46837..47745 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 48028..49236 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene int CDS 51170..51517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 51801..52232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 52229..52573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 52570..52950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 52950..53474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 53973..54536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 54570..54719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(54823..55680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 55573..55941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 56459..57733 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 57833..58654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 58741..58998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 59155..59547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 59547..59732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 59729..60640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 60637..62202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 62199..62969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 62972..63265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 63466..63756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(64205..64624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(64727..64957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(64954..65316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(65316..66065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(66122..66364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(66416..66703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 66801..67031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 67111..67395 product plasmid maintenance system killer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 67388..67702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(67820..68182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(69126..69440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(69992..70795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(70809..71015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 71455..72498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 tRNA complement(72773..72847) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(73008..74036) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2H4 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene tgt CDS complement(74131..74409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(74409..74747) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086810.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(74744..75793) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB05 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene queA CDS complement(75803..76837) product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(76853..77689) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920503.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(77717..78328) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(78325..79215) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(79228..79815) product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD54 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene queF tRNA 80010..80085 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(80174..80827) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 81075..82364 product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9L3 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene hemN CDS 82431..83126 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708340.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 83368..85017 product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03073 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene fixN CDS 85028..85756 product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene fixO2 CDS 85766..85930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 85920..86789 product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8F0 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 86809..88299 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene fixG CDS 88299..88796 product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 88793..91033 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919283.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene fixI CDS 91030..91191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(91280..93808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 93861..94082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(94359..95258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(95380..96948) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120474.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(96976..97359) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 98136..100454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 note possible pseudo, internal stop codon, frameshifted CDS 100439..100852 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 tRNA complement(101056..101132) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 101354..103189 product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974729.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene ggt CDS complement(103164..104618) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(104628..105962) product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene merA1 CDS complement(106062..106793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 note possible pseudo, internal stop codon CDS 107096..107230 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BQ2 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene rpmH CDS 107290..107625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 107679..109475 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BQ0 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene yidC CDS 109472..110116 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5K8 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene engB CDS 110153..111097 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5N6 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene xerC CDS complement(111094..112512) product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(112595..113764) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene metB CDS complement(113843..114097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(114205..114696) product type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(114851..115318) product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(115315..115677) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(115682..116176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(116215..117603) product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene cysB CDS complement(117673..119577) product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene mnmC CDS complement(119620..120135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(120266..121462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 121652..123346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 123353..123571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 123537..124934 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 125056..125991 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(125988..126881) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267708.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(127105..129114) product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555739.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(129192..130106) product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(130145..130675) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(130676..131467) product methylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(131477..133081) product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 133211..134383 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 134387..135109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 135176..136015 product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene tauD CDS 136121..136993 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(136998..137429) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(137419..137853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(137853..138998) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene blcB CDS complement(138995..139516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(139513..141267) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(141277..142191) product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(142198..142659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(142734..143486) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(143483..144397) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C3 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(144509..147346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(147585..149657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 149941..151725 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533660.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 151883..153754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(153764..154060) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 154299..154490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(154548..154964) product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691751.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(154961..156097) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(156481..156750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(156853..157203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 157210..157506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 157668..158660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 158770..159384 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 159459..160190 product NG,NG-dimethylarginine dimethylaminohydrolase protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975664.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 160228..161589 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 161646..162566 product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S70 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene glyQ CDS 162624..164282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 164398..164874 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969632.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 164989..165396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 165462..166205 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYX9 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene mtgA CDS 166220..166708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 166705..167031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 167059..167670 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 167667..168221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 168227..168673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 168806..170980 product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S69 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene glyS CDS complement(171110..172618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 172878..175568 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 175880..176653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 176809..177462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(177452..177940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(178075..179040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 179164..180042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(180128..180811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(180861..181706) product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene nadC CDS complement(181703..183247) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8U5 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene nadB CDS complement(183353..184465) product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4C4 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene nadA CDS 184715..185029 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 185045..185494 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969620.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(185483..186322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(186341..187375) product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(187395..187886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707430.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(188049..188666) product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 188887..189258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(189312..191435) product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 191778..192863 product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene recA CDS 193066..193434 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 193604..196261 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9N4 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene alaS CDS complement(196267..196914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(196973..197629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(197788..199002) product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD89 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene icd CDS 198907..199158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 199155..199952 product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Y8 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene rrm2 CDS 199982..200731 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 200762..202144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 202245..203771 product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 203940..204422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(204505..205161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 205494..206111 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5D9 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene rpsD CDS 206415..209543 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918983.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 209677..210465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(210483..211121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(211156..211956) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387816.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 sequence06 source 1..208527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..1549) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(1546..2313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(2316..2756) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(2759..3376) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(3373..3738) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(3735..4007) product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(4007..4489) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(4828..5430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(5427..6143) product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090120.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(6346..7557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 7705..8034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(8142..9716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(9783..10382) product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E130 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(10394..10804) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(10852..11271) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(11276..11809) product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(11869..13224) product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(13256..14080) product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 tRNA complement(14511..14585) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 14796..14872 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(14924..16720) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene mmgC CDS 16926..17537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 17627..18580 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0U2 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 18612..19298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918522.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(19313..20143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(20153..20947) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 21109..22527 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 22545..23390 product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5B6 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 23700..23891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(23964..25115) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(25163..25768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(25765..26451) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene wcaA CDS complement(26516..26719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(26894..27046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(27049..27222) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(27251..27649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039043.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 27921..28985 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(28990..30549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976224.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 30693..30917 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104925.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 30975..31340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 31337..31489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 31587..32237 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYB6 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene rnhB CDS 32420..32827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 33066..34220 product modification methylase CcrMI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZ33 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene ccrMIM CDS 34308..34994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(35025..35564) product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921307.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(35649..36314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(36409..37491) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971157.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene mutY CDS 37639..38013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 38117..38818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 38903..42406 product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7Y9 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene smc CDS 42534..42890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 42890..43291 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 43334..43837 product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 43848..44318 product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 44323..44808 product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 44805..45272 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 45290..45640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AAQ8 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene ybaA CDS 45705..46277 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(46437..46931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 47195..47530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 47568..48359 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene atpB CDS 48444..48671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 48701..49264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 49277..49840 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T930 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene atpF CDS 50003..50572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(50574..52097) product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV2 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(52163..52747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(52744..54084) product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4V4 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene gcvPA CDS complement(54103..54312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(54309..54680) product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCZ7 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene gcvH CDS complement(54690..55877) product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU9 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(56205..56696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(56785..57849) product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene idiA CDS complement(57946..58782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 58681..59013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 59046..60698 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(60702..62009) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(62006..63505) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 63648..65366 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 65575..66417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 66504..67067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 67078..68088 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3Z4 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(68097..68651) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(68763..69434) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(69436..69801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(69802..70998) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(71198..72115) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(72129..72575) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890146.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(72587..73042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(73077..74216) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(74226..74657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(74662..75864) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(75877..77586) product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(77681..79192) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 79342..80136 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 80198..80842 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene gpmB CDS complement(80904..81743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(81923..82177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(82309..82770) product small heat shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XGW7 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene ibpA CDS 82974..83873 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 83873..84181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 84178..85101 product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920114.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 85130..86683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 86696..87289 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531936.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(87320..88147) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709374.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(88202..88594) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722818.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(88794..89978) product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(90285..91190) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066934.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 91446..91805 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 tRNA 91910..91984 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 92241..93287 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5T6 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene rfbB CDS 93307..94179 product putative dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55463 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 94176..95042 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene rmlA CDS 95253..96440 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene wcaG CDS complement(96446..97006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(97032..98201) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 98310..99251 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090122.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(99307..99630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 99809..100954 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 100964..101683 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FT1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(101706..102116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 102274..102720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(102833..104872) product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(105199..105756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(105830..107764) product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FP0 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene thiC CDS complement(107761..108300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(108467..109207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(109200..110129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(110485..110949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 111104..112258 product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(112255..113547) product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCR6 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene purA CDS 113715..114236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(114344..115057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(115286..116866) product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3I9 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(116895..118052) product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 118213..119220 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(119213..120100) product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531073.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 120209..120577 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919113.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(120887..121321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(121443..124046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 tRNA complement(124616..124690) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(124762..125937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(126061..126243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 126188..128845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(128863..129537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 129767..129967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(129964..130656) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8V3 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene gph CDS 130549..130788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 130805..132163 product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene glmU CDS 132166..132861 product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NS9 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene rpiA CDS 132945..133460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 133471..134865 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene gor CDS complement(134870..135379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 135542..138217 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A299 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 138348..139151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 139148..140953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636070.2 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 140886..141755 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X45 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene dapF CDS 141758..142336 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXF9 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene tdk CDS complement(142333..145140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 tRNA 145329..145418 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(145600..145803) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084262.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene cspA CDS complement(146058..146939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(146993..147667) product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(147664..148419) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228961.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene paaG CDS 148500..150074 product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene yhcX CDS 150071..150625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(150633..151652) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090687.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 151851..152333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(152330..153412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(153484..154038) product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083254.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(154131..154394) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV03 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene rpmA CDS complement(154398..155048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(155202..156530) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530257.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(156543..157616) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 157752..159368 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(159365..160621) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(161012..161773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(161798..171457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(171629..172258) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 172285..174291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(174309..176960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 177110..177862 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(177859..179325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 179633..181279 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 181279..182037 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 182021..183013 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918670.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 183000..183623 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918669.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 183633..185225 product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene sglT CDS 185222..186118 product regucalcin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637112.2 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(186132..189215) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene lacZ CDS complement(189380..190891) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(191071..194055) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene btuB CDS 194882..195376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898046.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 tRNA complement(195826..195915) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 196100..196372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 196480..197289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(197690..198106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(198103..199095) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088672.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene galE CDS 199230..200018 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(200015..201373) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(201517..201906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(201943..203136) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFT4 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(203272..203451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(203668..204657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(204773..205330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(205342..205977) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(205977..206945) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR2 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(206932..207576) product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 sequence07 source 1..206787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1105 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061625.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 1113..1598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(1606..1905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 2855..4003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 4020..4670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 5123..7168 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene cti CDS 7434..7943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(7955..8800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085391.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 9042..9923 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 9916..10488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 10563..11399 product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083970.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 11481..12275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 12272..12940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 12964..14289 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(14433..15470) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249716.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(15494..16513) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene ldhA CDS complement(16536..18950) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G7 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene ppsA CDS complement(19678..19857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(20097..22355) product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K54 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene gyrA CDS 22657..23337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 23334..24263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(24721..25842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(25842..26624) product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY94 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene fliP1 CDS complement(26642..26965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385161.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene fliN CDS complement(26962..27561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(27562..29142) product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY91 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene fliF CDS 29215..29868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 29893..30480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 30484..31023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 31110..31979 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene motA1 CDS 31976..34288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 34281..34997 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY76 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 35022..35807 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY77 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 35812..36303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 36300..37052 product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY79 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene flgH CDS 37071..37646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(37718..38419) product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY67 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(38455..39666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 39748..40053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 40050..40436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 40779..41978 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4F1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 42070..42459 product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene flaF CDS 42456..42884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 42881..43720 product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene flgF CDS 43931..44506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 44717..47404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 47451..48095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 48212..48964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 49116..54008 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene gdhZ CDS complement(54023..54385) product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(54386..55969) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU8 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene purH CDS complement(56042..57247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(57332..58960) product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(58984..59697) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(59930..60556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 60636..61679 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921489.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(61848..62729) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene folD CDS complement(62732..63025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(63036..63338) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(63442..63849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 tRNA 64014..64089 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 64189..64911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 65003..66451 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLW9 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 66458..68074 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090609.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(68092..68511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(68694..69632) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(69636..71180) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(71170..71703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 71936..73762 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59362 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene glmS CDS 73810..74970 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088709.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 74967..76019 product GDP-mannose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522157.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene manC CDS 76027..77061 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527590.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(77058..78026) product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 tRNA 78501..78585 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 79106..79315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(79362..80540) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089820.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(80578..81285) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(81272..83146) product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 83301..83744 product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene nsrR CDS complement(84146..84631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550743.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(84691..85176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(85280..86527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(86542..87249) product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene narI CDS complement(87252..87959) product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971854.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene narJ CDS complement(87969..89486) product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene narH CDS complement(89483..93220) product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205550.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene narG CDS complement(93217..95979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 96237..96962 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919286.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene ftrB CDS 96965..97291 product alkylhydroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 97431..97979 product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706927.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(98483..99337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(99342..100727) product tricarballylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085108.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(100742..102256) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 102439..102819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(102954..103301) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338436.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 note possible pseudo, internal stop codon CDS complement(103635..104462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 104604..104930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(104985..105209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(105206..106837) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(106837..107799) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(107816..108304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 108547..109365 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 109371..111005 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 111033..111977 product putative lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700832.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(111982..112530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(112548..113318) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552055.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene linX CDS complement(113341..115725) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(116091..117356) product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(117361..117960) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061461.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(118035..119453) product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene cysG CDS complement(119440..122133) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(122135..122473) product tRNA-(guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003519747.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene nirD CDS complement(122470..124932) product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061458.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(124960..126198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(126311..128062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(128073..129071) product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(129229..130674) product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(131027..131950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(131999..133276) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY92 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(133459..136563) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918867.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(136589..137980) product C4-dicarboxylate transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y815 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene dctA CDS 138178..139962 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene dctB CDS 139959..141302 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888250.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene dctD CDS 141472..142617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 142639..143286 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(143292..144908) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(145003..146244) product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918296.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(146241..146900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(146906..147475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104740.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(147559..149487) product protease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MS9 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 149754..150746 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 150774..151688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 151692..154412 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708854.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 154409..156514 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139976.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 156636..157304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(157301..157657) product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P4 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(157688..158326) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0H4 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene queE CDS complement(158371..158814) product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(158878..159189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(159351..159935) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9D9 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene infC CDS complement(160010..160999) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(161009..162178) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 162391..164028 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 164025..166427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 166454..167641 product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(167620..169104) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711525.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(169135..171669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(171666..172211) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532101.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(172214..173086) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 173010..173219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 173255..174274 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 174301..175686 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 175686..176714 product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 176741..178714 product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(178715..179851) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974502.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(179862..181178) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920961.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 181297..182694 product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(182695..184044) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(184165..186570) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(186765..188372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 note possible pseudo, internal stop codon CDS complement(188373..188801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 note possible pseudo, internal stop codon CDS complement(188894..190513) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(190602..191075) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336982.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(191068..192240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(192708..192881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(193044..193223) product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310667.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(193249..193434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(193509..194165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 194359..194532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 194815..196152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 196163..196900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(196912..198456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(198612..198806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(198822..199583) product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529283.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 199473..200522 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(200519..200815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(200823..201350) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089224.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene ecfA CDS complement(201687..201938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530767.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(202114..202431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 202318..203040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(203106..203519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(203523..203840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(203906..205081) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391267.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(205617..206261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 misc_feature complement(206271..>206787) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339094.1:aldehyde oxidase locus_tag LOCUS_22760 sequence08 source 1..203133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..1275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 1281..1769 product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887552.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(1766..3352) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 3441..4202 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 4347..5888 product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390071.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 5900..6334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205545.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 6334..6762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 6780..7691 product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1ML42 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene prpB CDS 7693..8007 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 8027..9163 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1ML43 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 9172..9768 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene folE CDS 9790..10566 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 10602..12512 product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(12509..14356) product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388834.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 14546..15448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 15435..17144 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086599.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 17232..18230 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene ansA CDS complement(18243..22052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(22052..23827) product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389852.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 24074..25207 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 25188..26267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 26264..27250 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 27281..28162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 28259..28741 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846975.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(28738..29889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 29986..30867 product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 30870..31760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 31757..33031 product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 33279..33971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(33915..35069) product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085790.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(35111..36133) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYD1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene ispH CDS 36417..37067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 37219..38106 product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(38592..39221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 39109..39381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(39436..41997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 42246..43436 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 43436..44446 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918468.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 44451..45911 product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SD7 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene astD CDS 45922..46365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 46362..46538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 46844..48151 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMV4 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene astB CDS 48295..50118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(50121..50597) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187998.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 50765..51814 product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54531 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene yqiT CDS complement(51856..53064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 53244..54425 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene atoB CDS 54553..54888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(54920..56995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 57141..58343 product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(58337..58618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(58740..59798) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC20 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(59892..60884) product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 60979..61290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 61287..62711 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920344.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 62708..63214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(63310..64068) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640216.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 64285..64734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 64779..65270 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816757.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 65280..65699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 65781..67487 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5U4 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene metG CDS 67499..67939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 67951..68739 product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene kduD CDS complement(68837..70618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(70605..70982) product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919513.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 71218..72195 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(72192..73124) product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IV9 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(73125..73838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene radC CDS complement(74016..74861) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9X3 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene map CDS complement(74861..75571) product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0Z4 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene sfsA CDS complement(75790..77700) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140180.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 77615..77965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 77962..78720 product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 78797..79756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 79767..80753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 80769..82145 product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene sdaA CDS complement(82148..82582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(82689..83207) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(83474..83911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(85609..86349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(86442..88844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(88893..90428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 90641..90979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 91141..92304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 92441..93661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 93674..94213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 94225..94617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(94642..95562) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(95662..96603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384496.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(96603..98054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(98233..98991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 99305..99643 product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919216.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene glnK CDS 99668..100987 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene amt-2 CDS 101121..102551 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 102582..107096 product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921434.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene gltB CDS 107171..108355 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7C8 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 108686..109015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(109009..109236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 109120..109638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 110006..111013 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V8 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene metA CDS 111010..112221 product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene metB CDS 112212..113237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 113247..114407 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS0 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene proB CDS 114404..115675 product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF85 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene proA CDS 116261..116557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 117047..118666 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIY0 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene ilvD CDS 118684..119694 product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5L5 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene ilvC CDS 119703..121502 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA17 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 121499..122053 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 122174..123772 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67862 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene leuA CDS 123769..125190 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene leuC CDS 125190..125765 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene leuD CDS 125767..126804 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAR7 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene leuB CDS complement(126950..127396) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932275.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene cdd CDS 127471..128106 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCU5 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene upp CDS complement(128262..128708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 128824..129441 product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC12 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene ccmA CDS 129438..130106 product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L54 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene ccmB CDS 130122..130871 product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 130871..131014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(131011..131850) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(131913..133382) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640355.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(133495..136332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 137026..138318 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919742.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 138556..141384 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312594.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene mrcA CDS 141624..142571 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ76 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene prfB CDS 143308..143871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(143948..145384) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066658.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(145529..146155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 146256..147893 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919498.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(147897..148466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 148735..150402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(150492..151481) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920857.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(151597..152244) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 152317..152598 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 152625..153218 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403296.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 153363..153737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(153734..154456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 154940..155338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(155424..155975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(156039..156272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 156347..157402 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H551 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene ctaA CDS complement(157461..158579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(158796..160220) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(160231..160953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 note possible pseudo, frameshifted CDS complement(160938..162476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 note possible pseudo, frameshifted CDS 162916..163401 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGF3 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene rplM CDS 163405..163896 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7T6 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene rpsI CDS 164159..165766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 165774..167147 product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(167251..169908) product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(170012..170350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(170406..171284) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123106.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 171461..172243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(172244..172897) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene purN CDS complement(172897..173907) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7L9 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene purM CDS complement(173972..175237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 175426..176880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 176936..177646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 177687..179873 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MS0 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene ppk CDS 179950..181443 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(181462..182940) product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(183010..183849) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100978.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(184017..184715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(184894..186525) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E2 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene pyrG CDS complement(186603..187070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 187146..188102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(188110..189003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(189057..190874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 191117..192559 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919595.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 192564..192761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 192815..193252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 193392..194759 product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C893 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 195358..195786 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U847 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene rplK CDS 195792..196484 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAW8 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene rplA CDS complement(196644..197114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(197124..197489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(197506..199737) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(200096..200311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(200327..200707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 200675..200950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 201291..201803 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5T2 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene rplJ CDS 201853..202227 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5E7 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene rplL sequence09 source 1..187785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2134 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89WI2:phenylalanine--tRNA ligase beta subunit locus_tag LOCUS_24600 tRNA 2217..2292 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 2458..3648 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 3702..4355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 4450..4653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 4653..5102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 5129..6160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 6214..6519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 6617..8062 product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242272.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene hsdM CDS 8059..9252 product type I restriction-modification protein subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene hsdS CDS 9266..9508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 9577..11883 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 12213..16823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 16827..17357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 17794..19332 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(19288..20232) product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382227.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(20229..20918) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(20915..21658) product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Q7 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(21658..22875) product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene mntH CDS complement(23018..24001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084250.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 24133..25503 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 25578..25931 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533675.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(25997..26983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(26980..27708) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(27712..28302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529398.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(28379..29344) product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(29341..30036) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265777.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene ftsE CDS 30225..31565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 31624..32151 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497442.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene hpt CDS 32378..32863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(32869..35355) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066760.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 35469..35843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(35840..37102) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9L4 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene lysA CDS complement(37220..38596) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8I1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene argH CDS 38654..39265 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene tlpA CDS 39364..41040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 41147..42940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(43008..43211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(43345..44223) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529423.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(44302..44775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(44853..45314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(45468..46397) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53573 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene etfA CDS complement(46397..47146) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973172.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene etfB CDS 47330..47812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174341.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(47823..48029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265605.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(48113..49897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 50163..51065 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967912.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 51328..52278 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090475.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 52369..52842 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529725.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 52987..53238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(53339..53803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769594.2 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(53904..54326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 54393..55052 product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647911.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(55049..55906) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640436.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 56022..57095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 57171..57449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(57456..58874) product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532782.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 59112..60281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 60299..61963 product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDH9 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene coxA CDS 62170..62541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 62644..63570 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene ctaB CDS 63563..63721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 63734..64306 product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene ctaG CDS 64399..65379 product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 65414..65980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 65987..66361 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 66358..67068 product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UHP2 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 67180..67599 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972117.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(67600..68460) product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920156.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(68460..69320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(69317..70345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709323.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(70361..71305) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066882.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 71604..71957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(72029..74767) product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 74691..74897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(74918..75553) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385494.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene regA CDS complement(75546..76883) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 76965..77549 product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083950.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 77748..79034 product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265522.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(79058..79744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(79759..80136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 80189..82984 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(83181..83849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(83969..85855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 86081..86860 product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 86857..87837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 87824..88708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(88751..89833) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(89830..90888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 91009..92040 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 92093..92632 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918545.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(92633..93544) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL09 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene htpX CDS 93612..93794 product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338719.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 93965..94894 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181535.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene mrsF CDS 94906..95715 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921111.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 95813..96838 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192663.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(96845..98176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 98360..99241 product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972116.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(99222..100439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(100522..101997) product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU7 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(102038..102478) product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB9 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene apaG CDS 102626..103711 product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384164.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(103723..104223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(104256..105509) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(105868..106056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(106367..107023) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(107033..107974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(108072..108896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 tRNA 109152..109225 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 109486..110283 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104607.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(110286..111053) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MF8 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene gloB CDS 111157..111915 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 111985..113079 product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UL9 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene hisC2 CDS 113072..114001 product cyclohexadienyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920085.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(113998..115629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(115688..116827) product dolichol monophosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(116916..118421) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707794.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(118418..119740) product UPF0229 protein R01398 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QD3 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(119824..121773) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529362.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(122380..123045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(123056..124642) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABY6 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene lysS CDS 124793..125230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 125325..126068 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92XH6 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(126117..126515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(126512..127876) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 127976..128731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 128778..129131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 129128..130186 product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAR8 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(130183..131541) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 131621..132328 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090567.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(132325..132951) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(132979..133380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(133487..133897) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IW3 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene hisI CDS 133996..135369 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY2 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene cysS CDS 135373..136407 product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(136453..136992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 137340..138035 product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 138057..138482 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531981.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(138714..139649) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919001.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 139923..141326 product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene cysG CDS 141323..141604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 141606..142235 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 142235..143890 product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975275.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 143877..144338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 144349..145092 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7B1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene cysH CDS 145233..145769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(145816..146673) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(146783..147313) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKI6 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene ahpD CDS complement(147389..147934) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084586.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene ahpC CDS 148084..148983 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(148980..150104) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 150221..151561 product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121081.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene pabB CDS 151558..152139 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 152136..152999 product 2-keto-4-methylthiobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 152996..154174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(154171..154629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084261.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 154816..155544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 155713..155883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 156023..156529 product pilus assembly protein CpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene cpaA CDS 156622..157371 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene ctpC CDS 157397..158866 product secretin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084256.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene ctpD CDS 158880..159566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 159612..161330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 161343..162833 product pilus assembly protein CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920779.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene cpaF CDS 162840..163826 product secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920778.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 163837..164811 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533678.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(164808..165233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205213.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(165246..165980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(166070..167833) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(167996..168799) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085310.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(168827..169465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 169607..171286 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene fzeA CDS 171297..173021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919212.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 173018..173884 product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS7 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene ispE CDS 173921..175021 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(175023..176057) product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 176220..177113 product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene sohB CDS 177155..177367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(177364..177774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 177888..178394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 178527..179297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 179454..180245 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 180382..182478 product thio:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918106.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(182461..182634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 182732..184396 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ51 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene pgi CDS complement(184411..184611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 184824..185318 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E8 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene ppiA CDS complement(185319..185906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(185921..186382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 sequence10 source 1..187307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 295..2694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 2699..4951 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene cyaD2 CDS 5021..5200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 5720..6430 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776602.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(6432..7460) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(7460..9673) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338854.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 9788..10414 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707822.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 10503..11171 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206572.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene yceI CDS 11176..12411 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921220.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(12408..14258) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(14304..15920) product fatty-acyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223362.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 16179..17732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(17743..18381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(18580..20646) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 20893..21420 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB5 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene apt CDS 21458..22018 product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061445.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 22040..22861 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479113.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 22962..23921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(23982..24905) product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene tauD CDS complement(25004..25582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(25579..25917) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393829.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 26123..26467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(26464..26895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(26991..27344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967147.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 27974..28387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(28666..29481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(29465..29821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(29824..32760) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CB72 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene uvrA CDS 32959..33423 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD07 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 33549..33854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 34294..34566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(34652..34822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 34962..36827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 36827..38701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(38698..39681) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083422.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(39715..40128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(40137..41192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(41216..41788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(41800..42366) product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8G5 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 42485..45283 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L52 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene gyrA CDS 45280..46041 product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 46055..46558 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J263 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene coaD CDS 46632..47546 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 47543..47992 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y5 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 48014..49195 product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(49197..50642) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531228.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 50764..51534 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709123.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene paaB1 CDS complement(51536..52330) product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0DMK9 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene gspO CDS 52655..55453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 55461..58136 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene fecA CDS 58450..59304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 59304..61352 product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene pulD CDS 61369..62874 product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918063.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene pulE CDS 62861..64075 product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038521.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene xcsF CDS 64089..64550 product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918065.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 64519..65061 product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639898.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 65054..65428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 65415..66065 product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038517.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene xcsJ CDS 66062..67030 product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5C3 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene xcsK CDS 67027..68229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 68226..68696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 68693..69469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 69466..69951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(69958..70710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 71003..71974 product zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(71971..73302) product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(73385..74389) product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920048.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(74382..76001) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531215.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(75998..76843) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(76840..79377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(79499..80362) product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAT8 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene hemF CDS complement(80362..80817) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH5 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene trmL CDS 80970..81569 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE6 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene fbcF CDS 81584..82876 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CI51 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene fbcB CDS 82889..83815 product ubiquinol cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918362.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 83895..84776 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene mtnP CDS complement(84766..85500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(85566..86663) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DK0 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene ychF CDS complement(86670..87368) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI49 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene pth CDS complement(87417..88073) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene rplY CDS 88349..89719 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 89737..91140 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 91315..93891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 94034..94360 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036977.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 94363..95250 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKB9 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene hisG CDS complement(95252..96538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 tRNA complement(96631..96705) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(96791..97237) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(97251..97829) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 97942..98130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 98130..99389 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5U7 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene murA CDS 99399..99848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265795.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 99853..101148 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene hisD CDS 101180..101740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(101783..102517) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124938.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene gst CDS complement(102517..103527) product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885U7 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(103735..104652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 104797..105285 product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFX3 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 105300..105725 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 105810..106028 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V4 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene infA CDS 106029..106631 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQN0 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 106628..107794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 107775..107969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 108038..108379 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969808.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 108376..108912 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930760.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 109005..109319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 109393..111450 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(111537..112043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(112187..113227) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946407.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(113227..114009) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene bdhA CDS 114162..114692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 114694..115905 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 115918..116307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 116467..117072 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969125.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 117340..120780 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A700 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene dnaE1 CDS complement(120777..121646) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923328.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 121600..121839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 121913..122737 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314298.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(122734..124818) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 124893..125285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 125278..126060 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(126068..127585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(127677..128279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(128284..129750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 130018..130443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 130620..130973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918998.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene shpA CDS complement(130986..132161) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 132284..133594 product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene gabT CDS complement(133666..134265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(134275..135276) product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(135293..135739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(135742..137622) product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene korA CDS 137897..139231 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene yxaH CDS 139272..139925 product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM7 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene tal CDS 139936..140943 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 140934..143351 product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531144.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 143665..144093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 144107..144790 product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 144787..145722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 145727..146200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 146311..147603 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(147607..148149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 148335..150002 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(150017..150592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086720.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(150602..151201) product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(151205..153304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 153640..154908 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 155122..156114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(156118..157197) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 157340..158290 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920426.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 158333..160963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 161037..163781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 163828..165783 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene pepN CDS complement(165784..166875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 167022..167984 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969966.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 168009..168893 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 168924..169256 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IC8 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene grlA CDS complement(169269..169481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(169560..170393) product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706582.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(170415..172364) product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265707.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 172415..172906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 172977..173936 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD76 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 173952..174203 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089470.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(174212..174730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705171.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 174885..175847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 175921..177729 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 tRNA 177830..177904 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 178045..178494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 178703..179248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(179366..179932) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811316.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 180277..181572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 181565..182155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 182221..182463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 182542..182883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 182880..184076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 184173..184517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 184638..184922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 185199..186254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 186254..186943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 186940..187170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 sequence11 source 1..182839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(422..589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 691..1536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 1526..2443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 2762..3157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(3279..4631) product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(4641..7775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(7775..8917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 9018..9545 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337336.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 9542..10045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 10042..10428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 10835..11065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 11062..11739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 12275..12451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 12986..17455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(17473..22185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(22490..22705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(23198..23344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 23478..23801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 23794..24579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 24594..24794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 24844..25635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(25785..26483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338238.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(26483..26926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720621.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(27013..29001) product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(29459..30499) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084361.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(30649..31164) product peptidase S26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538231.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(31161..31460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 31842..32087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 32099..32338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(32384..32881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(33039..33368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533279.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(33775..35472) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(35469..35708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(35878..36951) product antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(37647..38030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(38046..38258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(38352..38774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(39215..39790) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(39838..40500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 40921..41520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(41570..41911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(41965..42384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708198.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 42443..43000 product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708199.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(42972..43541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(43538..43762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 note possible pseudo, internal stop codon CDS complement(44015..47401) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVC3 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(47619..48443) product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(48448..48666) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229067.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(48671..49441) product 4-oxalocrotonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230345.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(49442..50494) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene mhpE CDS complement(50491..51432) product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8Q8 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene mhpF CDS complement(51449..52231) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK05 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene mhpD CDS complement(52246..53709) product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(53826..54269) product glycolate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975376.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(54294..55238) product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338974.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(55257..55448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(55469..56413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(56457..57446) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3X9 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene pdxA CDS complement(57472..57963) product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190416.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene benB CDS complement(57960..59396) product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119889.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene benA CDS complement(59403..59948) product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NRI8 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene hcaF CDS complement(59962..61317) product 3-phenylpropionate/cinnamic acid dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83K39 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene hcaE CDS complement(61612..63120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(63124..64911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(64922..65170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(65183..67546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(67562..68701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(68783..69589) product 3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705090.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(69573..70412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(70468..70608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 70647..71003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(71322..71741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 71928..73388 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene gabD CDS 73616..74578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 74703..75731 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Y21 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 75753..76814 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339268.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(76981..78354) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194222.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 79144..79887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(80015..80362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(80381..80974) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(80971..81468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 81781..82011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(82260..82769) product anthranilate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(82766..83083) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807389.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(83160..84053) product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(84244..85491) product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899055.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(85497..86507) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090007.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(86558..87280) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111362.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(87516..88304) product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene xylL CDS complement(88316..88813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(88810..90000) product biphenyl 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925750.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(90082..90684) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765742.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene gst CDS complement(90822..91202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(91861..93330) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290397.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene aldA CDS 93755..94945 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089330.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 95225..96328 product aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene areB CDS 96442..97806 product 3-phenylpropionate/cinnamic acid dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83K39 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene hcaE CDS 97832..98389 product hypothetical biphenyl dioxygenase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705092.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 98778..99074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(99502..100464) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJH2 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(100486..100968) product ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807379.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(101009..102241) product aromatic oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205697.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(102270..102797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(102801..104150) product putative large terminal subunit of phenylpropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705095.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(104170..104967) product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(104978..105682) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884795.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene hpcG CDS complement(105818..106663) product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229072.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 106852..107433 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92X27 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene ubiX CDS complement(107458..108411) product transporter auxin efflux carrier (AEC) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545151.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(108519..109010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(109011..110537) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(110794..112266) product phenolic acid decarboxylase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLH4 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(112269..113705) product salicylaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085473.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene vdh CDS complement(113789..115348) product 4-cresol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(115345..116052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(116153..116575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 note possible pseudo, internal stop codon tRNA complement(117022..117097) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(117135..118310) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene lpxB CDS complement(118307..119146) product UDP-2,3-diacylglucosamine pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene lpxI CDS complement(119146..119934) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A715 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene lpxA CDS complement(119947..120411) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene fabZ CDS complement(120415..121404) product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR3 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene lpxD CDS complement(121607..122248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(122263..124926) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9L0 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene bamA CDS complement(124936..126198) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(126210..127433) product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene dxr CDS complement(127430..128278) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU04 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(128290..128967) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBQ6 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene lpxD CDS complement(129127..129672) product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFM0 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene frr CDS complement(129757..130509) product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C997 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene pyrH CDS complement(130754..131662) product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene tsf CDS complement(131790..132575) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWS3 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene rpsB CDS complement(132772..133245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 133364..134806 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene phrA CDS 134870..136093 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(136090..136800) product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8R0 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene lolD CDS complement(136793..138088) product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919796.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(138122..139468) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KM8 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene proS CDS complement(139556..139801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(139798..140112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 tRNA 140259..140343 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 140429..141160 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8M0 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene lipB CDS 141206..142222 product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 142313..143062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(143066..143776) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(143776..144759) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QE2 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene rluC CDS complement(144756..145139) product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene crcB CDS complement(145136..145933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(145933..147243) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919162.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(147275..149011) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970278.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(149069..150496) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(150598..151074) product ligand-binding SRPBCC domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265689.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(151071..151403) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919159.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(151400..151858) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195008.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(151950..153812) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969493.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(153908..154345) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA8 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene rplQ CDS complement(154381..155406) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F8 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene rpoA CDS complement(155441..155845) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene rpsK CDS complement(155858..156226) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME6 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene rpsM CDS complement(156446..157042) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U880 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene adk CDS complement(157039..158379) product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ9 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene secY CDS complement(158465..158932) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX9 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene rplO CDS complement(159067..159255) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T5 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene rpmD CDS complement(159267..159851) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene rpsE CDS complement(159864..160229) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE34 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene rplR CDS complement(160254..160787) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD9 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene rplF CDS complement(160802..161200) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E8 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene rpsH CDS complement(161216..161521) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C4 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene rpsN CDS complement(161592..162152) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene rplE CDS complement(162145..162459) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U870 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene rplX CDS complement(162462..162830) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD4 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene rplN CDS complement(162901..163143) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAY9 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene rpsQ CDS complement(163160..163354) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE26 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene rpmC CDS complement(163365..163778) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U6 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene rplP CDS complement(163811..164515) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J90 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene rpsC CDS complement(164515..164895) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D2 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene rplV CDS complement(164898..165176) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U863 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene rpsS CDS complement(165194..166027) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D4 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene rplB CDS complement(166040..166363) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW2 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene rplW CDS complement(166360..166977) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J85 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene rplD CDS complement(166977..167714) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5S2 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene rplC CDS complement(167727..168038) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC3 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene rpsJ CDS complement(168135..169310) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001326672.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(169394..171472) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J81 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene fusA CDS complement(171497..171967) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX6 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene rpsG CDS complement(171979..172350) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U854 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene rpsL CDS 172778..173956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(174029..178249) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLI4 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene rpoC CDS complement(178325..182407) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J74 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene rpoB sequence12 source 1..139438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1041..2294 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWL9 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene tyrS CDS complement(2295..5693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 5885..6355 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 6553..7173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 note possible pseudo, frameshifted CDS 7318..8628 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337885.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 8612..9217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(9292..9918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(10081..10560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(10678..11052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(11108..13270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 13527..14324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 14529..15173 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 15204..16742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 16742..17671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 17676..19367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390864.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 19369..20754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 20822..21649 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 21646..22725 product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 22722..23918 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(23920..24123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(24134..26788) product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ2 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene clpB CDS complement(26968..27303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 27612..28712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182199.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 28714..29217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(29231..30001) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWN0 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene thiG CDS complement(30005..30205) product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene thiS CDS 30331..30783 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U828 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene aroQ CDS 30830..31303 product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene accB CDS 31338..32681 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(32678..33805) product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528655.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(33802..34743) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 tRNA 35116..35210 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(35612..36250) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313420.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 36362..37027 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLC5 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene aat CDS complement(36979..37593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(37593..38096) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921521.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(38117..38527) product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640357.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 38746..42468 product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MB9 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene nrdJ CDS 42574..43425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(43442..44275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(44401..45534) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403986.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene thiO CDS complement(45664..46239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 46495..47718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(47728..48171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 48388..48960 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(48957..49664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 50040..52421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 52454..53047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989716.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(53053..53535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(53611..54234) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531882.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(54231..55154) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035876.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(55172..55960) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(55957..57093) product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937915.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 57266..59542 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969598.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene cyaD2 CDS complement(60326..60664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 60890..61168 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089489.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 61174..61584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(61643..63997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 64343..65272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(65286..66464) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919355.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 66583..67602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 67667..68149 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747V4 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene msrA CDS complement(68188..68376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 68731..69969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(69976..71127) product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529988.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(71124..72077) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(72246..72728) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(72739..73806) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(73968..74558) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 74646..75287 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930265.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(75316..75879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(76339..79854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 80108..80647 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(80826..81812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 82064..83470 product glutamine synthetase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05457 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene glnA CDS complement(83533..84837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(84954..86018) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 86129..86491 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707415.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 86493..87026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 87029..87598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 87643..88077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(88095..89387) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 89477..90286 product putative enoyl-coa hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704585.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 90385..92370 product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QA5 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene parE CDS complement(92664..92954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 93134..93949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(94019..95407) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW3 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(95452..95829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(95834..97138) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW2 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(97138..98154) product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970298.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene bkdAb CDS complement(98158..99390) product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970297.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene bkdAa CDS complement(99690..101393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968865.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(101390..101956) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(102028..104193) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIB3 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene ligA CDS complement(104212..105924) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NM7 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene recN CDS complement(106000..106968) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6U9 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene bamD CDS complement(107126..107920) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6U8 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene lpxC CDS complement(108267..109820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(110016..111302) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene ftsA CDS complement(111338..112207) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAU8 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene ftsQ CDS complement(112195..113121) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L8 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene ddl CDS complement(113118..114041) product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene murB CDS complement(114038..114481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(114478..115926) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU8 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene murC CDS complement(115939..117054) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NL9 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene murG CDS complement(117051..118187) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972054.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene ftsW CDS complement(118184..119596) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A597 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene murD CDS complement(119605..120738) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene mraY CDS complement(120738..122201) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M9 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene murF CDS complement(122198..123637) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT9 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene murE CDS complement(123634..125484) product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(125520..125894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(125906..126904) product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ6 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene rsmH CDS complement(126901..127383) product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58768 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene mraZ CDS complement(127643..128041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 128491..129192 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(129266..130087) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene ada CDS 130284..130637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(130634..131842) product 3-oxoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(131847..132095) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYE6 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene acpP CDS complement(132171..132656) product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M78 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 133253..134266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 134263..134976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 135048..135491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 135592..136101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(136110..136799) product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(136796..137707) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920424.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(137819..138007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(138131..138814) product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530944.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 sequence13 source 1..138085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1242..1634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 1963..4461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 4458..5324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 5331..7154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 7151..8488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 8566..10077 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene gdhA CDS 10105..12135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 12136..13866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(13830..14189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(14325..14801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 15106..17757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 17905..20415 product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927217.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(20412..21971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(21971..22429) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45406 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene ccmH CDS complement(22426..22959) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387795.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(22956..24944) product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(25032..26150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106235.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(26289..28097) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640360.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 28535..29635 product endopeptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057449.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 29775..30920 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAA2 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene rnd tRNA 31142..31218 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 32428..32670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 32670..33218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(33297..33569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(33801..36542) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(36573..36788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 36927..38003 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967605.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 38021..38881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(39084..39362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 39997..40965 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 41014..41886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 41899..42414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(42471..43289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(43320..43643) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(43643..43999) product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305420.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(43996..45258) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074378.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(45480..46448) product exopolyphosphatase GppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265726.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(46658..46822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(46912..47394) product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene pspC CDS complement(47387..47632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(47657..48340) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(48353..48493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 48694..49719 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764157.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(49726..50598) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene phhA CDS 50706..51167 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920392.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(51199..51732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(51884..52822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(52826..53233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(53496..54584) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FM2 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(54673..55248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(55331..55753) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKJ9 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene ndk CDS complement(55904..58111) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(58136..59344) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 59550..63215 product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJB4 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 63321..64520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 64528..65343 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(65340..65912) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y9 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene mobA CDS 65975..66736 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX9 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(66733..67920) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(67924..68406) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214726.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(68406..68936) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3L0 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene moaB CDS complement(68937..69404) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(69407..69658) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C533 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene moaD CDS complement(69660..70658) product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF6 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene moaA CDS complement(70700..72400) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBV0 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene fhs CDS complement(72458..73246) product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene fdhD CDS complement(73248..76100) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(76112..77668) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974089.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene nuoF CDS complement(77668..78123) product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085922.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene nuoE CDS complement(78196..79446) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969449.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 79569..80270 product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 80267..81358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969456.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 81355..82236 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086625.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 82233..83258 product 4-oxalomesaconate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene fldW CDS 83255..84169 product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 84166..84570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 84574..85422 product protocatechuate 4,5-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene pcaH CDS 85448..86398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 86425..87462 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 87524..88750 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(88756..89865) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088689.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(90083..90910) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY02 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(90941..91594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(91777..92160) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918002.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(92268..93380) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GY0 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene adhC CDS complement(93573..94445) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(94450..95739) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 96275..96829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 note possible pseudo, internal stop codon CDS complement(96826..97953) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804855.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(97953..98804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(98926..99084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(99087..99521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(99518..100237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(100260..101684) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 102011..102622 product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816000.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 102639..103547 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(103551..104090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(104111..104659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(104683..105927) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113027.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(106069..106947) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529196.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 107382..108224 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530570.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(108242..109765) product 4-coumarate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920258.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 110009..111406 product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971610.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene gcvT CDS 111575..112897 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206166.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene vanK CDS 112902..114452 product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_102164.2 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene mdlC CDS complement(114465..115433) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920257.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 115681..117867 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(117916..118803) product short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 119060..119860 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089189.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(119871..120815) product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704647.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(120904..121782) product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888196.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 122258..123436 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTE9 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene wecE CDS 123527..124216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 124206..125345 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730490.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(125342..126178) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971751.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 126447..126809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 126806..127567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 127564..128349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(128353..129243) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 129415..130143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 130140..131570 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 131574..132626 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730490.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 132644..134275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(134272..134730) product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89CF5 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(134738..136207) product carotenoid oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 136333..136755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 misc_feature complement(136801..>138085) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112297.1:MFS transporter locus_tag LOCUS_32660 sequence14 source 1..92498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 628..936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(943..1914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 2116..5625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(5646..7406) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337665.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 7294..7596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 7648..8055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(8036..8926) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(8953..9627) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(9670..10086) product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083398.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(10116..11177) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(11155..11430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(11447..11737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710134.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(11749..12897) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919227.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(12904..13566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(13580..14005) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(14068..14946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(14950..16443) product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(16656..17879) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(17942..18442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(18587..19039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 19486..20463 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene yrbG CDS 20467..21228 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383369.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 21232..21645 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(21642..22145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 22224..24149 product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF6 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene uvrC CDS 24522..26414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(26464..26850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(26856..28496) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 28667..29467 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(29541..31484) product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 31622..32176 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974979.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 32173..32871 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 32872..34185 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708804.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(34182..34991) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DI5 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene proC CDS complement(35037..35540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918381.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(35661..35900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090176.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 36005..36859 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZV6 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene lgt CDS 36856..37971 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972143.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 37968..38741 product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N75 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 38811..39770 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZV1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene prs CDS complement(39823..40200) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 40514..42634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(42631..43536) product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene rimK CDS complement(43553..44041) product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene rimK2 CDS complement(44043..45167) product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525804.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(45259..46338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 46645..47853 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A830 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 47958..48431 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658301.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene dps tRNA complement(48549..48624) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 48757..49197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(49202..50035) product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640174.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(50105..51397) product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 51487..52272 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58056 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene nadK CDS 52459..54414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(54417..55817) product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(55955..57250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 57462..58820 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ5 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene radA CDS 58924..59619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 59616..61175 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MY2 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene purF CDS 61245..62231 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974368.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(62328..65279) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3H4 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene valS CDS 65394..65750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(65751..67928) product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(68068..68589) product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene popZ CDS complement(68704..70062) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene rsaFb CDS complement(70192..70845) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720416.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 tRNA 71035..71108 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 71357..72952 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 72962..74167 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 74171..77374 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(77551..78348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(78379..79779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 tRNA 79915..79990 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(79961..81535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(81997..82308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970276.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(82305..82550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(82547..83383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(83611..84636) product antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(85081..85455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(85657..86019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 86063..86461 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 86696..87535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886998.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 87525..88442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(88503..89036) product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ33 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene lspA CDS complement(89033..89626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(89933..91978) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 sequence15 source 1..90995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..1134 product conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 1134..1301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 1390..2013 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970322.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 2006..2869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970323.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 2845..3099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(3489..4115) product atu genes repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090989.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene atuR CDS complement(4190..4426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 note possible pseudo, internal stop codon CDS complement(4481..4663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 4995..7343 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 7461..8378 product metapyrocatechase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228946.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 8466..8828 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 8997..9230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(9227..10876) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(11209..11499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 11659..12351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 12404..12892 product ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816691.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(13002..13214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 13206..14105 product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063638.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 note possible pseudo, frameshifted CDS 14110..14502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(14636..14935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 15044..16207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 16241..16690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 16716..18185 product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 18232..18981 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK05 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene mhpD CDS 18999..19940 product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8Q8 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene mhpF CDS 19937..20989 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene mhpE CDS 20990..21760 product 4-oxalocrotonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230345.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 21766..21996 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257238.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 21989..22813 product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 22876..24126 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887717.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 24215..25384 product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(25423..26583) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(26642..28276) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083665.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 28550..30808 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene fyuA CDS 30907..31806 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 31822..32268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 32286..32723 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene maoC CDS 32766..34259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 34256..35461 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(35576..36490) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(36623..37831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 37919..38176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(38283..40574) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene fyuA CDS complement(40843..41610) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(41611..42531) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 42865..44127 product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063917.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 44186..44674 product ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063916.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 44731..45918 product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812489.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 45915..46328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 46330..47250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 47266..47643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 47750..48076 product 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XW23 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene hcaC CDS complement(48243..48689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(49237..49623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 note possible pseudo, internal stop codon, frameshifted CDS complement(49620..50123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(50126..50647) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 50912..51901 product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 51901..55014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 55004..56311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 56313..57662 product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(57878..58339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(58973..60223) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(60515..60913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(61154..61387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 61627..62880 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 62877..64133 product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 64145..67309 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 67335..68057 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 68071..68736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(68843..69466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083640.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(69466..69813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545616.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 70686..73658 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038268.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene iroN CDS 73835..75352 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 75451..76674 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974049.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene xylR CDS 76991..77932 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920323.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 77964..79307 product mannanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918686.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 79386..81248 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 81248..82381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 82374..83549 product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y28 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 83561..84769 product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 84766..85620 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 85657..88185 product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene celD CDS complement(88244..90559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 sequence16 source 1..81838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(382..1686) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509587.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(1701..2984) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640633.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(3003..4112) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene aroB CDS complement(4109..4639) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW7 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene aroK CDS 4763..4945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 4932..6647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 6655..7599 product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCA1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene xerD CDS 7702..8673 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2N7 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene accA CDS complement(8699..8836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(8911..9252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(9368..10042) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532163.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 10294..10785 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 10782..11921 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 12178..13707 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919730.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene sufB CDS 13707..14075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 14072..14515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 14515..15261 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene sufC CDS 15258..16490 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141372.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 16487..17728 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGA5 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 17738..18142 product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532157.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 18133..18537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 18534..18899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 18899..19303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 19327..19731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(19728..20441) product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(20966..22384) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(22443..23000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310427.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(23003..23182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(23250..24215) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 24343..25887 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(25889..27064) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 27140..27745 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 27858..28439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(28474..28902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529289.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 29080..30690 product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene atuC CDS 30690..31205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141565.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 31221..32402 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529278.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 32407..33243 product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene atuE CDS 33240..35198 product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083807.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene mccA CDS 35199..36059 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083805.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 36212..38578 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 38580..39410 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 39431..40654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(40658..41617) product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF0 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 41817..42950 product putative dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSB4 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 42998..43195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 43196..44209 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536759.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(44229..45506) product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 45562..45891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 45914..47929 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932615.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 47996..48904 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 48901..49161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(49195..49554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(49720..50085) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923312.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 50323..51360 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123020.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(51364..52518) product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 52658..53146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919164.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 53152..53685 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089163.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 53797..54384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 54394..54816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(54813..55637) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C862 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene rsmA CDS complement(55634..56647) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKN3 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene pdxA CDS complement(56655..57968) product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8Y4 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(58048..60330) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA6 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene lptD CDS complement(60455..61549) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(61549..62661) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919561.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 62814..64304 product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene pepA CDS 64328..64762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 64766..65317 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 65314..65769 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919563.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 65782..66120 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(66117..67052) product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene yrbG CDS complement(67162..67455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 67567..67989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(67986..69866) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969079.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(69911..70951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 71168..72370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(72379..72867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 72967..73191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 73203..74624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 74670..75194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957538.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene grpB CDS complement(75196..75957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(76078..76845) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920496.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(77123..77752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(77797..78510) product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088316.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 78640..79353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 79436..79864 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(79913..80914) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088298.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 sequence17 source 1..80988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2899 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941497.1:cytochrome-c peroxidase locus_tag LOCUS_35210 CDS 2912..3220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 4737..4985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 5393..6424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(6492..7283) product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970761.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(7529..8608) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103965.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(8611..9207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 9523..12300 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762818.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 12403..13902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 13995..15398 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 15556..16155 product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265652.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 16179..17261 product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112303.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 17457..20909 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918867.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 21053..22387 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919838.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 22387..23643 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 23652..25427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 25523..26938 product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883980.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 27328..27936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 27941..28987 product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 29183..31744 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(31825..32571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 32781..33953 product tryptophan 2,3-dioxygenase KynA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074060.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene kynA CDS complement(33954..34298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(34279..35382) product flagellar biosynthetic protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385150.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene flhB CDS complement(35379..36167) product flagellar biosynthesis protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338876.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene fliR1 CDS complement(36172..38268) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338875.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene flhA1 CDS complement(38285..38551) product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385143.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene fliQ CDS complement(38579..38905) product flagellar hook-basal body protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338883.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene fliE1 CDS complement(38914..39306) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385141.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene flgC CDS complement(39318..39680) product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338884.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 39724..41151 product ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338885.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(41202..42608) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBF2 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene ahcY CDS 42793..43266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(43263..44144) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 44203..44757 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWH9 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene ligT CDS complement(44733..45200) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972483.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 45303..45815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 45822..46538 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2S6 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene cobB CDS 46645..49854 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918005.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 49866..51482 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920331.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(51484..54351) product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MI9 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene secA CDS 54532..55809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 55910..56311 product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene mutT CDS 56227..56526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(56534..57379) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene bioC CDS 57473..57841 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908792.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 57841..58587 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 58615..58872 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 58865..59710 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973100.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 59707..60171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 60234..61982 product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265771.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 62169..65444 product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(65449..66234) product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCF6 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene ubiG CDS 66347..67612 product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ7 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene lysC CDS 67623..69914 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene ptsP CDS 70076..70837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 70962..72092 product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U8 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene ispG CDS 72174..73247 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5V3 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene prfA CDS 73240..74124 product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XT8 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene prmC CDS 74445..75005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 75084..75875 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 75884..76630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(76627..78444) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(78547..79434) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene prmA misc_feature complement(79431..>80988) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4N8:DNA helicase locus_tag LOCUS_35850 sequence18 source 1..75332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1381 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918544.1:amidohydrolase locus_tag LOCUS_35860 CDS complement(1611..2030) product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS 2060..2683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 2680..3054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(3070..3423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 3583..4566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 4570..5478 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(5484..5822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(5956..6474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(6540..7577) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807348.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(7841..8500) product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H292 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene pdxH CDS 8603..9703 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RY1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene aroC CDS complement(9717..10631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(10680..11426) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084036.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(11590..11886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 11773..12648 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 12834..13652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(13660..14730) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919204.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(14743..15153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(15157..16449) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532784.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(16427..17152) product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974694.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 17277..18248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 18313..19347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143497.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(19364..19834) product S-isoprenylcysteine methyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974564.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(19961..21874) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RW1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 gene dxs CDS 22119..22946 product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702128.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 23091..24236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(24249..24494) product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M3 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene xseB CDS 24598..25791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531181.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 25801..26307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 26701..28461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(28543..30138) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384433.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 30303..31961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(32035..33375) product putative aldehyde dehydrogenase AldX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46329 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene aldX CDS complement(33492..34106) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919932.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(34147..35115) product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532793.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(35180..35422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 35620..36024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920005.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 36026..36460 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223897.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 36568..36906 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969808.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 36903..37373 product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976305.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 37370..38008 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920739.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 38090..38620 product deaminase reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708746.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 38676..38909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(38913..39734) product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707423.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(39739..40620) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(41129..42331) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(42487..43410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(43603..44931) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(44995..45174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(45185..46555) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529586.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene pcaK CDS complement(46757..49102) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene fyuA CDS complement(49923..50363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(50353..52614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(52614..53585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55650 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(53594..54604) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403889.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(54617..55906) product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX4 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene kamA CDS complement(56141..57472) product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene gabT CDS complement(57584..59035) product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943333.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(59035..62196) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940082.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(62233..63426) product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene acrA CDS 63587..64171 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 64339..65655 product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208368.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene macA CDS 65670..67610 product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPB4 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene macB CDS 67616..68959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene opmQ CDS 69008..69442 product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085853.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 69469..70923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(70927..71325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(71280..71534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(71471..73186) product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(73189..73467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(73712..75238) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 sequence19 source 1..64116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1105 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887493.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 1260..2054 product putative transcriptional regulator, AraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700820.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 2138..2797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 2883..3365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(3373..3867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 4549..6624 product cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene cti CDS 6661..7617 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528051.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(7628..8665) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249716.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(8689..9708) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(9699..12191) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G7 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene ppsA CDS complement(12247..12525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 note possible pseudo, frameshifted CDS 12937..13626 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene hutC CDS complement(13822..16326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(16384..19101) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037537.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene btuB CDS complement(19193..19669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(20142..20984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(20994..21509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(21525..24062) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918977.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 24576..25829 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065102.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(25967..27166) product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876185.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(27325..28482) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 28865..29833 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(29741..29992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 30122..30424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(30442..30639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 30592..30876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 30938..31504 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(31878..33143) product polysaccharide biosynthesis-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973111.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(33376..33786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 33754..34236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(34977..35255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 35283..36302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS complement(36369..36569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 37199..38887 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205076.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 39119..39745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 39720..40733 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267457.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 40906..41955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(41952..42299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(42326..43342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331292.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 43664..45148 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942823.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(45313..45657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 repeat_region 45651..46201 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccggggcgatcagaccccggaataa CDS complement(46426..46719) product CRISPR-associated endoribonuclease Cas2 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY12 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene cas2-1 CDS complement(46724..48454) product CRISPR-associated exonuclease Cas4/endonuclease Cas1 fusion inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY11 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene cas4-cas1 CDS 48690..51626 product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940729.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene cas3-1 CDS 51626..52519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 52516..53688 product type I-U CRISPR-associated protein Cas7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940731.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene csb1 CDS 53696..55936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(56171..57571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(57575..58993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 59647..61260 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339453.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 tRNA complement(61217..61293) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(61412..62527) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390398.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(62520..62993) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122325.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(62972..63340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(63360..63800) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064706.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 sequence20 source 1..55941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1349..2341) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061628.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(2420..3199) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(3217..4506) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086848.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene dnaC CDS 4959..5324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 5613..5981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 6017..7894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946767.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 7907..9199 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC99 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene ackA CDS 9196..10215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 10215..11954 product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009950383.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 11958..13109 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 13151..13945 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYE9 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 13966..14181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 14336..16309 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 16516..16785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 16782..17441 product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 17492..18037 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 18129..19241 product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56725 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene nhaA CDS 19419..19706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 19927..20295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(20695..20940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 20929..21807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 21907..22185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 22285..23649 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 23688..25205 product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 25202..26089 product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(26141..26509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 note possible pseudo, frameshifted CDS complement(26839..27891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(27907..28701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 note possible pseudo, internal stop codon, frameshifted CDS complement(28698..30692) product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene copA CDS complement(30777..31316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(31408..31659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(31902..32483) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(32473..33165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(33327..35684) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(35705..36103) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 36389..36556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(36658..37122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 37750..39003 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106279.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 39000..40595 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706760.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 40592..43777 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene cusA CDS 43841..45133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 45466..46056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 46068..46805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(46880..47326) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530143.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 47401..48264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 48279..48587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 48594..49022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 49116..49319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(49239..49736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 note possible pseudo, internal stop codon CDS complement(49788..50222) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 50262..50927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 50951..51520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 51558..51914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 51973..53211 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 53211..54377 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269235.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 sequence21 source 1..55163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(413..988) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088019.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS 1146..2294 product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6X6 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene cysD CDS 2295..4211 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(4222..4650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(4785..5588) product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389377.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(5585..6880) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNF0 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene hflX CDS complement(7049..7288) product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ2 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene hfq CDS complement(7435..8289) product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389372.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(8293..9612) product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Q4 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene trkH2 CDS complement(9706..11079) product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975268.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene trkA CDS complement(11119..12507) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535439.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene ntrX CDS complement(12537..14822) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640318.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene ntrY CDS complement(15020..16030) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAD3 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 16104..17288 product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene ispDF CDS 17285..17782 product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531490.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(17779..18633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(18638..21214) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918997.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(21406..21846) product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719940.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(21843..22529) product beta-aryl ether-cleaving enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969082.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene ligE CDS 22735..22965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 23034..23672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(23669..24631) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW82 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene lipA CDS complement(24782..25507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(25673..26125) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921402.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 26260..27372 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMH7 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(27436..27636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 27527..27877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(27881..28648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(28645..30021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921106.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(30032..30328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088538.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(30462..30758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(30814..31359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(31542..32984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(33162..35156) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFG9 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene rpoD CDS complement(35168..37150) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DT9 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene dnaG CDS 37303..39153 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918627.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS complement(39828..40778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 40722..41072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(41076..42302) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919485.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 42505..43371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087108.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(43368..44066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 44151..45068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(45065..45523) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976357.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 45749..46918 product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CB10 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene carA CDS 46981..47460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113663.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 47469..47711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS 47798..48361 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene efp CDS complement(48462..48740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 48630..48974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS 49012..49734 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919067.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(49717..50292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(50388..51389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(51535..51957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(51950..52276) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 sequence22 source 1..52706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(497..856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS 933..1259 product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8Q1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 1438..1662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(1705..2289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(2286..2930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 3001..3435 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 3476..4126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083060.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 4826..5317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 note possible pseudo, internal stop codon, frameshifted CDS complement(5431..6855) product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0E4 transl_table 11 codon_start 1 locus_tag LOCUS_38290 gene merA CDS complement(6938..7270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(7289..7678) product mercury transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294667.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 7767..8180 product heavy metal-dependent transcription regulator 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58379 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene hmrR2 CDS complement(8242..8916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(8922..9893) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene msrP CDS complement(10120..10446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(10625..10981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(10993..11526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(11709..14879) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(14876..16474) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263308.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene cusB CDS complement(16471..17718) product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106279.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(17812..18189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(18305..18571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 18740..19039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 19036..19491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 19445..20155 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 20515..20961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 21133..21381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 21466..21966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS 22055..23944 product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265648.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 23941..24741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 24754..25818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 26021..26524 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 26863..27405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(27429..28316) product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(28313..29821) product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(29837..31201) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(31362..31739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(31950..33140) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45359 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene thlA CDS complement(33501..33971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(33990..35861) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene ftsH CDS complement(35976..36638) product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS complement(36635..36865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(36902..38953) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(39237..40025) product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYE9 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(40049..41059) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(41060..41230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(41220..42251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(42248..43300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 43190..43459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(43549..45399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946767.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(45463..45891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(45990..46730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS 46935..48176 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 48331..48651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 48638..48934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 49083..49865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 49960..50937 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887496.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 50941..52671 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 sequence23 source 1..50528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..1603) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene sun CDS 1759..2478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38800 tRNA complement(2709..2784) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(2916..3338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 3474..4796 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9A8 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene aroA CDS complement(4806..7016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 7129..7800 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP6 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene cmk CDS 7974..9674 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WF0 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene rpsA CDS complement(9735..10832) product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089975.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(10832..11938) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089976.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 12067..12927 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59752 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene mutM CDS 13039..13305 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY9 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene rpsT CDS 13925..15403 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWW5 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene dnaA CDS 15704..16822 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP6 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene dnaN CDS 16819..18024 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT0 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene recF CDS 18041..20452 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB82 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene gyrB CDS complement(20599..21657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(21698..22693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 tRNA 23160..23236 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 23393..23584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 24161..24526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(24715..25197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(25187..25663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(25667..26167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(26273..29656) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QR6 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(29667..30308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS complement(30298..31125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(31269..32000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 32346..32885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(32892..34145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS complement(34287..34484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 34721..36445 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205076.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(36674..38578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976224.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 39491..40162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 40188..41450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 41626..42663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 42660..43883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 43978..44712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(44969..45205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 note possible pseudo, internal stop codon CDS complement(45218..46399) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918162.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 note possible pseudo, internal stop codon CDS complement(46520..46711) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084405.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 47674..47973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 48001..48603 product ECF sigma factor FoxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene foxI CDS 48611..49585 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267457.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 49796..50311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 sequence24 source 1..43480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(520..609) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 928..1914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 1982..3154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 3155..3802 product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9D5 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene tmk CDS 3855..4877 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919689.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 4881..5669 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919688.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 5685..6530 product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919687.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 6632..7468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 7851..8642 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6P1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 8654..9022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921255.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 9095..9580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 9814..12033 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919836.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(12103..12708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 12817..13113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 13155..14039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(14036..14569) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3J9 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene nusG CDS complement(14593..14880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(15035..16924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 17295..18599 product prophage integrase IntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32053 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene intA CDS complement(18606..18770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(18836..19144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970276.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(19148..19384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(19381..20649) product conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(20651..21628) product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920535.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(21625..22323) product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084433.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene trbF CDS complement(22325..23683) product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533265.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS complement(23702..24430) product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(24415..26853) product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(26847..27101) product conjugal transfer protein TrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533268.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(27111..27437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(27434..28426) product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533270.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(28423..28881) product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(28878..30896) product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(31983..33605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 34386..34577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 35020..35379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 35396..36268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 36270..38477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 38588..38938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 38943..39470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS 39567..40094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 40094..40810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 40823..41377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(41613..42404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(42382..42636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 note possible pseudo, internal stop codon CDS complement(42682..43314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39660 note possible pseudo, internal stop codon sequence25 source 1..33750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(703..1176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 1338..1589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(1801..2238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(2333..3619) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD26 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene dinB CDS 3768..4166 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537642.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene celR1 CDS 4205..5581 product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene pleD CDS complement(5585..6073) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(6151..6318) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZL9 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene rpmG CDS complement(6432..6854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087873.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(6990..8291) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5G3 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(8288..8473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(8495..9799) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33915 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene gltA CDS complement(9894..11306) product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA3 transl_table 11 codon_start 1 locus_tag LOCUS_39790 gene gltX1 CDS 11411..13576 product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(13799..14086) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(14083..14406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390829.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(14470..15210) product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A724 transl_table 11 codon_start 1 locus_tag LOCUS_39830 gene lexA CDS complement(15379..16176) product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9X9 transl_table 11 codon_start 1 locus_tag LOCUS_39840 gene trpC CDS complement(16173..17192) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene trpD CDS complement(17189..17767) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 17880..18911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(18915..20756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(20876..22381) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(22387..24282) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971799.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene ppiD CDS 24472..25197 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU3 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene tpiA CDS 25221..26162 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090277.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 26159..26425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS 26549..27784 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528870.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 27895..31410 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F5 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene mfd CDS complement(31418..32998) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109795.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS complement(33585..33749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39970 sequence26 source 1..30231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(483..926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(947..1384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(1431..1874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(1994..2275) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UH1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 gene infA CDS complement(2193..3743) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084264.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene rhlE CDS complement(3918..4136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 4117..4389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(4449..4652) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140407.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(4951..7458) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS complement(7779..9266) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709773.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(9290..10102) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 10168..11115 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS 11112..11426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 11347..11619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 note possible pseudo, frameshifted CDS complement(11623..14157) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921186.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 14493..15344 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089434.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS complement(15341..16633) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087813.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(16639..17634) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(17631..18140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 18328..19302 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706166.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 19355..20263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(20401..21780) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ46 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene dinB CDS complement(21827..22606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 22684..23346 product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C539 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 23440..23802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 23815..24156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 24160..25395 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(25392..26243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS complement(26323..27078) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538576.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 27257..29029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 sequence27 source 1..20256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(292..368) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(456..764) product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 tRNA complement(801..877) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(969..2489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40290 tRNA 2709..2783 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(2872..3180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(3205..4368) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919300.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(4400..4975) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(5053..6054) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919302.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(6261..6494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40340 note possible pseudo, internal stop codon, frameshifted CDS complement(6682..7506) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 7673..8599 product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene ilvE CDS complement(8666..10252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS 10552..11565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(11587..13143) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene phoA CDS 13271..15424 product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918909.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(15432..15941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS complement(15981..16649) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708491.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(16681..17619) product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A919 transl_table 11 codon_start 1 locus_tag LOCUS_40430 gene dhmA CDS 17775..19001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS complement(19039..19590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 sequence28 source 1..5731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 249..1022 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970505.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 1083..2372 product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS complement(2913..3254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083295.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 3527..4459 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 4876..5436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 sequence29 source 1..3108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..1242) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269235.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(1242..2480) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(2538..2873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40530