>Feature sequence001 <1 505 gene locus_tag LOCUS_0010 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F3Q4:ATP-dependent protease subunit HslV 505 1818 gene locus_tag LOCUS_0020 gene hslU 505 1818 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA1 protein_id gnl|my_center|LOCUS_0020 2347 1808 gene locus_tag LOCUS_0030 2347 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 2855 2337 gene locus_tag LOCUS_0040 2855 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 3511 2855 gene locus_tag LOCUS_0050 gene dnaQ 3511 2855 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCJ9 protein_id gnl|my_center|LOCUS_0050 4065 3508 gene locus_tag LOCUS_0060 4065 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 4882 4058 gene locus_tag LOCUS_0070 gene aroE 4882 4058 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJC5 protein_id gnl|my_center|LOCUS_0070 5474 4884 gene locus_tag LOCUS_0080 5474 4884 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8FA20 protein_id gnl|my_center|LOCUS_0080 5730 5536 gene locus_tag LOCUS_0090 5730 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 5725 6984 gene locus_tag LOCUS_0100 gene rho 5725 6984 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHB1 protein_id gnl|my_center|LOCUS_0100 8060 6987 gene locus_tag LOCUS_0110 gene rlmN 8060 6987 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L68 protein_id gnl|my_center|LOCUS_0110 8121 9455 gene locus_tag LOCUS_0120 gene mnmE 8121 9455 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6F2A3 protein_id gnl|my_center|LOCUS_0120 9605 11461 gene locus_tag LOCUS_0130 gene mnmG 9605 11461 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KW2 protein_id gnl|my_center|LOCUS_0130 11448 12062 gene locus_tag LOCUS_0140 gene rsmG 11448 12062 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE89 protein_id gnl|my_center|LOCUS_0140 12059 12814 gene locus_tag LOCUS_0150 12059 12814 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596591.1 protein_id gnl|my_center|LOCUS_0150 12811 13665 gene locus_tag LOCUS_0160 12811 13665 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074697.1 protein_id gnl|my_center|LOCUS_0160 14312 13662 gene locus_tag LOCUS_0170 14312 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 14853 14305 gene locus_tag LOCUS_0180 14853 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 17233 14867 gene locus_tag LOCUS_0190 gene leuS 17233 14867 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDB1 protein_id gnl|my_center|LOCUS_0190 17818 17249 gene locus_tag LOCUS_0200 17818 17249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 18969 17938 gene locus_tag LOCUS_0210 18969 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 20715 19129 gene locus_tag LOCUS_0220 20715 19129 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 protein_id gnl|my_center|LOCUS_0220 20753 21730 gene locus_tag LOCUS_0230 20753 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0230 21720 22361 gene locus_tag LOCUS_0240 21720 22361 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385539.1 protein_id gnl|my_center|LOCUS_0240 22354 22848 gene locus_tag LOCUS_0250 22354 22848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 22848 23381 gene locus_tag LOCUS_0260 22848 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 25437 23374 gene locus_tag LOCUS_0270 25437 23374 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546688.1 protein_id gnl|my_center|LOCUS_0270 25464 26594 gene locus_tag LOCUS_0280 gene ubiH 25464 26594 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021491.1 protein_id gnl|my_center|LOCUS_0280 27245 26595 gene locus_tag LOCUS_0290 27245 26595 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067253.1 protein_id gnl|my_center|LOCUS_0290 28121 27249 gene locus_tag LOCUS_0300 28121 27249 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310301.1 protein_id gnl|my_center|LOCUS_0300 28360 28286 gene locus_tag LOCUS_t0010 28360 28286 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 28604 28446 gene locus_tag LOCUS_0310 28604 28446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 29994 28621 gene locus_tag LOCUS_0320 29994 28621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 30874 29996 gene locus_tag LOCUS_0330 gene aroE 30874 29996 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4X1 protein_id gnl|my_center|LOCUS_0330 31762 30878 gene locus_tag LOCUS_0340 gene aroG-2 31762 30878 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_0340 32830 31766 gene locus_tag LOCUS_0350 32830 31766 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_0350 34184 32823 gene locus_tag LOCUS_0360 34184 32823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 34884 34171 gene locus_tag LOCUS_0370 gene neuA 34884 34171 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932825.1 protein_id gnl|my_center|LOCUS_0370 35950 34886 gene locus_tag LOCUS_0380 35950 34886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 36738 35947 gene locus_tag LOCUS_0390 36738 35947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532751.1 protein_id gnl|my_center|LOCUS_0390 37520 36759 gene locus_tag LOCUS_0400 37520 36759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 37673 39502 gene locus_tag LOCUS_0410 gene asnB 37673 39502 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964098.1 protein_id gnl|my_center|LOCUS_0410 39700 39506 gene locus_tag LOCUS_0420 39700 39506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 41309 39636 gene locus_tag LOCUS_0430 gene pglK 41309 39636 CDS product protein glycosylation K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9C4 protein_id gnl|my_center|LOCUS_0430 42311 41322 gene locus_tag LOCUS_0440 42311 41322 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_0440 42357 43517 gene locus_tag LOCUS_0450 42357 43517 CDS product CDP-4-keto-6-deoxy-D-glucose-3-dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_0450 43517 44452 gene locus_tag LOCUS_0460 43517 44452 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_0460 44459 45430 gene locus_tag LOCUS_0470 44459 45430 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_0470 45423 46412 gene locus_tag LOCUS_0480 gene fcl 45423 46412 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NET6 protein_id gnl|my_center|LOCUS_0480 47367 46414 gene locus_tag LOCUS_0490 gene fcl 47367 46414 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97H34 protein_id gnl|my_center|LOCUS_0490 47893 47357 gene locus_tag LOCUS_0500 47893 47357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0500 48512 47895 gene locus_tag LOCUS_0510 48512 47895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 >Feature sequence002 <1 1070 gene locus_tag LOCUS_0520 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074085.1:electron transfer flavoprotein-ubiquinone oxidoreductase 2856 1078 gene locus_tag LOCUS_0530 2856 1078 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039483.1 protein_id gnl|my_center|LOCUS_0530 2991 3194 gene locus_tag LOCUS_0540 2991 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 3204 5546 gene locus_tag LOCUS_0550 3204 5546 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_0550 5546 7174 gene locus_tag LOCUS_0560 5546 7174 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257757.1 protein_id gnl|my_center|LOCUS_0560 7174 7977 gene locus_tag LOCUS_0570 7174 7977 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879825.1 protein_id gnl|my_center|LOCUS_0570 7992 8234 gene locus_tag LOCUS_0580 7992 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 8479 8300 gene locus_tag LOCUS_0590 8479 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 8696 9739 gene locus_tag LOCUS_0600 8696 9739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462369.1 protein_id gnl|my_center|LOCUS_0600 9714 11339 gene locus_tag LOCUS_0610 9714 11339 CDS product thiamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262997.1 protein_id gnl|my_center|LOCUS_0610 11326 11943 gene locus_tag LOCUS_0620 gene ynjD 11326 11943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262996.1 protein_id gnl|my_center|LOCUS_0620 11940 12284 gene locus_tag LOCUS_0630 11940 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 13142 12288 gene locus_tag LOCUS_0640 13142 12288 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971921.1 protein_id gnl|my_center|LOCUS_0640 14389 13145 gene locus_tag LOCUS_0650 gene folC 14389 13145 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_0650 15236 14394 gene locus_tag LOCUS_0660 gene accD 15236 14394 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC3 protein_id gnl|my_center|LOCUS_0660 16019 15240 gene locus_tag LOCUS_0670 gene trpA 16019 15240 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE4 protein_id gnl|my_center|LOCUS_0670 17217 16012 gene locus_tag LOCUS_0680 gene trpB 17217 16012 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ6 protein_id gnl|my_center|LOCUS_0680 17864 17223 gene locus_tag LOCUS_0690 17864 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 18516 17809 gene locus_tag LOCUS_0700 gene pyrF 18516 17809 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI95 protein_id gnl|my_center|LOCUS_0700 18808 18509 gene locus_tag LOCUS_0710 18808 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 20477 18780 gene locus_tag LOCUS_0720 20477 18780 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP7 protein_id gnl|my_center|LOCUS_0720 21846 20548 gene locus_tag LOCUS_0730 gene aroA 21846 20548 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 protein_id gnl|my_center|LOCUS_0730 22616 21897 gene locus_tag LOCUS_0740 gene lptB 22616 21897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_0740 23088 22609 gene locus_tag LOCUS_0750 23088 22609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 23485 23054 gene locus_tag LOCUS_0760 23485 23054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 24428 23478 gene locus_tag LOCUS_0770 24428 23478 CDS product putative phosphosugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67500 protein_id gnl|my_center|LOCUS_0770 25064 24432 gene locus_tag LOCUS_0780 25064 24432 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597621.1 protein_id gnl|my_center|LOCUS_0780 25070 26032 gene locus_tag LOCUS_0790 25070 26032 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 protein_id gnl|my_center|LOCUS_0790 >Feature sequence003 <1 1461 gene locus_tag LOCUS_0800 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528031.1:FAD-dependent oxidoreductase 1487 2437 gene locus_tag LOCUS_0810 1487 2437 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971946.1 protein_id gnl|my_center|LOCUS_0810 2581 3759 gene locus_tag LOCUS_0820 2581 3759 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533052.1 protein_id gnl|my_center|LOCUS_0820 3836 5410 gene locus_tag LOCUS_0830 gene rbsA 3836 5410 CDS product ribose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860721.1 protein_id gnl|my_center|LOCUS_0830 5421 6416 gene locus_tag LOCUS_0840 5421 6416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533020.1 protein_id gnl|my_center|LOCUS_0840 6413 7405 gene locus_tag LOCUS_0850 6413 7405 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533021.1 protein_id gnl|my_center|LOCUS_0850 7407 9509 gene locus_tag LOCUS_0860 7407 9509 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_0860 9502 11298 gene locus_tag LOCUS_0870 gene hyuB 9502 11298 CDS product hydantoin utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929991.1 protein_id gnl|my_center|LOCUS_0870 11501 12346 gene locus_tag LOCUS_0880 11501 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 12568 13980 gene locus_tag LOCUS_0890 12568 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 13977 14978 gene locus_tag LOCUS_0900 13977 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55579 protein_id gnl|my_center|LOCUS_0900 14994 15716 gene locus_tag LOCUS_0910 14994 15716 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419147.1 protein_id gnl|my_center|LOCUS_0910 16625 15732 gene locus_tag LOCUS_0920 16625 15732 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986613.1 protein_id gnl|my_center|LOCUS_0920 17529 16651 gene locus_tag LOCUS_0930 17529 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0930 17923 17531 gene locus_tag LOCUS_0940 17923 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 18927 18019 gene locus_tag LOCUS_0950 18927 18019 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210056.1 protein_id gnl|my_center|LOCUS_0950 19323 18928 gene locus_tag LOCUS_0960 gene pcaC 19323 18928 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_0960 19693 20442 gene locus_tag LOCUS_0970 gene etfB1 19693 20442 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970096.1 protein_id gnl|my_center|LOCUS_0970 20442 21395 gene locus_tag LOCUS_0980 gene etfA 20442 21395 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_0980 >Feature sequence004 915 400 gene locus_tag LOCUS_0990 gene fabA 915 400 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 protein_id gnl|my_center|LOCUS_0990 1675 908 gene locus_tag LOCUS_1000 1675 908 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954515.1 protein_id gnl|my_center|LOCUS_1000 2105 1647 gene locus_tag LOCUS_1010 gene dut 2105 1647 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_1010 2739 2095 gene locus_tag LOCUS_1020 2739 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_1020 3258 2740 gene locus_tag LOCUS_1030 3258 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_1030 3956 3258 gene locus_tag LOCUS_1040 gene ubiE 3956 3258 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCP3 protein_id gnl|my_center|LOCUS_1040 3955 4770 gene locus_tag LOCUS_1050 gene mutM 3955 4770 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHR7 protein_id gnl|my_center|LOCUS_1050 4828 5094 gene locus_tag LOCUS_1060 gene rpsT 4828 5094 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S440 protein_id gnl|my_center|LOCUS_1060 5204 6571 gene locus_tag LOCUS_1070 gene dnaA 5204 6571 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59758 protein_id gnl|my_center|LOCUS_1070 6575 7684 gene locus_tag LOCUS_1080 gene dnaN 6575 7684 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W64 protein_id gnl|my_center|LOCUS_1080 7685 8761 gene locus_tag LOCUS_1090 gene recF 7685 8761 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZEB6 protein_id gnl|my_center|LOCUS_1090 8758 11193 gene locus_tag LOCUS_1100 gene gyrB 8758 11193 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZK5 protein_id gnl|my_center|LOCUS_1100 11195 12442 gene locus_tag LOCUS_1110 11195 12442 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918137.1 protein_id gnl|my_center|LOCUS_1110 12430 12978 gene locus_tag LOCUS_1120 gene regR 12430 12978 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083726.1 protein_id gnl|my_center|LOCUS_1120 13025 15706 gene locus_tag LOCUS_1130 13025 15706 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_1130 15707 16321 gene locus_tag LOCUS_1140 15707 16321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 16958 16395 gene locus_tag LOCUS_1150 16958 16395 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_1150 17197 16958 gene locus_tag LOCUS_1160 17197 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 <17799 17198 gene locus_tag LOCUS_1170 <17799 17198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962627.1:ribonucleoside-diphosphate reductase >Feature sequence005 35 1717 gene locus_tag LOCUS_1180 gene fhs 35 1717 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI03 protein_id gnl|my_center|LOCUS_1180 1769 2161 gene locus_tag LOCUS_1190 gene apaG 1769 2161 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS0 protein_id gnl|my_center|LOCUS_1190 2177 3625 gene locus_tag LOCUS_1200 gene trkH2 2177 3625 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Q4 protein_id gnl|my_center|LOCUS_1200 4110 3622 gene locus_tag LOCUS_1210 4110 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 4979 4095 gene locus_tag LOCUS_1220 gene argF 4979 4095 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE8 protein_id gnl|my_center|LOCUS_1220 5060 5764 gene locus_tag LOCUS_1230 5060 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 6977 5817 gene locus_tag LOCUS_1240 6977 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057045.1 protein_id gnl|my_center|LOCUS_1240 7720 6983 gene locus_tag LOCUS_1250 7720 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 8618 7713 gene locus_tag LOCUS_1260 8618 7713 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875987.1 protein_id gnl|my_center|LOCUS_1260 9850 8639 gene locus_tag LOCUS_1270 9850 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1270 11084 9870 gene locus_tag LOCUS_1280 11084 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1280 11970 11062 gene locus_tag LOCUS_1290 11970 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 13910 11973 gene locus_tag LOCUS_1300 gene wbpQ 13910 11973 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073062.1 protein_id gnl|my_center|LOCUS_1300 14538 14681 gene locus_tag LOCUS_1310 14538 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 15642 14839 gene locus_tag LOCUS_1320 15642 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 >Feature sequence006 2938 1889 gene locus_tag LOCUS_1330 gene pheS 2938 1889 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 protein_id gnl|my_center|LOCUS_1330 3307 2948 gene locus_tag LOCUS_1340 gene rplT 3307 2948 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP6 protein_id gnl|my_center|LOCUS_1340 3521 3321 gene locus_tag LOCUS_1350 gene rpmI 3521 3321 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBD0 protein_id gnl|my_center|LOCUS_1350 4145 3609 gene locus_tag LOCUS_1360 gene infC 4145 3609 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_1360 5231 4158 gene locus_tag LOCUS_1370 5231 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 6129 5221 gene locus_tag LOCUS_1380 6129 5221 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 protein_id gnl|my_center|LOCUS_1380 7246 6116 gene locus_tag LOCUS_1390 7246 6116 CDS product capsular polysaccharide biosynthesis protein CapM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597471.1 protein_id gnl|my_center|LOCUS_1390 7240 7968 gene locus_tag LOCUS_1400 7240 7968 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886270.1 protein_id gnl|my_center|LOCUS_1400 12482 7965 gene locus_tag LOCUS_1410 12482 7965 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_1410 13891 12479 gene locus_tag LOCUS_1420 gene gltD 13891 12479 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385170.1 protein_id gnl|my_center|LOCUS_1420 13987 14748 gene locus_tag LOCUS_1430 gene uppP 13987 14748 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUJ4 protein_id gnl|my_center|LOCUS_1430 >Feature sequence007 290 967 gene locus_tag LOCUS_1440 290 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 967 1530 gene locus_tag LOCUS_1450 967 1530 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166419.1 protein_id gnl|my_center|LOCUS_1450 2933 1800 gene locus_tag LOCUS_1460 gene pgi 2933 1800 CDS product putative glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMD4 protein_id gnl|my_center|LOCUS_1460 3354 2947 gene locus_tag LOCUS_1470 3354 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 3841 3347 gene locus_tag LOCUS_1480 gene lspA 3841 3347 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGD1 protein_id gnl|my_center|LOCUS_1480 6593 3813 gene locus_tag LOCUS_1490 gene ileS 6593 3813 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ34 protein_id gnl|my_center|LOCUS_1490 7518 6583 gene locus_tag LOCUS_1500 gene ribF 7518 6583 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66535 protein_id gnl|my_center|LOCUS_1500 7991 7524 gene locus_tag LOCUS_1510 7991 7524 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389594.1 protein_id gnl|my_center|LOCUS_1510 8090 8005 gene locus_tag LOCUS_t0020 8090 8005 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8209 8805 gene locus_tag LOCUS_1520 8209 8805 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_1520 8871 10403 gene locus_tag LOCUS_1530 8871 10403 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_1530 10429 10776 gene locus_tag LOCUS_1540 10429 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 11202 10786 gene locus_tag LOCUS_1550 11202 10786 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091024.1 protein_id gnl|my_center|LOCUS_1550 11291 12415 gene locus_tag LOCUS_1560 11291 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263666.1 protein_id gnl|my_center|LOCUS_1560 12435 13004 gene locus_tag LOCUS_1570 12435 13004 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_1570 13009 13473 gene locus_tag LOCUS_1580 13009 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 13454 14011 gene locus_tag LOCUS_1590 gene coq7 13454 14011 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_1590 >Feature sequence008 1828 881 gene locus_tag LOCUS_1600 1828 881 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957843.1 protein_id gnl|my_center|LOCUS_1600 3206 1893 gene locus_tag LOCUS_1610 3206 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 4096 3230 gene locus_tag LOCUS_1620 4096 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 5073 4093 gene locus_tag LOCUS_1630 5073 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 6089 5070 gene locus_tag LOCUS_1640 6089 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 7267 6092 gene locus_tag LOCUS_1650 7267 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 8452 7445 gene locus_tag LOCUS_1660 8452 7445 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_1660 9512 8496 gene locus_tag LOCUS_1670 9512 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 10207 9512 gene locus_tag LOCUS_1680 10207 9512 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987012.1 protein_id gnl|my_center|LOCUS_1680 10813 10220 gene locus_tag LOCUS_1690 gene gmhA 10813 10220 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4E9 protein_id gnl|my_center|LOCUS_1690 12076 10814 gene locus_tag LOCUS_1700 gene wbpA 12076 10814 CDS product UDP-N-acetyl-d-glucosamine 6-dehydrogenase WbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_1700 13302 12211 gene locus_tag LOCUS_1710 13302 12211 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_1710 <13992 13389 gene locus_tag LOCUS_1720 <13992 13389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3M9G9:60 kDa chaperonin >Feature sequence009 308 1258 gene locus_tag LOCUS_1730 gene mdh 308 1258 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIV5 protein_id gnl|my_center|LOCUS_1730 1347 4193 gene locus_tag LOCUS_1740 gene sucA 1347 4193 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067152.1 protein_id gnl|my_center|LOCUS_1740 4200 5261 gene locus_tag LOCUS_1750 gene sucB 4200 5261 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDY4 protein_id gnl|my_center|LOCUS_1750 7882 5258 gene locus_tag LOCUS_1760 gene acn 7882 5258 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37032 protein_id gnl|my_center|LOCUS_1760 8824 7931 gene locus_tag LOCUS_1770 8824 7931 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089835.1 protein_id gnl|my_center|LOCUS_1770 8931 9908 gene locus_tag LOCUS_1780 gene gpsA 8931 9908 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_1780 10167 9940 gene locus_tag LOCUS_1790 10167 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 10299 10676 gene locus_tag LOCUS_1800 10299 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 11259 10897 gene locus_tag LOCUS_1810 11259 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 11252 11563 gene locus_tag LOCUS_1820 11252 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 11572 12627 gene locus_tag LOCUS_1830 11572 12627 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_1830 12648 13166 gene locus_tag LOCUS_1840 12648 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 13379 13170 gene locus_tag LOCUS_1850 13379 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 <13927 13418 gene locus_tag LOCUS_1860 <13927 13418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261439.1:MFS transporter >Feature sequence010 <1 3164 gene locus_tag LOCUS_1870 <1 3164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YLE4:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 3218 3691 gene locus_tag LOCUS_1880 gene greA 3218 3691 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB1 protein_id gnl|my_center|LOCUS_1880 3698 4597 gene locus_tag LOCUS_1890 3698 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_1890 4635 5264 gene locus_tag LOCUS_1900 4635 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 5261 6190 gene locus_tag LOCUS_1910 gene trxB1 5261 6190 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W175 protein_id gnl|my_center|LOCUS_1910 6327 6202 gene locus_tag LOCUS_1920 gene rpmJ 6327 6202 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRH8 protein_id gnl|my_center|LOCUS_1920 6367 6786 gene locus_tag LOCUS_1930 6367 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037396.1 protein_id gnl|my_center|LOCUS_1930 6834 7349 gene locus_tag LOCUS_1940 gene ppiB 6834 7349 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_1940 8597 7356 gene locus_tag LOCUS_1950 8597 7356 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_1950 9532 8597 gene locus_tag LOCUS_1960 9532 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 9663 9587 gene locus_tag LOCUS_t0030 9663 9587 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11242 9722 gene locus_tag LOCUS_1970 gene murJ 11242 9722 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57415 protein_id gnl|my_center|LOCUS_1970 12102 11266 gene locus_tag LOCUS_1980 12102 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 >Feature sequence011 455 901 gene locus_tag LOCUS_1990 gene tadA 455 901 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXS5 protein_id gnl|my_center|LOCUS_1990 2155 893 gene locus_tag LOCUS_2000 gene purD 2155 893 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLE7 protein_id gnl|my_center|LOCUS_2000 2154 3506 gene locus_tag LOCUS_2010 2154 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 4358 3507 gene locus_tag LOCUS_2020 gene msbB 4358 3507 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 protein_id gnl|my_center|LOCUS_2020 5313 4351 gene locus_tag LOCUS_2030 gene lpxK 5313 4351 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV9 protein_id gnl|my_center|LOCUS_2030 6469 5306 gene locus_tag LOCUS_2040 6469 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 7103 6450 gene locus_tag LOCUS_2050 7103 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_2050 8827 7103 gene locus_tag LOCUS_2060 gene msbA 8827 7103 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_2060 9728 8820 gene locus_tag LOCUS_2070 gene ubiA 9728 8820 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CK36 protein_id gnl|my_center|LOCUS_2070 9727 10440 gene locus_tag LOCUS_2080 9727 10440 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF65 protein_id gnl|my_center|LOCUS_2080 10499 11347 gene locus_tag LOCUS_2090 gene ctaC 10499 11347 CDS product putative cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDC6 protein_id gnl|my_center|LOCUS_2090 >Feature sequence012 45 872 gene locus_tag LOCUS_2100 45 872 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887784.1 protein_id gnl|my_center|LOCUS_2100 1164 1778 gene locus_tag LOCUS_2110 gene hisH2 1164 1778 CDS product imidazole glycerol phosphate synthase subunit HisH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72138 protein_id gnl|my_center|LOCUS_2110 1782 2543 gene locus_tag LOCUS_2120 gene hisF2 1782 2543 CDS product putative imidazole glycerol phosphate synthase subunit hisF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72139 protein_id gnl|my_center|LOCUS_2120 2590 3663 gene locus_tag LOCUS_2130 gene wbpG 2590 3663 CDS product LPS biosynthesis protein WbpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_2130 3769 4110 gene locus_tag LOCUS_2140 3769 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 4360 5670 gene locus_tag LOCUS_2150 4360 5670 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066540.1 protein_id gnl|my_center|LOCUS_2150 5930 8053 gene locus_tag LOCUS_2160 gene katG 5930 8053 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_2160 8181 9128 gene locus_tag LOCUS_2170 8181 9128 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_2170 9141 9968 gene locus_tag LOCUS_2180 9141 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 10084 10731 gene locus_tag LOCUS_2190 10084 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 10982 10728 gene locus_tag LOCUS_2200 10982 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 11101 11481 gene locus_tag LOCUS_2210 11101 11481 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_2210 12031 11528 gene locus_tag LOCUS_2220 12031 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 >Feature sequence013 <1 1247 gene locus_tag LOCUS_2230 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887785.1:ferredoxin reductase 1639 1241 gene locus_tag LOCUS_2240 1639 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 1699 2025 gene locus_tag LOCUS_2250 1699 2025 CDS product Rieske family ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887786.1 protein_id gnl|my_center|LOCUS_2250 2047 3051 gene locus_tag LOCUS_2260 2047 3051 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887787.1 protein_id gnl|my_center|LOCUS_2260 3109 4395 gene locus_tag LOCUS_2270 3109 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 4573 5262 gene locus_tag LOCUS_2280 4573 5262 CDS product Ala-tRNA(Pro) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_2280 5259 6149 gene locus_tag LOCUS_2290 5259 6149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 protein_id gnl|my_center|LOCUS_2290 6200 7132 gene locus_tag LOCUS_2300 6200 7132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708274.1 protein_id gnl|my_center|LOCUS_2300 7129 7890 gene locus_tag LOCUS_2310 7129 7890 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7H5 protein_id gnl|my_center|LOCUS_2310 8011 8307 gene locus_tag LOCUS_2320 gene glnK 8011 8307 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_2320 8403 9593 gene locus_tag LOCUS_2330 8403 9593 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_2330 9814 11682 gene locus_tag LOCUS_2340 9814 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 >Feature sequence014 502 2970 gene locus_tag LOCUS_2350 gene secA 502 2970 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVH7 protein_id gnl|my_center|LOCUS_2350 3914 2973 gene locus_tag LOCUS_2360 gene accA 3914 2973 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 protein_id gnl|my_center|LOCUS_2360 4791 3922 gene locus_tag LOCUS_2370 4791 3922 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 protein_id gnl|my_center|LOCUS_2370 6309 4792 gene locus_tag LOCUS_2380 6309 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2380 6316 6477 gene locus_tag LOCUS_2390 6316 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 6500 7006 gene locus_tag LOCUS_2400 gene aroK 6500 7006 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CSF2 protein_id gnl|my_center|LOCUS_2400 7003 8067 gene locus_tag LOCUS_2410 gene aroB 7003 8067 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1U9 protein_id gnl|my_center|LOCUS_2410 8067 9317 gene locus_tag LOCUS_2420 8067 9317 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 protein_id gnl|my_center|LOCUS_2420 9591 9310 gene locus_tag LOCUS_2430 9591 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 9711 10097 gene locus_tag LOCUS_2440 9711 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 10099 11052 gene locus_tag LOCUS_2450 gene cobS 10099 11052 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523293.1 protein_id gnl|my_center|LOCUS_2450 >Feature sequence015 846 82 gene locus_tag LOCUS_2460 846 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 1135 839 gene locus_tag LOCUS_2470 1135 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 1318 1136 gene locus_tag LOCUS_2480 gene tatA 1318 1136 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8N5 protein_id gnl|my_center|LOCUS_2480 2393 1344 gene locus_tag LOCUS_2490 2393 1344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969280.1 protein_id gnl|my_center|LOCUS_2490 3033 2383 gene locus_tag LOCUS_2500 3033 2383 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBT7 protein_id gnl|my_center|LOCUS_2500 3760 3026 gene locus_tag LOCUS_2510 3760 3026 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087521.1 protein_id gnl|my_center|LOCUS_2510 4760 3750 gene locus_tag LOCUS_2520 4760 3750 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB3 protein_id gnl|my_center|LOCUS_2520 6566 4917 gene locus_tag LOCUS_2530 gene argS 6566 4917 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJQ6 protein_id gnl|my_center|LOCUS_2530 7662 6559 gene locus_tag LOCUS_2540 7662 6559 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE82 protein_id gnl|my_center|LOCUS_2540 7663 7989 gene locus_tag LOCUS_2550 7663 7989 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_2550 8043 8759 gene locus_tag LOCUS_2560 8043 8759 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975324.1 protein_id gnl|my_center|LOCUS_2560 <10094 8748 gene locus_tag LOCUS_2570 <10094 8748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89KY5:dihydroxy-acid dehydratase 2 >Feature sequence016 3 524 gene locus_tag LOCUS_2580 3 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 1652 516 gene locus_tag LOCUS_2590 1652 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 2105 1680 gene locus_tag LOCUS_2600 2105 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 2523 2098 gene locus_tag LOCUS_2610 2523 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 3520 2516 gene locus_tag LOCUS_2620 gene fcl 3520 2516 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF18 protein_id gnl|my_center|LOCUS_2620 4239 3517 gene locus_tag LOCUS_2630 4239 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2630 5407 4226 gene locus_tag LOCUS_2640 5407 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 6572 5457 gene locus_tag LOCUS_2650 6572 5457 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_2650 8012 6576 gene locus_tag LOCUS_2660 8012 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 8946 8026 gene locus_tag LOCUS_2670 8946 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 9308 8955 gene locus_tag LOCUS_2680 9308 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 9754 9305 gene locus_tag LOCUS_2690 9754 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 >Feature sequence017 <1 634 gene locus_tag LOCUS_2700 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387799.1:cytochrome C biogenesis protein CcmC 606 773 gene locus_tag LOCUS_2710 606 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 736 1185 gene locus_tag LOCUS_2720 gene ccmE 736 1185 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMN7 protein_id gnl|my_center|LOCUS_2720 1318 3033 gene locus_tag LOCUS_2730 1318 3033 CDS product heme lyase subunit CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982453.1 protein_id gnl|my_center|LOCUS_2730 3026 3514 gene locus_tag LOCUS_2740 gene cycY 3026 3514 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384161.1 protein_id gnl|my_center|LOCUS_2740 3495 3854 gene locus_tag LOCUS_2750 3495 3854 CDS product cytochrome c biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946599.1 protein_id gnl|my_center|LOCUS_2750 4524 3847 gene locus_tag LOCUS_2760 gene nocM 4524 3847 CDS product nopaline transport system permease protein NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35113 protein_id gnl|my_center|LOCUS_2760 5219 4524 gene locus_tag LOCUS_2770 gene nocQ 5219 4524 CDS product nopaline transport system permease protein NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35118 protein_id gnl|my_center|LOCUS_2770 6098 5271 gene locus_tag LOCUS_2780 gene nocT 6098 5271 CDS product nopaline-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35120 protein_id gnl|my_center|LOCUS_2780 6578 6192 gene locus_tag LOCUS_2790 6578 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2790 7157 6579 gene locus_tag LOCUS_2800 7157 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 7159 7404 gene locus_tag LOCUS_2810 7159 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 7473 7949 gene locus_tag LOCUS_2820 7473 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 8033 8797 gene locus_tag LOCUS_2830 8033 8797 CDS product histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 protein_id gnl|my_center|LOCUS_2830 8742 9104 gene locus_tag LOCUS_2840 8742 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 >Feature sequence018 1176 1051 gene locus_tag LOCUS_2850 1176 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2850 1517 2989 gene locus_tag LOCUS_2860 1517 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2860 2986 4404 gene locus_tag LOCUS_2870 2986 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 4373 5779 gene locus_tag LOCUS_2880 4373 5779 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972148.1 protein_id gnl|my_center|LOCUS_2880 5865 5791 gene locus_tag LOCUS_t0040 5865 5791 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6125 6553 gene locus_tag LOCUS_2890 6125 6553 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 protein_id gnl|my_center|LOCUS_2890 6553 8478 gene locus_tag LOCUS_2900 6553 8478 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957787.1 protein_id gnl|my_center|LOCUS_2900 >Feature sequence019 803 189 gene locus_tag LOCUS_2910 gene pyrE 803 189 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRD8 protein_id gnl|my_center|LOCUS_2910 1391 909 gene locus_tag LOCUS_2920 1391 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 2071 1388 gene locus_tag LOCUS_2930 2071 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 2970 2068 gene locus_tag LOCUS_2940 2970 2068 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_2940 3027 3563 gene locus_tag LOCUS_2950 3027 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 4154 3543 gene locus_tag LOCUS_2960 gene mobA 4154 3543 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJS4 protein_id gnl|my_center|LOCUS_2960 4956 4147 gene locus_tag LOCUS_2970 gene fdhD 4956 4147 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU0 protein_id gnl|my_center|LOCUS_2970 4986 5471 gene locus_tag LOCUS_2980 4986 5471 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531704.1 protein_id gnl|my_center|LOCUS_2980 5468 6646 gene locus_tag LOCUS_2990 5468 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 6863 6636 gene locus_tag LOCUS_3000 6863 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 6963 7844 gene locus_tag LOCUS_3010 6963 7844 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970351.1 protein_id gnl|my_center|LOCUS_3010 >Feature sequence020 284 1348 gene locus_tag LOCUS_3020 284 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 1807 1334 gene locus_tag LOCUS_3030 1807 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 2973 1807 gene locus_tag LOCUS_3040 gene dapE 2973 1807 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC93 protein_id gnl|my_center|LOCUS_3040 3817 2975 gene locus_tag LOCUS_3050 gene dapD 3817 2975 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_3050 4508 3828 gene locus_tag LOCUS_3060 4508 3828 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706659.1 protein_id gnl|my_center|LOCUS_3060 5136 4561 gene locus_tag LOCUS_3070 gene engB 5136 4561 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1H7 protein_id gnl|my_center|LOCUS_3070 6821 5136 gene locus_tag LOCUS_3080 gene yidC 6821 5136 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_3080 7064 6825 gene locus_tag LOCUS_3090 7064 6825 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHA5 protein_id gnl|my_center|LOCUS_3090 7389 7048 gene locus_tag LOCUS_3100 gene rnpA 7389 7048 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MRS3 protein_id gnl|my_center|LOCUS_3100 7573 8445 gene locus_tag LOCUS_3110 gene panC 7573 8445 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67891 protein_id gnl|my_center|LOCUS_3110 >Feature sequence021 72 518 gene locus_tag LOCUS_3120 gene ybeY 72 518 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH55 protein_id gnl|my_center|LOCUS_3120 508 1335 gene locus_tag LOCUS_3130 508 1335 CDS product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_3130 1821 1573 gene locus_tag LOCUS_3140 1821 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 1895 2827 gene locus_tag LOCUS_3150 1895 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 2808 3452 gene locus_tag LOCUS_3160 2808 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 3502 5001 gene locus_tag LOCUS_3170 gene nusA 3502 5001 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 protein_id gnl|my_center|LOCUS_3170 5017 7041 gene locus_tag LOCUS_3180 gene infB 5017 7041 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS0 protein_id gnl|my_center|LOCUS_3180 7043 7387 gene locus_tag LOCUS_3190 7043 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 7393 8109 gene locus_tag LOCUS_3200 7393 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 8140 8394 gene locus_tag LOCUS_3210 gene rpsO 8140 8394 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66594 protein_id gnl|my_center|LOCUS_3210 >Feature sequence022 392 820 gene locus_tag LOCUS_3220 392 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 1017 2189 gene locus_tag LOCUS_3230 1017 2189 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085330.1 protein_id gnl|my_center|LOCUS_3230 2182 2628 gene locus_tag LOCUS_3240 2182 2628 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082795.1 protein_id gnl|my_center|LOCUS_3240 2637 3029 gene locus_tag LOCUS_3250 2637 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3250 3633 3022 gene locus_tag LOCUS_3260 3633 3022 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_310491.1 protein_id gnl|my_center|LOCUS_3260 3690 4418 gene locus_tag LOCUS_3270 3690 4418 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 protein_id gnl|my_center|LOCUS_3270 4429 4689 gene locus_tag LOCUS_3280 gene grxC 4429 4689 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024391.1 protein_id gnl|my_center|LOCUS_3280 4686 5375 gene locus_tag LOCUS_3290 4686 5375 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022397.1 protein_id gnl|my_center|LOCUS_3290 7569 5368 gene locus_tag LOCUS_3300 gene ndh 7569 5368 CDS product bifunctional NADH dehydrogenase FAD-containing subunit/selenide,water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124488.1 protein_id gnl|my_center|LOCUS_3300 8153 7572 gene locus_tag LOCUS_3310 8153 7572 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_3310 >Feature sequence023 50 802 gene locus_tag LOCUS_3320 50 802 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_3320 807 1985 gene locus_tag LOCUS_3330 gene ufaM 807 1985 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 protein_id gnl|my_center|LOCUS_3330 2081 2551 gene locus_tag LOCUS_3340 2081 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096714.1 protein_id gnl|my_center|LOCUS_3340 3113 2535 gene locus_tag LOCUS_3350 3113 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529237.1 protein_id gnl|my_center|LOCUS_3350 3349 3128 gene locus_tag LOCUS_3360 gene rpmE 3349 3128 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM38 protein_id gnl|my_center|LOCUS_3360 4191 3397 gene locus_tag LOCUS_3370 4191 3397 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_3370 4765 4199 gene locus_tag LOCUS_3380 gene efp 4765 4199 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDT7 protein_id gnl|my_center|LOCUS_3380 5679 4765 gene locus_tag LOCUS_3390 gene fbaB 5679 4765 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383967.1 protein_id gnl|my_center|LOCUS_3390 6701 5682 gene locus_tag LOCUS_3400 6701 5682 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXW8 protein_id gnl|my_center|LOCUS_3400 <8379 6698 gene locus_tag LOCUS_3410 <8379 6698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MII9:transketolase >Feature sequence024 <1 870 gene locus_tag LOCUS_3420 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU19:proline--tRNA ligase 1035 826 gene locus_tag LOCUS_3430 1035 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 989 2029 gene locus_tag LOCUS_3440 989 2029 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598076.1 protein_id gnl|my_center|LOCUS_3440 2026 2670 gene locus_tag LOCUS_3450 gene lolD 2026 2670 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57383 protein_id gnl|my_center|LOCUS_3450 2664 5852 gene locus_tag LOCUS_3460 gene dnaE 2664 5852 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KN8 protein_id gnl|my_center|LOCUS_3460 5956 6675 gene locus_tag LOCUS_3470 gene rpsB 5956 6675 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TA05 protein_id gnl|my_center|LOCUS_3470 6668 7543 gene locus_tag LOCUS_3480 gene tsf 6668 7543 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66930 protein_id gnl|my_center|LOCUS_3480 7554 8255 gene locus_tag LOCUS_3490 gene pyrH 7554 8255 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R6G5 protein_id gnl|my_center|LOCUS_3490 >Feature sequence025 43 119 gene locus_tag LOCUS_t0050 43 119 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 709 146 gene locus_tag LOCUS_3500 709 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 1138 920 gene locus_tag LOCUS_3510 1138 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 1943 1254 gene locus_tag LOCUS_3520 1943 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 2512 2249 gene locus_tag LOCUS_3530 2512 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 2774 2553 gene locus_tag LOCUS_3540 2774 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 3451 2972 gene locus_tag LOCUS_3550 3451 2972 CDS product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_3550 3549 4715 gene locus_tag LOCUS_3560 gene pgk 3549 4715 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I9 protein_id gnl|my_center|LOCUS_3560 5235 4705 gene locus_tag LOCUS_3570 5235 4705 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNW8 protein_id gnl|my_center|LOCUS_3570 6055 5237 gene locus_tag LOCUS_3580 6055 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 6903 6091 gene locus_tag LOCUS_3590 gene dapF 6903 6091 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBZ4 protein_id gnl|my_center|LOCUS_3590 >Feature sequence026 1401 13 gene locus_tag LOCUS_3600 gene pepA 1401 13 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9C8 protein_id gnl|my_center|LOCUS_3600 1503 2435 gene locus_tag LOCUS_3610 1503 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 2422 3387 gene locus_tag LOCUS_3620 2422 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 3380 5539 gene locus_tag LOCUS_3630 3380 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 5520 6200 gene locus_tag LOCUS_3640 5520 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 6178 7110 gene locus_tag LOCUS_3650 6178 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 >Feature sequence027 1440 286 gene locus_tag LOCUS_3660 gene metC 1440 286 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946625.1 protein_id gnl|my_center|LOCUS_3660 2026 1430 gene locus_tag LOCUS_3670 2026 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 2142 2555 gene locus_tag LOCUS_3680 2142 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 3631 2696 gene locus_tag LOCUS_3690 3631 2696 CDS product microcin B17 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477009.1 protein_id gnl|my_center|LOCUS_3690 3797 4255 gene locus_tag LOCUS_3700 3797 4255 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_3700 4259 5146 gene locus_tag LOCUS_3710 gene rfbA 4259 5146 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2R7 protein_id gnl|my_center|LOCUS_3710 6589 5159 gene locus_tag LOCUS_3720 6589 5159 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BX4 protein_id gnl|my_center|LOCUS_3720 7642 6638 gene locus_tag LOCUS_3730 7642 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 >Feature sequence028 128 817 gene locus_tag LOCUS_3740 gene rpe 128 817 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A1H8 protein_id gnl|my_center|LOCUS_3740 810 2294 gene locus_tag LOCUS_3750 gene purH 810 2294 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3W6 protein_id gnl|my_center|LOCUS_3750 2294 2596 gene locus_tag LOCUS_3760 2294 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 2598 3158 gene locus_tag LOCUS_3770 2598 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 3199 3813 gene locus_tag LOCUS_3780 3199 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 3898 4422 gene locus_tag LOCUS_3790 3898 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 4419 5417 gene locus_tag LOCUS_3800 4419 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_3800 5459 7291 gene locus_tag LOCUS_3810 gene asnB 5459 7291 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_3810 >Feature sequence029 1055 144 gene locus_tag LOCUS_3820 1055 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 1087 1416 gene locus_tag LOCUS_3830 gene rpsF 1087 1416 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE4 protein_id gnl|my_center|LOCUS_3830 1416 1604 gene locus_tag LOCUS_3840 1416 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 1608 2066 gene locus_tag LOCUS_3850 gene rplI 1608 2066 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV51 protein_id gnl|my_center|LOCUS_3850 2106 3533 gene locus_tag LOCUS_3860 2106 3533 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD0 protein_id gnl|my_center|LOCUS_3860 3543 4310 gene locus_tag LOCUS_3870 3543 4310 CDS product putative ABC transporter permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE51 protein_id gnl|my_center|LOCUS_3870 4313 5026 gene locus_tag LOCUS_3880 4313 5026 CDS product organic solvent ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599741.1 protein_id gnl|my_center|LOCUS_3880 5031 5588 gene locus_tag LOCUS_3890 5031 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3890 5575 7056 gene locus_tag LOCUS_3900 gene purF 5575 7056 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8U0 protein_id gnl|my_center|LOCUS_3900 >Feature sequence030 3161 1674 gene locus_tag LOCUS_3910 3161 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 3314 4012 gene locus_tag LOCUS_3920 gene cysQ-2 3314 4012 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707246.1 protein_id gnl|my_center|LOCUS_3920 4992 4015 gene locus_tag LOCUS_3930 gene xerC 4992 4015 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCE0 protein_id gnl|my_center|LOCUS_3930 5030 7105 gene locus_tag LOCUS_3940 gene priA 5030 7105 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD10 protein_id gnl|my_center|LOCUS_3940 >Feature sequence031 <1 502 gene locus_tag LOCUS_3950 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389878.1:branched-chain amino acid aminotransferase 968 507 gene locus_tag LOCUS_3960 gene moaE 968 507 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191688.1 protein_id gnl|my_center|LOCUS_3960 1222 968 gene locus_tag LOCUS_3970 1222 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 1773 1219 gene locus_tag LOCUS_3980 1773 1219 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974979.1 protein_id gnl|my_center|LOCUS_3980 3571 1766 gene locus_tag LOCUS_3990 gene uvrC 3571 1766 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCX9 protein_id gnl|my_center|LOCUS_3990 3655 4764 gene locus_tag LOCUS_4000 3655 4764 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU3 protein_id gnl|my_center|LOCUS_4000 4761 6092 gene locus_tag LOCUS_4010 4761 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124371.1 protein_id gnl|my_center|LOCUS_4010 >Feature sequence032 1477 158 gene locus_tag LOCUS_4020 1477 158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_4020 3229 1478 gene locus_tag LOCUS_4030 gene pepF 3229 1478 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973304.1 protein_id gnl|my_center|LOCUS_4030 3525 3229 gene locus_tag LOCUS_4040 3525 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709340.1 protein_id gnl|my_center|LOCUS_4040 3542 5008 gene locus_tag LOCUS_4050 3542 5008 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 protein_id gnl|my_center|LOCUS_4050 6196 5000 gene locus_tag LOCUS_4060 6196 5000 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVA9 protein_id gnl|my_center|LOCUS_4060 >Feature sequence033 68 1129 gene locus_tag LOCUS_4070 68 1129 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 protein_id gnl|my_center|LOCUS_4070 2128 1118 gene locus_tag LOCUS_4080 gene mutY 2128 1118 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851465.1 protein_id gnl|my_center|LOCUS_4080 2081 2548 gene locus_tag LOCUS_4090 2081 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4090 2577 3164 gene locus_tag LOCUS_4100 2577 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 3166 5766 gene locus_tag LOCUS_4110 gene smc 3166 5766 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73ML2 protein_id gnl|my_center|LOCUS_4110 5756 5974 gene locus_tag LOCUS_4120 5756 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 >Feature sequence034 <1 544 gene locus_tag LOCUS_4130 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390323.1:Fe-S cluster assembly protein SufB 544 1287 gene locus_tag LOCUS_4140 gene sufC 544 1287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165620.1 protein_id gnl|my_center|LOCUS_4140 1287 2396 gene locus_tag LOCUS_4150 1287 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 2396 3607 gene locus_tag LOCUS_4160 2396 3607 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q815Z3 protein_id gnl|my_center|LOCUS_4160 3604 3993 gene locus_tag LOCUS_4170 3604 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 3995 4333 gene locus_tag LOCUS_4180 3995 4333 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S26 protein_id gnl|my_center|LOCUS_4180 4354 5259 gene locus_tag LOCUS_4190 4354 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 6135 5239 gene locus_tag LOCUS_4200 6135 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 >Feature sequence035 313 1281 gene locus_tag LOCUS_4210 gene mltB 313 1281 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_4210 1265 2038 gene locus_tag LOCUS_4220 1265 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4220 2007 3143 gene locus_tag LOCUS_4230 2007 3143 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_4230 3151 3759 gene locus_tag LOCUS_4240 gene tmk 3151 3759 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0I3 protein_id gnl|my_center|LOCUS_4240 3744 4541 gene locus_tag LOCUS_4250 3744 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 4531 6045 gene locus_tag LOCUS_4260 gene metG 4531 6045 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 protein_id gnl|my_center|LOCUS_4260 >Feature sequence036 <1 527 gene locus_tag LOCUS_4270 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117603.1:amino acid transporter 1668 967 gene locus_tag LOCUS_4280 1668 967 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_4280 1819 3102 gene locus_tag LOCUS_4290 1819 3102 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599197.1 protein_id gnl|my_center|LOCUS_4290 4444 3107 gene locus_tag LOCUS_4300 4444 3107 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_4300 4883 4494 gene locus_tag LOCUS_4310 4883 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 4939 5475 gene locus_tag LOCUS_4320 gene hemG 4939 5475 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070441.1 protein_id gnl|my_center|LOCUS_4320 <6336 5480 gene locus_tag LOCUS_4330 <6336 5480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZC86:oxygen-dependent coproporphyrinogen-III oxidase >Feature sequence037 367 50 gene locus_tag LOCUS_4340 gene fdx 367 50 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312579.1 protein_id gnl|my_center|LOCUS_4340 449 1474 gene locus_tag LOCUS_4350 gene ctaA 449 1474 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_4350 1505 2218 gene locus_tag LOCUS_4360 1505 2218 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_4360 2395 3723 gene locus_tag LOCUS_4370 2395 3723 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 protein_id gnl|my_center|LOCUS_4370 3707 4462 gene locus_tag LOCUS_4380 3707 4462 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975520.1 protein_id gnl|my_center|LOCUS_4380 4479 4976 gene locus_tag LOCUS_4390 gene purE 4479 4976 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ4 protein_id gnl|my_center|LOCUS_4390 4982 6004 gene locus_tag LOCUS_4400 gene purK 4982 6004 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M66 protein_id gnl|my_center|LOCUS_4400 >Feature sequence038 2490 2957 gene locus_tag LOCUS_4410 gene ssb 2490 2957 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L50 protein_id gnl|my_center|LOCUS_4410 2968 5649 gene locus_tag LOCUS_4420 gene gyrA 2968 5649 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK1 protein_id gnl|my_center|LOCUS_4420 5639 6130 gene locus_tag LOCUS_4430 gene coaD 5639 6130 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE7 protein_id gnl|my_center|LOCUS_4430 6156 6231 gene locus_tag LOCUS_t0060 6156 6231 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 20 96 gene locus_tag LOCUS_t0070 20 96 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 938 363 gene locus_tag LOCUS_4440 938 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4440 1728 964 gene locus_tag LOCUS_4450 1728 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE54 protein_id gnl|my_center|LOCUS_4450 1727 3736 gene locus_tag LOCUS_4460 1727 3736 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A836 protein_id gnl|my_center|LOCUS_4460 3733 5463 gene locus_tag LOCUS_4470 3733 5463 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008686556.1 protein_id gnl|my_center|LOCUS_4470 <6243 5456 gene locus_tag LOCUS_4480 <6243 5456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RI94:DNA ligase >Feature sequence040 105 815 gene locus_tag LOCUS_4490 105 815 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_4490 823 1110 gene locus_tag LOCUS_4500 823 1110 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087215.1 protein_id gnl|my_center|LOCUS_4500 1107 2036 gene locus_tag LOCUS_4510 gene dusA 1107 2036 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHE9 protein_id gnl|my_center|LOCUS_4510 2027 4354 gene locus_tag LOCUS_4520 2027 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 5766 4351 gene locus_tag LOCUS_4530 5766 4351 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAB7 protein_id gnl|my_center|LOCUS_4530 >Feature sequence041 214 582 gene locus_tag LOCUS_4540 214 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 1046 573 gene locus_tag LOCUS_4550 gene rppH 1046 573 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC1 protein_id gnl|my_center|LOCUS_4550 2294 1056 gene locus_tag LOCUS_4560 2294 1056 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_4560 2655 2296 gene locus_tag LOCUS_4570 gene rsfS 2655 2296 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI6 protein_id gnl|my_center|LOCUS_4570 3215 2652 gene locus_tag LOCUS_4580 gene nadD 3215 2652 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS2 protein_id gnl|my_center|LOCUS_4580 3637 3212 gene locus_tag LOCUS_4590 3637 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 4896 3634 gene locus_tag LOCUS_4600 gene proA 4896 3634 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS1 protein_id gnl|my_center|LOCUS_4600 <5874 4893 gene locus_tag LOCUS_4610 <5874 4893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UBS0:glutamate 5-kinase >Feature sequence042 2071 488 gene locus_tag LOCUS_4620 gene ftsI 2071 488 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708639.1 protein_id gnl|my_center|LOCUS_4620 2345 2052 gene locus_tag LOCUS_4630 2345 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 3250 2339 gene locus_tag LOCUS_4640 gene rsmH 3250 2339 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1T3 protein_id gnl|my_center|LOCUS_4640 3670 3254 gene locus_tag LOCUS_4650 3670 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 4574 4134 gene locus_tag LOCUS_4660 4574 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 4521 5465 gene locus_tag LOCUS_4670 gene bamD 4521 5465 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDY1 protein_id gnl|my_center|LOCUS_4670 >Feature sequence043 <1 1184 gene locus_tag LOCUS_4680 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918558.1:cobaltochelatase subunit CobT 2376 1177 gene locus_tag LOCUS_4690 gene tgt 2376 1177 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBV8 protein_id gnl|my_center|LOCUS_4690 3136 2369 gene locus_tag LOCUS_4700 3136 2369 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879601.1 protein_id gnl|my_center|LOCUS_4700 3342 3136 gene locus_tag LOCUS_4710 3342 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 4298 3477 gene locus_tag LOCUS_4720 4298 3477 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313164.1 protein_id gnl|my_center|LOCUS_4720 5338 4295 gene locus_tag LOCUS_4730 gene pyrD 5338 4295 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX27 protein_id gnl|my_center|LOCUS_4730 >Feature sequence044 261 701 gene locus_tag LOCUS_4740 gene rnhA 261 701 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH79 protein_id gnl|my_center|LOCUS_4740 1937 684 gene locus_tag LOCUS_4750 1937 684 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_4750 3285 1924 gene locus_tag LOCUS_4760 3285 1924 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314231.1 protein_id gnl|my_center|LOCUS_4760 4729 3290 gene locus_tag LOCUS_4770 4729 3290 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946880.1 protein_id gnl|my_center|LOCUS_4770 5399 4722 gene locus_tag LOCUS_4780 5399 4722 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T808 protein_id gnl|my_center|LOCUS_4780 >Feature sequence045 990 1310 gene locus_tag LOCUS_4790 990 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4790 1480 1307 gene locus_tag LOCUS_4800 1480 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4800 1555 2337 gene locus_tag LOCUS_4810 gene dapB 1555 2337 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS7 protein_id gnl|my_center|LOCUS_4810 2772 2323 gene locus_tag LOCUS_4820 2772 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 2803 3456 gene locus_tag LOCUS_4830 gene nth 2803 3456 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_4830 >Feature sequence046 2357 1449 gene locus_tag LOCUS_4840 gene miaA 2357 1449 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEB5 protein_id gnl|my_center|LOCUS_4840 3738 2350 gene locus_tag LOCUS_4850 3738 2350 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_4850 4671 3799 gene locus_tag LOCUS_4860 4671 3799 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_4860 <5497 4661 gene locus_tag LOCUS_4870 <5497 4661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390052.1:protease modulator HflK >Feature sequence047 1462 269 gene locus_tag LOCUS_4880 gene ftsA 1462 269 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q44774 protein_id gnl|my_center|LOCUS_4880 2106 1459 gene locus_tag LOCUS_4890 2106 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 2995 2096 gene locus_tag LOCUS_4900 gene ddl 2995 2096 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDS6 protein_id gnl|my_center|LOCUS_4900 3889 2996 gene locus_tag LOCUS_4910 gene murB 3889 2996 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDS7 protein_id gnl|my_center|LOCUS_4910 5246 3861 gene locus_tag LOCUS_4920 gene murC 5246 3861 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67373 protein_id gnl|my_center|LOCUS_4920 >Feature sequence048 20 1150 gene locus_tag LOCUS_4930 gene ispDF 20 1150 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PM68 protein_id gnl|my_center|LOCUS_4930 2055 1147 gene locus_tag LOCUS_4940 gene lipA 2055 1147 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TND8 protein_id gnl|my_center|LOCUS_4940 3435 2059 gene locus_tag LOCUS_4950 3435 2059 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCF1 protein_id gnl|my_center|LOCUS_4950 4736 3435 gene locus_tag LOCUS_4960 gene aceF 4736 3435 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4N2 protein_id gnl|my_center|LOCUS_4960 <5381 4740 gene locus_tag LOCUS_4970 <5381 4740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531482.1:pyruvate dehydrogenase complex E1 component subunit beta >Feature sequence049 <1 513 gene locus_tag LOCUS_4980 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AL1:UPF0234 protein 1009 503 gene locus_tag LOCUS_4990 1009 503 CDS product prolyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973263.1 protein_id gnl|my_center|LOCUS_4990 1135 2235 gene locus_tag LOCUS_5000 1135 2235 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_5000 2453 2232 gene locus_tag LOCUS_5010 2453 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 3198 2497 gene locus_tag LOCUS_5020 3198 2497 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_5020 3327 4169 gene locus_tag LOCUS_5030 3327 4169 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930002.1 protein_id gnl|my_center|LOCUS_5030 >Feature sequence050 <1 803 gene locus_tag LOCUS_5040 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545835.1:nucleoside triphosphate pyrophosphohydrolase 785 2050 gene locus_tag LOCUS_5050 785 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5050 2050 2946 gene locus_tag LOCUS_5060 2050 2946 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_5060 3035 4198 gene locus_tag LOCUS_5070 gene argD 3035 4198 CDS product acetylornithine/succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57600 protein_id gnl|my_center|LOCUS_5070 5030 4179 gene locus_tag LOCUS_5080 gene argB 5030 4179 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ8 protein_id gnl|my_center|LOCUS_5080 >Feature sequence051 1060 785 gene locus_tag LOCUS_5090 1060 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 1071 1826 gene locus_tag LOCUS_5100 1071 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5100 1816 2709 gene locus_tag LOCUS_5110 gene rpoH1 1816 2709 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9T3 protein_id gnl|my_center|LOCUS_5110 3964 2711 gene locus_tag LOCUS_5120 gene purA 3964 2711 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN24 protein_id gnl|my_center|LOCUS_5120 4665 3964 gene locus_tag LOCUS_5130 4665 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 <5280 4655 gene locus_tag LOCUS_5140 <5280 4655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I7E5:phosphoglucosamine mutase >Feature sequence052 <1 507 gene locus_tag LOCUS_5150 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E317:pyridoxine 5'-phosphate synthase 504 872 gene locus_tag LOCUS_5160 gene acpS 504 872 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57344 protein_id gnl|my_center|LOCUS_5160 859 1605 gene locus_tag LOCUS_5170 859 1605 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8S3 protein_id gnl|my_center|LOCUS_5170 1610 2260 gene locus_tag LOCUS_5180 gene rnc 1610 2260 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 protein_id gnl|my_center|LOCUS_5180 2253 2888 gene locus_tag LOCUS_5190 2253 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 2872 3306 gene locus_tag LOCUS_5200 gene rpiB 2872 3306 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853308.1 protein_id gnl|my_center|LOCUS_5200 3303 4583 gene locus_tag LOCUS_5210 gene glyA2 3303 4583 CDS product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I03 protein_id gnl|my_center|LOCUS_5210 4589 5047 gene locus_tag LOCUS_5220 gene nrdR 4589 5047 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 protein_id gnl|my_center|LOCUS_5220 >Feature sequence053 1778 1152 gene locus_tag LOCUS_5230 gene hisG 1778 1152 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C67 protein_id gnl|my_center|LOCUS_5230 3033 1771 gene locus_tag LOCUS_5240 gene murA 3033 1771 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PP65 protein_id gnl|my_center|LOCUS_5240 3180 3641 gene locus_tag LOCUS_5250 3180 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 4830 3718 gene locus_tag LOCUS_5260 gene kynU 4830 3718 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074059.1 protein_id gnl|my_center|LOCUS_5260 >Feature sequence054 8 1048 gene locus_tag LOCUS_5270 8 1048 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267571.1 protein_id gnl|my_center|LOCUS_5270 1048 1281 gene locus_tag LOCUS_5280 1048 1281 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW8 protein_id gnl|my_center|LOCUS_5280 1285 1683 gene locus_tag LOCUS_5290 1285 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 2288 1680 gene locus_tag LOCUS_5300 2288 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 2887 2291 gene locus_tag LOCUS_5310 2887 2291 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_5310 2956 3414 gene locus_tag LOCUS_5320 2956 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_5320 3424 4617 gene locus_tag LOCUS_5330 gene argG 3424 4617 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV0 protein_id gnl|my_center|LOCUS_5330 >Feature sequence055 942 463 gene locus_tag LOCUS_5340 942 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 1180 2391 gene locus_tag LOCUS_5350 gene icd 1180 2391 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD89 protein_id gnl|my_center|LOCUS_5350 4784 2388 gene locus_tag LOCUS_5360 gene alaS 4784 2388 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE87 protein_id gnl|my_center|LOCUS_5360 >Feature sequence056 1826 1485 gene locus_tag LOCUS_5370 1826 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 2315 1887 gene locus_tag LOCUS_5380 gene ribH1 2315 1887 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZV0 protein_id gnl|my_center|LOCUS_5380 3393 2305 gene locus_tag LOCUS_5390 gene ribBA 3393 2305 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZU9 protein_id gnl|my_center|LOCUS_5390 3972 3397 gene locus_tag LOCUS_5400 3972 3397 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_5400 <4804 3972 gene locus_tag LOCUS_5410 <4804 3972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q186Q7:riboflavin biosynthesis protein RibD >Feature sequence057 228 731 gene locus_tag LOCUS_5420 gene nuoB 228 731 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU39 protein_id gnl|my_center|LOCUS_5420 735 1328 gene locus_tag LOCUS_5430 gene nuoC 735 1328 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU38 protein_id gnl|my_center|LOCUS_5430 1333 2508 gene locus_tag LOCUS_5440 gene nuoD 1333 2508 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDH4 protein_id gnl|my_center|LOCUS_5440 2505 3095 gene locus_tag LOCUS_5450 gene nuoE 2505 3095 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDH5 protein_id gnl|my_center|LOCUS_5450 3085 4347 gene locus_tag LOCUS_5460 3085 4347 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_5460 >Feature sequence058 1009 275 gene locus_tag LOCUS_5470 1009 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 2224 1010 gene locus_tag LOCUS_5480 2224 1010 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 protein_id gnl|my_center|LOCUS_5480 2269 2922 gene locus_tag LOCUS_5490 gene ubiG 2269 2922 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820B5 protein_id gnl|my_center|LOCUS_5490 3344 2919 gene locus_tag LOCUS_5500 3344 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810190.1 protein_id gnl|my_center|LOCUS_5500 4184 3348 gene locus_tag LOCUS_5510 4184 3348 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_5510 4498 4184 gene locus_tag LOCUS_5520 4498 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 >Feature sequence059 1043 318 gene locus_tag LOCUS_5530 1043 318 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DJ3 protein_id gnl|my_center|LOCUS_5530 2052 1036 gene locus_tag LOCUS_5540 2052 1036 CDS product succinate dehydrogenase [ubiquinone] iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599715.1 protein_id gnl|my_center|LOCUS_5540 2807 2031 gene locus_tag LOCUS_5550 gene lgt 2807 2031 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SA1 protein_id gnl|my_center|LOCUS_5550 2749 2976 gene locus_tag LOCUS_5560 2749 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 3046 3507 gene locus_tag LOCUS_5570 3046 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 3494 4267 gene locus_tag LOCUS_5580 3494 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 >Feature sequence060 56 1624 gene locus_tag LOCUS_5590 gene leuA 56 1624 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67862 protein_id gnl|my_center|LOCUS_5590 1624 2679 gene locus_tag LOCUS_5600 1624 2679 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 protein_id gnl|my_center|LOCUS_5600 2672 3433 gene locus_tag LOCUS_5610 2672 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 >Feature sequence061 792 460 gene locus_tag LOCUS_5620 gene qacF 792 460 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_5620 2857 800 gene locus_tag LOCUS_5630 2857 800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_5630 3911 2871 gene locus_tag LOCUS_5640 3911 2871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_5640 4683 4000 gene locus_tag LOCUS_5650 4683 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 >Feature sequence062 295 654 gene locus_tag LOCUS_5660 295 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5660 659 937 gene locus_tag LOCUS_5670 659 937 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528325.1 protein_id gnl|my_center|LOCUS_5670 934 1872 gene locus_tag LOCUS_5680 gene attM 934 1872 CDS product N-acyl homoserine lactonase AttM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3U0 protein_id gnl|my_center|LOCUS_5680 1946 2755 gene locus_tag LOCUS_5690 1946 2755 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881313.1 protein_id gnl|my_center|LOCUS_5690 2809 3450 gene locus_tag LOCUS_5700 2809 3450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 protein_id gnl|my_center|LOCUS_5700 3447 4115 gene locus_tag LOCUS_5710 3447 4115 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590982.1 protein_id gnl|my_center|LOCUS_5710 4106 4555 gene locus_tag LOCUS_5720 4106 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 >Feature sequence063 899 279 gene locus_tag LOCUS_5730 gene gpmA 899 279 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T25 protein_id gnl|my_center|LOCUS_5730 928 2316 gene locus_tag LOCUS_5740 gene fumC1 928 2316 CDS product fumarate hydratase class II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28894 protein_id gnl|my_center|LOCUS_5740 3180 2323 gene locus_tag LOCUS_5750 gene lpxC 3180 2323 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SF9 protein_id gnl|my_center|LOCUS_5750 <4680 3252 gene locus_tag LOCUS_5760 <4680 3252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVV0:cell division protein FtsZ >Feature sequence064 2207 1497 gene locus_tag LOCUS_5770 2207 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 2206 3825 gene locus_tag LOCUS_5780 2206 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 3815 4435 gene locus_tag LOCUS_5790 3815 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 >Feature sequence065 2085 1216 gene locus_tag LOCUS_5800 2085 1216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_5800 3142 2087 gene locus_tag LOCUS_5810 3142 2087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_5810 <4535 3135 gene locus_tag LOCUS_5820 <4535 3135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088896.1:ABC transporter ATP-binding protein >Feature sequence066 1102 20 gene locus_tag LOCUS_5830 1102 20 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 protein_id gnl|my_center|LOCUS_5830 2066 1092 gene locus_tag LOCUS_5840 2066 1092 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_5840 2120 2776 gene locus_tag LOCUS_5850 2120 2776 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771848.1 protein_id gnl|my_center|LOCUS_5850 2778 3821 gene locus_tag LOCUS_5860 2778 3821 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090704.1 protein_id gnl|my_center|LOCUS_5860 3927 4466 gene locus_tag LOCUS_5870 3927 4466 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088168.1 protein_id gnl|my_center|LOCUS_5870 >Feature sequence067 <1 940 gene locus_tag LOCUS_5880 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972663.1:membrane protein 1376 927 gene locus_tag LOCUS_5890 1376 927 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729045.1 protein_id gnl|my_center|LOCUS_5890 1418 1696 gene locus_tag LOCUS_5900 1418 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 1747 2166 gene locus_tag LOCUS_5910 gene umuD 1747 2166 CDS product umuD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940167.1 protein_id gnl|my_center|LOCUS_5910 2170 3444 gene locus_tag LOCUS_5920 2170 3444 CDS product SOS mutagenesis and repair UmuC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947430.1 protein_id gnl|my_center|LOCUS_5920 4372 3455 gene locus_tag LOCUS_5930 4372 3455 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_5930 4456 4382 gene locus_tag LOCUS_t0080 4456 4382 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence068 <1 750 gene locus_tag LOCUS_5940 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006312773.1:cysteine synthase A 1503 853 gene locus_tag LOCUS_5950 1503 853 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD08 protein_id gnl|my_center|LOCUS_5950 1706 3352 gene locus_tag LOCUS_5960 1706 3352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810841.1 protein_id gnl|my_center|LOCUS_5960 3750 3388 gene locus_tag LOCUS_5970 3750 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 >Feature sequence069 565 1965 gene locus_tag LOCUS_5980 565 1965 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583060.1 protein_id gnl|my_center|LOCUS_5980 1962 2534 gene locus_tag LOCUS_5990 gene trpG 1962 2534 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_5990 2535 3518 gene locus_tag LOCUS_6000 2535 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 3515 4273 gene locus_tag LOCUS_6010 gene trpC 3515 4273 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K192 protein_id gnl|my_center|LOCUS_6010 >Feature sequence070 <1 750 gene locus_tag LOCUS_6020 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQV7:elongation factor G 754 1068 gene locus_tag LOCUS_6030 gene rpsJ 754 1068 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_6030 1071 1679 gene locus_tag LOCUS_6040 1071 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 1684 2298 gene locus_tag LOCUS_6050 gene rplD 1684 2298 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_6050 2295 2582 gene locus_tag LOCUS_6060 gene rplW 2295 2582 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5S0 protein_id gnl|my_center|LOCUS_6060 2582 3409 gene locus_tag LOCUS_6070 gene rplB 2582 3409 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D4 protein_id gnl|my_center|LOCUS_6070 3409 3687 gene locus_tag LOCUS_6080 gene rpsS 3409 3687 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG43 protein_id gnl|my_center|LOCUS_6080 3690 4034 gene locus_tag LOCUS_6090 3690 4034 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_6090 >Feature sequence071 <1 560 gene locus_tag LOCUS_6100 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU27:NADH-quinone oxidoreductase subunit N 562 1260 gene locus_tag LOCUS_6110 562 1260 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583575.1 protein_id gnl|my_center|LOCUS_6110 1257 1994 gene locus_tag LOCUS_6120 gene coaX 1257 1994 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37564 protein_id gnl|my_center|LOCUS_6120 1991 3649 gene locus_tag LOCUS_6130 1991 3649 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_6130 3691 3846 gene locus_tag LOCUS_6140 3691 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 >Feature sequence072 <1 950 gene locus_tag LOCUS_6150 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048423.1:acetyl-CoA carboxylase biotin carboxylase subunit 1301 951 gene locus_tag LOCUS_6160 1301 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 1701 1252 gene locus_tag LOCUS_6170 1701 1252 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597050.1 protein_id gnl|my_center|LOCUS_6170 2153 1698 gene locus_tag LOCUS_6180 2153 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6180 2446 2138 gene locus_tag LOCUS_6190 2446 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6190 2506 3588 gene locus_tag LOCUS_6200 2506 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 <4256 3562 gene locus_tag LOCUS_6210 <4256 3562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886312.1:phosphomannomutase >Feature sequence073 1235 2017 gene locus_tag LOCUS_6220 1235 2017 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533151.1 protein_id gnl|my_center|LOCUS_6220 2017 3525 gene locus_tag LOCUS_6230 2017 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 >Feature sequence074 63 701 gene locus_tag LOCUS_6240 gene lipB 63 701 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC91 protein_id gnl|my_center|LOCUS_6240 1494 658 gene locus_tag LOCUS_6250 gene rluC 1494 658 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166934.1 protein_id gnl|my_center|LOCUS_6250 2208 1852 gene locus_tag LOCUS_6260 gene rplQ 2208 1852 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P832 protein_id gnl|my_center|LOCUS_6260 3239 2211 gene locus_tag LOCUS_6270 gene rpoA 3239 2211 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4E3 protein_id gnl|my_center|LOCUS_6270 3666 3265 gene locus_tag LOCUS_6280 gene rpsK 3666 3265 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAJ6 protein_id gnl|my_center|LOCUS_6280 4046 3669 gene locus_tag LOCUS_6290 gene rpsM 4046 3669 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY2 protein_id gnl|my_center|LOCUS_6290 >Feature sequence075 204 431 gene locus_tag LOCUS_6300 gene xseB 204 431 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDY6 protein_id gnl|my_center|LOCUS_6300 428 1312 gene locus_tag LOCUS_6310 gene ispA 428 1312 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022464.1 protein_id gnl|my_center|LOCUS_6310 1312 3177 gene locus_tag LOCUS_6320 gene dxs 1312 3177 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RW1 protein_id gnl|my_center|LOCUS_6320 <4054 3169 gene locus_tag LOCUS_6330 <4054 3169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89RY1:chorismate synthase >Feature sequence076 897 1283 gene locus_tag LOCUS_6340 897 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 1293 1688 gene locus_tag LOCUS_6350 1293 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 2342 1695 gene locus_tag LOCUS_6360 2342 1695 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY27 protein_id gnl|my_center|LOCUS_6360 <4025 2417 gene locus_tag LOCUS_6370 <4025 2417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UE85:pyruvate carboxylase >Feature sequence077 595 1455 gene locus_tag LOCUS_6380 595 1455 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478191.1 protein_id gnl|my_center|LOCUS_6380 1452 2039 gene locus_tag LOCUS_6390 1452 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 2465 2040 gene locus_tag LOCUS_6400 2465 2040 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391066.1 protein_id gnl|my_center|LOCUS_6400 2489 3331 gene locus_tag LOCUS_6410 2489 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 3324 3608 gene locus_tag LOCUS_6420 3324 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 3798 3625 gene locus_tag LOCUS_6430 3798 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6430 >Feature sequence078 1493 264 gene locus_tag LOCUS_6440 1493 264 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_6440 1716 1477 gene locus_tag LOCUS_6450 1716 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6450 2344 1859 gene locus_tag LOCUS_6460 2344 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 3402 2344 gene locus_tag LOCUS_6470 3402 2344 CDS product His-Xaa-Ser system radical SAM maturase HxsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106270.1 protein_id gnl|my_center|LOCUS_6470 >Feature sequence079 104 997 gene locus_tag LOCUS_6480 104 997 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930839.1 protein_id gnl|my_center|LOCUS_6480 1137 2657 gene locus_tag LOCUS_6490 1137 2657 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J62 protein_id gnl|my_center|LOCUS_6490 2654 3652 gene locus_tag LOCUS_6500 2654 3652 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GI5 protein_id gnl|my_center|LOCUS_6500 >Feature sequence080 126 2669 gene locus_tag LOCUS_6510 gene mgpS 126 2669 CDS product ATP-dependent helicase MgpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003581.1 protein_id gnl|my_center|LOCUS_6510 2662 3093 gene locus_tag LOCUS_6520 2662 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 3093 3428 gene locus_tag LOCUS_6530 3093 3428 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_6530 >Feature sequence081 399 490 gene locus_tag LOCUS_t0090 399 490 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 499 1371 gene locus_tag LOCUS_6540 gene dapA 499 1371 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH76 protein_id gnl|my_center|LOCUS_6540 1377 1811 gene locus_tag LOCUS_6550 gene smpB 1377 1811 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8R6 protein_id gnl|my_center|LOCUS_6550 1858 2136 gene locus_tag LOCUS_6560 1858 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 >Feature sequence082 612 184 gene locus_tag LOCUS_6570 612 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 1247 1771 gene locus_tag LOCUS_6580 1247 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 protein_id gnl|my_center|LOCUS_6580 1768 3141 gene locus_tag LOCUS_6590 1768 3141 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_6590 <3787 3186 gene locus_tag LOCUS_6600 <3787 3186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389599.1:C4-dicarboxylate ABC transporter >Feature sequence083 <1 708 gene locus_tag LOCUS_6610 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O68460:K(+)-insensitive pyrophosphate-energized proton pump 1037 705 gene locus_tag LOCUS_6620 1037 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 1083 2096 gene locus_tag LOCUS_6630 gene plsX 1083 2096 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_6630 2086 2355 gene locus_tag LOCUS_6640 2086 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 2355 2660 gene locus_tag LOCUS_6650 2355 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 2753 3220 gene locus_tag LOCUS_6660 gene rplM 2753 3220 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7X8 protein_id gnl|my_center|LOCUS_6660 3213 3602 gene locus_tag LOCUS_6670 gene rpsI 3213 3602 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QR5 protein_id gnl|my_center|LOCUS_6670 >Feature sequence084 320 108 gene locus_tag LOCUS_6680 320 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 910 317 gene locus_tag LOCUS_6690 910 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6690 2442 1210 gene locus_tag LOCUS_6700 2442 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 2909 2448 gene locus_tag LOCUS_6710 2909 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 3000 3362 gene locus_tag LOCUS_6720 3000 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 3359 3493 gene locus_tag LOCUS_6730 3359 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6730 >Feature sequence085 1420 422 gene locus_tag LOCUS_6740 1420 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6740 <3662 1438 gene locus_tag LOCUS_6750 <3662 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A711:outer membrane protein assembly factor BamA >Feature sequence086 554 1465 gene locus_tag LOCUS_6760 554 1465 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528373.1 protein_id gnl|my_center|LOCUS_6760 1458 2276 gene locus_tag LOCUS_6770 1458 2276 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969509.1 protein_id gnl|my_center|LOCUS_6770 >Feature sequence087 902 2083 gene locus_tag LOCUS_6780 902 2083 CDS product CDP-4-keto-6-deoxy-D-glucose-3-dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_6780 2096 3151 gene locus_tag LOCUS_6790 gene gmd 2096 3151 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066186.1 protein_id gnl|my_center|LOCUS_6790 3539 3615 gene locus_tag LOCUS_t0100 3539 3615 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence088 454 2424 gene locus_tag LOCUS_6800 454 2424 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529051.1 protein_id gnl|my_center|LOCUS_6800 2562 2801 gene locus_tag LOCUS_6810 2562 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 >Feature sequence089 496 1740 gene locus_tag LOCUS_6820 496 1740 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9Q2 protein_id gnl|my_center|LOCUS_6820 1749 2510 gene locus_tag LOCUS_6830 1749 2510 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_6830 <3515 2520 gene locus_tag LOCUS_6840 <3515 2520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UBR8:ribosome-binding ATPase YchF >Feature sequence090 1465 56 gene locus_tag LOCUS_6850 1465 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 2308 1529 gene locus_tag LOCUS_6860 2308 1529 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392692.1 protein_id gnl|my_center|LOCUS_6860 3075 2470 gene locus_tag LOCUS_6870 3075 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 >Feature sequence091 127 1500 gene locus_tag LOCUS_6880 127 1500 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787585.1 protein_id gnl|my_center|LOCUS_6880 1733 1942 gene locus_tag LOCUS_6890 1733 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 2252 2611 gene locus_tag LOCUS_6900 2252 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6900 2953 2612 gene locus_tag LOCUS_6910 2953 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 >Feature sequence092 <1 1176 gene locus_tag LOCUS_6920 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MBU2:serine--tRNA ligase 2020 1163 gene locus_tag LOCUS_6930 2020 1163 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719693.1 protein_id gnl|my_center|LOCUS_6930 2001 2261 gene locus_tag LOCUS_6940 2001 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 >Feature sequence093 35 367 gene locus_tag LOCUS_6950 35 367 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391032.1 protein_id gnl|my_center|LOCUS_6950 1621 359 gene locus_tag LOCUS_6960 1621 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6960 2292 1621 gene locus_tag LOCUS_6970 2292 1621 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599468.1 protein_id gnl|my_center|LOCUS_6970 2705 2289 gene locus_tag LOCUS_6980 2705 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6980 >Feature sequence094 2984 771 gene locus_tag LOCUS_6990 gene mrcA 2984 771 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCE9 protein_id gnl|my_center|LOCUS_6990 >Feature sequence095 243 1142 gene locus_tag LOCUS_7000 243 1142 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527334.1 protein_id gnl|my_center|LOCUS_7000 1147 2181 gene locus_tag LOCUS_7010 1147 2181 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708355.1 protein_id gnl|my_center|LOCUS_7010 >Feature sequence096 1170 91 gene locus_tag LOCUS_7020 1170 91 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338501.1 protein_id gnl|my_center|LOCUS_7020 1226 1864 gene locus_tag LOCUS_7030 1226 1864 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931019.1 protein_id gnl|my_center|LOCUS_7030 2006 2182 gene locus_tag LOCUS_7040 2006 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7040 2182 2340 gene locus_tag LOCUS_7050 2182 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 3095 2478 gene locus_tag LOCUS_7060 3095 2478 CDS product leucine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705795.1 protein_id gnl|my_center|LOCUS_7060 >Feature sequence097 110 814 gene locus_tag LOCUS_7070 110 814 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 protein_id gnl|my_center|LOCUS_7070 914 1798 gene locus_tag LOCUS_7080 914 1798 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 protein_id gnl|my_center|LOCUS_7080 2238 1807 gene locus_tag LOCUS_7090 2238 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7090 3018 2239 gene locus_tag LOCUS_7100 3018 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 >Feature sequence098 1362 10 gene locus_tag LOCUS_7110 1362 10 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_7110 >Feature sequence099 2294 1539 gene locus_tag LOCUS_7120 2294 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7120 2447 2659 gene locus_tag LOCUS_7130 2447 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 >Feature sequence100 <1 1965 gene locus_tag LOCUS_7140 <1 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086164.1:flotillin family protein 1979 2368 gene locus_tag LOCUS_7150 1979 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 >Feature sequence101 <1 649 gene locus_tag LOCUS_7160 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974944.1:beta-ketoacyl-ACP reductase 723 959 gene locus_tag LOCUS_7170 gene acpP 723 959 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 protein_id gnl|my_center|LOCUS_7170 971 2215 gene locus_tag LOCUS_7180 971 2215 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC2 protein_id gnl|my_center|LOCUS_7180 2264 2884 gene locus_tag LOCUS_7190 gene gmk 2264 2884 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCH7 protein_id gnl|my_center|LOCUS_7190 >Feature sequence102 1177 44 gene locus_tag LOCUS_7200 gene dxr 1177 44 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2X6 protein_id gnl|my_center|LOCUS_7200 1632 1174 gene locus_tag LOCUS_7210 1632 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7210 2560 1895 gene locus_tag LOCUS_7220 gene uppS 2560 1895 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ5 protein_id gnl|my_center|LOCUS_7220 >Feature sequence103 1431 550 gene locus_tag LOCUS_7230 gene atpG 1431 550 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM2 protein_id gnl|my_center|LOCUS_7230 <2893 1431 gene locus_tag LOCUS_7240 <2893 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV20:ATP synthase subunit alpha >Feature sequence104 299 1186 gene locus_tag LOCUS_7250 299 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7250 >Feature sequence105 900 295 gene locus_tag LOCUS_7260 900 295 CDS product putative hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05958 protein_id gnl|my_center|LOCUS_7260 961 1161 gene locus_tag LOCUS_7270 961 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7270 1173 2564 gene locus_tag LOCUS_7280 gene argH 1173 2564 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5A3 protein_id gnl|my_center|LOCUS_7280 >Feature sequence106 <1 1034 gene locus_tag LOCUS_7290 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104922.1:glutathione-disulfide reductase 1031 2785 gene locus_tag LOCUS_7300 gene ggt 1031 2785 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085656.1 protein_id gnl|my_center|LOCUS_7300 >Feature sequence107 156 491 gene locus_tag LOCUS_7310 156 491 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7H3 protein_id gnl|my_center|LOCUS_7310 494 1684 gene locus_tag LOCUS_7320 494 1684 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN4 protein_id gnl|my_center|LOCUS_7320 1730 2779 gene locus_tag LOCUS_7330 1730 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404941.1 protein_id gnl|my_center|LOCUS_7330 >Feature sequence108 893 51 gene locus_tag LOCUS_7340 893 51 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532775.1 protein_id gnl|my_center|LOCUS_7340 1440 907 gene locus_tag LOCUS_7350 gene ctaG 1440 907 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBS6 protein_id gnl|my_center|LOCUS_7350 2477 1548 gene locus_tag LOCUS_7360 gene ctaB 2477 1548 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJX3 protein_id gnl|my_center|LOCUS_7360 >Feature sequence109 238 29 gene locus_tag LOCUS_7370 238 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7370 1451 270 gene locus_tag LOCUS_7380 1451 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919352.1 protein_id gnl|my_center|LOCUS_7380 1870 1580 gene locus_tag LOCUS_7390 1870 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083510.1 protein_id gnl|my_center|LOCUS_7390 2066 2539 gene locus_tag LOCUS_7400 2066 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 >Feature sequence110 1006 68 gene locus_tag LOCUS_7410 1006 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7410 1224 1006 gene locus_tag LOCUS_7420 1224 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7420 1357 2502 gene locus_tag LOCUS_7430 1357 2502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_7430 >Feature sequence111 3 164 gene locus_tag LOCUS_7440 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 1083 172 gene locus_tag LOCUS_7450 1083 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7450 2475 1753 gene locus_tag LOCUS_7460 2475 1753 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_7460 >Feature sequence112 <1 541 gene locus_tag LOCUS_7470 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886326.1:penicillin-binding protein 2 534 1637 gene locus_tag LOCUS_7480 534 1637 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886254.1 protein_id gnl|my_center|LOCUS_7480 1634 1984 gene locus_tag LOCUS_7490 1634 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7490 1981 2367 gene locus_tag LOCUS_7500 1981 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7500 >Feature sequence113 846 415 gene locus_tag LOCUS_7510 846 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7510 1737 883 gene locus_tag LOCUS_7520 gene hemK 1737 883 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Y4 protein_id gnl|my_center|LOCUS_7520 <2729 1727 gene locus_tag LOCUS_7530 <2729 1727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8U8B8:peptide chain release factor 1 >Feature sequence114 56 1303 gene locus_tag LOCUS_7540 56 1303 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_7540 1300 2628 gene locus_tag LOCUS_7550 gene trkA 1300 2628 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_7550 >Feature sequence115 <1 1646 gene locus_tag LOCUS_7560 <1 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387909.1:GTP-binding protein 1708 2136 gene locus_tag LOCUS_7570 1708 2136 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 protein_id gnl|my_center|LOCUS_7570 2670 2149 gene locus_tag LOCUS_7580 2670 2149 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_7580 >Feature sequence116 <1 1938 gene locus_tag LOCUS_7590 <1 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085105.1:formate dehydrogenase subunit alpha 2557 1940 gene locus_tag LOCUS_7600 2557 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7600 >Feature sequence117 <1 580 gene locus_tag LOCUS_7610 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P57313:UDP-N-acetylmuramoylalanine--D-glutamate ligase 707 564 gene locus_tag LOCUS_7620 707 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7620 1186 1671 gene locus_tag LOCUS_7630 1186 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7630 1649 2329 gene locus_tag LOCUS_7640 1649 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7640 >Feature sequence118 677 192 gene locus_tag LOCUS_7650 677 192 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531007.1 protein_id gnl|my_center|LOCUS_7650 691 1206 gene locus_tag LOCUS_7660 gene def 691 1206 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5I4 protein_id gnl|my_center|LOCUS_7660 1199 2128 gene locus_tag LOCUS_7670 gene fmt 1199 2128 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP0 protein_id gnl|my_center|LOCUS_7670 >Feature sequence119 1688 591 gene locus_tag LOCUS_7680 1688 591 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_7680 <2593 1678 gene locus_tag LOCUS_7690 <2593 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957744.1:aminotransferase DegT >Feature sequence120 109 2163 gene locus_tag LOCUS_7700 109 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7700 >Feature sequence121 <1 1353 gene locus_tag LOCUS_7710 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18B72:DNA repair protein RecN >Feature sequence122 779 39 gene locus_tag LOCUS_7720 779 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 1004 789 gene locus_tag LOCUS_7730 1004 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7730 1197 1027 gene locus_tag LOCUS_7740 1197 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7740 <2511 1219 gene locus_tag LOCUS_7750 <2511 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896012.1:ammonium transporter >Feature sequence123 <1 1290 gene locus_tag LOCUS_7760 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J273:phosphoribosylformylglycinamidine synthase subunit PurL 1295 1525 gene locus_tag LOCUS_7770 1295 1525 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_7770 1527 1868 gene locus_tag LOCUS_7780 1527 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7780 <2495 1933 gene locus_tag LOCUS_7790 <2495 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J446:30S ribosomal protein S4 >Feature sequence124 143 1534 gene locus_tag LOCUS_7800 143 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7800 1656 2354 gene locus_tag LOCUS_7810 1656 2354 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_7810 >Feature sequence125 800 477 gene locus_tag LOCUS_7820 800 477 CDS product nucleoid-associated protein, YbaB/EbfC family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_7820 2418 793 gene locus_tag LOCUS_7830 2418 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7830 >Feature sequence126 211 1338 gene locus_tag LOCUS_7840 211 1338 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388442.1 protein_id gnl|my_center|LOCUS_7840 >Feature sequence127 <1 858 gene locus_tag LOCUS_7850 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YIE4:homoserine dehydrogenase 851 1807 gene locus_tag LOCUS_7860 gene gplX 851 1807 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEJ8 protein_id gnl|my_center|LOCUS_7860 >Feature sequence128 1741 698 gene locus_tag LOCUS_7870 gene hisC 1741 698 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PII2 protein_id gnl|my_center|LOCUS_7870 >Feature sequence129 1692 742 gene locus_tag LOCUS_7880 gene ispH1 1692 742 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU5 protein_id gnl|my_center|LOCUS_7880 1721 2212 gene locus_tag LOCUS_7890 1721 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7890 >Feature sequence130 <1 884 gene locus_tag LOCUS_7900 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWE4:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 896 2137 gene locus_tag LOCUS_7910 gene hisS 896 2137 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_7910 >Feature sequence131 542 949 gene locus_tag LOCUS_7920 542 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7920 <2247 1233 gene locus_tag LOCUS_7930 <2247 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056400.1:deoxyribodipyrimidine photo-lyase >Feature sequence132 1842 1060 gene locus_tag LOCUS_7940 1842 1060 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385185.1 protein_id gnl|my_center|LOCUS_7940 >Feature sequence133 1334 78 gene locus_tag LOCUS_7950 gene der 1334 78 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9R9 protein_id gnl|my_center|LOCUS_7950 >Feature sequence134 <2172 1298 gene locus_tag LOCUS_7960 <2172 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113857.1:ABC transporter ATP-binding protein >Feature sequence135 1981 743 gene locus_tag LOCUS_7970 gene gltX1 1981 743 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96551 protein_id gnl|my_center|LOCUS_7970 >Feature sequence136 <1 1695 gene locus_tag LOCUS_7980 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU43:Lon protease 1765 2046 gene locus_tag LOCUS_7990 gene hupA 1765 2046 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043907.1 protein_id gnl|my_center|LOCUS_7990 >Feature sequence137 <2071 1119 gene locus_tag LOCUS_8000 <2071 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UED8:acetyl-coenzyme A synthetase >Feature sequence138 78 1103 gene locus_tag LOCUS_8010 78 1103 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597722.1 protein_id gnl|my_center|LOCUS_8010 1888 1100 gene locus_tag LOCUS_8020 gene panB 1888 1100 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UA91 protein_id gnl|my_center|LOCUS_8020 >Feature sequence139 616 1161 gene locus_tag LOCUS_8030 616 1161 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_8030 1149 1634 gene locus_tag LOCUS_8040 1149 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8040 >Feature sequence140 1196 315 gene locus_tag LOCUS_8050 gene hmt-1 1196 315 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206015.1 protein_id gnl|my_center|LOCUS_8050 1359 1434 gene locus_tag LOCUS_t0110 1359 1434 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence141 1806 733 gene locus_tag LOCUS_8060 gene mraY 1806 733 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCW0 protein_id gnl|my_center|LOCUS_8060 >Feature sequence142 <1 796 gene locus_tag LOCUS_8070 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPG0:aspartate carbamoyltransferase 807 1394 gene locus_tag LOCUS_8080 gene plsY 807 1394 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFU1 protein_id gnl|my_center|LOCUS_8080 >Feature sequence143 136 1464 gene locus_tag LOCUS_8090 gene secY 136 1464 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME4 protein_id gnl|my_center|LOCUS_8090 >Feature sequence144 <1 589 gene locus_tag LOCUS_8100 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92N73:ribose-phosphate pyrophosphokinase 619 1260 gene locus_tag LOCUS_8110 gene rplY 619 1260 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 protein_id gnl|my_center|LOCUS_8110 1279 1827 gene locus_tag LOCUS_8120 gene pth 1279 1827 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCV4 protein_id gnl|my_center|LOCUS_8120 >Feature sequence145 401 126 gene locus_tag LOCUS_8130 401 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8130 596 919 gene locus_tag LOCUS_8140 596 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8140 922 1434 gene locus_tag LOCUS_8150 922 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8150 >Feature sequence146 <1852 781 gene locus_tag LOCUS_8160 <1852 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8H444:ATP-dependent zinc metalloprotease FtsH >Feature sequence147 1605 985 gene locus_tag LOCUS_8170 1605 985 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919410.1 protein_id gnl|my_center|LOCUS_8170 >Feature sequence148 >Feature sequence149 159 1139 gene locus_tag LOCUS_8180 159 1139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967034.1 protein_id gnl|my_center|LOCUS_8180 >Feature sequence150 332 1600 gene locus_tag LOCUS_8190 332 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8190 >Feature sequence151 >Feature sequence152 <1681 733 gene locus_tag LOCUS_8200 <1681 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000683574.1:adenosine kinase >Feature sequence153 816 40 gene locus_tag LOCUS_8210 gene fabI 816 40 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJX9 protein_id gnl|my_center|LOCUS_8210 <1679 809 gene locus_tag LOCUS_8220 <1679 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406135.1:beta-ketoacyl-[acyl-carrier-protein] synthase I >Feature sequence154 614 42 gene locus_tag LOCUS_8230 614 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8230 <1673 601 gene locus_tag LOCUS_8240 <1673 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YL42:diaminopimelate decarboxylase >Feature sequence155 399 1271 gene locus_tag LOCUS_8250 399 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_8250 >Feature sequence156 >Feature sequence157 76 546 gene locus_tag LOCUS_8260 76 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8260 1106 552 gene locus_tag LOCUS_8270 1106 552 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140078.1 protein_id gnl|my_center|LOCUS_8270 >Feature sequence158 430 987 gene locus_tag LOCUS_8280 430 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8280 1491 1039 gene locus_tag LOCUS_8290 1491 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8290 >Feature sequence159 <1574 1073 gene locus_tag LOCUS_8300 <1574 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_002345596.1:thiamine transporter substrate binding subunit >Feature sequence160 111 1238 gene locus_tag LOCUS_8310 gene rng 111 1238 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438072.1 protein_id gnl|my_center|LOCUS_8310 1319 1245 gene locus_tag LOCUS_t0120 1319 1245 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence161 1476 175 gene locus_tag LOCUS_8320 1476 175 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSV0 protein_id gnl|my_center|LOCUS_8320 >Feature sequence162 >Feature sequence163 <1 1189 gene locus_tag LOCUS_8330 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004599075.1:single-stranded-DNA-specific exonuclease RecJ 1232 1306 gene locus_tag LOCUS_t0130 1232 1306 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence164 157 759 gene locus_tag LOCUS_8340 gene ccmA 157 759 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC12 protein_id gnl|my_center|LOCUS_8340 1267 995 gene locus_tag LOCUS_8350 1267 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8350 >Feature sequence165 404 631 gene locus_tag LOCUS_8360 404 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8360 636 1097 gene locus_tag LOCUS_8370 636 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8370 >Feature sequence166 <1 630 gene locus_tag LOCUS_8380 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0W2:glutamate dehydrogenase 653 729 gene locus_tag LOCUS_t0140 653 729 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 789 1097 gene locus_tag LOCUS_8390 789 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8390 >Feature sequence167 <1 1421 gene locus_tag LOCUS_8400 <1 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972394.1:acetolactate synthase >Feature sequence168 490 1194 gene locus_tag LOCUS_8410 gene thiQ 490 1194 CDS product thiamine import ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGM1 protein_id gnl|my_center|LOCUS_8410 >Feature sequence169 870 364 gene locus_tag LOCUS_8420 870 364 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085338.1 protein_id gnl|my_center|LOCUS_8420 >Feature sequence170 1239 445 gene locus_tag LOCUS_8430 1239 445 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_8430 >Feature sequence171 >Feature sequence172 <1 743 gene locus_tag LOCUS_8440 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TKS9:ornithine carbamoyltransferase, catabolic 728 1204 gene locus_tag LOCUS_8450 728 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8450 >Feature sequence173 >Feature sequence174 159 290 gene locus_tag LOCUS_8460 159 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8460 280 408 gene locus_tag LOCUS_8470 280 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8470 437 814 gene locus_tag LOCUS_8480 437 814 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084974.1 protein_id gnl|my_center|LOCUS_8480 930 1088 gene locus_tag LOCUS_8490 930 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707700.1 protein_id gnl|my_center|LOCUS_8490 1334 1164 gene locus_tag LOCUS_8500 1334 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8500 >Feature sequence175 >Feature sequence176 1228 464 gene locus_tag LOCUS_8510 gene lpxA 1228 464 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH5 protein_id gnl|my_center|LOCUS_8510 >Feature sequence177 1040 414 gene locus_tag LOCUS_8520 1040 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8520 >Feature sequence178 434 732 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tggagataagtatgttggagaat >Feature sequence179 685 119 gene locus_tag LOCUS_8530 685 119 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463452.1 protein_id gnl|my_center|LOCUS_8530 1195 1001 gene locus_tag LOCUS_8540 1195 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8540 >Feature sequence180 <1214 467 gene locus_tag LOCUS_8550 <1214 467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963565.1:lycopene cyclase >Feature sequence181 >Feature sequence182 <1 774 gene locus_tag LOCUS_8560 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TC20:ferredoxin--NADP reductase >Feature sequence183 <1 665 gene locus_tag LOCUS_8570 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870400.1:molybdopterin biosynthesis protein >Feature sequence184 644 3 gene locus_tag LOCUS_8580 644 3 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_8580 >Feature sequence185 174 635 gene locus_tag LOCUS_8590 174 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8590 902 669 gene locus_tag LOCUS_8600 902 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8600 >Feature sequence186 <1062 108 gene locus_tag LOCUS_8610 <1062 108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y707:D-3-phosphoglycerate dehydrogenase >Feature sequence187 >Feature sequence188 <1035 312 gene locus_tag LOCUS_8620 <1035 312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389652.1:nucleoside recognition protein >Feature sequence189