COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..986681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1125 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118365.1:cation:proton antiporter locus_tag LOCUS_00010 CDS 1136..1426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1410..3125 product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3259..3894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(3884..4477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 4376..4651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 4716..7079 product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 7107..7901 product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7973..8938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(9058..9864) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(9870..10808) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 10960..11487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 11523..12092 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CRJ8 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene sigW CDS 12092..12532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 12529..12987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(13071..14771) product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(14749..15414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(15576..16295) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203732.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 16476..16889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098697.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 16893..17507 product carbon-phosphorus lyase subunit PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969861.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene phnH CDS 17512..18630 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene phnI CDS 18641..19588 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ4 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene phnJ CDS 19585..20373 product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091781.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 20373..21089 product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene phnL CDS 21086..22243 product phosphonate metabolism protein PhnM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061593.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 22280..22894 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(22932..23489) product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene phnN CDS 23697..24728 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(24784..25761) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2A2 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene argC CDS 26211..29087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(29243..30274) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(30271..31011) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 30913..31143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 31146..31919 product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU90 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 31968..33362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939950.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 33367..34863 product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEI1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(34930..35328) product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(35447..37273) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 37549..37908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 38011..38466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(38477..39490) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 39645..40370 product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083209.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 40367..41002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 41007..41798 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene paaG CDS 41813..42160 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPS6 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(42157..43374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(44064..45017) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(45093..45506) product peptide methionine sulfoxide reductase MsrB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RA4 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene msrB1 CDS complement(45567..46781) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(46864..47616) product CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084110.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(47621..48436) product CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene gctA CDS 48611..50215 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 50665..52011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 52024..53214 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(53283..53855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 54003..56426 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085293.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(56432..57664) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(57749..58564) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(58564..59466) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528517.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(59472..60551) product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDP2 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(60653..61723) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(61913..63211) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(63229..64332) product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980451.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 64508..66031 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 66035..67660 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 tRNA 67817..67908 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(68170..68547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 68893..69660 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(69713..70201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 70450..71157 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 71166..72524 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947166.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene cpxA CDS complement(72615..74300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(74336..74944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(75217..75798) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086652.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 75929..77143 product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene mexE1 CDS 77195..80389 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(80456..81160) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 81306..81596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816969.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 81599..82777 product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(82860..83873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(84121..85014) product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 85264..87342 product trifolitoxin synthesis, TfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(87368..88033) product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(88035..88736) product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(88733..89467) product glutamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(89566..90402) product polar amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 90844..92295 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(92406..92774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 note possible pseudo, frameshifted CDS complement(92813..93232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 note possible pseudo, frameshifted CDS complement(93300..94073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(94210..94893) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene bioH CDS complement(95088..96083) product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066596.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(96125..97234) product nitrate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(97231..98115) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(98102..98959) product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(99036..100490) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene dht CDS complement(100511..101761) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 102065..102700 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(102855..104159) product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(104180..105520) product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 105678..106496 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(106570..107133) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084296.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(107120..108775) product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene cysI CDS complement(108780..109085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(109098..110513) product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene cysG CDS 110716..111165 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090847.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 111420..112526 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 112603..113661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 113685..116348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 116557..117387 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456614.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 117384..118466 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 118567..119853 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 119925..120806 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 120803..121633 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(121636..123078) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(123140..123406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(123673..124110) product UPF0178 protein R01393 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QD8 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 124203..125438 product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC36 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene mct CDS 125447..126697 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M98 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene kynU CDS complement(126694..127377) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 127449..127775 product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 127789..128136 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 128269..129483 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 129560..131176 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(131186..132382) product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 132619..134982 product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 135027..135614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(135670..136818) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 137255..138136 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(138203..138673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(138832..140298) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K31 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene gatB CDS complement(140300..141784) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH4 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene gatA CDS complement(141784..142071) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J460 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene gatC CDS 142200..142625 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 142675..143640 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 143637..144083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(144138..145187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 145823..146116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(146530..147975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(148043..148534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(148617..149120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(149290..149502) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(149521..149940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(150064..150942) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086106.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(151053..151820) product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWM6 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(151901..154576) product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(154686..155279) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 156022..156228 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494703.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene cspA CDS 156658..157752 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 157827..158552 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(158590..159363) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 159694..161778 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(161824..162789) product putative ABC transporter substrate-binding lipoprotein YhfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SP94 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene yhfQ CDS complement(162786..163850) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(163847..164815) product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(164857..165645) product iron-dicitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832050.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 165814..167118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 167262..167567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(167704..168123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(168201..168710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(168762..169193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(169197..169970) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(169960..170748) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 170818..171534 product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF6 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene sfsA CDS 171642..172460 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF8 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene map CDS 172549..173241 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 173317..173934 product threonine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(173949..175166) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(175163..176473) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947610.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 176725..179244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(179241..179516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(179678..179923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(179954..180625) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(180625..181734) product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VT4 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene mtnA CDS 181889..183187 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCK6 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(183265..183591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 183861..184544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 184549..185268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 185316..186725 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 186937..188745 product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TI9 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene thiC CDS complement(188832..190334) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 190638..191402 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI0 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene purC CDS 191444..191686 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene purS CDS 191696..192163 product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(192160..192723) product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9L6 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene yebN CDS complement(192963..194348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 194589..195278 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IB6 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene purQ CDS 195275..197485 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI3 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene purL CDS 197531..197764 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 197822..198169 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI6 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(198320..198700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(198966..199892) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 200121..201515 product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 201551..202576 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(202652..203245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 203346..203843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(203898..204494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(204743..205366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(205489..205875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(205985..208099) product PTS lactose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814145.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(208389..209108) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(209205..211112) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DY5 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene ftsH-1 CDS complement(211213..212328) product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene luxA2 CDS complement(212408..213616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(213762..215630) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK13 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene ilvD CDS 216015..217922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 217932..218870 product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 218909..220183 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 220185..220577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 221087..221443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 221630..222160 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 222150..222731 product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 222840..224648 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6P3 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene ade CDS complement(224739..224942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(225097..227778) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 228240..230171 product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 230175..231017 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 231044..232003 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 232009..233082 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 233189..234517 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 234570..235409 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 235449..236687 product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(236756..238417) product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37967 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene pnbA CDS 238800..240002 product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 240041..240949 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970855.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 241014..241571 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT82 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(241581..241922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 242103..242495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(242528..243169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(243300..244085) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(244132..245322) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 245502..246197 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 246319..247314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 247322..247810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 247832..249337 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 249402..250508 product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 250903..251817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 251873..253990 product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 tRNA complement(254090..254165) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 254385..254663 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 254677..255009 product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH5 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 255024..255920 product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene folD CDS complement(255931..256218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 256328..257023 product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967675.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene nnrU CDS complement(257042..257269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(257441..258367) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PG0 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene psuG CDS complement(258482..259693) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAJ3 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene argG CDS 259913..260452 product peptide methionine sulfoxide reductase MsrA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJI2 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene msrA2 CDS 260813..263896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 264166..265845 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(265923..266537) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ0 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene rpsD CDS complement(266560..266748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 266795..267520 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087355.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(267536..268312) product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene trmJ CDS complement(268316..269929) product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 270176..270775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(270786..272180) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene cysS CDS complement(272331..273680) product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK3 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene gltX1 CDS complement(273677..275371) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene nadE CDS complement(275431..275754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 275903..276190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 276443..277384 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 277381..278289 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene oppC CDS 278366..279955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 280101..280664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(280710..282101) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(282311..283033) product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(283041..284222) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(284247..285638) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK8 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(285820..287196) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 287438..288826 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969100.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(288894..290366) product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene davD CDS complement(290522..291334) product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(291415..292578) product putative dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702927.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(292575..293783) product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(293819..295642) product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene glmS CDS complement(295668..297071) product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene glmU CDS 297299..297970 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYC6 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene cbbZ tRNA 298014..298088 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(298174..298494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389769.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(298498..299445) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(299651..301345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 301588..302628 product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 302753..303649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(303795..304004) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene cspA CDS complement(304060..304389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 304893..306050 product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085983.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 306276..307715 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 307783..308418 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533542.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(308531..308743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(309077..309526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(309670..309984) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 310139..310411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(310460..310699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(310823..311395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45900 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene yqaC CDS complement(311406..312569) product hippurate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene hipO1 CDS 312747..313892 product NADH:flavin oxidoreductase / NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(313901..314425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(314422..314820) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(314832..316967) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886845.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(317211..317642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 317718..318395 product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084189.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene alkA CDS 318582..321074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 321097..322146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(322159..322875) product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 322961..323734 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(323731..324381) product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 324504..325457 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 325550..327016 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 327138..327626 product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 327788..329578 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 329587..329814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(329845..330369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(330507..331091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 331283..331825 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185346.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 331879..332820 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(332839..333693) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 333842..334816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(334821..335279) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(335408..337276) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(337364..338308) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(338512..340236) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(340317..340799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(340913..341617) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 341844..343052 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083205.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(343096..343779) product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705261.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 343932..345131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(345141..345641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(345950..347641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(347856..348572) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(348776..349570) product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(349567..350808) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088989.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 351002..351856 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H09 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(351873..352394) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 352535..353758 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(353755..354720) product acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929723.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(354870..356420) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 356585..357685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(357777..358670) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(358828..360078) product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709513.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(360087..361037) product hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(361105..362325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(362333..362749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919719.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(362904..363710) product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene fadB CDS complement(363876..364571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(364568..364876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 365097..366368 product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 366409..367056 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(367075..367440) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(367556..368140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(368323..369204) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N85 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(369299..369778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 370026..370535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(370630..371673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 371897..372211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 372208..372708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 372794..373909 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(373929..375152) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(375242..376096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(376241..377416) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 377946..379997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(380023..380937) product diheme cytochrome c-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53143 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene cycG CDS complement(381004..381477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 381599..382123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(382149..383033) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459241.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 383134..383634 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 383800..384276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 tRNA complement(384336..384411) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(384471..385037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(385214..386374) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(386378..388390) product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(388392..388901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(388898..389839) product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX69 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(389885..390928) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(391237..392256) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G50 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene ilvC CDS complement(392394..392993) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene ilvH CDS complement(393101..394891) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX73 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(395054..396079) product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX74 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene miaA CDS 396078..396974 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene serB CDS complement(397096..398523) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(398871..399059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(399099..399974) product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(399971..401140) product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 401282..402451 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T733 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(402460..402978) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(402982..403512) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G37 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene folA CDS complement(403515..404309) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TG68 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene thyA CDS 404482..405999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 406450..406911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 407004..408614 product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS89 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 408628..409269 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(409281..409535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 409959..410171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 410230..411051 product flagellin FljL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18914 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene fljL CDS complement(411127..411552) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(411564..414164) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(414343..415326) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(415660..416988) product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(417070..417717) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(417717..418703) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035876.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(418724..419539) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(419543..420811) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088806.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 420847..421362 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT4 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene apt CDS complement(421497..422417) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 422606..422890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(422927..424153) product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 424568..425248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(425379..426026) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(426040..426327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(426344..426967) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 427147..427734 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 427763..428272 product topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(428313..429266) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 429349..430014 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(430106..431683) product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene serA CDS complement(431764..432759) product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 433560..434066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(434219..434611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(434732..435406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(435486..436460) product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383432.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 436590..437261 product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C539 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 437425..438246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(438265..438852) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(438925..440730) product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P532 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene opgH CDS 441174..442316 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 442313..443185 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(443193..443369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 443554..445092 product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 445132..446025 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 446123..447160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(447162..447536) product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086574.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(447569..448819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(448824..449741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(449749..450516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(450597..451286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 451984..452478 product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 452563..453519 product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 453614..453856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 453868..454257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(454302..454919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(455308..456453) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(456459..457841) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(457849..459216) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 459100..459351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(459376..460431) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(460574..461899) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(461899..462405) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(462398..463216) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972092.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 463365..464240 product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708673.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(464252..465268) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 465380..466399 product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(466428..466787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 466975..467730 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 467899..468819 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 468824..469588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 469619..470104 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 470253..473132 product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 473129..473947 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 473958..474908 product DMSO reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(474887..476236) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 476457..476669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 477305..479887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(479974..481191) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene dctD CDS complement(481188..482906) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 483137..484141 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479018.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 484238..484912 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 484916..486292 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(486373..487401) product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(487489..488700) product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(488705..490042) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(490086..492416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(492595..492885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(493071..493724) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXB1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene gmk CDS complement(493721..494620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 494683..495486 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(495508..497001) product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(497118..498086) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(498093..499358) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC2 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(499430..499666) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene acpP CDS complement(499912..500652) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene fabG CDS complement(500693..501643) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MW0 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene fabD CDS 501936..502412 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC6 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene rpsF CDS 502416..502670 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC7 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rpsR CDS 502783..503706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 503780..504373 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ0 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rplI CDS 504676..506100 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD0 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 506100..507236 product alanine racemase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58737 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene dadB CDS complement(507206..507376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 507350..508057 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 508074..508862 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 508877..510283 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD4 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene radA CDS 510287..510955 product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 510975..512486 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD6 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene purF CDS 512512..513216 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 513209..514153 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089324.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 514251..515240 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene cmaX CDS 515267..517750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 517765..518943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(518940..520163) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 520426..521166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(521212..521526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(521613..523004) product indoleacetamide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59385 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene bam CDS complement(523136..524551) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPR6 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene der CDS complement(524663..526006) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQB5 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene bamB CDS complement(526020..526664) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532849.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 526925..527263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390836.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 527268..528653 product coa transferase caib/baif family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 528752..529033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(529030..529704) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 529841..530554 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene dehII CDS 530801..531163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 531135..531734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(531811..532566) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene linC CDS 532793..533569 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 533573..534481 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(534501..535823) product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(535871..537178) product glutamine synthetase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87393 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene glnT CDS complement(537254..538582) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010914750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(538593..539279) product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene fwdC CDS complement(539283..540179) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(540279..540959) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532514.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(540959..541906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 541985..542194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 542282..542473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(542454..542756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 542674..543768 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228175.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(543859..545955) product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969782.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene fhuA CDS complement(546064..546948) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(547107..548519) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(548516..549835) product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083890.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(549891..550223) product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene fdx CDS 550367..551122 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083866.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene pcaR CDS complement(551648..551929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 551942..552199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(552434..553276) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(553397..554440) product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(554451..555488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(555583..556572) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(556956..557897) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWE8 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene metA CDS complement(558182..559114) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(559324..560274) product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IV9 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(560350..561192) product 6-chlorohydroxyquinol-1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(561210..562418) product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 562564..563466 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(563481..564497) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene nodX CDS complement(564681..566231) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI5 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene guaA CDS complement(566420..566998) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(567091..568464) product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(568504..569964) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU6 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene guaB CDS complement(570088..570654) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(570726..571142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(571120..571821) product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU5 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene rlmE CDS complement(571920..572876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(573238..573996) product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(573993..574964) product enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(574954..575916) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(576008..576946) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(577030..579024) product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461725.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 579231..580226 product iron-regulated virulence regulatory protein IrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6D1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene irgB CDS complement(580236..581213) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 581109..581306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 tRNA 581469..581542 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 581825..582367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(582720..583088) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 583295..585334 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene mcpM CDS complement(585344..586174) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(586264..587721) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(587749..589140) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene yhxA CDS complement(589355..591466) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051707.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 591889..592734 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705152.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 592731..593759 product heme ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705153.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 593756..594835 product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 594853..595806 product protein translocase component YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 595834..596775 product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098734.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(596814..598064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(598204..600318) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(600538..601398) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 601554..602168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 602216..602683 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532018.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(602622..604115) product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 604440..604865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(604933..605397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 605655..606584 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 606708..607574 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089189.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(607591..608742) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 608623..608973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 609049..609507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 609511..610566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 610759..613659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(613679..614353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(614350..615285) product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537674.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 615387..616307 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 616424..617497 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 617535..618689 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 618770..619612 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 619612..620391 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810041.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 620393..621763 product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 621802..622563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 622569..623861 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene ordL CDS 624057..624953 product 3-sulfolactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVD6 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(625024..625641) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QG7 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene azoR CDS 625754..626689 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085062.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(626690..627331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(627331..628989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(628982..629692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(629696..631810) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene cyaA CDS complement(632009..632509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 632874..633617 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085178.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 633660..634040 product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 634037..634780 product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene pcaH CDS 634780..635394 product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 635615..636484 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 636489..636971 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 637138..638364 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970764.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 638367..639443 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 639683..641935 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(642028..643119) product tricarballylate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085110.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene citB CDS complement(643109..644509) product tricarballylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(644718..645470) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384628.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(645479..646279) product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(646266..647030) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(647101..648075) product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(648184..648873) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 649041..649727 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336836.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 649962..651623 product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene ilvB CDS 651941..652780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(652759..654072) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(654072..655319) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 655430..656365 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(656383..656664) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(656664..656987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 657172..657639 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(657649..658572) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(658569..659645) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(659635..661194) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(661191..662036) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene xdhC CDS complement(662033..664378) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene xdhB2 CDS complement(664378..665832) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887365.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(665836..666168) product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG81 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 666390..667805 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 667802..668659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528244.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 668656..669147 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J689 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(669254..669796) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 670261..671382 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 671385..672038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 672451..673260 product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 673253..674005 product 5-amino-6-(5-phosphoribosylamino)uracil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(673998..674807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(674804..675883) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(675880..676278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene ptpS CDS complement(676292..677290) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230079.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(677524..678465) product tartronate semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(678644..679279) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(679418..680044) product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(680125..682434) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 682585..683490 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(683493..684776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 684997..685317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(685328..685813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(685881..686513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 686607..687980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 687977..688357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(688351..689121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 689252..691552 product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 691609..693252 product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene ilvB CDS 693294..693983 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 694140..694685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 694752..695861 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 695872..699063 product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(699087..700238) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(700258..701799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 701954..703288 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(703354..703563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 703451..704188 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(704204..705460) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(705618..706709) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene bllY CDS 706820..707326 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 707478..708044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 708124..708573 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene aroQ CDS 708592..709026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 709042..710388 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 710436..711089 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U825 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene aat CDS complement(711023..711457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(711486..711944) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(712006..712359) product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(712445..713110) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(713150..713776) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708648.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 714344..718030 product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(718167..719918) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(719915..720760) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(720757..721701) product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(721740..723284) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970008.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(723341..724456) product peptidase C45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(724453..725343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 725524..726186 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 726215..727096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 727562..728029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 728104..729291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 729434..729622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(729739..732057) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(732064..732390) product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSI5 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene clpS CDS complement(732731..733261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 733670..734947 product peptidase S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(735120..735707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(736082..736396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(736702..738084) product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(738081..739409) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(739425..740207) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSH8 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(740398..741114) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531778.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(741140..741874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 741961..742446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(742462..742866) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731503.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(742923..743864) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382920.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 744345..744551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(744640..745539) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 745679..746665 product thymidine diphosphoglucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064829.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(746678..748186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(748648..749895) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(749982..750704) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225220.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(750852..751700) product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene tauD CDS complement(751795..753162) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 753379..754275 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968433.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 754418..755347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 755491..756618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(756743..757147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970109.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 757283..757657 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964435.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 757816..758118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 758199..758747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 758806..760557 product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene copA CDS 760561..761262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(761317..762006) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(761993..762991) product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U7F8 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 763191..764111 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 764259..765668 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 765769..767094 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 767091..767828 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(767856..769109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(769212..770474) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531116.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(770622..771644) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ7 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 771881..773092 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(773103..773393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(773380..773631) product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 773727..773936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 774202..774711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 774732..775691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 775958..778159 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene uvrB CDS 778473..779450 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(779456..779818) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene folB CDS complement(779821..780636) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707495.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 781044..783011 product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS75 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene uvrC CDS 783087..783719 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 783770..784276 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene mobB CDS 784280..785551 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene moeA CDS 785548..785799 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI4 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene moaD CDS 785804..786250 product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX97 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene moaE CDS 786548..786934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 787017..787388 product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 787388..788107 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 788114..789088 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 789185..790186 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(790246..791139) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816435.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 791255..792004 product putative oxidoreductase YkvO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31680 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene ykvO CDS 792148..792762 product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967188.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(792909..793154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(793133..793309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(793311..795233) product NorD nitric oxide reductase activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338147.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene norD CDS complement(795249..796058) product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene norQ CDS complement(796055..797407) product nitric oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene norB CDS complement(797421..797804) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565637.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene norC CDS 797836..797997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(798292..798855) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338152.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene nnrR CDS 798781..798981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 799108..799521 product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 799609..800790 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338153.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene nnrS CDS complement(800757..801575) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089827.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(801654..802802) product nitrite reductase, copper-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(803312..804265) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(804262..804858) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(804855..805283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 806301..806762 product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCY1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene mraZ CDS 806759..807730 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rsmH CDS 807727..808098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 808098..809834 product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 809821..811314 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N0 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene murE CDS 811311..812747 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU0 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene murF CDS 812757..813845 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene mraY CDS 813850..815226 product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU2 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene murD CDS 815277..816347 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 816344..817480 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene murG CDS 817477..818922 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU5 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene murC CDS 818919..819881 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene murB CDS 819878..820795 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU7 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene ddl CDS 820783..821661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 821661..822962 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene ftsA CDS 822962..823138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 823160..824773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 824958..825872 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene lpxC CDS 825994..826833 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene bamD CDS 826840..828504 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV4 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 828518..830608 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV5 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene ligA CDS complement(830960..831367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(831385..831798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(831906..832694) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(832715..834529) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 834795..835238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(835336..836259) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(836271..838583) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU59 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(838968..840782) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(840788..841279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 841382..842260 product Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 842381..844132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 844407..845183 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387816.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 845198..845821 product organic solvent tolerance ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(845910..847592) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(847836..848120) product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(848267..849154) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(849156..850385) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523407.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(850382..851464) product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS46 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(851461..851655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(851674..852078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 852077..853069 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3R4 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene rluD CDS 853229..854116 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD4 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene rpoH CDS complement(854157..854654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(854718..856715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(856941..858233) product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9F8 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene purA CDS complement(858319..859479) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD9 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene hisZ CDS 859638..860072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 860117..861391 product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CUC3 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene fabF CDS complement(861481..862407) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(862404..862745) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972681.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(862857..864053) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(864292..865674) product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(865671..866279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(866279..868348) product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(868345..870081) product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(870081..870959) product isocitrate lyase family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(870956..871444) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064987.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(871441..872718) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(872721..873422) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(873415..874161) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(874154..875182) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(875194..876093) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(876173..877414) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(877455..878276) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 878545..879765 product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 879941..881203 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 881253..882536 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(882552..883166) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067632.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 883371..884555 product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532575.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 884552..886045 product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532574.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(886042..888186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(888405..889367) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820327.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 889562..891667 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 891677..892843 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 892854..893171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(893192..893830) product riboflavin deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887768.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 894286..897672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 897676..898605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(898782..899201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(899204..899560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(899662..900255) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(900452..901087) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(901645..902808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(902937..903260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(903889..904935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(905006..907174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 907357..908385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 910137..911588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 911712..912083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 912378..913313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970319.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 913310..914041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(914047..914934) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene accE CDS complement(914931..915869) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970322.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(915866..916867) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(916864..917838) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(917904..919466) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene accA CDS complement(919887..920201) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(920255..921055) product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93SH7 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene hmuV CDS complement(921048..922112) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536368.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene hmuU CDS complement(922116..922964) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(922961..924028) product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(924064..926079) product TonB-dependent heme/hemoglobin receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(926176..926370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(926546..927595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(927592..927993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(927998..928405) product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(928413..929105) product biopolymer transport protein exbB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52043 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene exbB1 CDS complement(929169..929612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(929637..930320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(930334..931440) product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015576.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(931479..932663) product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 932818..933282 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086994.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 933360..933785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 933847..935934 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(936004..937311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(937311..937835) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(937927..938907) product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(939174..940091) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038953.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(940093..940761) product hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090029.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(940805..941767) product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 942366..943436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 943439..944386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 944376..945200 product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 945261..946799 product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B14 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene mtaD CDS complement(946848..947693) product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(947690..948442) product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(948451..949296) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(949298..950155) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(950223..951518) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887379.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(951542..952618) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(952833..953522) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene vanR CDS 953822..954835 product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 954948..955178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 955171..956592 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(956614..957528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387831.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(957544..958539) product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(958573..959283) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064937.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(959312..960343) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(960340..961467) product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(961479..962384) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(962404..963360) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(963463..965049) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 965629..965847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 965844..967271 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969923.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(967458..968834) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(968997..969479) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888390.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(969481..970473) product cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene arcB CDS complement(970466..971488) product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene eutB CDS 971637..972830 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 972839..974002 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(974012..974704) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268601.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 974855..975523 product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 975520..976326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(976416..978383) product RiPP maturation radical SAM protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(978405..979400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(979393..986424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 sequence02 source 1..775422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1630..3087) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067193.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(3099..4553) product ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925697.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(4598..6226) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 6469..7689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 7785..8702 product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 8732..9646 product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(9609..10835) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(10925..11338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(11489..11686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 11857..12453 product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 12580..13770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920937.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 13893..15011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 15018..16409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(16445..17677) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 17886..18827 product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(18904..20397) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(20399..20878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(20947..21939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(22172..22594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 tRNA 22885..22969 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(23042..24193) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 24366..25229 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 25291..26040 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 26077..27042 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene argC CDS complement(27087..27911) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(28017..29312) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTR0 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene hflX CDS complement(29324..29584) product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTR1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene hfq CDS complement(29700..30353) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(30363..31739) product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene trkA CDS complement(31767..33158) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(33148..35433) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(35591..37033) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(37036..38166) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene ntrB CDS complement(38163..39188) product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene dus CDS complement(39286..40086) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389365.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 40143..41315 product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene ispDF CDS 41312..41782 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389622.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 41796..42296 product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(42293..43453) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532426.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 43578..44477 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098566.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(44585..45022) product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(45041..46069) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2P4 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene lipA CDS complement(46066..46329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(46376..47773) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT67 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(47872..49218) product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9R9N3 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene pdhC CDS complement(49231..50616) product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene pdhB CDS complement(50672..51595) product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E8 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene pdhA CDS complement(51865..52281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(52447..53730) product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT60 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene eno CDS 53896..54369 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 54556..54993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972834.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(55129..56532) product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038934.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(56549..57391) product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT59 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene kdsA CDS complement(57428..59062) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT58 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene pyrG CDS complement(59165..59479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(59600..60346) product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene tpiA CDS 60483..62441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 62441..63949 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(64048..65310) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 65400..65672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 65739..66227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 tRNA complement(66260..66336) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(66435..66953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(66974..67285) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS7 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene ihfA CDS complement(67529..68515) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9J6 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene fabH2 CDS complement(68512..69576) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS9 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene plsX CDS complement(69719..70339) product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(70350..70892) product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 71103..71552 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(71627..73723) product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68460 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene hppA CDS complement(73928..75142) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(75234..75707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(75728..76714) product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC5 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene thiL CDS complement(76717..77220) product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I9 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene nusB CDS complement(77229..77666) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I8 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene ribH2 CDS complement(77663..78832) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(78825..79448) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(79458..80558) product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(80638..81099) product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W6 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene nrdR CDS complement(81156..82448) product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB8 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene glyA2 CDS complement(82520..82969) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 83285..83737 product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389582.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(83812..84036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 84172..85395 product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(85473..85913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(86250..86501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(86517..86921) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(86943..88610) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(88607..89410) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU25 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene coaX CDS complement(89410..90168) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(90227..91687) product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene nuoN CDS complement(91704..93215) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(93220..95154) product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(95161..95472) product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QP2 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene nuoK1 CDS complement(95475..96080) product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(96179..96667) product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F0 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene nuoI1 CDS complement(96727..97749) product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU33 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene nuoH CDS complement(97764..99860) product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU34 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(99897..101201) product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(101201..101878) product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(101875..103053) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJA9 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene nuoD CDS complement(103053..103685) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH84 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene nuoC CDS complement(103726..104265) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU39 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene nuoB CDS complement(104274..104639) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene nuoA tRNA complement(104864..104940) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 105181..105588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 tRNA complement(105604..105679) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(105771..106043) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(106311..108710) product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU43 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene lon CDS complement(108821..110098) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU44 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene clpX CDS complement(110273..110914) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU45 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene clpP CDS complement(110987..112468) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU46 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene tig tRNA complement(112532..112616) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(112704..114122) product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(114154..115662) product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 115776..116162 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 tRNA complement(116188..116264) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(116358..117521) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 117725..118891 product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 119105..119443 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene glnB CDS 119646..121055 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSK9 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(121225..122064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(122221..122859) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(122918..123325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(123361..123756) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 123860..125866 product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQT8 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene parE CDS 126101..127597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 127690..127932 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391210.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(127939..129171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(129295..129957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(129969..132623) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene pepN CDS complement(132667..133437) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 133539..134492 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(134519..134902) product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 135212..136156 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(136160..137794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(138094..139254) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878348.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(139301..140008) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531138.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 140035..141246 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815840.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 141359..142276 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 142284..143600 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 143659..144000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 144002..144709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 note possible pseudo, frameshifted CDS 144717..146375 product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 146377..146814 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene nifU CDS complement(146826..147263) product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57420 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene flgC CDS 147414..148178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(148187..149293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 149507..150724 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 150721..151302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(151316..151660) product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719728.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 151829..152386 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(152479..153336) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 153519..153770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(153837..154931) product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene paaE CDS complement(154941..155450) product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene paaD CDS complement(155454..156221) product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(156246..156536) product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813296.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene paaB CDS complement(156590..157573) product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene paaA CDS 157685..158164 product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene paaI CDS 158164..159105 product transcriptional repressor PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76086 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene paaX CDS 159310..159507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 159600..161690 product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 161703..163427 product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 163450..164235 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 164317..165078 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene fnr CDS complement(165100..166479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 166616..168187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390363.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 168259..168858 product cation-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105676.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 168899..170278 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31381 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene hemN CDS 170506..172182 product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 172186..172920 product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene fixO2 CDS 172933..173082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 173085..173954 product Cbb3-type cytochrome c oxidase subunit CcoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J015 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene ccoP CDS 173926..175548 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene fixG CDS 175545..176060 product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 176069..178372 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 178359..178496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 178597..179424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(179421..180200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 180475..181950 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 181975..182931 product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 182924..183811 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 184042..184566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(184688..185023) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531657.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 185230..186522 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(186549..188117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(188291..189055) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388807.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 189283..189663 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(189681..190058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 190402..192675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(192721..193887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(194080..195066) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 195292..196086 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969833.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(196185..197702) product tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088773.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(197725..198222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(198332..199279) product tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088775.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 199910..201607 product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 201604..204384 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 204404..205225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 205424..208108 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(208180..208518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(208630..209862) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 210227..211834 product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(211948..212397) product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(212419..213465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 213664..214296 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 214293..215342 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene trpD CDS 215335..216141 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene trpC CDS 216174..216650 product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI5 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene moaC CDS 216640..217893 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene moeA CDS 217961..218761 product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PW3 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene lexA CDS complement(218771..219085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(219170..221212) product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 221372..222766 product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene gltX2 CDS 222864..224165 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ5 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(224245..225444) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(225441..226274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(226282..227088) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ8 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene lpxA CDS complement(227092..227568) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene fabZ CDS complement(227568..228599) product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q47 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene lpxD CDS complement(228619..229227) product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(229178..231499) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU01 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene bamA CDS complement(231622..232755) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(232799..234049) product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene dxr CDS complement(234056..235009) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU04 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(234951..235682) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU05 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(235686..236246) product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8K5 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene frr CDS complement(236249..237001) product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU07 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene pyrH CDS complement(237042..237965) product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene tsf CDS complement(238120..238947) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU09 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene rpsB CDS complement(239133..239981) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529404.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 240146..240856 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF82 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(240872..241564) product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene nthA CDS complement(241561..241875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(241875..242234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(242306..242974) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(242971..244512) product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7V1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(244583..244891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(244905..248402) product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(248509..249258) product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA3 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene lolD CDS complement(249251..250495) product LolC/E family lipoprotein releasing system, protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(250523..251842) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZS9 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene proS CDS complement(252033..252554) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388478.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(252637..253518) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJ85 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(253583..254650) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(254647..255798) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 256022..257071 product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene hemB CDS 257204..258031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 258041..259399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(259436..260254) product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(260415..261413) product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(261388..262314) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 262466..262924 product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529104.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 262962..263432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 263554..264678 product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 264675..266204 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 266257..268671 product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(268678..269280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 269480..270718 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087499.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(270777..271253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 271460..272320 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 272401..273462 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 273472..274218 product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTA0 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene ate CDS complement(274215..276425) product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene parC CDS complement(276528..277286) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVD0 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene recO CDS complement(277273..278124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(278200..279126) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R46 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene era CDS complement(279119..279808) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene rnc CDS complement(279801..280517) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(280650..281072) product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69159 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene acpS CDS complement(281083..281838) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene pdxJ CDS complement(281835..282458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(282546..284693) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(284799..285194) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT88 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene rpoZ CDS complement(285273..285800) product 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 285995..286657 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 286677..287327 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(287331..287801) product ssrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z9 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene smpB CDS complement(287844..288743) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH76 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene dapA CDS 289140..291131 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 291138..291842 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 291956..292957 product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(293019..293519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(293500..295098) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 295154..295783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 295915..297171 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821029.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene soxB CDS 297184..297474 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 297471..300503 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 300496..301104 product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532910.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 301188..301874 product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 301942..302562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 302568..303062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 303071..303829 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 303944..305551 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 305613..306635 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338505.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene DppB CDS 306651..307580 product cytochrome c550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066547.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 307577..308461 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene dppD2 CDS 308472..309254 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene DppF CDS 309302..309790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(309815..310168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 310399..311421 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 311414..311833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(312023..312460) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZG71 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene mgsA CDS 312563..313270 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 313308..314276 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087329.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 314289..315044 product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene hpcH CDS 315044..316165 product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 316305..318641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(318762..319640) product isocitrate lyase family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(319749..319934) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE65 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene rpmF CDS complement(320061..322049) product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888157.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene pccA CDS complement(322101..322901) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(322928..323212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(323279..324466) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D196 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene aspB CDS 324619..325230 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene gpmB CDS 325368..325748 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(325791..326672) product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(326669..327847) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(327915..328667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 328557..328826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(328960..329328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(329328..330188) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(330345..333005) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI0 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene alaS CDS complement(333331..334407) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene recA CDS complement(334679..336703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(336765..337841) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene flhB CDS complement(337899..338663) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH6 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(338679..338945) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(339039..339344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(339414..339824) product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG22 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene flgC CDS complement(339853..340263) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH2 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 340392..340796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 340793..341125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 341253..341585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 341582..342358 product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQG8 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene fliP CDS complement(342385..346035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390459.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(346092..346754) product OmpA/MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(346918..347448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(347452..347922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(347967..348356) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(348546..349412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(349412..350023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(350033..351070) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF8 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(351080..351619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 352065..352790 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY76 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 352815..353600 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF5 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 353635..354621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 354648..355412 product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF3 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene flgH CDS complement(355559..355975) product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene dksA CDS complement(356152..356574) product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390475.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene fliX CDS 356795..357952 product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQE9 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene flgI CDS 357964..358299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 358301..358747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(358805..359749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(359953..360351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(360557..361561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(361576..363048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 363181..364920 product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21296 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene flbA CDS complement(364950..365324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(365358..366176) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene fljJ CDS complement(366799..367236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(367236..367652) product flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21297 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene flbT CDS complement(367867..368694) product flagellin FljL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18914 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene fljL CDS complement(369039..369866) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6U1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene fljL CDS 370254..372281 product flagellar hook-length control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 372294..372962 product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ4 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 373072..374382 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY3 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene flgE CDS 374544..374858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(374860..376422) product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21296 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene flbA CDS 376687..378378 product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ6 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 378419..379300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 379329..379703 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 379862..380581 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 380630..382099 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 382166..384301 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene flhA CDS 384350..385345 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 385382..386173 product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(386330..386614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(386913..387167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 387676..388629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(388648..389064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(389061..390425) product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene fliI CDS 390603..391331 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(391428..392264) product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(392271..393449) product chemotaxis response regulator protein-glutamate methylesterase of group 2 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T55 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene cheB2 CDS complement(393450..393815) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(393874..394365) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(394373..397075) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(397257..397898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 398092..398295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265963.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 398322..399401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(399408..399710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(399849..400418) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene mobA CDS complement(400468..401361) product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU0 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene fdhD CDS 401531..402523 product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y5 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene moaA CDS complement(402567..403070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 403226..403984 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene nadK CDS 404047..405012 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 405201..405383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(405390..406247) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(406276..407307) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(407311..408291) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104208.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(408303..409238) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(409235..410212) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816048.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(410286..411896) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 412117..413091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 413109..414281 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(414318..414761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(414857..415039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(415131..416090) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene pldB CDS complement(416083..417369) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389832.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 417520..418797 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(418817..419647) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene fljJ CDS complement(419856..420974) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX09 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene ald CDS 421185..421313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 421450..422616 product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972062.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene solA CDS complement(422626..425001) product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RF7 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(425202..425825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(425861..427711) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930067.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(427986..430808) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89R17 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene ppc CDS complement(430978..431331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(431390..431791) product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(431791..433020) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR78 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(433017..434348) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(434369..435130) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene SufC CDS complement(435172..436629) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(436687..437166) product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 437396..438277 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809826.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 438408..440138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(440135..440995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(441048..441854) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206036.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene catD CDS complement(441870..442454) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL02 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(442469..443872) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(443859..444194) product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886767.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(444175..445293) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(445300..445656) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(445659..446807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106235.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(446923..447225) product alkylphosphonate uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene phnA CDS complement(447313..447945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(447942..448424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 448810..449859 product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384996.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene lplA CDS complement(449931..451241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(451553..451819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(451816..452025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(452839..453234) product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(453252..453584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(453603..455111) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(455117..456325) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 456485..457270 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene dcaE CDS complement(457308..459806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(459897..460901) product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene adhP CDS complement(460929..461690) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818730.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(461706..462593) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 462782..464365 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389103.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 464402..465367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(465506..466447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(466453..467364) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 467479..468930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(468925..469362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(469384..469797) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(469889..470899) product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(470917..471942) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(472035..473276) product formyl-CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QH2 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene frc CDS complement(473346..475070) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(475130..475795) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085942.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(476038..477270) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(477313..478389) product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene proV CDS complement(478386..479282) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(479313..480254) product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene opuC CDS 480390..480980 product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN0 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene betI CDS 480977..482494 product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 482500..484149 product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN3 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene betA CDS 484173..485636 product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN4 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene betB CDS 485705..486850 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 486847..488469 product CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 488560..488886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(488905..489714) product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(489711..490631) product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(490632..491789) product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM67 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(491965..493002) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(493152..493775) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(493778..495463) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(495489..496703) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 496832..497794 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 497839..499392 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190045.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 499745..501052 product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 501129..501338 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533862.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene cspA2 CDS complement(501397..502452) product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(502846..504849) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(504945..506105) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 506388..507170 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090097.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(507167..510379) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 510635..511111 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(511115..511654) product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(511686..512891) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(512920..513555) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCU5 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene upp CDS complement(513653..514567) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(514667..516166) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAZ4 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(516180..516974) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709581.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene glpR CDS 517337..519073 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 519249..520331 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 520344..521435 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973408.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 521432..522295 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 522297..523106 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 523121..523402 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531808.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 523664..527314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 527396..527983 product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229034.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene pcaC CDS complement(528097..528375) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 528886..529314 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815484.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(529325..529867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(529970..530866) product fluoroacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(530859..531707) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 531931..533025 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 533025..533693 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(533719..534696) product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073496.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(534856..535482) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RL0 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene ureG CDS complement(535495..536208) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UF8 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene ureF CDS complement(536168..536710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(536718..538430) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42885 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene ureC CDS complement(538432..538752) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42886 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene ureB CDS complement(538762..539064) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCH3 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene ureA CDS complement(539090..539953) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UG4 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene ureD CDS complement(540148..540807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 540927..541691 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYE9 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 541977..543881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(543901..544596) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(544598..545362) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(545359..546537) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(546541..548184) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(548281..549564) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531849.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 550143..551807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 551788..552630 product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51069 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene cheR CDS 552627..553709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(553723..556941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(556946..557866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(557863..558288) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720191.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene cheY6 CDS 558584..559288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(559303..560973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390048.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(561337..562323) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(562320..563327) product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(563327..564523) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(564528..565538) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(565647..567620) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(567943..568599) product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(568602..569270) product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(569366..570217) product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(570279..571103) product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530326.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 571368..571841 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222215.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene lrp CDS complement(571917..572402) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEN4 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene bfr CDS 572704..573570 product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404190.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene lppC CDS complement(573687..575120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(575117..575656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 575904..576575 product dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 576588..577259 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 577282..578109 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 578127..579302 product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene solA CDS complement(579299..580696) product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(580693..582480) product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(582477..583247) product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SB3 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene otsB CDS complement(583375..584025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 584278..584832 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 584925..586100 product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 586113..589235 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972841.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(589282..591861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 592418..592909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(592930..593289) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 593484..594509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 594566..595216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 595515..597188 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI03 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene fhs CDS 597275..598192 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94463 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene fmt CDS complement(598294..599988) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640110.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 600210..600833 product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene pncA CDS 600823..601566 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 601614..602372 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(602431..604044) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(604273..605217) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 605335..605610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(605685..606623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(606640..607395) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707075.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(607403..609322) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T825 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene dxs CDS complement(609345..610232) product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(610274..610522) product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXC6 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene xseB CDS complement(610602..611531) product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 611780..612913 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 612918..616127 product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 616373..617629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 617746..618141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 618260..619510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(619517..620581) product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088453.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 620719..621132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202812.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(621154..621657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 622121..623776 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 623886..624821 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 624838..625992 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 626006..628069 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(628169..628645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 629125..630675 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(630726..631691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 631887..632681 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 632681..633484 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 633572..634276 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 634306..634854 product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083840.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(635207..636124) product phosphonate transporter PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene phnE CDS complement(636218..637234) product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(637268..638128) product phosphonates import ATP-binding protein PhnC 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882S0 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene phnC2 CDS complement(638256..638705) product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(638716..639774) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 640107..641222 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 641249..642142 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 642135..643802 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 643799..644518 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene livF CDS 644575..645261 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PY1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene pyrE CDS 645299..645922 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 646011..647711 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 647736..648704 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173671.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 648701..649627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 649677..650090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(650121..650603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 650523..650735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(650790..651224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(651458..652264) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(652261..652860) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(652913..654085) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(654144..655415) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(655468..656382) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SH8 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene rbsK CDS 656449..657876 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932001.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 657873..658523 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(658547..660178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 660329..660835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(660861..661877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(662404..664035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(664127..665302) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene pobA CDS 665456..666373 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 666401..666904 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(666901..668862) product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(668957..669982) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(670028..671650) product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970574.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(671678..672343) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 672468..673232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 673346..673987 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970533.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 673993..674313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(674341..675639) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene sun CDS 675830..677188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(677185..678048) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F7 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene htpX CDS 678167..678391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(678418..679380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(679388..680539) product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(680544..681482) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 681671..682180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 682173..683711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(683631..684242) product lysine exporter protein LysE/YggA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532487.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 684350..685282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089437.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 685453..686847 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388455.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(686850..688343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 688512..688832 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087171.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 688880..689926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 690049..690867 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene cysE CDS complement(690908..691717) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226399.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene iclR CDS 691922..692983 product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 692994..694259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 694466..695734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 695731..696609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(696625..697851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(698101..699522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(699546..700307) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 700463..700942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 700939..701286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 note possible pseudo, frameshifted CDS 701305..701526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 tRNA complement(701588..701674) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 701819..702400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(702425..703600) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene mnmA CDS complement(703715..704986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(705146..705835) product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DQ1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(705832..706152) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(706191..707300) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene nifS CDS complement(707374..707625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 708146..708814 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(708839..709942) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR4 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene anmK CDS 710077..711324 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR3 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene tyrS CDS complement(711361..714483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 714678..717668 product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene glnE CDS 717769..719604 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 719693..720853 product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808328.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 720953..721414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 721483..722325 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene fljJ CDS complement(722334..724370) product N-methylproline demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 724485..725147 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(725182..725610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(725647..726177) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 726246..726629 product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(726632..727183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(727188..727643) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IW3 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene hisI CDS 727743..728624 product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 728621..730447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 730482..731639 product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(731745..735329) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 735484..736398 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(736514..737125) product pyridoxamine 5'-phosphate oxidase-like FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(737183..738265) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(738291..738626) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(738652..739674) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ7 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 739962..741263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(741282..742094) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706164.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(742194..742823) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 742719..743111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(743063..743881) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 744438..744827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 tRNA 744907..744983 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 745453..746217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(746613..747056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(747253..748257) product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(748254..749663) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(749964..752063) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(752149..753153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815960.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(753438..755597) product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene katG CDS complement(755818..756924) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(756935..758089) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(758126..758713) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267478.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(758710..759246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 759354..760280 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(760359..761390) product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLE5 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(761423..762244) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337460.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(762237..763166) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(763163..764236) product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(764233..765708) product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337463.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 766658..767299 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(767328..768056) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(768053..768811) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(768811..769605) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064998.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(769605..770618) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(770615..771523) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(771626..772909) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(773352..775043) product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 sequence03 source 1..388820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(219..292) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(402..486) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 781..1509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 1673..3145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(3203..3856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(4020..5156) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 5417..5872 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 6248..6928 product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(6997..7764) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 8361..8948 product DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031635.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(8974..9459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(9465..9770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(9954..10898) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(10930..11535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(11690..12505) product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FP61 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene phnX CDS complement(12523..13659) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(13735..14298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(14515..14955) product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 15191..16396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(16415..17530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 17753..18943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 18954..19331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 19508..20797 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 20897..22396 product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 22406..23500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 23506..24633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527911.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 24754..25137 product cytochrome C protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(25186..26145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(26145..26687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(26789..27625) product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(27687..28118) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 28264..28998 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 29035..29871 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 29868..30218 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 30215..30616 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 30638..32005 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970462.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(32064..32507) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(32611..33243) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(33280..34248) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene znuA CDS complement(34326..35129) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(35157..35540) product translation initiation inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814499.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(35650..36591) product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(36740..37192) product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(37196..38029) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531742.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 38173..38649 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(38654..39214) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene hutC CDS complement(39352..40728) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene hutF CDS 40820..42019 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J290 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene hutI CDS 42016..43563 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J289 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene hutH CDS 43579..45246 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8Z9 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene hutU CDS 45246..46748 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 46829..47707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(47714..48340) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537802.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene nahD CDS complement(48465..50372) product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973829.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(50567..50989) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene cheY-3 CDS complement(51006..54089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 54372..55046 product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRL9 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 55043..55642 product cobalt ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 55670..56221 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(56281..56589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(56687..57652) product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(57656..58798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920937.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(58817..60361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(60492..61754) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(61913..62869) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084169.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 63428..63943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 64069..66240 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM9 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene glcB CDS complement(66349..66537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 66938..68008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 68035..68271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 68268..68414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 68411..69466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 69463..70224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 70224..70496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 70579..71370 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967347.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 71472..72653 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808070.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 72666..73865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936116.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 73878..75020 product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 75276..75938 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 75971..76414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(76610..77068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(77117..78004) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH9 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene mtnP CDS 78466..81930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 81942..83039 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(83143..83913) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(83913..85169) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH7 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(85182..85712) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 85910..86401 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE3 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene trmL CDS 86643..87209 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 87350..87916 product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 88009..88893 product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(88906..90819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(90862..91761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(91969..93801) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 94038..95621 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 95636..96592 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 96606..97433 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974600.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 97430..99094 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 99117..101132 product peptidase S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(101146..102990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(103243..103746) product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA7 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene atpF1 CDS complement(103746..104339) product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0U9 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene atpF2 CDS complement(104428..104652) product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA5 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene atpE CDS complement(104730..105464) product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA4 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene atpB CDS complement(105476..105712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(106029..109520) product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA2 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene smc CDS complement(109572..110189) product disulfide bond formation protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309853.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(110369..110908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 110975..112027 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(112024..112845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(112845..113030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(113723..115309) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN46 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene purH CDS complement(115380..116243) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 116169..116402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(116410..116817) product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW22 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene alaE CDS complement(116829..117719) product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(117803..120244) product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 120527..121615 product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A4 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 121727..122797 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 122898..124160 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 124172..125026 product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 125153..125692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390263.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 125933..126340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(126315..127034) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(127130..127489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(127530..128399) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(128557..129153) product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RH8 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene pdxH CDS 129458..129937 product 17 kDa surface antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16624 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene omp CDS 130020..130967 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(131027..132352) product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ49 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 132533..133345 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T839 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 133364..134449 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RY1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene aroC CDS 134569..136335 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR27 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 136346..136831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(136854..138479) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 138637..139434 product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 139459..139749 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 139768..140931 product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene celE CDS 141508..144123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(144120..144890) product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706661.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(144844..145959) product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(146152..146958) product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(146987..147688) product Ala-tRNA(Pro) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(147685..148674) product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 148881..150281 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 150330..150914 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(150972..152183) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920868.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(152287..152505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 152522..153523 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 153520..155439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(155454..156719) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 156918..157079 product UPF0057 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5W9 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 157076..158515 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(158505..158900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 159117..159506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311710.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 159639..161195 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226507.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene add CDS complement(161262..162947) product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083745.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 tRNA complement(163153..163228) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(163281..163499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 163584..164372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(164668..164865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(164968..166272) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 166521..167972 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 168207..168938 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537761.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 168948..169976 product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090884.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene gtrA CDS complement(169984..171519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 171669..172778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(172925..175000) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB6 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene rpoD CDS complement(175060..176922) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB5 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene dnaG CDS complement(177021..177476) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 177777..178994 product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene carA CDS 179003..182260 product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 182358..182831 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene greA CDS 182977..183609 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970533.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 183906..185114 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S95 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene metZ CDS 185220..185750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 185836..186363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 186431..186853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(186872..187852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 188005..188514 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 188899..190260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 190356..190799 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J474 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene dtd CDS 190796..191470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 191564..192931 product NAD(P) transhydrogenase subunit alpha part 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB2 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene pntAA CDS 192934..193350 product NAD(P) transhydrogenase subunit alpha part 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB3 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene pntAB CDS 193367..194764 product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB4 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene pntB CDS 194890..195885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(196043..197323) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(197401..198648) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 198848..200125 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530448.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 200182..200601 product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 200628..201302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 201381..202145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 202491..203285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 203333..204091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(204093..205691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(205787..206113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 tRNA 206331..206420 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(206630..207124) product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090633.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(207540..207965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(208186..209913) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 210126..211094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 211100..212698 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(212723..213088) product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AD90 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(213116..213472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384293.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(213562..214896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 218640..219110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 219385..220707 product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(220883..221764) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(221855..222865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594045.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 223169..224287 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(224310..225824) product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(225967..226953) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 227003..227962 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 227972..228754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 228784..229947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 230020..231111 product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDV6 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(231133..232371) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(232368..234128) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531857.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(234125..234826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531856.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(234945..235979) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(236039..237214) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529024.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 237313..238218 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(238259..238954) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(238944..239408) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090697.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(239462..240349) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 240445..241281 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087073.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(241352..242206) product D-alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974702.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene dat CDS complement(242188..242499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 242739..244202 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 244237..245454 product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 245459..247414 product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NX6 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene macB CDS 247626..250238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(250248..250628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(250867..251289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 251651..251845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 252001..252951 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(253215..254108) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(254147..254740) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGE9 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(254737..254874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 255080..255877 product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066570.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 255956..256120 product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGP0 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 256211..257221 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973606.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 257771..259405 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529277.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(259402..259770) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(259928..260716) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262679.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene livF CDS complement(260713..261471) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931109.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(261482..262624) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528526.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(262626..263642) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812854.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(263732..265087) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809679.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 265318..266829 product propionyl-CoA carboxylase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E6 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene pccR CDS 266937..267308 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 267312..267575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 267575..270298 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(270299..271429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(271575..272216) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene yjdF CDS complement(272272..273783) product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAY7 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene glpK CDS complement(273936..274469) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4C9 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene ppa CDS complement(274650..274874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(274926..275774) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(275764..277044) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338987.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(277148..277627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 277840..279042 product aspartate aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q02635 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene aatA CDS complement(279112..280854) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 281029..281247 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I5 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene rpmE CDS 281478..281945 product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(282129..282725) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(282722..287275) product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(287293..288735) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 289087..289887 product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH3 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene uppP1 CDS 289980..290831 product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 290836..291732 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 291845..292834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(292849..293547) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(293644..293847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(293936..294379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene mmcB CDS complement(294390..295817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918239.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(295928..296875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 297244..297966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 298146..298610 product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 298674..298901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(298971..299435) product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(299535..300113) product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene PSrp1 CDS complement(300285..301865) product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI0 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(301877..302671) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(302718..303569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(303569..304276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(304463..305074) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 tRNA complement(305208..305294) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 305534..306487 product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387777.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 307034..307384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 tRNA complement(307671..307746) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(307853..308278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 308500..309831 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene aroA CDS 309828..310460 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP6 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene cmk CDS 310688..312409 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP7 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 312645..312926 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP8 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene ihfB CDS 313277..313618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083567.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 313642..314283 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C5 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene trpF CDS 314408..315643 product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E5 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene trpB CDS 315643..316479 product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE4 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene trpA CDS 316515..317435 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene accD CDS 317506..318777 product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene folC CDS 318948..319691 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 319780..320133 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 320212..320580 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 320585..321298 product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064045.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(321420..322529) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 322699..323463 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene fabG CDS 323539..324123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(324148..328035) product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PI8 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene putA CDS complement(328130..329392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 329538..331673 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(331720..332586) product endopeptidase DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(332592..333047) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918024.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 333269..334150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(334175..334465) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(334505..335284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 335485..339081 product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(339067..339303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(339309..340715) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532784.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 340789..341214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 341293..341820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(341848..342258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(342365..343099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 343326..343742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 343936..344412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 344378..345637 product large terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 345684..346385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 346408..347613 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816192.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 347728..348531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390960.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 348616..349224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 349257..350468 product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 350605..351756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 351857..352189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 352186..352656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 352653..353015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 353027..353431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 353474..354643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 354678..355136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 355214..355435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 355442..358420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 358431..359939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 359946..360797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 360797..361831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(361887..363599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 363725..363976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 363973..364149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 364173..364403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(364432..365769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(365863..366666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(366755..368056) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene ahcY CDS 368230..369411 product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUI9 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene aruH CDS complement(369430..369915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887064.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(369912..370379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391287.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(370478..370948) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(370945..372114) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H09 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(372166..373938) product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ6 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(373952..374260) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene ptsH CDS complement(374262..374687) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(374754..375677) product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(375691..376110) product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(376136..377905) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(377902..378621) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 378909..379646 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090865.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 379798..381402 product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene pckA2 CDS 381644..382018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(382031..382555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(382581..385424) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 385633..386259 product generic methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(386256..386438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 386554..387555 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918077.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 387545..388579 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 tRNA 388670..388746 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 sequence04 source 1..354570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(7..81) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 597..1907 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ67 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene murA CDS 1923..2441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 2497..3159 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM6 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene hisG CDS 3149..4450 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene hisD CDS 4464..4988 product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL90 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 4996..5496 product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 5594..5812 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL88 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene infA CDS 5823..6452 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQN0 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 6445..7764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 7781..8011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(8016..9839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(9861..11066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 tRNA 11236..11311 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 11787..12164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(12272..12592) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(12728..16249) product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(16253..19255) product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(19279..20043) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(20060..21106) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(21097..21627) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140033.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(21624..24080) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(24170..24850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(24872..26299) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 26580..27053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(27033..28181) product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene queG CDS complement(28204..29328) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR0 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene tgt CDS complement(29325..30365) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXQ9 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene queA CDS complement(30375..30950) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 31310..31504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 31692..31904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(31947..33494) product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(33588..34052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 34171..35130 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VG9 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene aroK CDS complement(35127..36278) product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946904.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 36579..37208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 37261..38199 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 38269..38436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 38540..39238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 39435..40841 product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWB6 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(41145..42455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(42532..44109) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 44222..44893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 44981..45745 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(45752..46168) product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene mutT CDS complement(46165..46722) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918206.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(46734..47966) product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene argJ CDS complement(48001..48930) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE5 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(49092..50000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(50234..51379) product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 51609..54335 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXV5 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene secA CDS complement(54381..54857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(55152..55712) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(55709..57841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 57964..58413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(58414..59175) product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H209 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene ubiG CDS 59313..60542 product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 60546..62819 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 62994..64424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 64548..65696 product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J241 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene gcpE CDS 65821..67065 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene hisS CDS 67077..68369 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE2 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene hemA CDS 68366..69421 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene prfA CDS 69421..70290 product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE0 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene prmC CDS complement(70549..70752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 70693..71316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 note possible pseudo, frameshifted CDS complement(71401..71850) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976508.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(71885..72559) product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 72897..75515 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWD8 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene clpB CDS complement(75573..76322) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y582 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene map2 CDS complement(76406..76945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55366 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(76935..77243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(77288..77917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(77943..78713) product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(78710..79741) product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920694.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene flmD CDS 79828..80889 product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 80891..82600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192726.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 82626..84464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 84461..86191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(86199..87068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(87237..87596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(87748..88500) product nopaline transport system permease protein NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35113 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene nocM CDS complement(88504..89223) product nopaline transport system permease protein NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35118 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene nocQ CDS complement(89307..90158) product nopaline-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35120 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene nocT CDS complement(90217..91005) product histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(91119..92576) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387793.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(92576..93058) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(93055..93603) product thiol:disulfide interchange protein CycY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709715.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(93605..95599) product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(95596..96051) product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF4 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene ccmE CDS complement(96032..96223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(96356..97081) product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(97191..97856) product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(97853..98674) product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF0 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene ccmA CDS 98961..100154 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088770.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 100197..100997 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 101128..101727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(101776..102108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086763.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(102206..104998) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene acnB CDS complement(105276..106310) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(106325..106828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(106825..107628) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887781.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(107600..108199) product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 108310..109170 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 109295..110155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(110198..110413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 110471..111901 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931176.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(112042..112515) product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD54 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene queF CDS complement(112643..113770) product gamma-butyrobetaine,2-oxoglutarate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 113957..114859 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523143.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 115103..115867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(115944..117467) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 117731..118162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 118370..118924 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528613.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(119096..119971) product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523151.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(120018..120404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(120551..121282) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 121527..123824 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967611.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(123831..124907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 125362..126900 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(126937..128331) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 128538..128942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 128959..129867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 129864..130490 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 130535..131281 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103289.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(131368..133023) product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV4 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene groL2 CDS complement(133041..133331) product co-chaperonin GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001326101.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene groES CDS 133711..133974 product protein usg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088370.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(134014..134913) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388364.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(134910..135950) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 136269..136904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 136911..137882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 137882..138094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 138212..139291 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QR8 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene ctaA CDS 139378..140658 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532989.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(140742..141035) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9V8 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene rpmB CDS complement(141124..141351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(141479..141991) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 142275..142589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(142602..143459) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388273.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(143512..144723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(144745..145812) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX27 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene pyrD CDS complement(145820..146185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970930.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 146350..147195 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_766869.2 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene ilvE CDS complement(147246..147686) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(147812..148135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(148288..149808) product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(149895..151766) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066780.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(151791..152792) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(152861..153439) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 153556..153822 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 154016..154297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(154279..154845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(154970..155419) product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(155468..156826) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(156826..157956) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene aroB CDS complement(157997..158578) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW7 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene aroK CDS 158933..160870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 160875..161810 product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A437 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene xerD CDS 161892..162848 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene accA CDS 162961..163947 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361489.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene yhiI CDS 163940..166678 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene rbbA CDS 166683..167804 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(167814..168674) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(168697..168963) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(169077..169817) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 169922..170863 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 171099..172811 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090030.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(172868..173518) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(173598..174431) product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087316.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 174603..175001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(174998..176611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 177185..177946 product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene kduD CDS 177977..179140 product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089743.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 179241..179861 product potassium transporter KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106276.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 179861..181741 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 181844..182416 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707822.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 182401..182877 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(182865..183770) product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972258.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 183926..184894 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 184973..186772 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 186811..188163 product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene pcaB CDS 188239..188883 product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729327.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene eda CDS 188880..189845 product fructokinase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527149.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 189912..191354 product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G3 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(191385..194564) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969721.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(194561..195682) product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529678.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(195829..197250) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene hipO CDS 197493..198335 product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976385.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(198348..199163) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(199160..199771) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J588 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(199984..200316) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(200321..200542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 200894..202855 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7F2 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 202921..203928 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CFL0 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene gapA CDS 203956..204885 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 204962..205606 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene thiE CDS 205626..207152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(207177..209375) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(209368..211257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 211556..212122 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene efp CDS 212193..212996 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 213147..215093 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085334.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(215211..215390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(215507..215995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 215940..216371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 note possible pseudo, internal stop codon, frameshifted CDS 216494..217630 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388829.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 217643..219235 product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140137.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 219649..220674 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 220784..221317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 221376..222953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038755.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(223258..224043) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene pcaD CDS 224290..225696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 225837..226841 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 226931..228733 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNY6 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene lepA CDS complement(228924..229358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(230301..232412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(232409..235186) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972668.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(235197..236054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(236069..237079) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 237165..237752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104740.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 237752..238372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 238382..239590 product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918296.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 239593..240363 product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(240376..240813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(241052..241915) product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZX1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene hemF CDS complement(242007..242795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(242908..244392) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336796.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(244397..245800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(245902..246630) product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709691.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(246630..247586) product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND3 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene hemC CDS 247612..248700 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene tsaD CDS 248697..249719 product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene gpsA CDS 249734..250153 product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(250160..250888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(250928..252106) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene phnM CDS complement(252218..252547) product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(252544..253320) product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene dpm1 CDS complement(253417..255051) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 255211..256470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 256576..257064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(257068..257988) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 258113..258712 product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32HQ6 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 258740..259441 product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 259773..260420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 260488..261720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 261773..262249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 262246..263169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(263196..264188) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085169.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene lspL CDS 264502..267990 product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390034.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 268071..268841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972644.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(269017..270057) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 270677..273016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 273001..273180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(273177..274262) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 274794..277421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(277620..279044) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709055.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(279072..280031) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(280140..280820) product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083679.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(280813..281766) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene cysK CDS 281816..282793 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 282841..283074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(283088..284233) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(284248..284835) product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 285066..285470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 285493..287067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(287080..287517) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y731 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene aroQ CDS 287695..288579 product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(288589..289827) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene fldY CDS 289957..290691 product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969450.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 290694..291656 product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 291656..292327 product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 292320..293375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969456.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 293409..294296 product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969452.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 294531..295625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 295699..297714 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706260.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 298000..299031 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 299097..299591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 299584..300981 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 301037..302836 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887690.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 302888..304369 product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461336.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(304457..305755) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(305752..306762) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(306764..307468) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(307465..308247) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(308319..309506) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(309633..310562) product lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528299.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(310579..311295) product putative dimethlysulfonioproprionate lyase DddL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6L0 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene dddL CDS complement(311313..312305) product acrylyl-CoA reductase AcuI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6K9 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene acuI CDS complement(312319..312966) product transcriptional regulator AcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6K8 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene acuR CDS 313246..313848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(313832..315331) product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973412.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene cysG CDS complement(315306..317975) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(317972..318331) product tRNA-(guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(318328..320778) product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887237.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(320799..322541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(322553..323647) product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(323726..325108) product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(325413..326579) product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(326576..327151) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 327796..328644 product formate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 328672..330444 product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 330472..330921 product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IA8 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene cynS CDS 331118..331681 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390150.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 331697..332785 product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 332935..335406 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 335418..336329 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533591.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 336326..337108 product iron-hydroxamate transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704433.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 337098..337985 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533593.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 338002..339963 product Fe3+-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533592.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 340091..341800 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939091.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(341813..343555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(343570..344667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(344657..346234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(346231..346965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(347075..347872) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 347795..348058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(348034..348849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(348865..350100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(350229..351077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(351074..351970) product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836184.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(351967..353361) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(353351..354196) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888F0 transl_table 11 codon_start 1 locus_tag LOCUS_23450 sequence05 source 1..334495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 851..2593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2629..2928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(3451..3864) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 3942..4337 product mercuric transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 4350..4682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 4693..4932 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 4947..6377 product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DZ63 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene merA-1 CDS complement(6576..7745) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256133.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(7811..8479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 9574..12087 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 12081..12527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 12663..14099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 14467..15048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 15060..15479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886973.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 15576..15716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 15713..16198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 16195..16773 product thiol:disulfide interchange protein CycY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709715.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 16770..17291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 17288..17569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 17598..17882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 17941..18597 product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 18594..19031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384123.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 19031..19645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 19666..20139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 20132..20869 product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719288.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene ccdA CDS complement(20879..21301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 note possible pseudo, frameshifted CDS 22297..22722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 22772..23113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 23554..24162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 24183..24584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 24581..25240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 25272..25736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384123.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 25736..26362 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 26671..27720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 27725..28180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 28186..28671 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG40 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene lspA CDS 28917..29333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(29513..29812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(29802..32048) product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942791.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(32330..34990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(34996..35838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(36066..36473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 36832..37251 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(37330..38691) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 39593..39922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529383.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(39930..41090) product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ8 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene gci CDS complement(41216..41509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 41634..42242 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969312.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 42314..43150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 43275..43676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(43770..44930) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 45023..45607 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(45622..46065) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 46229..47164 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CTU5 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene arcA CDS 47204..48412 product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9P3 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene rocD CDS complement(48502..49065) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090707.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 49176..49829 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090706.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(49845..50825) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887K3 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene glk CDS 51025..52095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(52108..53148) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(53148..54053) product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene rimK CDS complement(54050..54532) product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 54652..55704 product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064880.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 55924..57441 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 57550..58467 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383488.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene appB CDS 58472..59380 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383487.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene dppCch1 CDS 59417..60421 product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762885.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 60418..61386 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267551.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 61409..61858 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 61941..62828 product endonuclease/exonuclease/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529690.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(62798..63505) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974790.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 63615..64502 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532538.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(64492..65427) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338391.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(65537..66226) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085107.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 66396..67109 product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM60 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene piuC CDS complement(67140..67367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(67398..67928) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 68072..69055 product trans-2-enoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(69057..69905) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(69918..70682) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(70669..70887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 71041..72057 product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 tRNA 72146..72222 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(72344..73297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 73918..76557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(76580..77269) product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921176.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(77266..77715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(77870..79123) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974558.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 79430..80191 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974559.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene dgdR CDS complement(80213..80893) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(80890..81549) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 81636..82799 product putative aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701595.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(82815..83927) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58524 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene solA CDS 84172..85911 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063696.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene ilvD CDS 85986..86294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(86377..87105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(87406..88149) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(88216..88419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 88596..89033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(89049..89615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(89612..90562) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA6 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 90790..91605 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387844.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 91608..93131 product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067317.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(93154..94038) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCP8 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene rpoH2 CDS complement(94196..95047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(95191..95688) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387840.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(95952..96296) product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067320.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(96343..96807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(96920..97318) product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387836.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(97315..100026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 100153..102060 product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYB8 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene htpG CDS 102189..102575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(102801..103409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 103712..103993 product protein killer gene system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816230.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 103993..104292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 104578..105567 product putative phosphoribosylaminoimidazole-succinocarboxamide synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCE7 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene purC2 CDS complement(105635..106138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(106135..106485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 106605..106892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003858627.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(106951..107592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 107916..110042 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529009.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 110413..111012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(111025..111507) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 111621..112979 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4F5 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene hmgA CDS 112981..114234 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204081.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene fahA CDS 114261..115211 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(115264..116061) product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5M4 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene cpdA CDS complement(116175..117413) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(117563..118459) product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKB7 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene ugpE CDS complement(118456..119445) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(119447..120583) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528416.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(120828..122255) product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(122430..125297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(125718..125960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 tRNA complement(126343..126417) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 126648..127679 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 127740..128573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 128693..129415 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974629.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 129671..130726 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 130878..131492 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 131544..133148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038755.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(133221..134348) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533412.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(134365..135528) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(135572..136417) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(136426..137412) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(137440..138441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(138568..140256) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(140267..140752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(140834..141805) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(142022..143032) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 143200..144015 product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FY1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene nadX CDS complement(144056..146554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 146758..148539 product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085656.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene ggt CDS complement(148536..148796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 148936..149442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(149435..150148) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 150305..150631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 150719..151063 product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084371.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 151074..153374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 153371..153784 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 153911..154729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141761.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 154732..155112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 155240..155701 product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHM4 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(155749..156207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(157057..157389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(157391..158227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016190.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 158607..158963 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 159044..159430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228304.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(159478..160290) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J061 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene thiM CDS complement(160568..161158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 161350..163143 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(163163..164176) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(164421..166133) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(166412..167674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(167671..168501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(169006..169935) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(169950..170441) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(170462..172009) product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(172179..172397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 172362..172877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 172874..173821 product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530436.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(173823..175385) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709449.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(175397..176551) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089362.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene emrA CDS 176734..177396 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089363.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(177408..177851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(178242..178475) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970127.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(178387..179181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(179697..180803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(180803..181372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(181369..183036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(183148..183951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(183956..184912) product guanidinopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6K2 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene gpuA CDS 185034..186152 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 186250..187725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(187733..189136) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 189313..190047 product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 190050..191909 product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 191906..192787 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230608.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 192804..193517 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 193695..194936 product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709425.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene speF CDS complement(194997..195749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(195834..196739) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 196864..197382 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 197379..198098 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530014.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 198202..199560 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(199557..199892) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086810.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(200028..200453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(200618..201232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(201298..202074) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWW7 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene proC CDS complement(202118..202621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(202851..203198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 203355..204347 product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP72 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene hldD CDS 204365..205180 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ0 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene lgt CDS 205177..206307 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 206304..207068 product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP8 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 207072..208220 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 208326..209255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 209383..210333 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP6 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene prs CDS 210487..211131 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene rplY CDS 211188..211841 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI49 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene pth CDS 211845..212948 product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV3 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene ychF CDS complement(212961..213833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(213987..214571) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090892.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 214698..215612 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090893.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(215590..216075) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 216340..217008 product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 217249..218859 product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(218897..220534) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 220723..221664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 222068..224248 product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 224588..225322 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525644.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(225335..225856) product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(225867..227033) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(227215..228543) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ62 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene pyrC CDS 228751..229884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 229888..230946 product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(230953..231615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(231786..232337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(232381..233688) product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNB1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(233703..234926) product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(234966..236453) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(236883..237782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 238035..238898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(238901..240505) product putative 2-ketoarginine decarboxylase AruI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUI8 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene aruI CDS 240654..241400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087151.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 241550..242467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 242464..244908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 244905..245777 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 245840..246802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 247010..248647 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061643.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 248647..249972 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene aprE CDS complement(249982..251151) product serine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(251174..254080) product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088782.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(254174..255031) product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene bcpA CDS 255184..256581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 256834..257397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 257427..258185 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810311.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 258230..258898 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(259038..259808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(259790..260572) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 260603..261853 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391123.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 261843..262823 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(262864..263721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 264101..266020 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene thrS CDS 266122..266610 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene infC CDS 266770..267807 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9F7 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene hemH CDS 268209..268778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 268999..269511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(269711..272110) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M6 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene pheT CDS complement(272107..273183) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene pheS CDS complement(273318..273683) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene rplT CDS complement(273699..273938) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNI0 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene rpmI CDS complement(274054..274785) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(274822..276000) product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531018.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(276117..276638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 276829..278433 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXH3 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene lysS CDS 278524..279132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(279205..279867) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 280077..281288 product cobalamin synthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538090.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(281304..282599) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973446.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene ordL CDS complement(282681..283430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(283560..284663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(284744..287524) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 287612..288865 product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085418.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 288862..289323 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089995.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene lrp CDS 289555..289926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(290085..290468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 290926..291534 product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195674.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 291585..292448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104227.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(292445..293194) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(293433..295112) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT17 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene leuA CDS 295509..296720 product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKP5 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(296838..297539) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(297539..298291) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(298288..299262) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(299266..300189) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(300288..301472) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083872.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(301631..303199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(303387..305753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 305969..308062 product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225692.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene bioW CDS 308441..310102 product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205070.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 310358..311530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 311794..312825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 312937..313128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(313160..313543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(313707..314354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 314235..314582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 314943..325004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 sequence06 source 1..232959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 527..1039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(1102..1545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971846.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(1595..2989) product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(3056..5077) product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389694.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(5077..5883) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(5887..7494) product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene mccB CDS complement(7505..8125) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(8154..8828) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(8841..9242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(9276..9887) product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971055.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene tag CDS complement(9901..11073) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389701.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(11106..11597) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840937.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(11590..11982) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(12027..13559) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSV0 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(13563..15854) product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene maeB tRNA complement(15970..16056) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 16187..16876 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA5 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene lipB CDS 16964..17263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(17260..17682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(17690..17905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 18255..19238 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPG0 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene pyrB CDS 19235..20563 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF9 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene pyrC CDS 20556..21185 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene plsY CDS 21247..22389 product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 22452..25142 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE8 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene topA CDS 25154..27418 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE7 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene rnr CDS 27528..29078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 29177..29344 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I8 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene rpmG CDS complement(29426..30811) product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene pleD CDS complement(30818..31213) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640499.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene divK CDS 31350..32276 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 32427..33662 product DNA polymerase IV 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QM8 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene dinB1 CDS complement(33684..34496) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531768.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 34734..35465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 35694..36023 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159242.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(36104..36934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 37299..38447 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene rnd CDS complement(38476..40005) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(40009..42153) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSD4 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene ppk CDS complement(42332..43114) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090612.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(43160..43876) product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(43898..44986) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(45038..46312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 46750..47550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 47547..48215 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene purN CDS 48312..48449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(48558..48980) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MS3 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene ndk CDS complement(49150..50367) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(50408..50857) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(50878..52365) product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene pepA CDS 52605..53729 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 53726..54820 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(54821..55054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 54974..57040 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA6 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene lptD note possible pseudo, internal stop codon, frameshifted CDS 57073..58380 product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA7 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 58389..59408 product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGD4 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene pdxA CDS 59401..60246 product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA9 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene rsmA CDS complement(60315..63035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 63604..64845 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 64980..67421 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 67628..68587 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ5 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 68651..69385 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(69434..69688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(69945..70796) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(70837..71547) product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene psd CDS complement(71563..72720) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 72845..73429 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI3 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 73559..74773 product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI4 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 74870..75220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(75248..77572) product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(77633..78904) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(78939..79439) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259757.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(79499..80557) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(80672..81466) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(81562..81741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 81834..82574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818563.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(82571..82996) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 83066..83665 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968400.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(83700..84272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529457.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(84277..84759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 85208..85654 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240402.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(85670..86572) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528259.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 86691..87584 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529403.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(87590..89242) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(89239..90132) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086127.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(90132..91076) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(91193..92773) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(92951..93580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 93676..94161 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(94158..94400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 94482..95186 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(95208..96041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(96049..97350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(97531..98592) product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(98589..100385) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 100486..102279 product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 102426..103316 product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 103326..104105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963400.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 104074..104712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 104728..106701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(106688..107761) product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene purK CDS complement(107761..108258) product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M67 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene purE CDS 108429..109658 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533037.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(109651..110565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(110583..110789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 110881..111435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390539.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 111447..112136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 112141..113487 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930606.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(113491..114180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(114177..114767) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK0 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene def CDS 114981..115184 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene rpsU CDS complement(115285..115989) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 116132..117157 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708358.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 117488..118309 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 transl_table 11 codon_start 1 locus_tag LOCUS_27640 tRNA 118392..118473 product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 118513..119349 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971635.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene mvrA CDS 119561..120124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 120277..121704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384497.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 121704..122645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 122648..123448 product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061413.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 123475..124206 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384494.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(124214..124564) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(124577..125047) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088276.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(125260..127467) product isoquinoline 1-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888272.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(127471..127929) product isoquinoline 1-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525768.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 128155..128985 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531763.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(128982..130199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974706.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 130264..130671 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(130861..131124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(131289..132926) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089435.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 133107..134129 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082945.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 134183..134950 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082944.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 134943..135743 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082943.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(135748..136581) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948447.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 136748..137764 product peptidase C45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190976.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 137800..139002 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975697.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(138963..139157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 139129..139620 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 139625..140845 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040344.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(140932..142542) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388915.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(142747..143298) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(143580..144233) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 144322..145200 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 145304..146161 product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene tauD CDS 146314..147558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 147566..148693 product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(148703..149575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(149682..150614) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(150687..151844) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(151867..153243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(153268..153975) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 154278..155921 product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813717.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 155997..156968 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083812.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 156974..157876 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083811.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(158035..159891) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065127.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 160051..160776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 160773..161111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(161129..163060) product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21296 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene flbA CDS 163425..163931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 164107..165801 product chemotaxis sensory transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388864.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 166185..166496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 166644..169133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 169202..169861 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMH9 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(169863..170744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 170886..172961 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390065.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 172974..173426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(173468..175363) product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709900.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene phbC1 CDS complement(175856..176152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(176360..176794) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 176945..177460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(177538..178890) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 178895..179260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 179257..179736 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6M2 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene ribH CDS 179855..180871 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAW9 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene msrP CDS 181043..181612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(181609..182421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 182541..182954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 183054..184022 product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4G3 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 184159..185058 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(185430..186809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(187159..188454) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970535.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(188447..188950) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538084.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(189014..190006) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538086.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(190056..190943) product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUJ7 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene aroE CDS 191130..192791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 192849..194744 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706100.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 194868..195884 product NADPH-dependent ferric siderophore reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529930.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(195908..196915) product bacteroid development protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08120 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene bacA CDS complement(197025..199280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 199483..199944 product putative N-acetyltransferase YsnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94562 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene ysnE CDS complement(199955..200743) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088777.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 200820..201209 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206717.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene modE CDS 201278..202075 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808340.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene modA CDS 202083..202760 product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene modB CDS 202768..203904 product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TG72 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene modC CDS 204015..205031 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 205117..206814 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 206837..208006 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(208036..208518) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(208563..208916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 209028..209468 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971197.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(209522..210526) product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDG7 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene dusA CDS complement(210639..211976) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702955.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 212247..212525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 212879..213841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309798.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(213865..214275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088530.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 214409..215206 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 215263..215727 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090358.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(215816..216712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098364.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(216792..217625) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969060.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 217805..218440 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887706.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(219078..219353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(219374..220345) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P736 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene apbE CDS complement(220326..222533) product NADPH flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(222546..223016) product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(223054..223407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(223579..224934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(224927..225244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 225391..226050 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 226047..227414 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140446.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(227827..228732) product Mrr restriction system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546249.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(228792..231332) product type III restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932833.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 misc_feature complement(231325..>232959) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932832.1:type III restriction endonuclease locus_tag LOCUS_28720 sequence07 source 1..224628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..1936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(1996..2268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(2487..4592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 4786..6414 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(6509..7285) product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7A0 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene cpdA CDS 7594..8898 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 9019..9927 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 9929..10789 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086912.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 10814..11878 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904134.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 11903..12655 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296480.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 12936..13928 product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU18 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene dctP CDS 14026..14535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 14535..15812 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(15867..16256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(16383..18947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(19051..19944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(19994..21064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(21205..21807) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89CM3 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene sodF CDS 22004..22795 product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AA2 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene cpdA CDS 22863..23819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(23822..24124) product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PF1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 24226..24612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391329.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 24714..25172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 25169..25393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 25539..25838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 25843..26271 product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene nsrR CDS complement(26278..26901) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971535.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(26912..28822) product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ52 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene mutL CDS complement(28819..30147) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903465.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(30232..31587) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390721.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(31598..32944) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(33047..33700) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(33798..34388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(34420..34911) product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ33 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene lspA CDS complement(34942..37749) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ34 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene ileS CDS complement(37791..38723) product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(38736..39191) product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 39329..40102 product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088574.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(40115..40687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(40760..42172) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085698.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 42373..43383 product sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 43414..43905 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199373.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 44006..44842 product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 45006..45392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(45408..46052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(46257..46646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(46728..47177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(47236..47721) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 47985..48779 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM2 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 48865..51276 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(51280..52092) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527951.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 52145..52459 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948422.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(52456..53472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 53514..53723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(53724..54635) product dehydrogenase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528721.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(54645..55397) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090842.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(55490..55978) product protein-S-isoprenylcysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709235.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(56021..56605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888592.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(56688..57032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 56916..57821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114172.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 57928..59118 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 59395..59943 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972294.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 60104..61363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 61566..62738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 62738..63346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(63393..65333) product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene acsA CDS complement(65454..66107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 66224..67060 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 67135..68283 product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(68381..68551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 68924..69967 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529114.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene trpS CDS 70140..71312 product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP73 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene argD CDS 71338..72282 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP74 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene argF CDS 72310..73272 product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q9 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 73327..73923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(73979..74461) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(74566..76689) product suppressor for copper-sensitivity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 76837..77427 product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 77576..77860 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(77894..78130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082872.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(78291..79493) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529349.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(79613..80506) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382879.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 80632..81582 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(81599..82210) product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene rimJ CDS complement(82341..83612) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(83609..85033) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337015.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene thrC CDS 85143..86039 product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087376.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(86036..86611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096602.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(86639..87106) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809010.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 87236..87493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528043.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(87526..89019) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(89012..89743) product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ9 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(89833..90207) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(90242..91027) product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene coxC CDS complement(91074..91685) product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9G7 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene ctaG CDS complement(91689..91823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(91829..92647) product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene ctaB CDS 92628..92810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(92803..94389) product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31833 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene ctaD CDS complement(94416..95273) product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6U4 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 95571..97004 product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 97125..97463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 97465..98919 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389995.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(98936..99859) product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene rfbQ CDS complement(99846..100907) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(101179..102033) product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6R0 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene speE1 CDS complement(102030..102539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(102825..103229) product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(103633..104202) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337576.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene pfpI tRNA complement(104601..104674) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 104866..106191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 106398..106790 product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS7 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene apaG CDS 106879..107523 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene folE CDS complement(107520..107834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 107721..109109 product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 109134..110303 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 110400..112187 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene ilvD5 CDS 112367..113128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(113147..114415) product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 114547..115326 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63KE1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene hyi CDS 115323..116315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173979.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(116321..117010) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene ctpA CDS complement(117130..118059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 118140..119381 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230809.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 119456..119932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(120041..120523) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0G1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene bfr CDS 121213..122694 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Q71 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene cobQ CDS 122744..123274 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene ppiB CDS 123335..123799 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene ppiB CDS complement(123856..124197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 124358..125350 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529637.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 125370..126989 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 126986..128092 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970668.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 128102..129079 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536145.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 129076..129900 product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVK6 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene xapA CDS 129893..130633 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE4 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene deoC CDS 130646..131959 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE3 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene deoA CDS 131959..133182 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJ99 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene deoB CDS 133193..133711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 133704..134303 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(134313..135230) product transporter RarD family, DMT superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003727.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 135775..137532 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391412.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(137662..138078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(138118..138864) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(138890..139738) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887194.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 139855..140772 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene dgoK CDS 140798..141709 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066710.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(141853..142905) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228694.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(143032..144099) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389542.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(144255..146927) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085325.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene ppdK CDS complement(146938..149004) product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ43 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene glyS CDS complement(148997..149923) product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene glyQ CDS complement(150043..150468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(150474..150848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389509.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 151000..152508 product 3-polyprenyl-4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(152517..153071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 153249..154595 product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 154698..155183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(155180..156160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 156390..157160 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388336.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 157174..158220 product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 158323..159048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 159045..160319 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene kdtA CDS 160316..161305 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV9 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene lpxK CDS complement(161310..162128) product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(162125..163726) product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY31 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene xseA CDS 163778..165067 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHN3 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene purD CDS 165201..167003 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707282.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(167022..167297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(167426..168283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(168464..170464) product acetoacetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3R3 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene acsA2 CDS 170628..171173 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886773.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 171344..172324 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(172331..172828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 172951..173712 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(173814..174512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(174690..175415) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN56 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene cobB CDS complement(175425..175880) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J463 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene tadA CDS 175958..177079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 note possible pseudo, internal stop codon, frameshifted CDS 177030..177602 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383306.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 177630..178100 product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 178197..178610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 178607..179317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530548.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(179349..180233) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083874.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(180233..180982) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888330.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(180979..182037) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(182034..182930) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(183034..184287) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(184447..185283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 185763..187199 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974078.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 187320..188054 product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene frdB CDS 188054..188383 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723680.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 188380..188721 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339082.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 188718..190475 product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene sdhA CDS 190575..191879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 192266..192796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 192864..194000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776582.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 194123..194716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(194959..196020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 196369..196968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 197144..198106 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339080.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene ttdA CDS 198070..198747 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene ttdB CDS complement(198826..199947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(200434..203139) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 203354..204166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(204403..205458) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086445.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 205711..206103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529135.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(206186..206482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917958.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(206538..207407) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene pheA CDS complement(207427..208182) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPI7 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene kdsB CDS 208451..209053 product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ37 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene cycM CDS 209124..209900 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 210117..211049 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103054.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(211077..211457) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(211550..212938) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 213133..213792 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(213812..214789) product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNW9 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene cobD CDS 215091..215324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(215358..215888) product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338347.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 215979..216182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(216190..217710) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917993.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 217930..218928 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971592.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene serA CDS complement(219126..220271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(220399..221265) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723694.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 221414..222649 product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene bcd CDS 222671..224281 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086799.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 sequence08 source 1..220096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(393..1487) product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVM6 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(1718..2731) product delta(1)-pyrroline-2-carboxylate/Delta(1)-piperideine-2-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I492 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene lhpD CDS complement(2815..2979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(2990..4990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(5073..6095) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969663.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(6434..7033) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974672.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene nahD CDS complement(7146..8084) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338543.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(8081..8620) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(8617..10251) product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene acsA CDS complement(10396..12426) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388895.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(12369..12578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(12890..13783) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064999.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(13909..14844) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814356.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 15337..17268 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814355.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(17395..18390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807559.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(18518..20047) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(20055..20504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 20676..21455 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(21491..21907) product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065002.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene pcaC CDS 22087..23442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065007.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 23467..24249 product beta-D-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065000.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 24402..25088 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814358.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 25181..25993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348532.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 26745..27101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 27037..27363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391157.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 27360..27638 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 27818..28132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 28464..28778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(28836..29729) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338926.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 30372..30920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895638.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 30973..32889 product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene copA CDS 32893..33594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 33682..34923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 34920..35384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(35459..36796) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(36793..37509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(37506..38171) product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(38164..38445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(38534..39172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 note possible pseudo, frameshifted CDS 39296..39541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(39842..40207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(40314..40679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(40681..41160) product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039876.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(41157..41465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(41491..41916) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720046.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(41975..44446) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(44962..45906) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene pyrF CDS complement(45948..47363) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(47436..48743) product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 48881..49651 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 49706..50029 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 50109..50354 product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK2 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(50358..50726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(50961..52049) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene phnM CDS 51939..52145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 52206..52949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388791.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(52955..54100) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene hisC CDS complement(54207..54680) product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 54872..55786 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385382.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene sitA CDS 55885..56727 product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385381.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene sitB CDS 56724..57608 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385380.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene sitC CDS 57608..58465 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538025.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene sitD CDS complement(58533..58745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(58900..59976) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(60011..60436) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314345.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene nifU CDS complement(60447..60896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037396.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(60975..62030) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(62100..63092) product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(63161..65317) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390232.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(65314..67239) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 67442..68920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 69051..70586 product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J62 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 70645..71775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 71792..72112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 72120..72860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 72893..74014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 74031..74999 product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 75034..76092 product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 76092..77240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088176.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(77237..78208) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088662.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 78455..79159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(79199..80425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(80500..83172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 note possible pseudo, internal stop codon, frameshifted CDS complement(83169..84233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 note possible pseudo, frameshifted CDS complement(84230..85099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(85096..85962) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF31 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(85962..86924) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(87113..87991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 88239..88460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(88525..89445) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene aroG-2 CDS complement(89476..90657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(90654..92465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388309.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(92462..93898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 93779..94129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 94313..95032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061927.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(95010..96686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(96710..98017) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 98017..98214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 98241..99983 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599398.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 99999..101387 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089709.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene aprE CDS 101440..102771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 102743..105151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 105249..105974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(105980..106696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(106750..108360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(108808..110661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(110709..111785) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(111854..112804) product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 112805..113023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 112990..113448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 113589..113966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 113990..115195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390673.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 115185..116288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(116298..117218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(117215..118162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940459.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(118184..119335) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088732.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(119340..120524) product perosamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(120524..121522) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene wcaG CDS complement(121636..122784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(122781..124877) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 125152..125955 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(125977..127305) product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975620.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 127360..128226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(128347..129267) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022257.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(129417..130076) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRD8 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene pyrE CDS complement(130073..131383) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815570.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(131745..133958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 134173..135048 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 135057..135614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 135611..136291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 136288..136950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 136947..137660 product CMP-N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI0 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene neuA CDS complement(137686..138387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 138750..139814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 139880..140515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(140519..140704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 141346..142374 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969596.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene cobW CDS 142416..146174 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969595.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene cobN CDS 146225..146875 product cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972580.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene cobO CDS complement(146890..148173) product flagellin modification protein FlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920697.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene flmF CDS complement(148361..149578) product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085418.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(149627..150655) product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(150662..151366) product hexapeptide transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene perB CDS complement(151363..152253) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391125.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 152392..153723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 154375..154839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(154852..156300) product nodulation protein NolO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45269 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene nolO CDS 156274..156570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 157035..158084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 158247..158831 product sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 158859..159584 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03C46 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 159678..160643 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771860.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 160733..161725 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GI5 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 161728..162732 product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 162746..163798 product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(163802..164458) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771848.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(164451..165338) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771849.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(165340..166632) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957733.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(166637..167563) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957732.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(167579..169294) product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C7G1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 169553..170638 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 170653..171306 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene cobH CDS 171303..172535 product precorrin-6Y C(5,15)-methyltransferase [decarboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZU0 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene cobL CDS 172540..173259 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526969.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene cobI CDS 173256..175052 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258424.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 175049..175813 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391131.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 176139..177107 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337193.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(177160..177915) product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(177918..179009) product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8GDE1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene cbiD CDS 179171..180013 product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene cobA CDS 180018..181346 product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(181406..181909) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(182486..182707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 182591..183538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 tRNA 183709..183784 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(183819..184658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 184850..185206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 185211..185708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(185739..186176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(186343..187065) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709723.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 187235..187606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 187603..188244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(188276..188671) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531853.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 188835..189281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 189473..190432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(190448..191143) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MS6 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene queC CDS complement(191232..191774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(192229..193140) product Mrr restriction system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546249.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(193284..194408) product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE14 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene rlmN CDS complement(194599..195129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 195383..195928 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 195931..196638 product zinc-binding anti-sigmaE4 factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263592.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene chrR CDS complement(196635..197198) product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 197320..198381 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 198506..199741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(199702..199938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 199840..201615 product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM3 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene aspS CDS 201619..204312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(204309..206159) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene asnB CDS complement(206311..207432) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389350.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(207458..208324) product glucose-1-phosphate thymidylyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37779 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene rfbA CDS complement(208344..209225) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(209231..210304) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8I5 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene rffG CDS complement(210318..210878) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 211035..211925 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 211925..212353 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886840.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 212540..215089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(215135..217138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 sequence09 source 1..188839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1077 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RN70:leucine--tRNA ligase locus_tag LOCUS_33060 CDS 1070..1588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 1601..2641 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene holA CDS complement(2648..3712) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(3709..4536) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(4508..5182) product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene rsmG CDS complement(5148..7010) product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN76 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene mnmG CDS complement(7128..8489) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN77 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene mnmE CDS 8593..10620 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 10617..11105 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN80 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 11194..11892 product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 11911..12885 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene qor CDS complement(12972..14174) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN82 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene rho CDS complement(14440..14874) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(14929..15960) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene hemE CDS 16360..17193 product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 17193..17831 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN87 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 17837..18433 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58100 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene coaE CDS 18426..19118 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(19119..19640) product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TE7 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene secB CDS complement(19687..20241) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547363.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(20296..20814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 20975..21646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 21687..22868 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391354.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 22935..23711 product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188391.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 23711..25144 product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 25144..25830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 25852..26454 product smr protein/Muts2-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 26474..26845 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(26901..27320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 27435..27899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(27975..28787) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103062.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 28868..30088 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090142.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene fsr CDS complement(30078..31385) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBH6 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene hslU CDS complement(31438..32001) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA2 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene hslV CDS 32170..32778 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA4 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene hisB CDS 32775..33452 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA5 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene hisH CDS 33464..34018 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102722.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 34015..34758 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene hisA CDS 34758..35519 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA7 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene hisF CDS 35516..35836 product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50935 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene hisE CDS 35868..36233 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(36244..36642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088462.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 36944..38206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 38277..39797 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 39872..40711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(40716..41654) product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene gshB CDS complement(41736..42569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(42573..43163) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391438.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(43173..43574) product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCV0 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(43574..44488) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SN5 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene rsmI CDS 44569..46074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(46109..47323) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene hemN CDS complement(47313..47960) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(47964..48695) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN60 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene rph CDS 48931..49977 product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN59 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene hrcA CDS 50097..50729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(50732..51634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391304.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 51792..53759 product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNE6 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene dnaK CDS 53885..55003 product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNE7 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene dnaJ CDS complement(55146..55685) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731619.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 55831..56637 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene dapB CDS complement(56650..57171) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 57267..57920 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY37 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene nth CDS complement(57927..58409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(58414..58932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(59100..59783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387911.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 60018..61010 product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 61003..62325 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(62336..63043) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(63072..63785) product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(63809..64633) product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8C2 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene pstB CDS complement(64644..65957) product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(65950..67332) product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(67473..68513) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(68634..70130) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391290.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(70335..72599) product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391289.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 72914..75559 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene mutS CDS complement(75556..76785) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706369.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 76906..79734 product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG2 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene glnD CDS 79801..81366 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 81447..82448 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene trpS CDS complement(82438..83832) product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085052.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 83979..84536 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 84670..85638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(85678..86685) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 86883..87578 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917948.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 87575..88051 product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917947.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 88344..89228 product ornithine-acyl ACP N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 89225..90160 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 90344..91780 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMT1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene miaB CDS 91777..92802 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391518.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 92811..93395 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS9 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene ybeY CDS 93419..94357 product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 94354..95970 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS7 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene lnt CDS 96107..96547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 96730..97899 product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene metK2 CDS 98003..98644 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene trmB CDS 98817..99314 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y659 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene rimP CDS 99364..100938 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene nusA CDS complement(100967..101308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(101321..101482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 101630..104233 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS0 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene infB CDS 104276..104722 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR9 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene rbfA CDS 104712..105638 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR8 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene truB CDS 105653..105922 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene rpsO CDS 106285..108396 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR6 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene pnp CDS 108410..109141 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196745.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene ugpQ CDS 109715..110584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(110615..111466) product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT9 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(111483..112706) product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072970.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene fabB CDS complement(112708..113238) product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene fabA CDS 113493..113942 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309975.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene irr CDS complement(113984..114529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391536.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 114663..115649 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 115650..115847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(116038..116826) product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(116832..117791) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528637.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(117900..118358) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61908 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene dut CDS complement(118355..119560) product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 119885..120331 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921021.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(120337..121401) product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919943.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(121621..123168) product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ4 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(123174..123914) product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ3 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene ubiE CDS 124085..124915 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ2 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene mutM CDS 124932..125333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 125383..126159 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 126260..126526 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMP9 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene rpsT CDS 127274..128695 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene dnaA CDS 128881..129999 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 130041..131258 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT0 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene recF CDS 131283..133733 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI6 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene gyrB CDS 133857..134477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(134499..135368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 135463..135795 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704640.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 135818..136360 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920703.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(136370..137752) product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 138086..140119 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(140132..141055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(141144..141866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(141958..143163) product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(143250..144365) product bifunctional transcriptional activator/DNA repair enzyme protein Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190110.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene ada CDS 144623..145930 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045558.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 146009..146887 product glycerol-3-phosphate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189753.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 146903..147745 product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRT5 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene ugpE CDS 147756..148826 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFU0 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene ugpC CDS 148887..149765 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 149844..151628 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 151671..152591 product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947574.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(152688..153437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(154302..155228) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086663.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(155345..155953) product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(156041..156709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(156801..157430) product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086061.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene bluF CDS complement(157427..158242) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Q75 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene cobS CDS 158370..159404 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9W4 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene cobT CDS 159421..160029 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(160014..160847) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(160844..161617) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 161759..163102 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 163181..163735 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918136.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene spdR CDS complement(163791..165035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 165409..166734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 166744..167361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 167370..169742 product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061870.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 169772..171184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(171178..172104) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103232.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(172104..172883) product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057274.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(172880..174052) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(174049..175209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(175178..176473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142196.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(176494..177315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 177461..178087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125468.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(178077..179702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(179699..180508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 180544..181956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 misc_feature complement(182081..>188839) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331491.1:hemolysin-type calcium-binding protein locus_tag LOCUS_34820 sequence10 source 1..176241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(559..1644) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931011.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(1720..2208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310724.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(2218..2673) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061534.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(2704..5340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 5552..6799 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 6846..8108 product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887335.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 8105..9232 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387982.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 9226..9819 product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229232.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 9816..10979 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene redA CDS 10976..11752 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887323.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 11749..12249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 12279..14177 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887330.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 14174..16093 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887331.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 16106..17104 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972421.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 17101..18273 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887333.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 18353..19555 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I6 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene pgk CDS 19647..19886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 20006..20542 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(20669..21616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(21613..22974) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(22999..23865) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene dapF CDS 23918..24988 product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085701.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(24990..26207) product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 26538..28001 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV60 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene ffh CDS 28046..28501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 28508..29071 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV58 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene rimM CDS 29061..29774 product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV57 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene trmD CDS 29944..30333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(30426..31184) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971130.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 31385..32794 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV55 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene leuC CDS 32806..33420 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X27 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene leuD CDS 33568..34686 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV53 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene leuB CDS 34788..35813 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV48 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene asd CDS 36294..36743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(36759..37616) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV45 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 37761..38663 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(38667..39188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389286.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 39862..40245 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene sdhC CDS 40285..40674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 40680..42470 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV40 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 42506..43285 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV39 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 43705..44406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 44455..45204 product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204963.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 45285..46436 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530254.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 46531..47637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 47715..48758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 48913..49866 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV34 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene mdh CDS 50046..51242 product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV33 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene sucC CDS 51242..52117 product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 52346..55270 product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_426301.2 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene sucA CDS 55363..56661 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X64 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene sucB CDS 56731..58137 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK0 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene lpdA2 CDS complement(58310..59668) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390624.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 59814..60317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(60324..61271) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV24 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene xerC CDS complement(61250..61999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(62016..62669) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM7 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene tal CDS complement(62841..63134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 63227..64099 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088376.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(64096..65316) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085426.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(65313..65855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 65999..68224 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWL6 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene priA CDS 68435..68986 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV21 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene atpH CDS 68986..70521 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV20 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene atpA CDS 70557..71441 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV19 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene atpG CDS 71519..72943 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene atpD CDS 72976..73380 product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV17 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene atpC CDS complement(73463..74620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(74800..75303) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene rppH CDS complement(75315..76445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(76586..77920) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(77920..79272) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(79285..80844) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV10 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene gpmI CDS complement(80899..81357) product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV09 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene rlmH CDS complement(81438..81899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(81934..82560) product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV9 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene nadD CDS complement(82592..83881) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV06 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene proA CDS complement(83921..85075) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS0 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene proB CDS complement(85072..86187) product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV04 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene obg CDS complement(86318..86584) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBR6 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene rpmA CDS complement(86588..87001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 87298..87726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 tRNA 87832..87921 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 88311..89480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141024.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 89480..90109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(90387..92576) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895468.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(92626..93732) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 93842..95605 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 95740..96447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 96666..97733 product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142317.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 97753..98541 product maleate cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 98653..99144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(99196..100434) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(100629..101447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(101437..102192) product phosphate-import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ70 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene phnC CDS complement(102273..103136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 103313..103960 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338485.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(103957..104586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 104856..106109 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090688.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 106191..106889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(106893..107360) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 107548..108309 product FMN reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94424 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene nfrA2 CDS 108367..109251 product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JL7 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 109611..111623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 111717..112493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS 112587..113567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(113580..114296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 114543..115058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 114961..116154 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 note possible pseudo, frameshifted CDS 116164..117279 product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087591.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene lldA CDS 117428..118603 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388027.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 118698..119420 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 119483..119884 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IL8 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(119907..120713) product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065001.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 120942..122954 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388476.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(122970..124145) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089466.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 124180..125028 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390243.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 125137..126924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(126890..128632) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066587.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 128790..129515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 129508..130242 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 130244..132250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 132261..133325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(133344..134378) product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969496.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 134533..135087 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ24 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene greB CDS 135093..136082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 136079..136762 product putative glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33341 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS 136876..137256 product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene pcaC CDS 137260..138180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 note possible pseudo, internal stop codon CDS 138370..138849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(138819..139214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 139498..141342 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391220.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 141347..141670 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM9 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 141701..142288 product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene recR CDS 142291..143202 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 143204..144814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(144811..145263) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639995.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(145271..145882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113265.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(145940..146710) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCK2 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene gloB CDS 146837..147619 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391017.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 147616..147900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 148115..148906 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 148969..150093 product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MG0 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene hisC1 CDS 150090..151067 product cyclohexadienyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391011.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(151044..152138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 152165..152791 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP91 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(152809..153702) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530746.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 153804..154508 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535109.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(154509..155357) product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(155386..155703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(155880..156590) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391306.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 156868..157071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 157111..157680 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 157806..158555 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390825.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 158555..159490 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 159582..160457 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 160593..160820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(160908..161942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(161995..162561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 162578..163993 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE3 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene argH CDS 164016..164162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 164205..165452 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8H9 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene lysA CDS 165619..168288 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970102.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(168321..169232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(169257..170144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(170291..171127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 171020..171265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 171382..172125 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391002.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 172130..173035 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 173032..173727 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973181.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 173858..176188 product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 sequence11 source 1..167520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..470 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene rpsJ CDS 489..1265 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW0 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene rplC CDS 1271..1888 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene rplD CDS 1885..2214 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW2 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene rplW CDS 2218..3042 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW3 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene rplB CDS 3056..3331 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW4 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene rpsS CDS 3348..3728 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW5 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene rplV CDS 3728..4408 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW6 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene rpsC CDS 4437..4850 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 transl_table 11 codon_start 1 locus_tag LOCUS_36610 gene rplP CDS 4868..5068 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R4 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene rpmC CDS 5095..5343 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW9 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene rpsQ CDS 5362..5730 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX0 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene rplN CDS 5730..6053 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene rplX CDS 6077..6616 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12877 transl_table 11 codon_start 1 locus_tag LOCUS_36660 gene rplE CDS 6635..6940 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF7 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene rpsN CDS 6956..7354 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX4 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene rpsH CDS 7369..7902 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U874 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene rplF CDS 7914..8276 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX6 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene rplR CDS 8290..8844 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX7 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene rpsE CDS 8860..9066 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX8 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene rpmD tRNA 9446..9534 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 9643..10986 product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene secY CDS 10983..11558 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene adk CDS 11742..12110 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q925X7 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene rpsM CDS 12147..12542 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene rpsK CDS 12661..13677 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene rpoA CDS 13747..14187 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA8 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene rplQ CDS complement(14276..15397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 15518..16993 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 16997..18307 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 18297..19178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 19193..19573 product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene crcB CDS 19570..20568 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 20569..21261 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 21276..24677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 24682..25377 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS 25429..26961 product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 26989..28038 product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085022.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene aph CDS complement(28035..28724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 note possible pseudo, internal stop codon CDS complement(28760..29509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531154.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(29581..30204) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE18 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(30236..31279) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(31414..32004) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 32162..32899 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391398.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 32899..35424 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(35454..37085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 37344..38189 product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706210.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(38245..38676) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 38822..39268 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709023.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 39357..39641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(39678..40145) product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337627.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(40142..40846) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104623.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(40850..43735) product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH2 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene gcvP CDS complement(43806..44177) product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I87 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene gcvH CDS complement(44203..45300) product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I140 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene gcvT2 CDS complement(45615..46157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 46245..47225 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8J6 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene ispH CDS 47230..48189 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU4 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene thrB CDS 48189..48620 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHA7 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene rnhA CDS 48617..49843 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064352.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(49884..50663) product iron-enterobactin transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372869.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(50660..51637) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967922.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(51634..52617) product siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259661.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(52614..53750) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259666.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 54026..56443 product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(56497..59214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 59498..60301 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(60298..60957) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 61067..61921 product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 62026..63072 product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 63078..63584 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338085.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(63716..64540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 64840..66435 product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(66460..67605) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886817.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(67678..68052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 68191..69267 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551047.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 69362..69976 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene gst CDS 70249..71028 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(71039..71809) product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969126.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(71830..72762) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975807.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 72911..73675 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(73726..74328) product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene soxG CDS complement(74321..77332) product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524300.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene soxA CDS complement(77329..77685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(77697..78989) product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524302.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 gene soxB CDS complement(79141..79689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(79705..81582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 81916..82872 product non-heme chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974329.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene prxC CDS complement(82974..84362) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 84730..86313 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 86403..87389 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085660.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 87400..88350 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815883.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 88350..89330 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 89323..90429 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(90539..92779) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(92975..93958) product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974566.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(94033..94611) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156585.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(94778..100849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(101255..101971) product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(102246..104138) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(104257..105483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(105553..105885) product branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(105875..106513) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 106416..106658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(106655..107656) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708387.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 107874..108551 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969610.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(108621..109187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 109376..109558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 109593..110423 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 110458..111252 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(111343..111507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 111663..112265 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PF2 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene ubiX CDS 112727..114034 product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene cysD CDS 114039..114839 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 114836..115276 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(115302..115802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(115848..116378) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 116803..117555 product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 117605..118183 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF7 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene ruvC CDS 118180..118803 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIH6 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene ruvA CDS 118800..119879 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF5 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene ruvB CDS 119872..120336 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973275.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 120399..121130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 121134..121586 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 121591..122568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 122679..123974 product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene tolB CDS 124141..124665 product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 124841..125929 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(125926..126081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 126080..127321 product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J044 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene tilS CDS 127368..129302 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE6 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene ftsH CDS 129307..130440 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS 130485..131849 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE4 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene glmM CDS 131869..132681 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 132856..133566 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530139.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(133569..134735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 134933..135646 product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719277.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene mtbC CDS 135697..136281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708368.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 136310..136618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531170.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(136623..137543) product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEN7 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene ugpE CDS complement(137548..138435) product sn-glycerol-3-phosphate transport system permease protein UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WD8 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene ugpA CDS complement(138508..139896) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385389.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene ugpB CDS complement(140021..141151) product sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBB7 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene ugpC2 CDS complement(141302..141910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 142074..142679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(142698..143180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(143258..145033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 145259..146095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(146131..147405) product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099398.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(147564..147767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(147790..148983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS complement(149166..149954) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268243.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 150015..150752 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184412.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 150775..151752 product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811703.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 151752..152282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 152282..153541 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(153709..154725) product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UMZ0 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene acdS CDS 154879..155349 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083072.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 155478..155870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 155977..156816 product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(156941..158074) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_772237.2 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS 158409..158750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 159418..159753 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(159825..161882) product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337730.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(161930..162835) product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531167.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(162873..163796) product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971608.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene metF CDS 164054..165256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66504 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(165310..166626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 sequence12 source 1..149043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 754..3396 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE9 transl_table 11 codon_start 1 locus_tag LOCUS_38200 gene valS CDS complement(3408..3854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(3870..4775) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389548.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 4944..5123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 5156..6658 product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IN3 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(6776..7546) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337637.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene xthA CDS complement(7662..8093) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 8222..9430 product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG5 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 9431..11188 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG6 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene argS CDS 11185..12114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 12129..13157 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389530.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 13157..13864 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 13873..14667 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 14664..15323 product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 15462..16526 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969280.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 16651..16890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 16980..17450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 17454..18275 product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH4 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene tatC CDS 18378..19667 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBU2 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene serS CDS 19682..20485 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH6 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene surE CDS 20485..21129 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH7 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene pcm CDS 21259..22323 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389520.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(22351..23208) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 23498..23848 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389518.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 23933..25504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38440 note possible pseudo, internal stop codon CDS 25517..26488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 note possible pseudo, internal stop codon CDS 26493..26870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 26863..27801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 27810..28658 product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087500.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(28660..30045) product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene trmFO CDS 30035..30214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 30230..31450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(31463..32344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS complement(32344..33252) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 33412..33678 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(33686..36550) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTJ3 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene uvrA CDS 36734..37261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 37440..38168 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815479.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 38155..39306 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040674.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 39345..40247 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815477.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 40367..41194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388089.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 41354..44116 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene gyrA CDS 44133..44639 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK2 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene coaD tRNA 44713..44788 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 45226..45561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 45656..45889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(45895..47076) product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene cefD CDS 47152..48024 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541157.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 48099..48818 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(48815..50896) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 51019..51279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087373.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 51362..54769 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTL9 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene mfd CDS 54973..57096 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348031.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 57218..58174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS 58238..59242 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931190.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 59246..60433 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706311.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 60631..61407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(61404..62057) product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 62180..63814 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(63839..64924) product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089439.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(65021..66859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(66844..67854) product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969443.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 67962..69551 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene prfC CDS complement(69607..70908) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888258.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 71302..71829 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139949.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 gene mucS CDS complement(71903..72592) product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848573.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(72607..73059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene ytoQ CDS 73421..74377 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 74520..75584 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 75581..77554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 77765..78826 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390594.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 78870..80402 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390595.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 80392..81441 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390596.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 81446..82396 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706298.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 82413..83687 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887791.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene codA1 CDS complement(83684..84823) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 85508..85867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 86820..88415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 tRNA complement(88429..88518) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 89617..90249 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972794.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 90291..91196 product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266702.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(91216..92499) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(92513..93094) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088798.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(93210..94196) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088799.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(94373..95299) product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UJN0 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS complement(95343..96128) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085602.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 96473..97450 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735487.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 97545..98522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 98674..99864 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 99857..100522 product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ9 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene tmk CDS 100522..101637 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 101737..103269 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene metG CDS 103270..104088 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 104097..104873 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(104922..105935) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963698.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 106111..106758 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920499.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(106823..107452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(107779..108609) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537440.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene fpr CDS complement(108688..109269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969298.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS complement(109262..110107) product thiamine biosynthesis protein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528452.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(110104..111537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528451.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(111534..114269) product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(114266..115108) product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 115192..115623 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004356487.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(115638..116333) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(116327..117034) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338847.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS complement(117022..117966) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(117963..118889) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338849.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS complement(118946..120223) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528442.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS complement(120353..121729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528441.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 121757..122530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 122597..124657 product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 124654..126300 product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS complement(126719..127183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(127329..127889) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199294.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 128120..128758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(128873..130429) product putative glucans biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI02 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene opgD CDS 130613..130846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(130915..132756) product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P532 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene opgH CDS complement(132877..134403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(134390..135199) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene phoP CDS complement(136018..139023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(139729..140907) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 141057..142730 product toxin ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 142727..144982 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073977.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 gene aggC CDS 144979..146322 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 sequence13 source 1..138213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4913..5254 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6E2 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 5265..5735 product serine-protein kinase RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81H23 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene rsbW CDS complement(5839..6543) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS complement(6576..7487) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974932.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene gstR CDS 7623..8168 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P219 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene mip CDS 8192..8842 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 8847..9353 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368844.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(9358..11124) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480939.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 tRNA complement(11165..11239) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(11286..12263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 tRNA complement(12433..12508) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(12557..12632) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 12815..13873 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(13928..15703) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(15707..16714) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEJ8 transl_table 11 codon_start 1 locus_tag LOCUS_39550 gene gplX CDS complement(16784..18073) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(18205..19578) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390165.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 19784..21583 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(21608..22141) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 22346..23551 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS 23860..24900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 25045..25902 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(25930..26877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 26992..27870 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(27907..28851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(28938..29435) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H554 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene rpsI CDS complement(29439..29909) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1Z4 transl_table 11 codon_start 1 locus_tag LOCUS_39670 gene rplM CDS complement(30088..30999) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(30996..31424) product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 31530..32624 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083007.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS complement(32654..33034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS complement(33147..33515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 33623..34486 product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(34499..35218) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975504.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 35374..35712 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene glnB CDS 35852..37570 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970278.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(37596..38402) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532964.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 38560..39495 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067623.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS complement(39514..40875) product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090501.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 40903..41889 product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531656.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 41951..43345 product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974998.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 43458..44255 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 44258..46084 product O-acetylhomoserine/O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389828.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 46156..46677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS 46972..47490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(47487..48026) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968511.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(48056..49069) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(49075..51201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089116.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(51198..51920) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927020.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS 52124..53185 product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 53309..54190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 54271..54837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(54925..56340) product phosphonate monoester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083258.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(56522..57346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(57370..58083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(58140..60464) product dimethylsulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268538.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 60647..61192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 61196..61795 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267478.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 61812..63038 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(63050..63370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(63579..64409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528056.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(64438..65502) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085526.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS complement(65556..66320) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228947.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 66632..67582 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(67619..70873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(70975..72024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 72511..72915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 tRNA 73029..73104 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(73210..75090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040060.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(75285..76496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(76811..77416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 77673..78149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(78267..79034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(79062..81056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS complement(81059..81424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 81857..84625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039744.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS 84622..85575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 85572..85790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 85916..86200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 86406..88376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS 88369..89559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039746.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(89608..91029) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 gene int CDS complement(91728..93710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(93850..95796) product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AA58 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene mnmC CDS complement(95853..96248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 96369..96614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS 96683..97435 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 97467..97841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 97838..98689 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728413.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 98690..99151 product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QM1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 99225..99410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 99507..100055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707298.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 100061..100798 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 100779..102038 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS 102049..102570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105266.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 102688..103071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 103098..104495 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 104590..105057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS complement(105067..105663) product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088377.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(105697..107154) product N-acyl-D-amino-acid deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266382.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 107356..108531 product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene dauA CDS 108708..109502 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene cysD CDS 109541..111430 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 gene nodQ CDS 111515..112156 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709767.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 112251..113420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 113451..113987 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339035.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 113980..114747 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140319.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS complement(114772..115029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS complement(115026..115652) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926969.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(115757..116362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 116588..116758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 116897..117718 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082948.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS 117715..118164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 118383..118820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(118846..119025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS complement(119149..119358) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389667.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS 119803..121263 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS 121330..122676 product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 122735..123502 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 123533..124774 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 124779..126140 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 126221..126733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(126704..127150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(127147..127896) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(127922..128527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 128863..129375 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene np20 CDS 129377..130135 product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPH6 transl_table 11 codon_start 1 locus_tag LOCUS_40660 gene znuC CDS 130170..131267 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS complement(131286..132182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(132231..133490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 133632..134246 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS complement(134256..135119) product aminoglycoside O-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222982.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(135137..135646) product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(135732..136259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS complement(136262..136696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(136807..137754) product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086114.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 sequence14 source 1..70846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 5948..6532 product phosphoheptose isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNE6 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene gmhA1 CDS 6532..8007 product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY67 transl_table 11 codon_start 1 locus_tag LOCUS_40770 gene hldE CDS 8141..8683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(8658..10850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 10987..11739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 11753..12784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088230.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 12810..13016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706319.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 13022..13309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(13331..15361) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088232.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 15482..16027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 16020..16673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 16843..17445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 17532..17726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 17881..20709 product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261956.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene fdnG CDS 20722..21318 product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088224.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 21505..21708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 21729..22814 product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088223.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 22831..24216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088233.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 24188..24358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 24478..25389 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970364.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(25408..26253) product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS complement(26277..27056) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS complement(27049..27756) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 27971..29623 product benzoyl-CoA-dihydrodiol lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083900.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 29679..31127 product benzoyl-CoA oxygenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(31707..32798) product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS complement(32825..33343) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(33340..33693) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888244.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 33802..34812 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 transl_table 11 codon_start 1 locus_tag LOCUS_41040 gene gapA CDS 34809..36080 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070878.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(36092..37138) product chemotaxis sensory transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387843.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 37318..38247 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693582.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS 38311..38631 product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971131.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS 38762..39952 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257345.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 39968..40720 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 40814..41689 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 41625..41993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 42075..43886 product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKB7 transl_table 11 codon_start 1 locus_tag LOCUS_41130 gene aceK CDS complement(43919..44428) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 tRNA complement(44580..44656) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 45159..46208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 46370..46792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS 46892..47398 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D63 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene gpt CDS complement(47411..48139) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS complement(48288..49667) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090818.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(49704..51161) product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 gene merA1 CDS complement(51410..51625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 51624..52001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 51998..52282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 52279..54030 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene yidC CDS 54038..54673 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP11 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene engB CDS 54722..55630 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene argB CDS 55894..56229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS complement(56243..57535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS complement(57525..59234) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 59350..60054 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(60058..61260) product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971806.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(61444..62361) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096828.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 62438..63193 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113599.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 63286..64146 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP4 transl_table 11 codon_start 1 locus_tag LOCUS_41340 gene dapD CDS 64148..65311 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKC4 transl_table 11 codon_start 1 locus_tag LOCUS_41350 gene dapE CDS 65317..65895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(65902..66642) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNZ9 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene truA CDS complement(66646..67611) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP00 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene fmt CDS complement(67644..68171) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5I4 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene def CDS 68337..69521 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 69521..70111 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS complement(70121..70546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808978.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 sequence15 source 1..70516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3464..3679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS 3679..4554 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226595.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS 4551..5255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 5382..6599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 6616..8640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 8786..9280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 9378..9572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 9597..11315 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 11308..12534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS complement(12550..13311) product ferrichrome ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976078.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(13305..14354) product iron-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976079.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(14351..15511) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887218.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(15511..17883) product TonB dependent/Ligand-Gated channel TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706422.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(18148..19125) product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390126.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(19241..19750) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(19877..20764) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085923.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(20810..21022) product NAD-dependent formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085918.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS complement(21019..21843) product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene fdhD CDS complement(21845..24697) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974090.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene fdhF CDS complement(24709..26259) product NAD-dependent formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040336.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene fdsB CDS complement(26256..26723) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726707.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(26861..27301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(27304..27636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(27735..28637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(28860..29906) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119872.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(30017..30226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315122.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(30337..30696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(30724..32475) product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086440.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 32626..33474 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101874.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 33471..34277 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086437.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS 34319..35029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973993.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS 35026..35925 product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814134.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS 35922..36317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(36327..36941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086115.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS 37352..39358 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085294.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(39481..41028) product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 gene dagA CDS complement(41045..41476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS complement(41907..43295) product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6I5 transl_table 11 codon_start 1 locus_tag LOCUS_41800 gene fumC CDS complement(43462..44148) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089549.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 44308..46017 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 gene ilvB CDS 46080..47081 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 47203..47697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 47699..49219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813871.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(49255..50520) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS complement(50654..51343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS 51691..52890 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085351.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(52936..53925) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(54046..54927) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 54808..55020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(55075..56673) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085899.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS 56971..59262 product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(59327..60637) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 gene ordL1 CDS complement(60637..61986) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066639.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(62118..62720) product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084064.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(62741..63229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084063.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(63399..65570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 66030..67844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS complement(67954..68775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(68762..70042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 sequence16 source 1..48374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(365..1153) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 gene spuA CDS 1250..2020 product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947815.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS complement(2030..2689) product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN03 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS complement(2839..5289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS complement(5322..6512) product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385507.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS complement(6732..8060) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 transl_table 11 codon_start 1 locus_tag LOCUS_42070 gene amt-2 CDS complement(8073..8411) product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388885.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 8766..9992 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(10031..10786) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971638.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(10882..11256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(11253..11525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS complement(11512..12162) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336781.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(12201..13106) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(13199..13744) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 tRNA 13956..14030 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(14074..14985) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 14885..15082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS 15170..15406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS complement(15412..18705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS 19053..23912 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 23932..25233 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS complement(25199..26287) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(26433..27086) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene rnhB CDS 27361..27960 product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708540.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(27964..29109) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971096.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(29157..29360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(29390..30451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS 30604..31356 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS 31359..31988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124719.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(31942..32493) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(32480..34372) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS complement(34583..35416) product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS 35554..37188 product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS 37244..38980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS 38973..39875 product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S79 transl_table 11 codon_start 1 locus_tag LOCUS_42350 gene ispE CDS complement(39872..42214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(42346..42717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS 42808..43233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(43401..43805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42390 tRNA 43930..44004 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(44034..44813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS complement(44899..45756) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(45847..46539) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS complement(46605..46910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(46924..47805) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 sequence17 source 1..40896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(263..1228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS 1824..2297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS 2431..3567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 4256..5512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS 5923..6102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(6075..6302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS complement(6350..7501) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085760.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(7505..8038) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS complement(8291..11890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(12209..13150) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707974.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS 13236..14144 product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528293.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS 14141..15583 product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3B2 transl_table 11 codon_start 1 locus_tag LOCUS_42560 gene lcdH CDS 15583..16743 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976305.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS 16750..18798 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976306.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS 18791..19576 product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969806.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS 19707..20459 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924398.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(20463..21179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(21302..22942) product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087216.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS complement(22985..23809) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(23809..24621) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS complement(24618..25475) product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene phnC CDS complement(25544..26503) product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(26799..27278) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS 27660..28121 product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263923.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene ectA CDS 28188..29462 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ7 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene ectB CDS 29508..29906 product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DYF2 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene ectC CDS 29950..31404 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS 31523..32566 product glycerol-3-phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331253.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS complement(32639..33928) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704225.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(33940..34782) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086912.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(34772..35566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 35925..36731 product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207993.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 gene yfdC CDS complement(36747..37457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(37474..38175) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089549.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS 38377..39246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816618.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 39276..40415 product cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 sequence18 source 1..40218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(482..1969) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS complement(1966..2370) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(2374..2811) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS complement(2808..3398) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(3395..3736) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS complement(3736..4068) product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS complement(4065..4553) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 4766..5674 product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRX5 transl_table 11 codon_start 1 locus_tag LOCUS_42880 gene prpB CDS 5844..6656 product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040241.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS complement(6709..7650) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(7651..8421) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 8663..9856 product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140150.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 gene acuC1 CDS 9882..10382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42930 tRNA 10495..10571 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 10708..11259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918014.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 11371..11685 product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 tRNA 11701..11777 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 12143..13114 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389866.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 note possible pseudo, internal stop codon CDS complement(13318..14907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 15315..15833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 15823..17913 product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888183.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 18000..18245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(18234..19247) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708246.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 19324..21222 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707482.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS 21241..22833 product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113365.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(22865..24049) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 24429..25472 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 gene bztA CDS 25666..26757 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS 26761..28116 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336959.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene bztC CDS 28167..28958 product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722560.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 gene bztD CDS complement(29096..30172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS complement(30184..31038) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS complement(31062..32063) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 gene cysK CDS complement(32170..32739) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061898.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS 32903..33421 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS 33418..35010 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887542.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS complement(34999..36099) product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525804.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 tRNA complement(36225..36299) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(36500..36573) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(36660..37736) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339267.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS 37874..38533 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS 38574..39971 product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 sequence19 source 1..35530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(90..1073) product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384302.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS complement(1076..2563) product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090039.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 3008..5185 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121318.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS 5182..6561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS 6574..7839 product oxidoreductase FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS 7884..8927 product cytochrome c554 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119032.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS 8939..10636 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123986.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS 10621..11454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123985.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS 11473..11733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS 11739..13940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS complement(13980..14801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384111.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(14801..15484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(15481..17256) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384110.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS complement(17261..19561) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537673.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene phuR CDS 19771..21705 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971835.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS complement(21716..23032) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 gene ectB CDS complement(23025..24155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS complement(24152..25273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(25298..26056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS complement(26082..28679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43380 misc_feature complement(28690..>35530) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224968.1:non-ribosomal peptide synthetase note possible pseudo, frameshifted locus_tag LOCUS_43390 sequence20 source 1..28695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2568..3503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(3540..6506) product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138064.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(6537..6989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS complement(6986..7594) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89D83 transl_table 11 codon_start 1 locus_tag LOCUS_43430 gene chrC CDS complement(7604..8971) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(8968..9906) product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196334.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS 10077..10643 product DNA-invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165548.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS complement(10650..11495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS complement(11958..12899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(13520..14182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 14722..17193 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS 17253..17678 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720046.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS 17704..18012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 18009..18488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 18490..18855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 19589..19804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS 20191..20856 product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS 20853..21569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS 21566..22903 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(22927..23391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS complement(23388..24629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS complement(24717..25418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS complement(25422..27332) product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 gene copA CDS complement(27373..27921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895638.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 sequence21 source 1..24721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 639..1976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(1980..2489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 2858..3715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886998.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS 3705..4634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS 4631..5542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(5612..8590) product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544913.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS 9566..9799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(9815..11431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(11589..11717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(11707..12339) product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538281.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS 12501..13139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(13144..14136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS 14459..15193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(15204..15503) product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(15503..15736) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887017.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 15893..17314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS 17523..18599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS 18621..19517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS 19766..19900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 19970..20299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS 20303..21910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS 21907..22206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS 22229..22591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS 22719..23060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 23072..24625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43890 tRNA complement(24609..24683) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 sequence22 source 1..21455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3021..4880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(4900..6771) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887989.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS complement(6774..12668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43920 misc_feature complement(12665..>21455) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226861.1:non-ribosomal peptide synthetase locus_tag LOCUS_43930 sequence23 source 1..15825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 190..265 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 333..530 product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU7 transl_table 11 codon_start 1 locus_tag LOCUS_43940 gene secE CDS 535..1065 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU8 transl_table 11 codon_start 1 locus_tag LOCUS_43950 gene nusG CDS 1147..1575 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU9 transl_table 11 codon_start 1 locus_tag LOCUS_43960 gene rplK CDS 1580..2278 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV0 transl_table 11 codon_start 1 locus_tag LOCUS_43970 gene rplA CDS 2567..3079 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene rplJ CDS 3129..3509 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV2 transl_table 11 codon_start 1 locus_tag LOCUS_43990 gene rplL CDS 3740..7927 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV3 transl_table 11 codon_start 1 locus_tag LOCUS_44000 gene rpoB CDS 8060..12238 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV4 transl_table 11 codon_start 1 locus_tag LOCUS_44010 gene rpoC CDS 12698..13069 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV5 transl_table 11 codon_start 1 locus_tag LOCUS_44020 gene rpsL CDS 13081..13551 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5E1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 gene rpsG CDS 13575..15650 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV7 transl_table 11 codon_start 1 locus_tag LOCUS_44040 gene fusA sequence24 source 1..15000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS 533..955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS 952..2220 product protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705000.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS complement(2779..4599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS complement(4599..6965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(6953..7915) product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B90 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS 8426..8614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS 8918..9094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS complement(9356..9580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 10115..11182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS complement(12169..12534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS complement(12681..12932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS complement(13344..14054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44170 sequence25 source 1..14212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1269..2924) product type III restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS complement(2921..3571) product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932831.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS complement(3656..3871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS complement(3858..4121) product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 4408..5043 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887706.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS 5262..5657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(5913..7337) product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0E4 transl_table 11 codon_start 1 locus_tag LOCUS_44240 gene merA CDS complement(7494..7706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS 8140..8532 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS complement(8728..8949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(9001..9789) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926031.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(9812..11413) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089435.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS complement(11410..12273) product alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 gene tfdA CDS complement(12383..13288) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 misc_feature complement(13610..>14212) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000457555.1:DNA polymerase V subunit UmuC locus_tag LOCUS_44320 sequence26 source 1..14011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2384..2995 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108953.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 misc_feature complement(3052..>14011) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331491.1:hemolysin-type calcium-binding protein locus_tag LOCUS_44340 sequence27 source 1..12151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(360..689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS complement(682..1299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039104.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(1366..3498) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889332.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS 3565..3981 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(4232..4573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 4827..5390 product DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113775.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS 6004..6879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS 7121..7774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS 7853..8512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS 8509..8829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS 8905..9261 product addiction module toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225795.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS 9242..9574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS 9590..10000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 10012..10770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS 10943..11404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS complement(11334..11621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 11737..12027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44510 sequence28 source 1..10922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2521..3459) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(3520..4887) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 gene gsh1 CDS complement(4942..5712) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNA1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS 5824..6735 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWW9 transl_table 11 codon_start 1 locus_tag LOCUS_44550 gene ubiA CDS 6732..7454 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528903.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS complement(7435..8169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44570 sequence29 source 1..9886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 530..2149 product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 gene hsdM-1 CDS 2223..3500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039058.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS 3482..4393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 4581..6407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS 6404..9550 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(9485..9685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44630 tRNA complement(9770..9846) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 sequence30 source 1..7480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(438..875) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089292.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS 1002..1907 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS 2028..2948 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975698.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 gene phoD CDS 3158..4015 product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS7 transl_table 11 codon_start 1 locus_tag LOCUS_44670 gene phcN CDS 4072..4989 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061597.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 5100..5939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 5951..7291 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529512.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 tRNA 7404..7480 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 sequence31 source 1..7101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1096 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074377.1:integrase locus_tag LOCUS_44710 CDS 1089..1391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS 1404..1775 product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS 1777..2145 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS 2138..3049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS 3046..3291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS 3288..5051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS 5060..5875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44780 sequence32 source 1..6218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..888 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082875.1:conjugal transfer protein TraG locus_tag LOCUS_44790 CDS 891..1922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS 1929..2315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS 2293..5199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44820 sequence33 source 1..5678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..1602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS complement(1599..1820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS 2122..3363 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWG2 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS 3356..3811 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS 3808..5172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44870 sequence34 source 1..5186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..661 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893633.1:hydrogenase locus_tag LOCUS_44880 CDS 683..2275 product cytochrome-c3 hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 gene hybC CDS 2355..2822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS 2831..3151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS 3148..3405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS 3380..4861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44930 sequence35 source 1..4549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1125 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118365.1:cation:proton antiporter locus_tag LOCUS_44940 CDS 1136..1426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS 1410..3125 product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS 3260..3895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44970 sequence36 source 1..4193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(330..1901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS complement(1879..2265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(2272..3303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45000 misc_feature complement(3306..>4193) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082875.1:conjugal transfer protein TraG locus_tag LOCUS_45010 sequence37 source 1..4061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1902..2474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS 2487..3482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS 3526..3873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45040 sequence38 source 1..3489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(324..1367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(1367..2050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS complement(2237..3376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45070 sequence39 source 1..3395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1313..2158) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388612.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(2178..3365) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694771.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 sequence40 source 1..3395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1313..2158) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388612.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS complement(2178..3365) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225636.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 sequence41 source 1..3359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS complement(768..1808) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391189.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS complement(1775..2317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS 2318..2713 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314894.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS complement(3094..3357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45160 sequence42 source 1..3308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(687..1997) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926703.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(2003..2533) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817345.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 sequence43 source 1..3088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence44 source 1..2896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(2249..>2896) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388326.1:methyl-accepting chemotaxis protein locus_tag LOCUS_45190 sequence45 source 1..2802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS complement(1003..1932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45210 misc_feature complement(2008..>2802) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RN64:GTP cyclohydrolase-2 locus_tag LOCUS_45220 sequence46 source 1..2802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS complement(1003..1932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45240 misc_feature complement(2008..>2802) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RN64:GTP cyclohydrolase-2 locus_tag LOCUS_45250 sequence47 source 1..2728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(741..1496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS complement(1489..2205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45270 sequence48 source 1..2719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..1365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389867.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS 1715..2230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391379.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 sequence49 source 1..2663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 953..1258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45300 tRNA 1405..1498 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 sequence50 source 1..2663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 953..1258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45310 sequence51 source 1..2642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence52 source 1..2450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence53 source 1..2438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence54 source 1..2366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..1257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45320 sequence55 source 1..2366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..1314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45330 sequence56 source 1..2158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence57 source 1..2062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(406..1515) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891513.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 gene tnp sequence58 source 1..2024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 96..1043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45350 sequence59 source 1..1802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(329..1510) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 sequence60 source 1..1793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence61 source 1..1712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence62 source 1..1512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..1432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45370 sequence63 source 1..1501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence64 source 1..1416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 143..219 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 repeat_region 327..>1416 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgcggctggacctcaaatccctatcggctaagat sequence65 source 1..1371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 96..1043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45380 sequence66 source 1..1354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence67 source 1..1337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence68 source 1..1337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence69 source 1..1288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence70 source 1..1216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..796) product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368396.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS complement(793..1152) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368395.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 sequence71 source 1..1208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(579..812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45410 sequence72 source 1..1202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(573..806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45420 sequence73 source 1..1186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence74 source 1..1146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(388..>1146) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389868.1:sulfotransferase locus_tag LOCUS_45430 sequence75 source 1..1101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(493..>1101) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709513.1:D-amino-acid dehydrogenase locus_tag LOCUS_45440 sequence76 source 1..1099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(491..>1099) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709513.1:D-amino-acid dehydrogenase locus_tag LOCUS_45450 sequence77 source 1..1068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@